Nucleic acid sample preparation
09822394 · 2017-11-21
Assignee
Inventors
Cpc classification
C12Q2525/121
CHEMISTRY; METALLURGY
C12Q2565/1015
CHEMISTRY; METALLURGY
C12Q2525/186
CHEMISTRY; METALLURGY
C12Q2565/1015
CHEMISTRY; METALLURGY
C12Q2525/186
CHEMISTRY; METALLURGY
C12Q2525/121
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q1/6874
CHEMISTRY; METALLURGY
International classification
Abstract
This invention relates to the preparation of nucleic acid samples for analysis. The invention may be particularly useful for single stranded samples. Embodiments of the invention involve the attachment of double stranded or hairpin oligonucleotides using template independent polymerase enzymes in the preparation of nucleic acid sequencing libraries.
Claims
1. A method for preparing an amplified mixture of nucleic acid molecules wherein each amplified molecule in the mixture has a known region at each end, the method comprising: a) providing a sample containing a population of nucleic acid molecules, b) treating the population to produce first single stranded oligonucleotides of different sequence from each of the nucleic acid molecules in the population, c) joining a hairpin oligonucleotide sequence to each of the first single stranded oligonucleotides of different sequence using template independent nucleic acid polymerase, wherein the hairpin oligonucleotide sequence comprises a single stranded region comprising a 5′-triphosphate, a region of self-complementary double stranded sequence, a 3′-overhang which hybridises to the first single stranded oligonucleotide, and a blocking moiety at the 3′ end, d) removing the 3′ blocking moiety, e) producing a full length copy of each of the first single stranded oligonucleotides by extending the deblocked 3′ hydroxyl of the hairpin oligonucleotide sequence to create a blunt end, f) attaching a further oligonucleotide sequence to each full length copy of the first single stranded oligonucleotides, g) cleaving the hairpin oligonucleotide sequence, thereby producing a mixture of double stranded nucleic acid molecules comprising the first single stranded oligonucleotides of different sequence and full length copies thereof, wherein each full length copy thereof has a known region at each end, and h) amplifying the double stranded nucleic acid molecules of step g), thereby generating an amplified mixture of nucleic acid molecules wherein each amplified molecule in the mixture has a known region at each end.
2. The method of claim 1 wherein the template independent nucleic acid polymerase enzyme is terminal transferase or polyadenylate polymerase (PAP).
3. The method of claim 1 wherein the hairpin oligonucleotide sequence comprises a triphosphate moiety attached to the 5′-end via a linker.
4. The method of claim 1 wherein the first single stranded oligonucleotide is copied using a nucleic acid polymerase or reverse transcriptase.
5. The method according to claim 1 wherein first single stranded oligonucleotides are DNA strands or RNA strands.
6. The method according to claim 3 wherein the linker comprises a ribose or deoxyribose moiety and the oligonucleotide is attached via the nucleotide base.
7. The method according to claim 1 wherein the first single stranded oligonucleotides are obtained by chemical or enzymatic cleavage of the sample.
8. The method according to claim 7 wherein the first single stranded oligonucleotides are obtained using bisulfite treatment.
9. The method according to claim 7 wherein the first single stranded oligonucleotides are a pool of fragments derived from treating a nucleic acid sample with an enzyme.
10. The method of claim 1 wherein the attaching is via ligation.
11. The method according to claim 1 wherein the hairpin oligonucleotide sequence is attached to a solid support.
12. The method according to claim 1 wherein the hairpin oligonucleotide sequence carries a moiety for attachment to a solid support, and the joined first single stranded oligonucleotides of different sequence and hairpin oligonucleotide sequence are immobilised.
13. The method of claim 1 wherein the blocking moiety at the 3′ end is a phosphate.
14. The method of claim 13 wherein the phosphate is removed using a suitable kinase to release an extendable 3′ hydroxyl.
Description
(1) Certain aspects and embodiments of the invention will now be illustrated by way of example and with reference to the figures described below.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15) Disclosed herein is a method comprising; a) providing a sample containing a population of nucleic acid molecules, b) treating the population to produce a sample of DNA strands containing a mixture of first single stranded oligonucleotides of different sequence, c) joining a second oligonucleotide sequence to the sample of DNA strands using template independent nucleic acid polymerase, and d) producing a copy of the first single stranded oligonucleotides.
(16) Disclosed herein is a method comprising; a) providing a sample containing a population of nucleic acid molecules, b) treating the population to produce a sample of DNA strands containing a mixture of first single stranded oligonucleotides of different sequence, c) joining a second oligonucleotide sequence having a 5′-triphosphate to the sample of DNA strands, and d) producing a copy of the first single stranded oligonucleotides.
(17) Disclosed herein is a method of preparing a nucleic acid sample for sequencing comprising; a) providing a sample containing a population of nucleic acid molecules, b) treating the population to produce a sample of DNA strands containing a mixture of first single stranded oligonucleotides of different sequence, c) joining an nucleotide triphosphate to the sample of DNA strands using a nucleic acid polymerase, wherein the nucleotide triphosphate is part of an oligonucleotide adapter which can hybridse at least in part with the sample of DNA strands; and d) producing a complementary copy of the first single stranded oligonucleotides using the extendable 3′-end of the oligonucleotide adapter,
(18) The method may contain additional steps or features. Additional features or steps may include:
(19) The second oligonucleotide, or oligonucleotide adapter may have a region of self-complementarity such that the second oligonucleotide may take the form of a hairpin. The hairpin, when in hybridised form, may have 3′-overhang suitable for polymerase extension. Hairpins are single oligonucleotide strands which can form intra-molecular double stranded regions. A hairpin is a nucleic acid sequence containing both a region of single stranded sequence (a loop region) and regions of self-complementary sequence such that an intra-molecular duplex can be formed under hybridising conditions (a stem region). The stem may also have a single stranded overhang. Thus the hairpin may have more than one single stranded region, the loop and the overhang. The hairpin may have 3′-overhang suitable for polymerase extension. The overhang may stretch across the triphosphate ‘linker’ region at the 5′ end, thus avoiding any issues relating the presence of the 5′-‘linker’ modification required for TDT incorporation. The self-complementary double stranded portion may be from 5-20 base pairs in length. The overhang may be from 1-10 bases in length. The overhang may contain one or more degenerate bases. The sequence may contain a mixture of bases A, C and T at each position (symbolised as H (not G)). H may be used in cases where the sample is bisulfite treated, and thus does not contain any C bases to which the G would be complementary. The overhang may consist of 1-10 H bases. The overhang may be 2-8 bases, which may be H. The overhang may have a 3′-phosphate. The overhang may have a 3′-OH.
