ANTI-INFLUENZA VIRUS AGENT AND SCREENING METHOD FOR ANTI-INFLUENZA VIRUS AGENT
20170290821 · 2017-10-12
Assignee
Inventors
- Yoshihiro KAWAOKA (Minato-ku, JP)
- Tokiko WATANABE (Suginami-ku, JP)
- Eiryo KAWAKAMI (Yokohama-shi, JP)
- Shinji WATANABE (Suginami-ku, JP)
Cpc classification
A61K31/519
HUMAN NECESSITIES
A61K45/00
HUMAN NECESSITIES
A61K31/473
HUMAN NECESSITIES
C12N2760/16122
CHEMISTRY; METALLURGY
C12Y207/10002
CHEMISTRY; METALLURGY
A61K31/713
HUMAN NECESSITIES
G01N33/50
PHYSICS
C12N2760/16111
CHEMISTRY; METALLURGY
C12Q1/6876
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
International classification
A61K31/473
HUMAN NECESSITIES
A61K31/519
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention provides an anti-influenza virus agent that targets biomolecules of host cells including human cells and a method of screening a candidate molecule for the anti-influenza virus agent. That is, the present invention is an anti-influenza virus agent that has an effect of suppressing expression or a function of a gene that encodes a protein having an effect of suppressing incorporation of an influenza virus vRNA or an NP protein into influenza virus-like particles in host cells and the gene is at least one selected from the group including JAK1 gene and the like.
Claims
1. An anti-influenza virus agent that has an effect of suppressing expression of a gene that encodes a protein involved in incorporation of an influenza virus vRNA or an NP protein into influenza virus-like particles in host cells or an effect of suppressing a function of the protein, wherein the gene is at least one selected from the group including JAK1 gene, CHERP gene, DDX21 gene, DNAJC11 gene, EEF1A2 gene, HNRNPK gene, ITM2B gene, MRCL3 gene, MYH10 gene, NDUFS8 gene, PSMD13 gene, RPL26 gene, SDF2L1 gene, SDF4 gene, SFRS2B gene, SNRPC gene, SQSTM1 gene, TAF15 gene, TOMM40 gene, TRM2B gene, USP9X gene, BASP1 gene, THOC2 gene, PPP6C gene, TESC gene, and PCDHB12 gene.
2. The anti-influenza virus agent according to claim 1, wherein the gene is JAK1 gene or USP9X gene.
3. The anti-influenza virus agent according to claim 1, wherein the anti-influenza virus agent is at least one selected from the group including Ruxolitinib, Tofacitinib, Tofacitinib (CP-690550) Citrate, Tyrphostin B42 (AG-490), Baricitinib (LY3009104, INCB028050), AT9283, Momelotinib, CEP33779, NVP-BSK805, ZM39923, Filgotinib, JANEX-1, NVP-BSK805, SB1317, and WPI 130.
4. An anti-influenza virus agent having an effect of suppressing expression of a gene that encodes a protein involved in influenza virus replication or transcription in host cells or an effect of suppressing a function of the protein, wherein the gene is at least one selected from the group including CCDC56 gene, CLTC gene, CYC1 gene, NIBP gene, ZC3H15 gene, C14orf173 gene, ANP32B gene, BAG3 gene, BRD8 gene, CCDC135 gene, DDX55 gene, DPM3 gene, EEF2 gene, IGF2BP2 gene, KRT14 gene, and S100A4 gene.
5. An anti-influenza virus agent having an effect of suppressing expression of a gene that encodes a protein involved in formation of influenza virus-like particles in host cells or an effect of suppressing a function of the protein, wherein the gene is at least one selected from the group including GBF1 gene, ASCC3L1 gene, BRD8 gene, C19orf43 gene, DDX55 gene, DKFZp564K142 gene, DPM3 gene, EEF2 gene, FAM73B gene, FLJ20303 gene, NCLN gene, C14orf173 gene, LRPPRC gene, and RCN1 gene.
6. The anti-influenza virus agent according to claim 5, wherein the gene is GBF1 gene.
7. The anti-influenza virus agent according to claim 5, wherein the anti-influenza virus agent is Golgicide A.
8. A screening method for an anti-influenza virus agent which is a method of screening a candidate compound for an anti-influenza virus agent, wherein a compound capable of suppressing or inhibiting expression of a gene that is at least one selected from the group including JAK1 gene, CHERP gene, DDX21 gene, DNAJC11 gene, EEF1A2 gene, HNRNPK gene, ITM2B gene, MRCL3 gene, MYH10 gene, NDUFS8 gene, PSMD13 gene, RPL26 gene, SDF2L1 gene, SDF4 gene, SFRS2B gene, SNRPC gene, SQSTM1 gene, TAF15 gene, TOMM40 gene, TRM2B gene, USP9X gene, BASP1 gene, THOC2 gene, PPP6C gene, TESC gene, PCDHB12 gene, CCDC56 gene, CLTC gene, CYC1 gene, NIBP gene, ZC3H15 gene, C14orf173 gene, ANP32B gene, BAG3 gene, BRD8 gene, CCDC135 gene, DDX55 gene, DPM3 gene, EEF2 gene, IGF2BP2 gene, KRT14 gene, S100A4 gene, GBF1 gene, ASCC3L1 gene, C19orf43 gene, DKFZp564K142 gene, FAM73B gene, FLJ20303 gene, NCLN gene, LRPPRC gene, and RCN1 gene or a function of a protein that the gene encodes is screened as the candidate compound for the anti-influenza virus agent.
9. The screening method for an anti-influenza virus agent according to claim 8, comprising: a process in which a target compound to be evaluated as a candidate compound for an anti-influenza virus agent is introduced into cells; a process in which an expression level of the gene in the cells into which the compound is introduced is measured; and a process in which, when the expression level of the gene is significantly lower than that of cells into which the compound is not yet introduced, the compound is selected as the candidate compound for the anti-influenza virus agent.
10. The screening method for an anti-influenza virus agent according to claim 8, wherein the protein that the gene encodes is an enzyme, and wherein the screening method includes a process in which enzyme activity of the protein that the gene encodes is measured under the presence of a target compound to be evaluated as a candidate compound for an anti-influenza virus agent; and a process in which, when the enzyme activity of the protein in the presence of the compound is lower than that in the absence of the compound, the compound is selected as the candidate compound for the anti-influenza virus agent.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0042]
[0043]
[0044]
DESCRIPTION OF EMBODIMENTS
<Anti-Influenza Virus Agent>
[0045] An anti-influenza virus agent according to the present invention is has an effect of suppressing expression of a gene (hereinafter referred to as an “anti-Flu gene” in some cases) encoding a host cell protein that interacts with an influenza virus protein and that, when expression in a host cell is suppressed, suppresses influenza virus replication without excessively impairing a proliferative ability of the host cell, or an effect of suppressing a function of the protein. Specific examples of the anti-Flu gene may include JAK1 gene, CHERP gene, DDX21 gene, DNAJC11 gene, EEF1A2 gene, HNRNPK gene, ITM2B gene, MRCL3 gene, MYH10 gene, NDUFS8 gene, PSMD13 gene, RPL26 gene, SDF2L1 gene, SDF4 gene, SFRS2B gene, SNRPC gene, SQSTM1 gene, TAF15 gene, TOMM40 gene, TRM2B gene, USP9X gene, BASP1 gene, THOC2 gene, PPP6C gene, TESC gene, PCDHB12 gene, CCDC56 gene, CLTC gene, CYC1 gene, NIBP gene, ZC3H15 gene, C14orf173 gene, ANP32B gene, BAGS gene, BRD8 gene, CCDC135 gene, DDX55 gene, DPM3 gene, EEF2 gene, IGF2BP2 gene, KRT14 gene, S100A4 gene, ASCC3L1 gene, C19orf43 gene, DKFZp564K142 gene, FAM73B gene, FLJ20303 gene, GBF1 gene, NCLN gene, LRPPRC gene, and RCN1 gene. As will be shown in the following examples, a protein that the anti-Flu gene encodes is a protein that directly or indirectly binds to 11 types of influenza virus proteins (PB2, PR1, PA, HA, NP, NA, M1, M2, NS1, NS2, and PR1-F2) and an interaction between them plays an important role in the influenza virus life cycle.
