Antimicrobial peptide Sparamosin from <i>Scylla paramamosain </i>and application thereof

Abstract

Provided is an antimicrobial peptide Sparamosin from Scylla paramamosain. The Sparamosin mature peptide and its functional domain Sparamosin.sub.26-54 were synthesized by solid-phase synthesis with a purity of over 95%. Both Sparamosin and Sparamosin.sub.26-54 exhibit strong antimicrobial activity. More importantly, Sparamosin.sub.26-54 has strong antifungal activity and could inhibit the growth of a variety of yeasts and filamentous fungi. Based on the potent antimicrobial activities of Sparamosin and Sparamosin.sub.26-54, both peptides could be developed as alternatives for conventional antibiotics, antimicrobial agents, feed additives in aquaculture and livestock, preservatives, and mold inhibitors.

Claims

1. A functional domain Sparamosin.sub.26-54, wherein the amino acid sequence is SEQ ID NO 03.

2. The functional domain Sparamosin.sub.26-54 according to claim 1, wherein the functional domain Sparamosin.sub.26-54 has antifungal activity.

3. The functional domain Sparamosin.sub.26-54 according to claim 1, wherein the functional domain Sparamosin.sub.26-54 has antimicrobial activity.

4. A method for preparing the functional domain Sparamosin.sub.26-54 according to claim 1, comprising: synthesizing the functional domain Sparamosin.sub.26-54 by a solid-phase synthesis.

5. A method, comprising: diluting the functional domain Sparamosin.sub.26-54 according to claim 1 to prepare antimicrobial agents.

6. A method, comprising: diluting the functional domain Sparamosin.sub.26-54 according to claim 1 to prepare feed additives.

7. A method, comprising: diluting the functional domain Sparamosin.sub.26-54 according to claim 1 to prepare preservatives and mold inhibitors.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the inhibition of Sparamosin.sub.26-54 on spore germination of Aspergillus niger, Neurospora crassa, Fusarium graminearum, Fusarium oxysporum, Aspergillus ochraceus and Aspergillus fumigatus. (I): A. niger, (II): N. crassa, (III): F. graminearum, (IV): F. oxysporum, (V): A. ochraceus, (VI): A. fumigatus. The final concentration of Sparamosin.sub.26-54 is as follows: A: 0 μM; B: 3 μM; C: 6 μM; D: 12 μM; E: 24 μM; and F: 48 μM.

(2) FIG. 2 is a time-kill curve of Sparamosin.sub.26-54 killing Staphylococcus aureus and Cryptococcus neoformans. In FIG. 2, the X-axis is time (min), and the Y-axis is the kill index (%).

(3) FIG. 3 shows the thermal stability of Sparamosin.sub.26-54 against S. aureus and C. neoformans. In FIG. 3, the X-axis is time (h), and the Y-axis is the OD.sub.600 value.

(4) FIG. 4 shows the cytotoxicity test of Sparamosin.sub.26-54 determined by MTS-PMS-assay. In FIG. 4, the X-axis is the concentration of Sparamosin.sub.26-54 (μg/mL), and the Y-axis is the cell proliferation rate (%).

DETAILED DESCRIPTION OF THE EMBODIMENTS

(5) The following embodiments can enable those skilled in the art to fully understand the present disclosure, and the present disclosure is not limited to the embodiments below.

Embodiment 1: Preparation of Sparamosin and Sparamosin.SUB.26-54

(6) The ORF sequence of Sparamosin is SEQ ID NO 01, and a sequence of SEQ ID NO 01 is as follows:

(7) TABLE-US-00004 ATGGCGCGCCACGTGCTCCCGCTGGTGTTGCTACTTGTGGCTCTTGTGGT GCGACTCATTTTGTCTGCACCTGTCCCTGATCCAGACTCTGAACAGAGCA ATATATCTGAAGTGCTAAAGGTGCAACATTCCATCTTCAGCGGCCTGGGC CCCAACCCGTGCCGCAAGAAATGCTACAAAAGGGATTTCTTGGGTCGATG TCGCCTGAATTTCACATGTATGTTTGGATGA

(8) The full length cDNA sequence of Sparamosin was obtained using 5′ RACE and 3′ RACE PCR and sequence splicing. The ORF of Sparamosin is 231 bp (containing the termination codon TGA), with the gene accession number in GenBank as MH423837.