(20) Disclosed herein is a method of joining a first single stranded oligonucleotide and an at least partly double stranded oligonucleotide adapter, wherein the first single stranded oligonucleotide is a member of a population of fragments obtained by cleaving a biological sample and the second oligonucleotide adapter has a double stranded portion and a 3′-overhang which hybridises to the first single stranded oligonucleotide, where the joining is carried out between a 3′ hydroxyl of the first single stranded oligonucleotide and a 5′-triphosphate of the adapter. The adapter may consist of one or two strands (i.e. a hairpin or a duplex). The attachment may be catalysed by a template dependent or template independent polymerase.
(21) Disclosed herein is a method of joining a first single stranded oligonucleotide and an oligonucleotide adapter using a template independent nucleic acid polymerase enzyme, wherein the first single stranded oligonucleotide is a member of a population of fragments obtained by cleaving a biological sample and the second oligonucleotide adapter takes the form of a hairpin having a single stranded region and a region of self-complementary double stranded sequence. The region of self-complementary double stranded sequence is capable of forming a duplex under hybridising conditions. Hybridising conditions may be for example 50° C. in a standard biological buffer as indicated in the experimental section below.
(22) The second oligonucleotide may have one or more regions for indexing such that different oligonucleotides can be attached to different samples, thereby allowing sample pooling.
(23) The second oligonucleotide, or the complement thereof where the second oligonucleotide is double stranded, is generally a chemically synthesised material having known length and modifications. The second oligonucleotide may have one or more modifications which allow site specific strand cleavage. The second oligonucleotide may have one or more uracil bases, thereby allowing site specific cleavage using enzyme treatment. The second oligonucleotide may be a hairpin and the method may include a further step of cleaving the hairpin. Cleavage of the hairpin means the two strands are no longer joined. If more than one cleavage site is present, one of the strands may be fragmented such that only one of the two strands remains intact and contains the desired properties of having two ends of known sequence. Where the adapter is double stranded, the method may include a step of denaturing the extended material.
(24) The second oligonucleotide or the strand hybridised thereto may have one or more bases which vary in sequence at the same location (i.e. the second oligonucleotide is a member of a population of second oligonucleotides). Such bases may be represented using the universal nucleotide codings known in the art. Such universal bases may be represented as N (all four bases A, G, C and T). In order to be used with bisulfite treated samples, which are depleted in C bases, the 3 bases may be represented by H (A, T and C (i.e. ‘not G’). The 3′ end of the second oligonucleotide, when in the form of a hairpin, may contain a region of bases shown as ‘H’.
(25) The second oligonucleotide or the strand hybridised thereto may have one or more modifications to allow attachment to a solid support. For example the second oligonucleotide may contain biotin. Cleavage of the hairpin may allow part of the material to be eluted from the solid support in single stranded form, whilst the remaining part stays attached to the solid support.
(26) A solid support is an insoluble, non-gelatinous body which presents a surface on which the polynucleotides can be immobilised. Examples of suitable supports include glass slides, microwells, membranes, or microbeads. The support may be in particulate or solid form, including for example a plate, a test tube, bead, a ball, filter, fabric, polymer or a membrane. Polynucleotides may, for example, be fixed to an inert polymer, a 96-well plate, other device, apparatus or material which is used in a nucleic acid sequencing or other investigative context. The immobilisation of polynucleotides to the surface of solid supports is well-known in the art. In some embodiments, the solid support itself may be immobilised. For example, microbeads may be immobilised on a second solid surface.
(27) The copies of the first single stranded oligonucleotides may be produced by extending the 3′-end of the attached hairpin or the 3′ end of the duplex where the adapter is double stranded. The extension of the hairpin produces an extended hairpin. The extended hairpin can also be described as a double stranded nucleic acid having one end joined. Upon denaturation, the extended hairpin becomes a single stranded molecule, but the length of the double stranded portion (for example at least 100 base pairs) means that the sample rapidly hybridises to form the extended hairpin.
(28) In cases where the adapter or hairpin contains a blocking moiety at the 3′ end, the blocking moiety can be removed. For example the 3′ end may be a phosphate. Methods of the invention may include a step of removing the phosphate moiety, for example treatment with a suitable kinase such as polynucleotide kinase (PNK).
(29) Attachment of the 5′-triphosphate oligonucleotide may give rise to a join which is not a natural phosphodiester linkage. Such joins may not be substrates for nucleic acid polymerases. In such cases, the use of 3′-overhangs, either as hairpins or double stranded adapters is advantageous as the linking region can be ‘bridged’ using an oligonucleotide primer sequence which is internal or part of the adapter. Hybridisation of a primer suitable for extension would also require such an internal spacer, and this lowers the affinity and specificity of the primer hybridisation, whereas no such issues arise where the adapter has an ‘internal’ primer which is already hybridised (or in the case of hairpins integral). The attachment of a single ‘hairpin’ which can be used as both the known end and the extendable primer when preparing a library (as shown in
(30) The extension can be carried out using a suitable enzyme and dNTP's. Where the sample is RNA, a reverse transcriptase can be used to produce the DNA/RNA duplex via the complementary DNA. Where the sample is DNA a nucleic acid polymerase can be used. The enzyme can be thermophilic or mesophilic. Suitable polymerases may include Klenow, Taq, Vent polymerase etc. If cleavage of the extended started is desired, the extension can be carried out using dUTP as a replacement for dTTP. A mixture of dUTP, dATP, dCTP and dGTP allows for complete extension as all four bases are present but allows selective strand cleavage at the uracil nucleotides. If it is desired to leave the strand intact, then dTTP case be used along with dATP, dCTP and dGTP. The nucleotide extension mix can include one or more modified dNTP's. For example the nucleotides may be used such that the resultant extended chains are not susceptible to exonuclease degradation. One or more of the dNTP's can be alpha-PS dNTPs, such that upon incorporation an exonuclease resistant thiophosphate (PS) linkage is formed.