[0046] Among anti-Flu genes according to the present invention, JAK1 gene, CHERP gene, DDX21 gene, DNAJC11 gene, EEF1A2 gene, HNRNPK gene, ITM2B gene, MRCL3 gene, MYH10 gene, NDUFS8 gene, PSMD13 gene, RPL26 gene, SDF2L1 gene, SDF4 gene, SFRS2B gene, SNRPC gene, SQSTM1 gene, TAF15 gene, TOMM40 gene, TRM2B gene, USP9X gene, BASP1 gene, THOC2 gene, PPP6C gene, TESC gene, and PCDHB12 gene are genes that encode proteins involved in incorporation of the influenza virus vRNA or NP protein in host cells into influenza virus-like particles. Therefore, when a substance having an effect of suppressing expression of such genes or an effect of suppressing a function of a protein that the gene encodes is introduced into host cells, incorporation of the vRNA or NP protein into influenza virus-like particles in host cells is suppressed. As a result, an anti-influenza virus effect (an influenza virus replication inhibitory effect) is obtained.
[0047] Among anti-Flu genes according to the present invention, CCDC56 gene, CLTC gene, CYC1 gene, NIBP gene, ZC3H15 gene, C14orf173 gene, ANP32B gene, BAG3 gene, BRD8 gene, CCDC135 gene, DDX55 gene, DPM3 gene, EEF2 gene, IGF2BP2 gene, KRT14 gene, and S100A4 gene encode proteins involved in influenza virus replication or transcription in host cells. Therefore, when a substance having an effect of suppressing expression of such genes or an effect of suppressing a function of a protein that the gene encodes is introduced into host cells, influenza virus replication or transcription in the host cells is suppressed. As a result, an anti-influenza virus effect is obtained.
[0048] Among anti-Flu genes according to the present invention, ASCC3L1 gene, BRD8 gene, C19orf43 gene, DDX55 gene, DKFZp564K142 gene, DPM3 gene, EEF2 gene, FAM73B gene, F1120303 gene, GBF1 gene, NCLN gene, C14orf173 gene, LRPPRC gene, and RCN1 gene encode proteins involved in the formation of influenza virus-like particles in host cells. Therefore, when a substance having an effect of suppressing expression of such genes or an effect of suppressing a function of a protein that the gene encodes is introduced into host cells, the formation of influenza virus-like particles in the host cells is suppressed. As a result, an anti-influenza virus effect is obtained
[0049] As the anti-influenza virus agent according to the present invention, an agent including a substance having an effect of suppressing expression of anti-Flu genes according to the present invention as an active ingredient may be exemplified. As a substance having an effect of suppressing expression of the anti-Flu gene, for example, a small interfering RNA (siRNA), a short hairpin RNA (shRNA) or a micro RNA (miRNA) having a double-stranded structure including a sense strand and an antisense strand of a partial region (an RNA interference (RNAi) target region) of cDNA of the anti-Flu gene may be exemplified. In addition, an RNAi inducible vector through which siRNA and the like can be produced in host cells may be used. siRNA, shRNA, miRNA, and an RNAi inducible vector can be designed and prepared from base sequence information of cDNA of a target anti-Flu gene using a general method. In addition, the RNAi inducible vector can be prepared by inserting a base sequence of an RNAi target region into a base sequence of various commercially available RNAi vectors.
[0050] As the anti-influenza virus agent according to the present invention, an agent including a substance having an effect of suppressing a function (hereinafter simply referred to as a “function of the anti-Flu gene according to the present invention”) of a protein encoded by the anti-Flu gene according to the present invention as an active ingredient may be exemplified. As the substance having an effect of suppressing the function of the anti-Flu gene, like an antibody for a protein (hereinafter simply referred to as an “anti-Flu protein according to the present invention”) that an anti-Flu gene according to the present invention encodes, a substance binding to the anti-Flu protein according to the present invention and suppressing a function of the protein may be exemplified. The antibody may be a monoclonal antibody or a polyclonal antibody. In addition, the antibody may be an artificially synthesized antibody such as a chimeric antibody, a single chain antibody, and a humanized antibody. Such antibodies can be prepared using a general method.
[0051] When the anti-Flu protein according to the present invention is an enzyme, as a substance having an effect of suppressing the function of the anti-Flu gene, an inhibitor for the enzyme may be used.
[0052] As the anti-influenza virus agent according to the present invention, a substance having an effect of suppressing expression or function of one type of anti-Flu gene or a substance having an effect of suppressing expression or functions of two or more types of anti-Flu genes may be used.
[0053] As the anti-influenza virus agent according to the present invention, a substance having an effect of suppressing expression or function of at least one anti-Flu gene selected from the group including JAK1 gene, GBF1 gene, and USP9X gene is preferable, a substance having an effect of suppressing expression or function of at least one anti-Flu gene selected from the group including JAK1 gene and GBF1 gene is more preferable, and a substance having an effect of suppressing expression or function of JAK1 gene is most preferable.
[0054] As a substance having an effect of suppressing a function of JAK1 gene, JAK inhibitors such as Ruxolitinib (CAS No.: 941678-49-5) and Tofacitinib (CAS No.: 477600-75-2) may be exemplified. Ruxolitinib approved as a therapeutic agent for myelofibrosis and Tofacitinib approved as an anti-rheumatic agent are substances that can be used on the human body relatively safely. In addition, as a substance having an effect of suppressing a function of GBF1 gene, Golgicide A (CAS No.: 1005036-73-6) may be exemplified. Golgicide A can suppress influenza virus replication without influencing proliferation of host cells when a dose concentration is appropriately set.
[0055] In addition, JAK inhibitors such as Tofacitinib (CP-690550) Citrate (3-((3R,4R)-4-methyl-3-(methyl(7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino)piperidin-1-yl)-3-oxopropanenitrile), Tyrphostin B42 (AG-490) ((E)-N-benzyl-2-cyano-3-(3,4-dihydroxyphenyl)acrylamide), Baricitinib (LY3009104, INCB028050) (2-[1-ethylsulfonyl-3-[4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-pyrazol-1-yl]azetidin-3-yl]acetonitrile), AT9283 (1-cyclopropyl-3-(3-(5-(morpholinomethyl)-1H-benzo[d]imidazol-2-yl)-1H-pyrazol-4-yl) urea), Momelotinib (CYT387) (N-(cyanomethyl)-4-(2-(4-morpholinophenylamino)pyrimidin-4-yl)benzamide), CEP33779 ([1,2,4]triazolo[1,5-a]pyridin-2-amine, N-[3-(4-methyl-1-piperazinyl)phenyl]-8-[4-(methylsulfonyephenyl] NVP-BSK805 (8-(3,5-difluoro-4-(morpholinomethyl)phenyl)-2-(1-(piperidin-4-yl)-1H-pyrazol-4-yl)qui noxaline), ZM39923 (1-propanone, 3-[(1-methylethyl)(phenylmethyl)amino]-1-(2-naphthalenyl)-, hydrochloride (1:1)), Filgotinib (GLPG0634) (N-[5-[4-[(1,1-dioxido-4-thiomorpholinyl)methyl]phenyl][1,2,4]triazolo[1,5-a]pyridin-2-yl]cyclopropanccarboxamidc), JANEX-1 (4-[(6,7-dimethoxy-4-quinazolinyl)amino]-phenol), NVP-BSK805 (4-[[2, 6-difluoro-4-[3-(1-piperidin-4-ylpyrazol-4-yl)quinoxalin-5-yl]phenyl]methyl]morpholine; dihydrochloride), and SB1317 (20-oxa-5,7,14,27-tetraazatetracyclo[19.3.1.12,6.18, 12]heptacosa-1(25),2,4,6(27),8,10,12(26),16,21,23-decane,14-methyl-) may be used as the anti-influenza virus agent according to the present invention. In addition, as a substance having an effect of suppressing a function of USP9X gene, WP1130 (Degrasyn) ((2E)-3-(6-bromo-2-pyridinyl)-2-cyano-N-[1S-phenylbutyl]-2-propenamide) which is a DUB inhibitor may be exemplified.
[0056] When the substance having an effect of suppressing expression of anti-Flu genes according to the present invention is used as an active ingredient of the anti-influenza virus agent according to the present invention, an expression level of anti-Flu genes is preferably reduced by 50% or more, more preferably reduced by 75% or more, and most preferably reduced by 80% or more with respect to a case in which the anti-influenza virus agent is absent. Similarly, when the substance having an effect of suppressing the function of the anti-Flu gene is used as an active ingredient of the anti-influenza virus agent according to the present invention, the function of the anti-Flu gene is preferably degraded by 50% or more, more preferably degraded by 75% or more, and most preferably degraded by 80% or more with respect to a case in which the anti-influenza virus agent is absent.