(9) Gene-specific primers were designed according to the cDNA sequence of Sparamosin in the sequencing results of transcriptome (Table 1).

(10) TABLE-US-00005 TABLE 1 The sequence amplification primers of Sparamosin Primer Name Sequence 5′-3′ Sparamosin 5′ 1 CCCAGGCCGCTGAAGATGGAATGTT Sparamosin 5′ 2 TGAGTCGCACCACAAGAGCCACA Sparamosin 3′ 1 TGTGGCTCTTGTGGTGCGACTCA Sparamosin 3′ 2 TGTCTGCACCTGTCCCTGATCCA Long Primer CTAATACGACTCACTATAGGGCAAGCAGTGG TATCAACGCAGAGT Short Primer CTAATACGACTCACTATAGGGC UPM The mixing ratio is as follows: Long Primer:Short Primer = 1:4 NUP AAGCAGTGGTATCAACGCAGAGT

(11) Sparamosin 5′ untranslated region (UTR) was amplified by 5′ RACE

(12) First Round of PCR Reaction

(13) The cDNA we previously prepared in this laboratory was used as a template for PCR, and the PCR reaction system is as follows:

(14) TABLE-US-00006 Template 1.25 μL 10 × LA PCR Buffer II (Mg.sup.2+ plus) 2.5 μL dNTP Mixture (2.5 mM each) 4 μL UPM 2.5 μL Sparamosin 5′1 1 μL LA Taq (5 U/μL) 0.25 μL Milli-Q water 13.5 μL Total reaction volume 25 μL

(15) The PCR reaction was carried out after mixing evenly and the reaction procedure was as follows:

(16) (1) pre-denaturation at 95° C. for 5 min;

(17) (2) denaturation at 95° C. for 30 s, annealing at 60° C. for 30 s, extension at 72° C. for 2 min, repeating for 30 cycles;

(18) (3) extension at 72° C. for 10 min; and

(19) (4) termination at 16° C.

(20) Second Round of PCR Reaction

(21) The first-round of PCR amplification products was diluted 50 times with Milli-Q water, and then used as a template for the second round PCR reaction. The PCR reaction system is as follows:

(22) TABLE-US-00007 Template 2.5 μL 10 × LA PCR Buffer II (Mg.sup.2+ plus) 5 μL dNTP Mixture (2.5 mM each) 8 μL NUP 2 μL Sparamosin 5′2 2 μL LA Taq (5 U/μL) 0.5 μL Milli-Q water 30 μL Total reaction volume 50 μL

(23) The PCR reaction was carried out after mixing evenly and the reaction procedure was as follows:

(24) (1) pre-denaturation at 95° C. for 5 min;

(25) (2) denaturation at 95° C. for 30 s, annealing at 60° C. for 30 s, extension at 72° C. for 2 min, repeating for 30 cycles;

(26) (3) extension at 72° C. for 10 min; and

(27) (4) termination at 16° C.

(28) Sparamosin 3′ UTR was amplified by 3′ RACE

(29) The amplification method of Sparamosin 3′ UTR is similar to 5′ UTR amplification.

(30) The amino acid sequence of Sparamosin is SEQ ID NO 02, and a sequence of SEQ ID NO 02 is as follows:

(31) TABLE-US-00008 Met-Ala-Arg-His-Val-Leu-Pro-Leu-Val-Leu-Leu-Leu- Val-Ala-Leu-Val-Val-Arg-Leu-Ile-Leu-Ser-Ala-Pro- Val-Pro-Asp-Pro-Asp-Ser-Glu-Gln-Ser-Asn-Ile-Ser- Glu-Val-Leu-Lys-Val-Gln-His-Ser-Ile-Phe-Ser-Gly- Leu-Gly-Pro-Asn-Pro-Cys-Arg-Lys-Lys-Cys-Tyr-Lys- Arg-Asp-Phe-Leu-Gly-Arg-Cys-Arg-Leu-Asn-Phe-Thr- Cys-Met-Phe-Gly,
where SEQ ID NO 11 represents signal peptide, and a sequence of SEQ ID NO 11 is Met-Ala-Arg-His-Val-Leu-Pro-Leu-Val-Leu-Leu-Leu-Val-Ala-Leu-Val-Val-Arg-Leu-Ile-Leu-Ser.