(31) The extended hairpin has a double stranded end. To which can be attached a further (third) oligonucleotide. Either or both strands can be adapted by the attachment of the further oligonucleotide. More commonly a double stranded adapter would be used, thereby adapting and extending both strands. The resultant product could be described as an even further extended hairpin. Methods of using hairpins are shown in
(32) After addition of further adapters, the sample may be treated to remove any adapter-adapter dimers. The treatment may involve exposure to one or more nucleases. Where the extension sample contains PS linkages, the sample is protected from digestion, whilst the adapters containing no PS linkages are digested and removed.
(33) If the original sample resulted from a bisulfate treatment step (hence containing uracil bases), it is possible to treat the sample to fragment the strand at the uracil locations. Inclusion of one or more uracil bases in the oligonucleotide triphosphate means the adapter can also be cleaved. Exposure with an enzyme mix such as UDG/EndoVIII (USER) results in the formation of fragments having no uracil bases. Thus the hairpins can be treated to be made single stranded.
(34) Disclosed herein is a method of preparing a nucleic acid sample for sequencing comprising; a) providing a sample containing a population of nucleic acid molecules, b) treating the population to produce a sample of DNA strands containing a mixture of first single stranded oligonucleotides of different sequence, c) joining an nucleotide triphosphate to the sample of DNA strands using a nucleic acid polymerase, wherein the nucleotide triphosphate is part of an oligonucleotide adapter which can hybridse at least in part with the sample of DNA strands. d) producing a complementary copy of the first single stranded oligonucleotides using the extendable 3′-end of the oligonucleotide adapter, e) attaching a third oligonucleotide to the sample of DNA strands, and f) denaturing the products of step e; thereby producing a mixture of nucleic acid molecules where each molecule in the mixture is a copy of a molecule from the population of nucleic acid molecules and has a known region at each end.
(35) Disclosed herein is a method of preparing a nucleic acid sample for sequencing comprising; a) providing a sample containing a population of nucleic acid molecules, b) treating the population to produce a sample of DNA strands containing a mixture of first single stranded oligonucleotides of different sequence, c) joining a second oligonucleotide sequence to the sample of DNA strands using template independent nucleic acid polymerase, wherein the second oligonucleotide sequence is a hairpin having an extendable 3′-end. d) producing a complementary copy of the first single stranded oligonucleotides using the extendable 3′-end of the hairpin, e) attaching a third oligonucleotide to the sample of DNA strands, and f) cleaving the first single stranded oligonucleotides whilst leaving the copies thereof intact; thereby producing a mixture of nucleic acid molecules where each molecule in the mixture is a copy of a molecule from the population of nucleic acid molecules and has a known region at each end.
(36) Such methods are exemplified in
(37) The joined fragments can be used in any subsequent method of sequence determination. For example, the fragments can undergo parallel sequencing on a solid support. In such cases the attachment of universal adapters to each end may be beneficial in the amplification of the population of fragments. Suitable sequencing methods are well known in the art, and include Illumina sequencing, pyrosequencing (for example 454 sequencing) or Ion Torrent sequencing from Life Technologies™).
(38) Populations of nucleic acid molecules with a 3′ adapter oligonucleotide and optionally a 5′ second adapter oligonucleotide may be sequenced directly. For example, the sequences of the first and second adapter oligonucleotides may be specific for a sequencing platform. For example, they may be complementary to the flowcell or device on which sequencing is to be performed. This may allow the sequencing of the population of nucleic acid fragments without the need for further amplification and/or adaptation.
(39) The first and second adapter sequences are different. Preferably, the adapter sequences are not found within the human genome.
(40) The nucleic acid strands in the population may have the same first adapter sequence at their 3′ ends and the same second adapter sequence at their 5′ ends i.e. all of the fragments in the population may be flanked by the same pair of adapter sequences.
(41) Adapting a population of single stranded nucleic acid fragments for sequencing as described herein avoids the need to produce copies or complementary strands. This is advantageous as it avoids bias introduced by amplification and other processes.
(42) Suitable adapter oligonucleotides for the production of nucleic acid strands for sequencing may include a region that is complementary to the universal primers on the solid support (e.g. a flowcell or bead) and a region that is complementary to universal sequencing primers (i.e. which when annealed to the adapter oligonucleotide and extended allows the sequence of the nucleic acid molecule to be read). Suitable nucleotide sequences for these interactions are well known in the art and depend on the sequencing platform to be employed. Suitable sequencing platforms include Illumina TruSeq, LifeTech IonTorrent, Roche 454 and PacBio RS.
(43) For example, the sequences of the first and second adapter oligonucleotides may comprise a sequence that hybridises to complementary primers immobilised on the solid support (e.g. a 20-30 nucleotides); a sequence that hybridises to sequencing primer (e.g. a 30-40 nucleotides) and a unique index sequence (e.g. 6-10 nucleotides). Suitable first and second adapter oligonucleotides may be 56-80 nucleotides in length.
(44) Following adaptation and/or labelling as described herein, the nucleic acid molecules may be purified by any convenient technique. Following preparation, the population of nucleic acid molecules may be provided in a suitable form for further treatment as described herein. For example, the population of nucleic acid molecules may be in aqueous solution in the absence of buffers before treatment as described herein.
(45) In other embodiments, populations of nucleic acid molecules with a 3′ adapter oligonucleotide and optionally a 5′ adapter oligonucleotide, may be further adapted and/or amplified as required, for example for a specific application or sequencing platform.