[0057] The anti-influenza virus agent according to the present invention can be used for preventing influenza virus infection in animals and treating animals infected with an influenza virus. As animals into which the anti-influenza virus agent according to the present invention is introduced to prevent influenza virus infection or treat influenza, mammals such as humans, monkeys, pigs, horses, dogs, cats, and tigers, and birds such as chickens, ducks, quails, geese, ducks, turkeys, budgerigars, parrots, mandarin ducks, and swans may be exemplified. As the anti-influenza virus agent according to the present invention, a substance for preventing influenza virus infection in humans and treating animals infected with an influenza virus is preferable.
[0058] An influenza treatment is performed by administering an effective amount of the anti-influenza virus agent according to the present invention to animals infected with an influenza virus or animals in which prevention of an influenza virus infection is needed. An effective amount of the anti-influenza virus agent may be an amount at which an amount of influenza viruses is reduced in animals to which the agent is administered than animals to which the agent is not administered, or an amount at which influenza virus infection can be prevented. In addition, an effective amount of the anti-influenza virus agent is preferably an amount at which no serious side effects are caused by the anti-influenza virus agent. An effective amount of the anti-influenza virus agents can be calculated experimentally in consideration of a type of the anti-influenza virus agent, a type of an administration target animal, an administration method and the like. For example, when the agent is administered to a laboratory animal infected with an influenza virus, an amount at which an amount of influenza viruses in the body of the laboratory animal can be 70% or less, preferably 80% or less and more preferably 90% or less in PFU with respect to a laboratory animal to which the agent is not administered can be defined as an effective amount.
[0059] The anti-influenza virus agent according to the present invention can be formulated into dosage forms suitable for various administration forms such as oral administration, intravenous injection, direct administration into a nasal cavity or a buccal cavity, and transdermal administration using a general method. As the dosage form, a tablet, a powder, granules, a capsule, a chewable tablet, a syrup, a solution, a suspension, an injectable solution, a gargle, a spray, a patch, and an ointment may be exemplified.
[0060] The anti-influenza virus agent according to the present invention may include various additives in addition to the substance having an effect of suppressing expression or function of the anti-Flu gene. As the additive, an excipient, a binder, a lubricant, a wetting agent, a solvent, a disintegrant, a solubilizing agent, a suspending agent, an emulsifier, an isotonizing agent, a stabilizer, a buffering agent, a preservative agent, an antioxidant agent, a flavoring agent, and a colorant may be exemplified. Among additives that are pharmaceutically acceptable substances and used for pharmaceutical formulation, an appropriate additive can be selected and used.
<Screening Method for an Anti-Influenza Virus Agent>
[0061] A screening method for an anti-influenza virus agent according to the present invention (hereinafter referred to as a “screening method according to the present invention” in some cases) is a method of screening a candidate compound for an anti-influenza virus agent. The method includes screening a candidate compound capable of suppressing or inhibiting expression or the function of the anti-Flu gene according to the present invention as a candidate compound for the anti-influenza virus agent. The screening method according to the present invention may be a method of screening a substance capable of suppressing or inhibiting expression or a function of one type of anti-Flu genes or a method of screening a substance capable of suppressing or inhibiting expression or functions of two or more types of anti-Flu genes.
[0062] Specifically, screening of a substance capable of suppressing or inhibiting expression of anti-Flu genes is performed such that a target compound to be evaluated as a candidate compound for the anti-influenza virus agent is first introduced into cells and it is examined whether expression of anti-Flu genes is suppressed. When expression of anti-Flu genes is significantly suppressed, the compound is selected as the candidate compound for the anti-influenza virus agent. That is, a process in which a target compound to be evaluated as a candidate compound for the anti-influenza virus agent is introduced into cells, a process in which an expression level of anti-Flu genes in the cells into which the compound is introduced is measured, and a process in which, when an expression level of the anti-Flu genes is significantly lower than an expression level of the anti-Flu genes in cells into which the compound is not yet introduced, the compound is selected as the candidate compound for the anti-influenza virus agent are performed.
[0063] Cells used in screening are preferably cells of organism species serving as hosts of an influenza virus. In consideration of the convenience of handling, cultured cell lines of mammals and birds are more preferable, and cultured cell lines of a human are most preferable. In addition, the evaluation target compound can be introduced into cells using an electroporation method, a lipofection method, a calcium phosphate method and the like. When the evaluation target compound is a low molecular compound, the compound is added to a culture solution, and thus the compound can be introduced into cells.
[0064] A change in the expression level of anti-Flu genes may be evaluated at the level of mRNA or may be evaluated at the level of protein. For example, it is possible to quantitatively compare an expression level of anti-Flu genes by using a nucleic acid amplification reaction of an RT-PCR method and the like or through an immunohistochemical method or Western blotting. Specifically, for example, PCR in which the full length or a part of cDNA of anti-Flu genes is amplified by using cDNA as a template synthesized by a reverse transcription reaction from RNA extracted from cells cultured for 1 to 2 days while the evaluation target compound is introduced is performed. When an amount of the obtained amplified product is significantly lower than an amount of an amplified product obtained in the same manner from cells into which the compound is not yet introduced, it is evaluated that the compound can suppress or inhibit expression of anti-Flu genes. In addition, for example, anti-Flu proteins in cells cultured for 1 to 2 days while the evaluation target compound is introduced and in cells into which the compound is not yet introduced, are stained using fluorescent-labeled antibodies, and fluorescence intensities of each cell are compared. When a fluorescence intensity per cell of cells into which the compound is introduced is significantly lower than that of cells into which the compound is not introduced, it is evaluated that the compound is capable of suppressing or inhibiting expression of anti-Flu genes. In addition, for example, cell extract liquids (lysates) of cells cultured for 1 to 2 days while the evaluation target compound is introduced and of cells into which the compound is not yet introduced are subjected to electrophoresis, separated, and then transcribed to membranes. Anti-Flu protein bands on the membranes are stained using fluorescent-labeled antibodies and fluorescence intensities of the bands are compared. When a fluorescence intensity of the anti-Flu protein band derived from the cells into which the compound is introduced is significantly lower than that derived from the cells into which the compound is not introduced, it is evaluated that the compound is capable of suppressing or inhibiting expression of anti-Flu genes.
[0065] When a function of the anti-Flu protein is an interaction with a specific biomolecule, for example, when a binding assay of the anti-Flu protein and the specific biomolecule is performed in the presence and absence of the evaluation target compound, and a connectivity between the anti-Flu protein and the specific biomolecule in the presence of the evaluation target compound is lower than that in the absence of the evaluation target compound, it is evaluated that the compound is capable of suppressing or inhibiting the function of the anti-Flu gene. In addition, when the anti-Flu protein is an enzyme, for example, when enzyme activity of the anti-Flu protein is measured in the presence and absence of the evaluation target compound and the enzyme activity of the anti-Flu protein in the presence of the evaluation target compound is lower than that in the absence of the evaluation target compound, it is evaluated that the compound is capable of suppressing or inhibiting the function of the anti-Flu gene.
EXAMPLES
[0066] Next, the present invention will be described in further detail with reference to examples but the present invention is not limited to the following examples.
<Cell Culture>
[0067] In the following examples, HEK293 cells and A549 cells (derived from human lung epithelial cells) were cultured in a DMEM medium (commercially available from Sigma Aldrich) containing 10% fetal calf serum (FCS) and antibiotics under a 5% carbon dioxide atmosphere at 37° C. Madin-Darby canine kidney (MDCK) cells were cultured in a 5% newborn calf serum (NCS)-containing Eagle's minimum essential medium (Eagle's MEM) (commercially available from GIBCO) under a 5% carbon dioxide atmosphere at 37° C.
<Influenza Viruses>
[0068] Influenza viruses used in the following examples were A type influenza viruses (A/WSN/33, HIN1 subtype; WSN) unless otherwise described. The viruses were human-derived influenza viruses adapted to mice, prepared by a method (refer to Non Patent Literature 7) using reverse genetics, and propagated in MDCK cells. In addition, virus titers were measured by a plaque assay using MDCK cells (refer to Non Patent Literature 8).