(32) The amino acid sequence of Sparamosin is 76 residues in length and consists of a 22-amino acid signal peptide. The putative signal peptide cleavage site predicted by the SignalP-4.1 Server (http://www.cbs.dtu.dk/services/SignalP/) is between Ser.sup.22 and Ala.sup.23. The Sparamosin mature peptide consists of 54 amino acids with the molecular formula C.sub.266H.sub.419N.sub.77O.sub.77S.sub.5. The molecular weight is 6.09 kDa. The grand average of hydropathicity is −0.476, indicating that Sparamosin mature peptide has high solubility in water. The theoretical pI is 8.87, with eight positively charged residues and five negatively charged residues, corresponding to the cationic peptide.

(33) The amino acid sequence of Sparamosin.sub.26-54 is SEQ ID NO 03, and a sequence of SEQ ID NO 03 is as follows:

(34) TABLE-US-00009 Gly-Leu-Gly-Pro-Asn-Pro-Cys-Arg-Lys-Lys-Cys-Tyr- Lys-Arg-Asp-Phe-Leu-Gly-Arg-Cys-Arg-Leu-Asn-Phe- Thr-Cys-Met-Phe-Gly.

(35) Sparamosin.sub.26-54 is the functional domain of Sparamosin mature peptide, which is formed from the 26th (glycine) to 54th (glycine) amino acid residue of the mature peptide. Sparamosin.sub.26-54 is composed of 29 amino acids and its molecular formula is C.sub.147H.sub.234N.sub.46O.sub.36S.sub.5. The molecular weight is 3.38 kDa. The grand average of hydropathicity is −0.528, indicating that Sparamosin.sub.26-54 has high solubility in water. The theoretical pI is 9.79, with seven positively charged residues and one negatively charged residue, corresponding to the cationic peptide.

(36) The Sparamosin and Sparamosin.sub.26-54 were synthesized by solid-phase synthesis with a purity of over 95%. In this embodiment, these two peptides were commercially synthesized by Jinken biochemical reagent (Wuhan, China) and Genscript (Nanjing, China).

Embodiment 2: The Determination of the MIC and Minimum Bactericidal Concentration (MBC) of Sparamosin and Sparamosin.SUB.26-54

(37) The strains involved in this embodiment include: S. aureus, Corynebacterium glutamicum, Bacillus cereus, Pseudomonas fluorescens, Pseudomonas aeruginosa, Escherichia coli, C. neoformans, C. albicans, Pichia pastoris GS115, A. niger, Aspergillus flavus, F. graminearum, F. oxysporum, A. ochraceus, A. fumigatus, and N. crasa. P. pastoris GS115 was purchased from the company Invitrogen, and all other strains were purchased from China General Microbiological Culture Collection Center (CGMCC), which were stored in this lab.

(38) {circle around (1)} S. aureus, C. glutamicum, B. cereus, P. fluorescens, P. aeruginosa, E. coli were inoculated on nutrient broth (NB) agar and cultured for 1-2 days. C. neoformans, C. albicans, P. pastoris GS115 were inoculated on yeast extract peptone dextrose (YPD) agar and cultured at 28° C. for 1-3 days. The spores of A. niger, A. flavus, F. graminearum, F. oxysporum, A. ochraceus, A. fumigatus, N. crasa were inoculated on potato dextrose agar (PDA) and cultured at 28° C. for 1-7 days.