(46) Preferably, the nucleic acid strands in the population may have the same first adapter sequence at their 3′ ends and the same second adapter sequence at their 5′ ends i.e. all of the fragments in the population may be flanked by the same pair of adapters, as described above. This allows the same pair of amplification primers to amplify all of the strands in the population and avoids the need for multiplex amplication reactions using complex sets of primer pairs, which are susceptible to mis-priming and the amplification of artefacts.
(47) Suitable first and second amplification primers may be 20-25 nucleotides in length and may be designed and synthesised using standard techniques. For example, a first amplification primer may hybridise to the first adapter sequence i.e. the first amplification primer may comprise a nucleotide sequence complementary to the first adapter oligonucleotide; and a second amplification primer may hybridises to the complement of second adapter sequence i.e. the second amplification primer may comprise the nucleotide sequence of the second adapter oligonucleotide. Alternatively, a first amplification primer may hybridise to the complement of first adapter sequence i.e. the first amplification primer may comprise a nucleotide sequence of the first adapter oligonucleotide; and a second amplification primer may hybridise to the second adapter sequence i.e. the second amplification primer may comprise the nucleotide sequence of the second adapter oligonucleotide.
(48) In some embodiments, the first and second amplification primers may incorporate additional sequences.
(49) Additional sequences may include index sequences to allow identification of the amplification products during multiplex sequencing, or further adapter sequences to allow sequencing of the strands using a specific sequencing platform.
EXPERIMENTS
(50) All reagents and buffers are commercially available unless otherwise stated.
Example 1
Preparation of Oligonucleotide Triphosphates
(51) Shown below is the ligation of the azido modified Cordycepin triphosphate (N3-ATP) to a 5′ alkyne modified DNA sequence (DBCO-Adapter) using copper-free click chemistry. The click reaction forms the 5′ triphosphate modified oligonucleotide (ATP-Triazole-Adapter). The 5′ triphosphate modified oligonucleotide (ATP-Triazole-Adapter) is then ligated to the 3′ end a second oligonucleotide (5′Fam-DC(U)) in a non templated fashion using TdT.
(52) ##STR00001##
(53) Reaction Conditions.
(54) To 2 μL of DBCO-Adapter DNA (500 mM in DMSO) was added 2 μL of N3-ATP (500 mM in water) and incubated at 37° C. for 1 hr. To the ligated ATP-Triazole-Adapter was added 2 μL, of TdT buffer (10×), 2 μL of CoCl2 (10×) and 5 μL of 5′-FAM-DC(U) DNA, the reaction was made unto 20 μL with water and incubated at 37° C. for 30 mins. The reaction mixture was loaded directly onto a 4% agarose gel using 4 μL of a 6× loading buffer, and run for 3 hr at 90V. The gel was imaged using a Typhoon imager using the standard setting for detecting the Fam flurophore (
(55) The experimental data/gel image (
Example 2
Addition of a Hairpin-triphosphate Adapter to ssDNA
(56) Materials:
(57) Oligonucleotides used in the experiment are listed in Table 1.
(58) TABLE-US-00001 TABLE 1 Oligonucleotide sequences Oligonucleotide Sequence 5′-3′ CEG_DC_U pCTCACCCACAACCACAAACATAUGATUAUGG UGAATUUGATUGAATUAGTTUUGUGUTTTAUG AAGTGUGAUAGUUTTAGTGATGTGATGGGTGG TATNN (SEQ ID NO: 2) CEG_OP_6H_IDX_1 DBCO-GATCGGAAGAGCUCAAGCAGAAGACGG CATACGAGATCGTGATGTGACTGGAGTTCAGA CGTGTGCTCTTCCGATCTHHHHHHp (SEQ ID NO: 3) CEG_OP_6H_IDX_4 DBCO-GATCGGAAGAGCUCAAGCAGAAGACGG CATACGAGATTGGTCAGTGACTGGAGTTCAGA CGTGTGCTCTTCCGATCTHHHHHHp (SEQ ID NO: 4) CEG_OP_6H_IDX_5 DBCO-GATCGGAAGAGCUCAAGCAGAAGACGG CATACGAGATCACTGTGTGACTGGAGTTCAGA CGTGTGCTCTTCCGATCTHHHHHHp (SEQ ID NO: 5) CEG_OP_6H_IDX 6 DBCO-GATCGGAAGAGCUCAAGCAGAAGACGG CATACGAGATATTGGCGTGACTGGAGTTCAGA CGTGTGCTCTTCCGATCTHHHHHHp (SEQ ID NO: 6) CEG_OP_6H_IDX 2 DBCO-GATCGGAAGAGCUCAAGCAGAAGACGG CATACGAGATACATCGGTGACTGGAGTTCAGA CGTGTGCTCTTCCGATCTHHHHHHp (SEQ ID NO: 7) CEG_OP_6H_IDX_3 DBCO-GATCGGAAGAGCUCAAGCAGAAGACGG CATACGAGATGCCTAAGTGACTGGAGTTCAGA CGTGTGCTCTTCCGATCTHHHHHHp (SEQ ID NO: 8) CEG_OP_6H_IDX_12 DBCO-GATCGGAAGAGCUCAAGCAGAAGACGG CATACGAGATTACAAGGTGACTGGAGTTCAGA CGTGTGCTCTTCCGATCTHHHHHHp (SEQ ID NO: 9) CEG_OP_6H_IDX 19: DBCO-GATCGGAAGAGCUCAAGCAGAAGACGG CATACGAGATTTTCACGTGACTGGAGTTCAGA CGTGTGCTCTTCCGATCTHHHHHHp (SEQ ID NO: 10) DBCO = dibenzocyclooctyne p = phosphate
(59) Modified nucleotide triphosphates used in the experiment are listed in Table 2.
(60) TABLE-US-00002 TABLE 2 Nucleotide triphosphates Nucleotide triphosphate Structure N.sup.6-(6-Azido)hexyl-2′- dATP (2′ dATP-N3, Jena Biosciences P/N NU-1707S)
(61) Enzymes used in the experiment are listed below.
(62) Terminal deoxytransferase (TdT, Enzymatics P/N P7070L).