[0069] PB2-KO/Rluc viruses (PB2 knockout viruses possessing a firefly luciferase gene) were replication-incompetent viruses and include a reporter gene encoding Renilla luciferase in a coding region of polymerase PB2 protein. PB2-KO/Rluc viruses were generated with pPolIPB2(120)Rluc(120) (a plasmid encoding Renilla luciferase flanked by 120 120 N- and C-terminal nucleotides derived from the PB2 segment) and a plasmid encoding the remaining seven viral RNA segments. PB2-KO/Rluc viruses were propagated and titers thereof were measured in MDCK cells stably expressing the PB2 protein (refer to Non Patent Literature 9).
<Antibodies>
[0070] Mouse anti-HA antibody (WS3-54), mouse anti-NA antibody (WS5-29), and mouse anti-M1 antibody (WS-27/52) used in the following example provided from National Institute of Infectious Diseases (chief researcher Emi Takashita) were used. Mouse anti-Aichi NP antibody (2S-347/3) and rabbit anti-WSN virus antibody (R309) prepared by the inventors using a general method were used. Anti β-actin (AC-74) antibody purchased from Sigma Aldrich were used.
Example 1
[0071] <Identification of Host Proteins that Interact with Influenza Virus Proteins>
[0072] First, the inventors identified host proteins that interacted with influenza virus proteins using an immunoprecipitation method.
[0073] Specifically, first, a plasmid encoding a Flag fusion protein in which Flag tag was fused to the N-terminus or the C-terminus for 11 types of influenza virus proteins (PB2, PB1, PA, HA, NP, NA, M1, M2, NS1, NS2, and PB1-F2) was transfected into HEK293 cells, respectively. Transfection was performed using a TransiT 293 reagent (commercially available from Mirus Bio Corp.). Cells cultured for 24 hours after the transfection were mixed in a cell lysis buffer (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40, protease inhibitor mixture Complete Mini (Roche, Mannheim, Germany)), incubated at 4° C. for 1 hour, and lysed to obtain a lysate. A supernatant collected by centrifuging the obtained lysate was added to an affinity gel (anti-FLAG M2 Affinity Gel commercially available from Sigma Aldrich) to which anti-Flag antibodies were bound and incubated at 4° C. for 18 hours. Then, the affinity gel was washed three times with cell lysis buffer, then washed twice with an immunoprecipitation (IP) buffer (50 mM Tris-HCl (pH 7.5) 150 mM NaCl, 1 mM EDTA), and was stirred with an IP buffer containing 0.5 mg/mL of FLAG peptides (F1804, commercially available from Sigma Aldrich) at 4° C. for 2 hours. Then, the affinity gel was removed through centrifugation and a supernatant was collected.
[0074] The collected supernatant was filtrated through an Ultrafree-MC filter (commercially available from Merck Millipore Corporation), and then the contained protein was identified through nano LC-MS/MS (nanoflow liquid chromatography tandem mass spectrometry) analysis. Q-STAR Elite (commercially available from AB SCIEX) coupled with Dina (commercially available from KYA technologies corporation) was used to analyze the mass spectrometry data. Co-immunoprecipitated proteins of HEK293 cells (host cells) were identified by comparing the obtained MS/MS signal with RefSeq (human protein database of National Center for Biotechnology Information). For this comparison, Mascot algorithm (version 2.2.04; commercially available from Matrix Science) was used under the following conditions: variable modifications, oxidation (Met), N-acetylation; maximum missed cleavages, 2; peptide mass tolerance, 200 ppm; MS/MS tolerance, 0.5 Da.). Protein identification required at least one MS/MS signal with a Mascot score that exceeded significantly the threshold value.
[0075] As a result, 388 host proteins were co-immunoprecipitated with PB2 proteins, 322 host proteins were co-immunoprecipitated with PB1 proteins, 304 host proteins were co-immunoprecipitated with PA proteins, 351 host proteins were co-immunoprecipitated with HA proteins, 574 host proteins were co-immunoprecipitated with NP proteins, 675 host proteins were co-immunoprecipitated with NA proteins, 659 host proteins were co-immunoprecipitated with M1 proteins, 531 host proteins were co-immunoprecipitated with M2 proteins, 113 host proteins were co-immunoprecipitated with NS1 proteins, 42 host proteins were co-immunoprecipitated with NS2 proteins, and 81 host proteins were co-immunoprecipitated with PB1-F2 proteins. That is, a total of 1292 host proteins were co-immunoprecipitated with any of 11 types of influenza virus proteins.
<siRNA>
[0076] Next, RNA interference was performed on genes that encoded the 1292 host proteins identified by immunoprecipitation and it was examined whether these proteins were actually involved in influenza virus replication. 2 types of siRNA were selected from genome-wide Human siRNA Libraries (FlexiTube siRNA; commercially available from Qiagen) for host genes and used. In addition, AllStars Negative Control siRNA (commercially available from Qiagen) (a control siRNA) was used as a negative control. In addition, siRNA (GGA UCU UAU UUC UUC GGA GUU) of NP genes of WSN virus was purchased from Sigma Aldrich.
[0077] Specifically, first, an RNAiMAX Reagent (commercially available from Invitrogen) was used to transfect 2 types of siRNA into HEK293 cells at 25 nM (final concentration: 50 nM) twice.
<Cell Viability>
[0078] Viability of cells 24 hours after the second transfection of siRNA was determined according to the appended instructions of CellTiter-Glo assay system (commercially available from Promega Corporation). The ratio of the number of living cells among cells into which each siRNA was introduced to the number of living cells among cells into which the control siRNA was introduced was calculated as cell viability (%).
<qRT-PCR>
[0079] Quantitative reverse transcription-PCR (qRT-PCR) was performed on cells before transfection of siRNA and cells 48 hours after transfection and it was confirmed whether expression of target host genes was suppressed due to siRNA.
[0080] Specifically, first, in the same manner as in the above <siRNA>, siRNA was transfected into HEK293 cells and cells 48 hours after the second transfection were lysed in the cell lysis buffer to prepare a lysate. Total RNA was extracted from the prepared lysate using the Maxwell 16 LEV simply RNA Tissue Kit (commercially available from Promega Corporation). A reverse transcription reaction was performed using ReverTra Ace qPCR RT Master Mix (commercially available from Toyobo Co., Ltd.) or SuperScript III Reverse Transcriptase (commercially available from Invitrogen) using the total RNA as a template. Using the synthesized cDNA as a template, a primer set specific to each host gene and THUNDERBIRD SYBR qPCR Mix (commercially available from Toyobo Co., Ltd.) were used to perform quantitative PCR. The relative mRNA expression levels of each host gene were calculated by the ΔΔCt method using β-actin as internal control. The ratio of an mRNA expression level in cells into which each siRNA was introduced to an mRNA expression level in cells into which the control siRNA was introduced was calculated as a knockdown efficiency (%).
<Replicative Competence of Virus>
[0081] In the same manner as in <siRNA>, in two 24-well dishes, siRNA was transfected into HEK293 cells, and the cells after the second transfection were infected with an influenza virus of 50 pfu (plaque-forming units). A culture supernatant was collected 48 hours after the viral infection and virus titers were examined through a plaque assay using MDCK cells. A value obtained by dividing a common logarithmic value of a virus titer in cells into which each siRNA was introduced by a common logarithmic value of a virus titer in cells into which the control siRNA was introduced was calculated as an amount of change in virus titer.