(39) {circle around (2)} Strains were then inoculated on the corresponding solid culture medium: the bacteria was further cultured for 1-2 days; the yeasts were further cultured for 1-3 days; and the molds were further cultured for 1-7 days. Bacteria and yeast were washed away from the solid culture medium with 10 mM sodium phosphate buffer (pH=7.4). A mixed solution of Mueller-Hinton (MH) medium and sodium phosphate buffer solution was used to dilute the bacteria, and a mixed solution of YPD medium and sodium phosphate buffer solution was used to dilute the yeasts, so that the final concentration of the bacteria or yeasts became 3.3×10.sup.4 cfu/mL. The mold spores were washed away from the solid culture medium with 10 mM sodium phosphate buffer and diluted in a mixed solution of potato dextrose broth and sodium phosphate buffer. The concentration of spores was determined using a hemocytometer under an optical microscope and adjusted to 5×10.sup.4 spores/mL.

(40) {circle around (3)} Sparamosin and Sparamosin.sub.26-54 were diluted to 3, 6, 12, 24, 48 and 96 μM with sterilized Milli-Q water. The peptide solutions should be filter-sterilized using a 0.22 μm pore size filter.

(41) {circle around (4)} Each test was set up with a sterile control, a negative control group and an experimental group in sterile 96-well microtiter plates. All measurements were repeated three times.

(42) a. sterile control: 50 μL of peptide solution with 50 μL of culture medium, b. negative control: 50 μL of sterilized Milli-Q water with 50 μL of microbial suspension, and c. experimental group: 50 μL of peptide solution with 50 μL of microbial suspension.

(43) The cultures were grown at 28° C. or 37° C. for 1-2 days. The test isolates without visible growth were then placed on an appropriate medium and incubated at 28° C. or 37° C. for 1-2 days.

(44) The results of MIC and MBC of Sparamosin are shown in Table 2.

(45) TABLE-US-00010 TABLE 2 MIC and MBC of synthetic Sparamosin Microorganism CGMCC NO. MIC MBC Gram-positive bacteria Bacillus cereus 1.3760 24-48 >48 Staphylococcus aureus 1.2465 12-24 48 Gram-negative bacteria Pseudomonas fluorescens 1.3202 12-24 24 Escherichia coli 1.2389 12-24 24 Fungi Cryptococcus neoformans 2.1563 >48 >48 Pichia pastoris (GS115) Invitrogen  6-12 24

(46) The results of MIC and MBC of Sparamosin.sub.26-54 are shown in Table 3.

(47) TABLE-US-00011 TABLE 3 MIC and MBC of synthetic Sparamosin.sub.26-54 Microorganism CGMCC NO. MIC MBC Gram-positive bacteria Staphylococcus aureus 1.2465 3-6  12 Corynebacterium glutamicum 1.1886 1.5-3   6 Bacillus cereus 1.3760 6-12 24 Gram-negative bacteria Pseudomonas fluorescens 1.3202 3-6  6 Pseudomonas aeruginosa 1.2421 6-12 12 Escherichia coli 1.2389 6-12 12 Fungi Cryptococcus neoformans 2.1563 1.5-3   12 Pichia pastoris (GS115) Invitrogen 1.5-3   3 Candida albicans 2.2411 >48 >48 Aspergillus niger 3.316 6-12 24 Aspergillus flavus 3.441 >48 >48 Fusarium graminearum 3.4521 6-12 12 Fusarium oxysporum 3.6785 6-12 12 Aspergillus ochraceus 3.5830 3-6  48 Aspergillus fumigatus 3.5835 12-24  24 Neurospora crasa 3.1604 12-24  48 MIC: minimum inhibitory concentration (μM), expressed a-b. a: The highest peptide concentration that induce visible growth of microorganisms. b: The lowest peptide concentration that does not induce visible growth of microorganisms; MBC: minimum bactericidal concentration (μM), the lowest peptide concentration killed more than 99.9% of bacteria;

Embodiment 3: Anti-Mold Properties of Sparamosin.SUB.26-54

(48) {circle around (1)} The spores of A. niger, N. crasa, F. graminearum, F. oxysporum, A. ochraceus, and A. fumigatus were inoculated on PDA plates and cultured at 28° C. for 1-7 days.