(63) Method:
(64) Step 1. Formation of Hairpin-triphosphate Adapters
(65) To 0.5 μL of Tris-HCl (100 mM, pH 7.0) was added 1 nmol of 2′dATP (2 μL of 500 μM in 10 mM Tris-HCl, pH 7.0) and 1.25 nmol of the CEG_OP_6H_N adapter (2.5 μL in 500 μM in DMSO) as shown in Table 3. The mixture was incubated at 10° C. for 2 hr and diluted down to a final concentration of 100 μM by the addition of 5 μL of Tris-HCl (100 mM, pH 7.0).
(66) TABLE-US-00003 TABLE 3 Hairpin-triphosphate mixes Volume (μL) Volume (μL) of Tris-HCl of N.sup.6-(6- Volume of (100 mM, Azido)hexyl-2′- CEG_OP_6H_N Ref pH 7.0) dATP (500 μM) (500 μM) CEG19_105_1 0.5 2.0 2.5 (N = IDX 1) CEG19_105_2 0.5 2.0 2.5 (N = IDX 4) CEG19_105_3 0.5 2.0 2.5 (N = IDX 5) CEG19_105_4 0.5 2.0 2.5 (N = IDX 6) CEG19_105_5 0.5 2.0 2.5 (N = IDX 2) CEG19_105_6 0.5 2.0 2.5 (N = IDX 3) CEG19_105_7 0.5 2.0 2.5 (N = IDX 12) CEG19_105_8 0.5 2.0 2.5 (N = IDX 19)
(67) Exemplary Hairpin-triphosphate Structure (e.g. CEG19_105_5)
(68) ##STR00003##
(69) Step 2. Addition of ssDNA Template with OmniPin Adapter
(70) To 3 pmol of ssDNA template (100 ng, CEG_DC_U) in 7 μL water was added 1 μL of CEG TdT 10× Buffer (1 M Tris-acetate, 12.5 mM cobalt acetate, 1.25 mg/mL BSA, pH 6.6), 300 pmol of the OmniPin adapter (1 uL of CEG19_105_1-8, Table 4) followed by 20 U of TdT (20 U/μL). The reaction mixture was incubated at 37° C. for 30 mins before purification of the DNA.
(71) TABLE-US-00004 TABLE 4 Adaption mixes Volume (μL) of Volume Volume (μL) Volume (μL) Volume (μL) CEG_DC_U (μL) CEG TdT CEG19_100_1-8 TdT (10 Ref (100 ng/μL) dH.sub.2O Buffer (10×) (100 μM) U/μL) CEG19_105_9 1 6 1 1 1 (CEG19_105_1) CEG19_105_10 1 6 1 1 1 (CEG19_105_2) CEG19_105_11 1 6 1 1 1 (CEG19_105_3) CEG19_105_12 1 6 1 1 1 (CEG19_105_4) CEG19_105_13 1 6 1 1 1 (CEG19_105_5) CEG19_105_14 1 6 1 1 1 (CEG19_105_6) CEG19_105_15 1 6 1 1 1 (CEG19_105_7) CEG19_105_16 1 6 1 1 1 (CEG19_105_8)
(72) Results:
(73) Purified hairpin-adapted template products (9 uL each of CEG19_105_9-16) were loaded onto a 4-20% PAGE TBE gel (Life Technologies, P/N EC62255BOX) and ran for 35 minutes at 200 V (
Example 3
Whole Human Genome Sequencing Using Libraries Prepared with OmniPrep Single Stranded Library Construction Method
(74) Materials:
(75) Oligonucleotides used in the experiment are listed in Table 5.
(76) TABLE-US-00005 TABLE 5 Oligonucleotide sequences Oligonucleotide Sequence 5′-3′ CEG_OP_6H_IDX_1 DBCO-GATCGGAAGAGCUCAAGCAGAAGACGG CATACGAGATCGTGATGTGACTGGAGTTCAGA CGTGTGCTCTTCCGATCTHHHHHHp (SEQ ID NO: 3) CEG_OP_6H_IDX_4 DBCO-GATCGGAAGAGCUCAAGCAGAAGACGG CATACGAGATTGGTCAGTGACTGGAGTTCAGA CGTGTGCTCTTCCGATCTHHHHHHp (SEQ ID NO: 4) CEG_OP_6H_IDX 5 DBCO-GATCGGAAGAGCUCAAGCAGAAGACGG CATACGAGATCACTGTGTGACTGGAGTTCAGA CGTGTGCTCTTCCGATCTHHHHHHp (SEQ ID NO: 5) CEG_OP_6H_IDX_6 DBCO-GATCGGAAGAGCUCAAGCAGAAGACGG CATACGAGATATTGGCGTGACTGGAGTTCAGA CGTGTGCTCTTCCGATCTHHHHHHp (SEQ ID NO: 6) CEG_OP_6H_IDX_2 DBCO-GATCGGAAGAGCUCAAGCAGAAGACGG CATACGAGATACATCGGTGACTGGAGTTCAGA CGTGTGCTCTTCCGATCTHHHHHHp (SEQ ID NO: 7) CEG_OP_6H_IDX_3 DBCO-GATCGGAAGAGCUCAAGCAGAAGACGG CATACGAGATGCCTAAGTGACTGGAGTTCAGA CGTGTGCTCTTCCGATCTHHHHHHp (SEQ ID NO: 8) CEG_OP_6H_IDX_12 DBCO-GATCGGAAGAGCUCAAGCAGAAGACGG CATACGAGATTACAAGGTGACTGGAGTTCAGA CGTGTGCTCTTCCGATCTHHHHHHp (SEQ ID NO: 9) CEG_OP_6H_IDX_19 DBCO-GATCGGAAGAGCUCAAGCAGAAGACGG CATACGAGATTTTCACGTGACTGGAGTTCAGA CGTGTGCTCTTCCGATCTHHHHHHp (SEQ ID NO: 10) CEG_Frw_AD_U AATGATACGGCGACCACCGAGATCTACACTCT UTCCCTACACGACGCTCTUCCGATCT (SEQ ID NO: 11) CEG_Frw_AD_Comp pGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG TAGATCTCGGTGGTCGCCGTATCATTp (SEQ ID NO: 12) Fwd_PCR_Primer AATGATACGGCGACCACCGAG (SEQ ID NO: 13) Rev_PCR_Primer CAAGCAGAAGACGGCATACGA (SEQ ID NO: 14) DBCO = dibenzocyclooctyne p = phosphate
(77) Modified nucleotide triphosphates used in the experiment are listed in Table 6.