[0082] As a result, in 323 host genes, gene expression levels were reduced due to transfection of siRNA. Among the 323 host genes, in 299 host genes, an influenza virus titer was reduced by a common logarithmic value of 2 or more (that is, an amount of change in virus titer-2 or more), and in 24 host genes, an influenza virus titer was increased by a common logarithmic value of 1 or more (that is, an amount of change in virus titer was 1 or more). In the following 91 host genes among the host genes, although cell viability of host cells remained at 80% or more, an influenza virus titer was reduced by a common logarithmic value of 3 or more, and thus they were indicated to be useful as a target of the anti-influenza virus agent: ANP32B gene, AP2A2 gene, ASCC3L1 gene, ATP5O gene, BAG3 gene, BASP1 gene, BRD8 gene, BUB3 gene, C14orf173 gene, C19orf43 gene, CAPRIN1 gene, CCDC135 gene, CCDC56 gene, CHERP gene, CIRBP gene, CLTC gene, CNOT1 gene, CTNNB1 gene, CYC1 gene, DDX21 gene, DDX55 gene, DKFZp564K142 gene, DNAJC11 gene, DPM3 gene, EEFIA2 gene, EEF2 gene, FAM73B gene, F1120303 gene, GBF1 gene, GEMIN4 gene, HNRNPK gene, IARS gene, IGF2BP2 gene, ITGA3 gene, ITGB4BP gene, ITM2B gene, JAK1 gene, KIAA0664 gene, KRT14 gene, LRPPRC gene, MRCL3 gene, MYH10 gene, NCAPD3 gene, NCLN gene, NDUFAIO gene, NDUFS8 gene, NFIA gene, NIBP gene, NUP160 gene, NUP205 gene, PCDHB12 gene, PHB gene, PPP6C gene, PSMA4 gene, PSMA5 gene, PSMB2 gene, PSMC1 gene, PSMC4 gene, PSMC6 gene, PSMD11 gene, PSMD12 gene, PSMD13 gene, PSMD14 gene, PSMD2 gene, PSMD6 gene, RCN1 gene, RPL26 gene, S100A4 gene, SAMHD1 gene, SDF2L1 gene, SDF4 gene, SF3A2 gene, SF3B2 gene, SF3B4 gene, SFRS10 gene, SFRS2B gene, SNRP70 gene, SNRPC gene, SNRPD3 gene, SQSTM1 gene, STK38 gene, TAF15 gene, TESC gene, THOC2 gene, TOMM40 gene, TRIM28 gene, UAP1 gene, USP9X gene, VCP gene, XPO1 gene, and ZC3H15 gene.
[0083] The amount of change in virus titer, the cell viability (%), and the knockdown efficiency (%) of the 91 host genes are shown in Tables 1 to 3.
TABLE-US-00001 TABLE 1 Amount of Cell Knockdown change in viabil- efficien- Gene name Gene ID virus titer ity (%) cy (%) ANP32B 10541 −4.65 99.45 1.56 AP2A2 161 −3.18 95.81 6.28 ASCC3L1 23020 −3.08 96.11 2.91 ATP5O 539 −3.74 82.96 13.09 BAG3 9531 −4.11 103.25 5.07 BASP1 10409 −3.51 107.98 40.30 BRD8 10902 −4.86 114.74 48.14 BUB3 9184 −3.28 97.88 9.68 C14orf173 64423 −3.01 87.95 14.83 C19orf43 79002 −4.18 108.05 8.39 CAPRIN1 4076 −4.83 97.06 5.98 CCDC135 84229 −4.13 114.76 2.24 CCDC56 28958 −3.45 101.34 33.50 CHERP 10523 −4.63 103.63 17.74 CIRBP 1153 −3.07 114.17 10.46 CLTC 1213 −3.11 95.80 4.45 CNOT1 23019 −3.02 119.11 6.63 CTNNB1 1499 −3.55 115.53 1.73 CYC1 1537 −3.66 94.25 3.10 DDX21 9188 −3.52 99.20 11.33 DDX55 57696 −3.37 97.39 24.07 DKFZp564K142 84061 −3.11 95.17 1.20 DNAJC11 55735 −3.14 96.26 35.77 DPM3 54344 −4.16 85.79 1.41 EEF1A2 1917 −3.15 91.40 1.67 EEF2 1938 −3.41 110.44 3.80 FAM73B 84895 −3.79 111.63 0.12 FLJ20303 54888 −3.68 103.10 46.80 GBF1 8729 −5.06 109.48 9.48 GEMIN4 50628 −3.00 85.59 41.30
TABLE-US-00002 TABLE 2 Amount of Cell Knockdown change in viabil- efficien- Gene name Gene ID virus titer ity (%) cy (%) HNRNPK 3190 −4.99 113.48 1.12 IARS 3376 −3.17 103.38 8.00 IGF2BP2 10644 −3.30 89.82 6.61 ITGA3 3675 −3.38 92.90 8.68 ITGB4BP 3692 −3.27 81.34 26.05 ITM2B 9445 −3.23 100.15 0.68 JAK1 3716 −5.10 80.07 1.94 KIAA0664 23277 −3.82 91.33 12.35 KRT14 3861 −3.66 108.94 17.36 LRPPRC 10128 −4.16 108.87 8.33 MRCL3 10627 −3.11 92.84 2.00 MYH10 4628 −3.57 89.49 7.05 NCAPD3 23310 −3.14 87.57 30.04 NCLN 56926 −3.38 90.16 3.79 NDUFA10 4705 −3.52 103.54 9.75 NDUFS8 4728 −3.49 92.94 1.38 NFIA 4774 −4.34 98.05 3.00 NIBP 83696 −3.59 98.42 8.65 NUP160 23279 −3.77 98.13 47.25 NUP205 23165 −4.71 91.59 27.45 PCDHB12 56124 −3.66 110.37 35.50 PHB 5245 −5.89 86.57 1.56 PPP6C 5537 −4.84 104.25 5.65 PSMA4 5685 −3.03 101.54 11.10 PSMA5 5686 −4.01 103.75 4.66 PSMB2 5690 −3.14 86.44 1.92 PSMC1 5700 −4.02 80.49 15.81 PSMC4 5704 −4.52 90.10 27.87 PSMC6 5706 −4.77 94.29 17.43 PSMD11 5717 −5.16 86.58 10.03
TABLE-US-00003 TABLE 3 Amount of Cell Knockdown change in viabil- efficien- Gene name Gene ID virus titer ity (%) cy (%) PSMD12 5718 −3.41 109.54 8.30 PSMD13 5719 −3.28 102.30 6.80 PSMD14 10213 −4.09 83.53 15.39 PSMD2 5708 −3.66 83.48 14.71 PSMD6 9861 −3.91 81.82 17.91 RCN1 5954 −3.08 83.94 3.42 RPL26 6154 −3.14 89.03 9.93 S100A4 6275 −3.66 106.05 45.83 SAMHD1 25939 −3.48 101.14 34.03 SDF2L1 23753 −4.45 91.54 0.82 SDF4 51150 −3.44 92.11 6.35 SF3A2 8175 −3.13 89.26 16.05 SF3B2 10992 −3.06 82.55 17.71 SF3B4 10262 −4.33 102.63 5.89 SFRS10 6434 −4.92 105.62 32.28 SFRS2B 10929 −3.25 94.42 29.98 SNRP70 6625 −3.30 83.21 7.73 SNRPC 6631 −3.23 110.27 2.95 SNRPD3 6634 −4.02 82.34 0.83 SQSTM1 8878 −3.41 99.11 18.46 STK38 11329 −4.63 93.74 1.93 TAF15 8148 −3.65 106.52 0.72 TESC 54997 −4.34 104.88 8.30 THOC2 57187 −4.39 123.42 7.04 TOMM40 10452 −3.33 108.53 2.04 TRIM28 10155 −3.58 98.94 12.60 UAP1 6675 −3.01 106.91 44.47 USP9X 8239 −3.37 112.88 14.23 VCP 7415 −3.11 86.85 5.14 XPO1 7514 −4.91 102.74 17.20 ZC3H15 55854 −5.28 98.39 4.03
<Influence on Intracellular Protein Synthesis>
[0084] It was examined whether suppression of expression of these 91 host genes influenced intracellular protein synthesis.
[0085] Specifically, in the same manner as in <siRNA>, siRNA was transfected into HEK293 cells and a plasmid for expressing Renilla luciferase under control of an RNA Polymerase II promotor (for example, chicken β-actin promotor) that functioned within a cell was used as a control in cells 24 hours after the second transfection.
[0086] A luciferase assay was performed on cells 48 hours after the transfection using a Renilla Luciferase Assay System (commercially available from Promega Corporation). Luciferase activity was measured using the GloMax-96 Microplate Luminometer (commercially available from Promega Corporation).