(49) {circle around (2)} Molds were then inoculated on the PDA plates and cultured at 28° C. for 1-7 days. The mold spores were washed away from solid culture medium with 10 mM sodium phosphate buffer and diluted in a mixed solution of potato dextrose broth and sodium phosphate buffer. The concentration of spores was determined using a hemocytometer under an optical microscope and adjusted to 5×10.sup.4 spores/mL.

(50) {circle around (3)} Sparamosin and Sparamosin.sub.26-54 were diluted to 3, 6, 12, 24, 48 and 96 μM with sterilized Milli-Q water. The peptide solutions should be filter-sterilized using a 0.22-μm pore size filter.

(51) {circle around (4)} Each test was set up with a negative control group and an experimental group in sterile 96-well microtiter plates. All measurements were repeated three times.

(52) a. negative control: 50 μL of sterilized Milli-Q water with 50 μL of spore suspension, and

(53) b. experimental group: 50 μL of peptide solution with 50 μL of spore suspension.

(54) Cultures were grown at 28° C. for 24 hours. Spores germination were observed under an optical microscope (see FIG. 1).

Embodiment 4: Time-Kill Curve of Sparamosin.SUB.26-54

(55) The time-killing kinetic curve of Sparamosin.sub.26-54 was performed using S. aureus and C. neoformans. The final concentration of Sparamosin.sub.26-54 was adjusted to 1×MBC (S. aureus: 12 μM, C. neoformans: 12 μM). This procedure is similar to the antimicrobial assay described in Embodiment 2.

(56) At 10, 15, 30, 60, 180 and 360 minutes of incubation, a mixed solution of 6 μL of S. aureus and synthetic Sparamosin.sub.26-54 from each test was diluted into 600 μL of 10 mM sodium phosphate buffer. After mixing evenly, 40 μL of the solution was taken out and plated on NB agar. The number of S. aureus monoclonal was recorded, and the percentage of CFU was calculated after incubation at 37° C. for 1-2 days.

(57) At 15, 30, 60, 120, 240, 360 and 480 minutes of incubation, a mixed solution of 40 μL of C. neoformans and synthetic Sparamosin.sub.26-54 was taken from each test and plated on YPD agar. The number of C. neoformans monoclonal was recorded and the percentage of CFU was calculated after incubation at 28° C. for 1-2 days.

(58) The percentage of CFU is defined relative to the CFU obtained in the control (see FIG. 2).

Embodiment 5: The Thermal Stability of Sparamosin.SUB.26-54 .Against S. aureus and C. neoformans

(59) The thermal stability of Sparamosin.sub.26-54 was performed using S. aureus and C. neoformans. The procedure is similar to the antimicrobial assay described in Embodiment 2. The final concentration of Sparamosin.sub.26-54 was adjusted to 1×MBC (S. aureus: 12 μM, C. neoformans: 12 μM). The Sparamosin.sub.26-54 solution was heated at 100° C. for 10, 20 and 30 minutes. After cooling, Sparamosin.sub.26-54 or sterile Milli-Q water was incubated with microorganisms. Growth inhibition was evaluated by measuring absorbance value of the solution at 600 nm at 0, 12, 24, 36 and 48 h (see FIG. 3).

Embodiment 6 Determination of Cytotoxicity Effect of Synthetic Sparamosin.SUB.26-54

(60) The cytotoxicity effect of synthetic Sparamosin.sub.26-54 was evaluated using normal mouse liver cell line (AML12 cell line) and normal human liver cell line (L02 cell line).

(61) {circle around (1)} AML12 or L02 cells were harvested, and the cell concentration was adjusted to 10.sup.5 cells/mL.

(62) {circle around (2)} 100 μL of AML12 or L02 cells were seeded in 96-wells and incubated at 37° C.

(63) {circle around (3)} Cells were treated with different concentrations of Sparamosin.sub.26-54 (0, 0.1, 1, 10, 100 μg/mL) for 24 h at 37° C.

(64) {circle around (4)} Cells were treated with 20 μL of MTS-PMS reagent for another 2 hours, and then the absorbance value of each well was measured at 492 nm (see FIG. 4).