(78) TABLE-US-00006 TABLE 6 Nucleotide triphosphates Nucleotide triphosphate Structure N.sup.6-(6-Azido)hexyl-2′- dATP (2′ dATP-N3, Jena Biosciences P/N NU-1707S)
(79) Enzymes used in the experiment are listed in Table 7 below.
(80) TABLE-US-00007 TABLE 7 Enzymes Enzyme Vendor and P/N Terminal deoxytransferase (TdT) Enzymatics P7070L T4 Polynucleotide Kinase (PNK) Enzymatics Y9040L Klenow(exo-) DNA polymerase Enzymatics P7010-HC-L T4 DNA Ligase Enzymatics L6030-HC-L Thermolabile UDG Enzymatics G5020L VERASEQ ™ ULtra DNA polymerase Enzymatics P7520L
(81) Methods
(82) Step 1. Formation of Hairpin-triphosphate Adapters
(83) To 0.5 μL of Tris-HCl (100 mM, pH 7.0) was added 1 nmol of 2′dATP (2 μL of 500 μM in 10 mM Tris-HCl, pH 7.0) and 1.25 nmol of the CEG_OP_6H_* adapter (2.5 μL in 500 μM in DMSO, * denotes separate indexed hairpin adapters each listed in Table 5). Each mixture was incubated at 10° C. for 2 hr and diluted down to a final concentration of 100 μM by the addition of 5 μL of Tris-HCl (100 mM, pH 7.0).
(84) Step 2. Bisulfite Conversion of Human Genomic DNA
(85) Human Cerebellum genomic DNA (AMSbio, 1 μg) was bisulfite (BS) or oxidative bisulfite (oxBS) converted using the TRUEMETHYL™ conversion kit (CEGX) following the manufacturers specification. The DNA was then quantified by QUBIT™ ssDNA assay kit (Invitrogen).
(86) Step 3. PNK Treatment of Genomic DNA
(87) To 100 ng of either native, BS or oxBS treated human cerebellum gDNA in 1× TdT buffer (100 mM Tris-acetate, 1.25 mM CoAc.sub.2, 125 μg/mL BSA, pH 6.6 @ 25° C.) supplemented with 10 Units of PNK was added and incubated at 37° C. for 20 min. The PNK reaction was stopped by heat denaturating at 95° C. for 3 min.
(88) Step 4. Addition of the Hairpin Adapter to the PNK Treated Genomic DNA
(89) To the PNK treated DNA (after heat denaturation) 50 pmols of the Hairpin adapter (hairpin-triphosphate adapter from step 1) and 20 Units of TdT was added and incubated at 37° C. for 30 min.
(90) Step 4. Magnetic Bead Purification of Hairpin-adapted Genomic DNA
(91) The hairpin-adapted DNA fragments were purified using magnetic beads (30% PEG-8000, 1 M NaCl, 1 mM EDTA, 10 mM Tris pH 8, 0.1% w/v carboxy Sera-Mag magnetic particles (GE P/N 09-981-123)). Samples were washed using freshly prepared acetonitrile:water (70:30) and eluted from the beads in ultra pure water.
(92) Step 5. Klenow Extension and Ligation of the Second Adapter
(93) The purified hairpin-adapted DNA fragments in 1× ligation buffer (50 mM Tris-HCl, 10 mM MgCl.sub.2, 5 mM DTT, 1 mM ATP, pH 7.6 @ 25° C.) supplemented with 1 mM dNTP, 10 U of PNK and 50 U of Klenow(exo-), were incubated at 37° C. for 30 min before the PNK and Klenow(exo-) were heat denatured at 95° C. for 3 min. The reaction mixture was used directly within the ligation reaction by the addition of PEG 6000 to a final concentration of 7.5%, 0.1 pMols of pre-annealed DNA adapters and 600 U of T4 DNA Ligase. The mixture was incubated for 15 mins at 25° C. to yield the doubly-adapted DNA fragment product.
(94) Step 6. Magnetic Bead Purification Doubly-adapted DNA Fragments
(95) The doubly-adapted DNA fragments were purified twice with a 18% PEG solution (18% PEG-8000, 1 M NaCl, 1 mM EDTA, 10 mM Tris pH 8, 0.1% w/v Carboxy-coated magnetic particles). Samples were washed using freshly prepared acetonitrile:water (70:30) and eluted from the beads in ultra pure water.
(96) Step 7. UDG Digestion to Yield Final Libraries
(97) The purified doubly-adapted DNA fragments in 1× VERASEQ™ buffer were treated with 1 U of thermolibale UDG for 20 mins at 37° C. before the UDG was heat denatured at 95° C. for 5 min. This final library of single stranded, doubly adapted fragments is referred to as an OmniPrep library. Samples were either sequenced directly as PCR-free libraries or PCR-amplified for 10 cycles before sequencing.
(98) Step 8. PCR Amplification of Omniprep Libraries
(99) PCR amplification of the OmniPrep libraries was performed on Agilent Surecycler 8800 thermocycler in 1× VERASEQ™ buffer supplemented with 125 μM of the forward PCR primer (Fwd_PCR_Primer), 125 μM of the reverse PCR primer (Rev_PCR_Primer), 500 μM dNTPs and 1 U of VERASEQ™ 2.0 DNA polymerase. Thermocycling conditions were 10 cycles of:
(100) Denaturation at 95° C. for 30 sec
(101) Annealing at 60° C. for 30 sec
(102) Extension at 72° C. for 90 sec
(103) Step 9. Magnetic Bead Purification of Amplified OmniPrep Libraries
(104) The amplified OmniPrep libraries were purified once with a 18% PEG solution (18% PEG-8000, 1 M NaCl, 1 mM EDTA, 10 mM Tris pH 8, 0.1% w/v Carboxy-coated magnetic particles). Samples were washed using freshly prepared acetonitrile:water (70:30) and eluted from the beads in ultra pure water.