[0087] The ratio of Renilla luciferase activity of cells into which each siRNA was introduced to Renilla luciferase activity of cells into which the control siRNA was introduced was calculated as a synthesis efficiency (%) of the intracellular protein. The calculated synthesis efficiency (%) of the intracellular proteins is shown in Table 4. As a result, firefly luciferase activity in cells into which siRNA of 28 host genes (ATP5O gene, CNOT1 gene, GEMIN4 gene, ITGB4BP gene, NCAPD3 gene, NUP160 gene, NUP205 gene, PSMA4 gene, PSMA5 gene, PSMB2 gene, PSMC1 gene, PSMC4 gene, PSMD11 gene, PSMD2 gene, PSMD6 gene, SF3A2 gene, SF3B4 gene, SNRPD3 gene, VCP gene, PSMC6 gene, PSMD12 gene, PSMD14 gene, SAMHD1 gene, SF3B2 gene, SNRP70 gene, CAPRIN1 gene, PHB gene, and SFRS10 gene) among the 91 host genes was introduced was decreased 80% or more (p<0.05) compared to that of cells into which the control siRNA was introduced. The results indicate that these host genes were involved in transcription and translation in host cells, and transcription and translation of an influenza virus were suppressed and influenza virus replication was inhibited by decreasing expression of these host genes.
TABLE-US-00004 TABLE 4 Synthesis efficiency (%) of host proteins Gene name Activity (%) AP2A2 75.11 ASCC3L1 65.37 ATP5O 2.79 BAG3 72.00 BRD8 146.60 BUB3 50.58 C19orf43 101.04 CCDC135 72.77 CCDC56 112.47 CHERP 172.80 CIRBP 69.48 CLTC 22.74 CNOT1 10.93 CYC1 48.89 DDX21 92.65 DDX55 38.81 DKFZp564K142 116.60 DNAJC11 89.91 DPM3 22.56 EEF1A2 89.30 EEF2 67.89 FAM73B 47.30 FLJ20303 39.03 GBF1 67.13 GEMIN4 12.89 HNRNPK 105.55 IARS 114.19 IGF2BP2 151.66 ITGA3 212.86 ITGB4BP 9.07 ITM2B 137.49 KIAA0664 60.55 KRT14 26.22 MRCL3 134.23 MYH10 96.54 NCAPD3 4.02 NCLN 135.47 NDUFS8 88.55 NIBP 135.35 NUP160 9.04 NUP205 3.97 PSMA4 10.32 PSMA5 4.23 PSMB2 1.47 PSMC1 6.49 PSMC4 3.33 PSMD11 1.82 PSMD13 23.75 PSMD2 1.55 PSMD6 0.30 RPL26 32.18 S100A4 109.39 SDF2L1 40.47 SDF4 116.39 SF3A2 2.81 SF3B4 2.77 SFRS2B 112.74 SNRPC 87.85 SNRPD3 5.34 SQSTM1 34.14 TAF15 192.11 TOMM40 125.32 TRIM28 37.64 UAP1 80.46 USP9X 202.02 VCP 2.27 ZC3H15 71.50 BASP1 84.14 C14orf173 77.71 CTNNB1 164.22 PSMC6 9.36 PSMD12 3.67 PSMD14 0.95 SAMHD1 10.13 SF3B2 1.99 SNRP70 4.52 THOC2 22.91 XPO1 20.42 ANP32B 45.32 CAPRIN1 5.42 LRPPRC 24.48 NFIA 54.13 PHB 8.83 PPP6C 39.93 SFRS10 10.82 STK38 34.02 TESC 30.75 JAK1 83.80 PCDHB12 77.64 NDUFA10 102.53 RCN1 40.47
<Mini-Replicon Assay>
[0088] Determination of whether the 91 host genes were involved in virus genome replication and transcription was examined using a mini-replicon assay (refer to Non Patent Literature 10) through which the activity of the influenza viral RNA Polymerase was examined. More specifically, the mini-replicon assay is an assay in which the activity of the viral replication complex (the complex containing the PB2 protein, the PB1 protein, the PA protein, and the NP protein) is examined based on replicative activity of virus-like RNA encoding a firefly luciferase reporter protein.
[0089] Specifically, in the same manner as in <siRNA>, siRNA was transfected into HEK293 cells and a plasmid for expressing the PA, a plasmid for expressing the PB1, a plasmid for expressing the PB2, a plasmid for expressing the NP, and a plasmid (pPolINP(0)luc2(0)) for expressing the virus-like RNA that encoding firefly luciferase were transfected into cells 24 hours after the second transfection. Also, the plasmid for expressing the PA, PB1, PB2 or NP was obtained by integrating cDNA that encodes each protein in a multi cloning site of plasmid pCAGGS. In addition, a plasmid for expressing Renilla luciferase under control of an RNA Polymerase II promotor (for example, a chicken β-actin promotor) that functions within a host cell was used as a control.
[0090] A luciferase assay was performed on cells 48 hours after the transfection using the Dual-Glo Luciferase assay system (commercially available from Promega Corporation). Luciferase activity was measured using the GloMax-96 Microplate Luminometer (commercially available from Promega Corporation). Virus RNA Polymerase activity was calculated as firefly luciferase activity that was normalized by Renilla luciferase activity.
[0091] The ratio of firefly luciferase activity of cells into which each siRNA was introduced to firefly luciferase activity of cells into which the control siRNA was introduced was calculated as viral polymerase activity (%). This viral polymerase activity indicates an expression level of the firefly luciferase reporter protein and is an indicator of efficiency of virus genome replication and transcription. The calculated viral polymerase activity (%) is shown in Table 5. As a result, viral polymerase activity in cells into which siRNA of 9 host genes (BUB3 gene, CCDC56 gene, CLTC gene, CYC1 gene, NIBP gene, ZC3H15 gene, C14orf173 gene, CTNNB1 gene, and ANP32B gene) among the 91 host genes was introduced, that is, virus genome replication and transcription, was decreased 50% or more (p<0.05) compared to that of cells into which the control siRNA was introduced. The results indicate that these host genes were involved in virus genome replication and transcription and genome replication and transcription of an influenza virus were suppressed by decreasing expression of these host genes.
TABLE-US-00005 TABLE 5 Viral polymerase activity (%) Gene name Activity (%) AP2A2 137.72 ASCC3L1 55.38 ATP5O 87.21 BAG3 212.58 BRD8 134.18 BUB3 29.86 C19orf43 60.22 CCDC135 164.75 CCDC56 35.89 CHERP 50.76 CIRBP 125.42 CLTC 21.45 CNOT1 122.58 CYC1 39.77 DDX21 227.00 DDX55 243.36 DKFZp564K142 73.46 DNAJC11 115.60 DPM3 166.79 EEF1A2 120.27 EEF2 56.88 FAM73B 148.67 FLJ20303 73.70 GBF1 218.22 GEMIN4 80.46 HNRNPK 220.87 IARS 119.39 IGF2BP2 96.58 ITGA3 57.93 ITGB4BP 142.67 ITM2B 136.82 KIAA0664 125.03 KRT14 126.87 MRCL3 82.07 MYH10 133.56 NCAPD3 75.26 NCLN 67.85 NDUFS8 62.68 NIBP 32.54 NUP160 161.95 NUP205 185.48 PSMA4 78.06 PSMA5 152.59 PSMB2 186.22 PSMC1 60.30 PSMC4 123.01 PSMD11 105.10 PSMD13 87.38 PSMD2 168.78 PSMD6 165.82 RPL26 75.28 S100A4 108.15 SDF2L1 76.28 SDF4 60.57 SF3A2 395.26 SF3B4 139.22 SFRS2B 67.87 SNRPC 134.40 SNRPD3 173.08 SQSTM1 136.86 TAF15 60.96 TOMM40 221.22 TRIM28 113.41 UAP1 83.45 USP9X 179.66 VCP 132.26 ZC3H15 16.67 BASP1 65.72 C14orf173 31.32 CTNNB1 41.41 PSMC6 68.22 PSMD12 83.21 PSMD14 135.56 SAMHD1 112.95 SF3B2 89.83 SNRP70 116.15 THOC2 432.48 XPO1 345.49 ANP32B 20.97 CAPRIN1 240.52 LRPPRC 99.80 NFIA 103.74 PHB 482.29 PPP6C 337.17 SFRS10 143.36 STK38 181.90 TESC 113.84 JAK1 170.25 PCDHB12 230.68 NDUFA10 135.21 RCN1 228.41
<PB2-KO/Rluc Virus Assay>
[0092] In order to examine whether the 91 host genes were involved at an early stage of the virus life cycle, a PB2-KO/Rluc virus assay was performed and virus invasion efficiency was examined.
[0093] Specifically, in the same manner as in <siRNA>, siRNA was transfected into HEK293 cells and PB2-KO/Rluc virus was infected into cells 24 hours after the second transfection. A luciferase assay was performed on cells 8 hours after the infection using a Renilla luciferase assay system (commercially available from Promega Corporation). Fluorescence was measured using the GloMax-96 Microplate Luminometer (commercially available from Promega Corporation).
[0094] A ratio of Renilla luciferase activity of cells into which each siRNA was introduced to Renilla luciferase activity of cells into which the control siRNA was introduced was calculated as virus invasion efficiency (%). The calculated virus invasion efficiency (%) is shown in Table 6. As a result, virus invasion efficiency of 23 host genes (SF3A2 gene, GEMIN4 gene, SFRS10 gene, BAG3 gene, CAPRIN1 gene, CCDC135 gene, IGF2BP2 gene, KRT14 gene, ATP5O gene, SAMHD1 gene, PSMD6 gene, BRD8 gene, PSMD11 gene, SF3B2 gene, SF3B4 gene, DPM3 gene, NCAPD3 gene, EEF2 gene, PHB gene, NUP205 gene, S100A4 gene, PSMD14 gene, and DDX55 gene) among the 91 host genes was decreased 50% or more (p<0.05) compared to that of cells into which the control siRNA was introduced. The results indicate that these host genes were involved in invasion of an influenza virus into host cells, and invasion of an influenza virus into host cells and influenza virus replication were inhibited by decreasing expression of these host genes.
TABLE-US-00006 TABLE 6 Virus invasion efficiency (%) Gene name Activity (%) AP2A2 105.13 ASCC3L1 127.45 ATP5O 32.22 BAG3 26.26 BRD8 36.25 BUB3 111.12 C19orf43 72.52 CCDC135 26.41 CCDC56 135.37 CHERP 152.40 CIRBP 81.17 CLTC 130.96 CNOT1 99.07 CYC1 208.99 DDX21 152.99 DDX55 41.36 DKFZp564K142 61.95 DNAJC11 89.42 DPM3 37.04 EEF1A2 118.58 EEF2 37.31 FAM73B 72.07 FLJ20303 171.60 GBF1 110.84 GEMIN4 19.22 HNRNPK 89.22 IARS 122.66 IGF2BP2 27.46 ITGA3 148.66 ITGB4BP 58.65 ITM2B 84.31 KIAA0664 368.93 KRT14 29.12 MRCL3 66.72 MYH10 127.85 NCAPD3 37.22 NCLN 102.04 NDUFS8 89.39 NIBP 157.58 NUP160 78.57 NUP205 38.39 PSMA4 141.94 PSMA5 61.95 PSMB2 58.19 PSMC1 170.15 PSMC4 111.62 PSMD11 36.26 PSMD13 128.58 PSMD2 122.48 PSMD6 35.49 RPL26 53.03 S100A4 40.97 SDF2L1 87.44 SDF4 111.77 SF3A2 16.50 SF3B4 36.86 SFRS2B 62.16 SNRPC 192.30 SNRPD3 189.24 SQSTM1 70.37 TAF15 182.19 TOMM40 74.91 TRIM28 57.02 UAP1 101.45 USP9X 69.50 VCP 139.02 ZC3H15 61.72 BASP1 81.97 C14orf173 52.52 CTNNB1 107.63 PSMC6 72.44 PSMD12 70.67 PSMD14 41.13 SAMHD1 34.45 SF3B2 36.43 SNRP70 79.70 THOC2 74.46 XPO1 56.05 ANP32B 77.65 CAPRIN1 26.29 LRPPRC 117.05 NFIA 143.19 PHB 37.52 PPP6C 50.69 SFRS10 26.23 STK38 90.17 TESC 91.50 JAK1 234.62 PCDHB12 80.80 NDUFA10 58.58 RCN1 89.00
[0095] In addition, it was found that, among these 23 host genes, 9 host genes (BAG3 gene, BRD8 gene, CCDC135 gene, DDX55 gene, DPM3 gene, EEF2 gene, IGF2BP2 gene, KRT14 gene, and S100A4 gene) were not involved in transcription and translation of host cells and were specifically involved in transcription and translation of an influenza virus. In addition, in these 9 host genes, influenza virus replication inhibitory activity was not confirmed in the mini-replicon assay. Therefore, the results indicate that these host genes played important roles at the early stage of the virus life cycle such as binding of viruses into surfaces of host cells, incorporation into host cells, and transition of a viral ribonucleoprotein (vRNP) complex into the nucleus.
<VLP Formation Assay>
[0096] Determination of whether the 91 host genes were involved in virus particle formation was examined through a virus-like particle (VLP) formation assay.
[0097] Specifically, in the same manner as in <siRNA>, in HEK293 cells transfected with siRNA, a plasmid for expressing the HA, a plasmid for expressing the NA, and a plasmid for expressing the M1 were transfected using a TransIT293 transfection reagent (commercially available from Mirus). Also, the plasmid for expressing the HA, NA, or M1 was obtained by integrating cDNA that encodes each protein in a multi cloning site of plasmid pCAGGS.
[0098] Cells 48 hours after the plasmid transfection were lysed in an SDS sample buffer solution (commercially available from Wako Pure Chemical Industries, Ltd.) containing 100 mM DTT. The obtained lysate was collected and subjected to a centrifugation treatment (3000×g, 4° C., 5 minutes), and a supernatant containing VLP was separated from cell residues and collected. The obtained supernatant was placed on phosphate buffered saline (PBS) containing 30 mass/volume % sucrose put into an ultracentrifugation tube and subjected to an ultracentrifugation treatment (50000 rpm, 4° C., 1 hour, SW55Ti Rotor). The obtained precipitate was lysed in an SDS sample buffer solution (commercially available from Wako Pure Chemical Industries, Ltd.) containing 100 mM DTT to prepare a western blotting sample.
[0099] A sample in which a Tris-Glycine SDS sample buffer (commercially available from Invitrogen) was mixed in the prepared western blotting sample was applied to 4%-20% Mini-PROTEAN TGX gradient gels (commercially available from Bio-Rad Laboratories, Inc) and was subjected to SDS-PAGE. The separated proteins were transcribed into a PVDF membrane, and the transcription membrane was blocked using a Blocking One solution (commercially available from Nakarai Tesque). The transcription membrane was incubated in a primary antibody solution (a solution of rabbit anti-WSN virus antibody (R309) or anti β-actin (AC-74) antibody was diluted in a solution (solution I) included in a Can Get Signal (commercially available from Toyobo Co., Ltd.)) at room temperature for at least 1 hour. Next, the transcription membrane was washed with TBS (TBST) containing 0.05 volume % Tween-20 three times. Then, a secondary antibody solution (a solution of ECL donkey anti-mouse IgG antibodies (commercially available from GE healthcare) conjugated with horseradish peroxidase was diluted in a solution (solution II) included in a Can Get Signal (commercially available from Toyobo Co., Ltd.)) was incubated and then washed with TBST three times. The transcription membrane was incubated in an ECL Prime Western blotting detection reagent (commercially available from GE healthcare) and a chemiluminescent signal was then detected in bands of the HA protein and the M1 protein in VLPs and bands of β-actin using a VersaDoc Imaging System (commercially available from Bio-Rad Laboratories, Inc).
[0100] An amount of VLPs produced was calculated as the ratio of an amount of the HA protein or the M1 protein in VLPs with respect to an amount of the HA protein or the M1 protein in the lysate. The ratio of an amount of VLPs produced in cells into which each siRNA was introduced to an amount of VLPs produced in cells into which the control siRNA was introduced was calculated as a production efficiency (%) of VLPs. The result of the VLP production efficiency (%) based on the HA protein is shown in Table 7, and the result of the VLP production efficiency (%) based on the M1 protein is shown in Table 8. As a result, a VLP production efficiency of 15 host genes (ASCC3L1 gene, BRD8 gene, C19orf43 gene, DDX55 gene, DKFZp564K142 gene, DPM3 gene, EEF2 gene, FAM73B gene, FLJ20303 gene, GBF1 gene, NCLN gene, C14orf173 gene, XPO1 gene, LRPPRC gene, and RCN1 gene) among the 91 host genes was decreased 50% or more (p<0.05) compared to that of cells into which the control siRNA was introduced. The results indicate that these host genes were involved in formation of VLP, and formation of VLP and influenza virus replication were inhibited by decreasing expression of these host genes.