(105) Step 10. Sequencing and Analysis of the OmniPrep Libraries
(106) Sequencing was carried out on an Illumina NextSeq500 sequencer with a paired end run (2×75 bp). Two individual runs were conducted, one for the PCR-free libraries, a second for the PCR-amplified libraries. Libraries were prepared in duplicate (native) or triplicate (converted) and pooled to a final concentration of 2 nM, then denatured and diluted according to the manufacturers instructions before Sequencing. The raw output fastq read sequences were quality filtered and trimmed using TrimGalore, the trimmed data was aligned to the human genome (release 37.55) with Bismark software. A summary of the sequencing results is shown in Table 8.
(107) TABLE-US-00008 TABLE 8 Whole human genome OmniPrep library sequencing metrics # non- # uniquely uniquely mapped mapped Alignment Sample # PE reads reads reads rate PCR_native_rep1 16640651 11507328 457049 69.2% PCR_native_rep2 14304479 10632055 441680 74.3% PCR_BS_rep1 28416019 17265923 984970 60.8% PCR_BS_rep2 7866065 5547305 304164 70.5% PCR_BS_rep3 32336222 22677644 1146295 70.2% PCR_oxBS_rep1 35661755 24297095 1246204 68.2% PCR_oxBS_rep2 24124304 17101247 990627 70.9% PCR_oxBS_rep3 31384442 22721639 1186467 72.4% PCRfree_native_rep1 41729358 32452776 1516459 77.8% PCRfree_native_rep2 46284959 34231016 1673857 74.0% PCRfree_BS_rep1 3996331 2282322 148326 57.1% PCRfree_BS_rep2 7140997 4731152 300306 66.3% PCRfree_BS_rep3 6164831 4115330 258993 66.8% PCRfree_oxBS_rep1 20869094 13311899 863129 63.8% PCRfree_oxBS_rep2 3776160 2469895 166376 65.5% PCRfree_oxBS_rep3 11869124 8218475 508641 69.3%
(108) Results and Observations
(109) The sequencing data clearly demonstrates the successful sequencing of PCR-amplified and PCR-free OmniPrep libraries prepared using ssDNA from native and converted (bisulfite and oxidative-bisulfite) human cerebellum gDNA. High alignment rates indicate that the majority of the data is comprised of unique reads that align unambiguously to the human genome. This experiment illustrates that the OmniPrep method can be used to prepare sequencable libraries from ssDNA that accurately map to the expected genome of interest.
Example 4
On-bead OmniPrep Library Preparation
(110) Materials
(111) Oligonucleotides used in the experiment are listed in Table 9.
(112) TABLE-US-00009 TABLE 9 Oligonucleotide sequences Oligonucleotide Sequence 5'-3' CEG_OPS_6H_Biotin DBCO-GAT(Biotin)CGGAAGAGCU TACACTCTTTCCCTACACGACGCTCT TCCGATCTHHHHHHp (SEQ ID NO: 15) CEG_SHORT_IDX_AD_3P GTGACTGGAGTUCAGACGTGTGCTCT CUCGATCTp (SEQ ID NO: 16) CEG_SHORT_IDX_COMP_53P pGATCGGAAGAGCACACGTCTGAACT CCAGTCACp (SEQ ID NO: 17) Fwd_PCR_Primer_long AATGATACGGCGACCACCGAGATCTA CACTCTTTCCCTACACGACGCTCTTC CGATCT (SEQ ID NO: 18) Rev_PCR_Primer_long CAAGCAGAAGACGGCATACGAGATCA CTGTGTGACTGGAGTTCAGACGTGT (SEQ ID NO: 19) DBCO = dibenzocyclooctyne p = phosphate
(113) Modified nucleotide triphosphates used in the experiment are listed in Table 10.
(114) TABLE-US-00010 TABLE 10 Nucleotide triphosphates Nucleotide triphosphate Structure N.sup.6-(6-Azido)hexyl-2′- dATP (2′ dATP-N3, Jena Biosciences P/N NU-1707S)
(115) Enzymes used in the experiment are listed in Table 11 below.
(116) TABLE-US-00011 TABLE 11 Enzymes Enzyme Vendor and P/N Terminal deoxytransferase (TdT) Enzymatics P7070L T4 Polynucleotide Kinase (PNK) Enzymatics Y9040L Klenow(exo-) DNA polymerase Enzymatics P7010-HC-L T4 DNA Ligase Enzymatics L6030-HC-L Thermolabile UDG Enzymatics G5020L VERASEQ ™ ULtra DNA polymerase Enzymatics P7520L Exonuclease 1 (Exol) Enzymatics X8010L Exonuclease VII (ExoVII) NEB M0379S Exonuclease T (ExoT) NEB M0265S Endonuclease VII (EndoVII) Enzymatics Y9080L
(117) Method
(118) Step 1. Formation of Hairpin-triphosphate (OmniPin) Adapters
(119) To 0.5 μL of Tris-HCl (100 mM, pH 7.0) was added 1 nmol of 2′dATP (2 μL of 500 μM in 10 mM Tris-HCl, pH 7.0) and 1.25 nmol of the CEG_OPS_6H_Biotin adapter (2.5 μL in 500 μM in DMSO). Each mixture was incubated at 10° C. for 2 hr and diluted down to a final concentration of 100 μM by the addition of 5 μL of Tris-HCl (100 mM, pH 7.0).
(120) Step 2. Bisulfite Conversion of Human Genomic DNA
(121) Human genomic DNA (Promega, 1 μg) was bisulfite (BS) converted using the TRUEMETHYL™ conversion kit (CEGX) following the manufacturers specification. The DNA was then quantified by QUBIT™ ssDNA assay kit (Invitrogen).
(122) Step 3. PNK Treatment of Genomic DNA
(123) To 60 ng of BS converted DNA in 1× TdT buffer (100 mM Tris-acetate, 1.25 mM CoAc.sub.2, 125 μg/mL BSA, pH 6.6 @ 25° C.) 10 U of PNK was added and incubated at 37° C. for 20 min. The PNK reaction was stopped by denaturating at 95° C. for 3 min.
(124) Step 4. Addition of the Hairpin-triphosphate Adapter to the PNK Treated Genomic DNA
(125) To the PNK treated DNA after heat denaturation 50 pmols of the OmniPin adapter (hairpin-triphosphate adapter) and 20 U of TdT was added and incubated at 37° C. for 30 min.
(126) Step 5. Binding of OmniPin-adapted DNA Fragments to Streptavidin Coated Magnetic Beads
(127) The OmniPin-adapted DNA fragments were bound to 50 μL of streptavidin coated magnetic particles (Life Technologies Dynabeads, M280) in 1× BW buffer (1 M NaCl, 5 mM Tris-HCl, 0.5 mM EDTA, 0.1% Tween, pH 8.0 at 25° C.) for 30 mins at 25° C.
(128) Step 6. Washing of Immobilised OmniPin-adapted DNA Fragments
(129) DNA-bound streptavidin coated magnetic particles were precipitated on a magnetic rack and the supernatant was removed and discarded. The beads were washed twice, by re-suspending in a high stringency wash buffer (0.1×SSC, 0.1×SDS). The beads were finally washed with 1× Ligation buffer (50 mM Tris-HCl, 10 mM MgCl.sub.2, 5 mM DTT, 1 mM ATP, pH 7.6 @ 25° C.).
(130) Step 7. On-bead Klenow Extension of OmniPin-adapted DNA Fragments
(131) The washed DNA-bound streptavidin beads were re-suspended in 1× ligation buffer (50 mM Tris-HCl, 10 mM MgCl.sub.2, 5 mM DTT, 1 mM ATP, pH 7.6 @ 25° C.) supplemented with 0.25 mM dNTP (dATPαS was used in place of dATP), 10 U of PNK and 50 U of Klenow(exo-). The reaction was incubated at 37° C. for 30 min.
(132) Step 8. Washing of Klenow Extended Immobilised OmniPin-adapted DNA Fragments
(133) Extended DNA-bound streptavidin coated magnetic particles were precipitated on a magnetic rack and the supernatant was removed. The beads were washed twice, by re-suspending in a high stringency wash buffer (0.1×SSC, 0.1×SDS). The beads were finally washed with 1× NEBuffer 4 (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate, 1 mM DTT, pH 7.9 at 25° C.).
(134) Step 9. On-bead Nuclease Digestion of Immobilized DNA Fragments
(135) A selection of nucleases were independently tested at this stage. The washed, Klenow extended, DNA-bound streptavidin beads were resuspended in 1× NEBuffer4 supplemented with either 10 U of Exo I, or 10 U of Exo VII, or 10 U of Exo T, or 20 U of a combination of Exo I, Exo VII and Exo T. The reactions were incubated at 37° C. for 60 min.
(136) Step 10. Washing of Nuclease Digested Immobilised OmniPin-adapted DNA Fragments
(137) Nuclease digested DNA-bound streptavidin coated magnetic particles were precipitated on a magnetic rack and the supernatant was removed. The beads were washed twice, by re-suspending in a high stringency wash buffer (0.1×SSC, 0.1×SDS). The beads were finally washed with 1× Ligation buffer (50 mM Tris-HCl, 10 mM MgCl.sub.2, 5 mM DTT, 1 mM ATP, pH 7.6 @ 25° C.).
(138) Step 11. On-bead Ligation of the Second Adapter
(139) The washed nuclease-digested DNA-immobilized streptavidin beads were re-suspended in 1× Ligation buffer supplemented with 0.1 pmol of pre-annealed DNA adapters (equimolar mix of CEG_SHORT_IDX_AD_3P and CEG_SHORT_IDX_COMP_53P) and 600 U of T4 DNA Ligase. The mixture was incubated for 15 mins at 25° C. to yield the doubly-adapted DNA fragment product.
(140) Step 12. Washing of Doubly-adapted Immobilized DNA Fragments
(141) The doubly-adapted DNA-immobilized streptavidin coated magnetic particles were precipitated on a magnetic rack and the supernatant was removed. The beads were washed twice, by re-suspending in a high stringency wash buffer (0.1×SSC, 0.1×SDS). The beads were finally washed with 1× VERASEQ™ Buffer (25 mM TAPS, 50 mM KCl, 2 mM MgCl.sub.2, 1 mM β-ME, pH 9.3 at 25° C.).
(142) Step 13. On-bead UDG/Endonuclease VII Digestion of Immobilized Doubly Adapted DNA Fragments
(143) The washed doubly-adapted DNA-immobilized streptavidin beads were re-suspended in 1× VERASEQ™ buffer was treated with 1 U of thermolabile UDG and 10 U of Endonuclease VII for 20 mins at 37° C. before the UDG reaction was stopped by denaturating at 60° C. for 10 min. This treatment cuts the desired product from the bead. The streptavidin coated magnetic particles were precipitated on a magnetic rack and the supernatant was removed and retained for further PCR amplification. This final library of single stranded, doubly adapted fragments is referred to as an OmniPrep library.
(144) Step 14. PCR Amplification of OmniPrep Libraries
(145) PCR amplification of the OmniPrep libraries was performed on Agilent Surecycler 8800 thermocycler in 1× VERASEQ™ buffer supplemented with 125 μM of the forward PCR primer (Fwd_PCR_Primer_long), 125 μM of the reverse PCR primer (Rev_PCR_Primer_long), 500 μM dNTPs and 1 U of VERASEQ™ 2.0 DNA polymerase. Thermocycling conditions were 10 cycles of:
(146) Denaturation at 95° C. for 30 sec
(147) Annealing at 60° C. for 30 sec
(148) Extension at 72° C. for 90 sec
(149) Results
(150) The PCR products were loaded on to a 2% agarose gel and ran at 120 V for 60 mins (gel shown in