TABLE-US-00007 TABLE 7 VLP production efficiency (%) based on HA proteins Gene name Activity (%) AP2A2 177.34 ASCC3L1 164.31 ATP5O 231.41 BAG3 76.58 BRD8 131.03 BUB3 141.86 C19orf43 138.87 CCDC135 80.11 CCDC56 99.94 CHERP 139.28 CIRBP 206.25 CLTC 183.70 CNOT1 113.66 CYC1 145.24 DDX21 89.03 DDX55 62.07 DKFZp564K142 77.20 DNAJC11 98.32 DPM3 37.43 EEF1A2 73.32 EEF2 32.28 FAM73B 22.48 FLJ20303 24.25 GBF1 46.44 GEMIN4 38.02 HNRNPK 60.20 IARS 117.45 IGF2BP2 145.77 ITGA3 108.10 ITGB4BP 105.61 ITM2B 152.06 KIAA0664 116.85 KRT14 121.78 MRCL3 257.17 MYH10 144.03 NCAPD3 60.43 NCLN 49.60 NDUFS8 82.87 NIBP 88.27 NUP160 91.43 NUP205 87.21 PSMA4 109.43 PSMA5 81.34 PSMB2 209.71 PSMC1 135.75 PSMC4 212.29 PSMD11 149.91 PSMD13 94.54 PSMD2 134.75 PSMD6 125.70 RPL26 88.86 S100A4 143.16 SDF2L1 219.96 SDF4 363.99 SF3A2 411.61 SF3B4 693.20 SFRS2B 229.98 SNRPC 161.92 SNRPD3 264.49 SQSTM1 123.78 TAF15 119.20 TOMM40 119.26 TRIM28 111.28 UAP1 96.46 USP9X 113.07 VCP 251.95 ZC3H15 346.37 BASP1 198.63 C14orf173 63.05 CTNNB1 115.18 PSMC6 138.70 PSMD12 173.40 PSMD14 200.50 SAMHD1 134.99 SF3B2 200.77 SNRP70 404.20 THOC2 174.33 XPO1 61.99 ANP32B 206.57 CAPRIN1 75.64 LRPPRC 72.43 NFIA 97.73 PHB 69.14 PPP6C 79.39 SFRS10 82.25 STK38 295.34 TESC 85.68 JAK1 74.23 PCDHB12 82.21 NDUFA10 115.30 RCN1 117.61
TABLE-US-00008 TABLE 8 VLP production efficiency (%) based on M1 proteins Gene name Activity (%) AP2A2 105.25 ASCC3L1 37.96 ATP5O 30.59 BAG3 54.31 BRD8 46.15 BUB3 77.36 C19orf43 31.44 CCDC135 65.85 CCDC56 84.01 CHERP 86.77 CIRBP 192.75 CLTC 452.07 CNOT1 180.01 CYC1 353.99 DDX21 68.64 DDX55 34.18 DKFZp564K142 24.61 DNAJC11 66.02 DPM3 28.47 EEF1A2 54.03 EEF2 75.49 FAM73B 95.69 FLJ20303 34.39 GBF1 52.00 GEMIN4 34.51 HNRNPK 72.32 IARS 196.77 IGF2BP2 101.08 ITGA3 108.01 ITGB4BP 66.69 ITM2B 114.84 KIAA0664 65.31 KRT14 65.35 MRCL3 362.33 MYH10 260.58 NCAPD3 246.13 NCLN 25.09 NDUFS8 126.10 NIBP 211.85 NUP160 75.36 NUP205 49.40 PSMA4 56.67 PSMA5 93.31 PSMB2 67.65 PSMC1 39.83 PSMC4 84.63 PSMD11 42.69 PSMD13 51.04 PSMD2 88.15 PSMD6 63.50 RPL26 93.69 S100A4 96.92 SDF2L1 78.78 SDF4 114.31 SF3A2 91.21 SF3B4 87.39 SFRS2B 75.66 SNRPC 70.65 SNRPD3 56.78 SQSTM1 91.41 TAF15 121.08 TOMM40 130.27 TRIM28 124.46 UAP1 129.75 USP9X 233.73 VCP 239.19 ZC3H15 332.94 BASP1 88.45 C14orf173 49.67 CTNNB1 93.10 PSMC6 76.21 PSMD12 159.72 PSMD14 139.36 SAMHD1 86.38 SF3B2 113.47 SNRP70 232.69 THOC2 52.38 XPO1 22.30 ANP32B 157.69 CAPRIN1 33.65 LRPPRC 41.86 NFIA 98.23 PHB 29.04 PPP6C 87.35 SFRS10 34.02 STK38 188.37 TESC 59.33 JAK1 57.70 PCDHB12 105.78 NDUFA10 89.91 RCN1 30.55
<Efficiency of Incorporation of vRNP into Progeny Virus Particles>
[0101] In order to examine whether the 91 host genes were involved in incorporation of vRNP into progeny virus particles, incorporation of vRNA and NP into progeny virus particles was examined.
[0102] Specifically, first, in the same manner as in <siRNA>, siRNA was transfected into HEK293 cells and cells after the second transfection were infected with an influenza virus with a multiplicity of infection (MOI) of 5. A culture supernatant containing released virus particles was separated from cell residues through a centrifugation treatment (3000×g, 4° C., 5 minutes) and collected 12 hours after the infection. The obtained supernatant was placed on PBS containing 30 weight/volume % sucrose put into an ultracentrifugation tube and was subjected to an ultracentrifugation treatment (50000 rpm, 4° C., 1 hour, SW55Ti Rotor). The precipitate containing virus particles was homogenized in PBS and viral RNA was extracted using the Maxwell 16 LEV simply RNA Tissue Kit. An amount of viral RNA in the supernatant and an amount of viral RNA in cells were quantified through strand specific real time PCR according to Kawakami's method (refer to Non Patent Literature 11). Also, a reverse transcription reaction using total RNA as a template was performed using SuperScript III Reverse Transcriptase and an influenza virus genome specific primer (vRNA_tag_NP_1F; ggccgtcatggtggcgaatAGCAAAAGCAGGGTAGATAATCACTC (the lower case part is a tag sequence)) to which a tag sequence including 19 bases was added to the 5′ terminus. In addition, quantitative PCR was performed using a primer specific to the tag sequence (vRNA tag; GGCCGTCATGGTGGCGAAT), a primer specific to a virus genome (WSN-NP_100R; GTTCTCCATCAGTCTCCATC), a probe labeled with 6-FAM/ZEN/IBFQ (IDT, WSN-NP_46-70; ATGGCGACCAAAGGCACCAAACGAT), and THUNDERBIRD Probe qPCR Mix.
[0103] An amount of vRNA and NP protein incorporated into progeny virus particles was determined by a value obtained by dividing an amount of vRNA or NP proteins in the viruses collected from the culture supernatant by an amount of vRNA or NP proteins in the lysate. The ratio of an amount of vRNA incorporated into progeny virus particles of cells into which each siRNA was introduced to an amount of vRNA incorporated into progeny virus particles of cells into which the control siRNA was introduced was calculated as vRNA incorporation efficiency (%). The ratio of an amount of the NP protein incorporated into progeny virus particles of cells into which each siRNA was introduced to an amount of the NP protein incorporated into progeny virus particles of cells into which the control siRNA was introduced was calculated as the NP protein incorporation efficiency (%). The calculation results are shown in Tables 9 and 10. As a result, among the 91 host genes, efficiency of vRNA incorporated into progeny virus particles in cells into which siRNA of 16 host genes (HNRNPK gene, DDX21 gene, JAK1 gene, EEF1A2 gene, SFRS2B gene, DNAJC11 gene, SQSTM1 gene, BASP1 gene, PCDHB12 gene, KIAA0664 gene, SNRPC gene, PPP6C gene, MRCL3 gene, ITM2B gene, TAF15 gene, and SDF4 gene) was introduced was decreased 50% or more (p<0.05) compared to that of cells into which the control siRNA was introduced and efficiency of the NP protein incorporated into progeny virus particles in cells into which siRNA of 27 host genes (SFRS2B gene, BASP1 gene, THOC2 gene, SNRPC gene, KIAA0664 gene, PPP6C gene, HNRNPK gene, ITM2B gene, SQSTM1 gene, RPL26 gene, NDUFS8 gene, SDF2L1 gene, JAK1 gene, DDX21 gene, EEF1A2 gene, TRIM28 gene, SDF4 gene, USP9X gene, PSMD13 gene, TAF15 gene, CIRBP gene, CHERP gene, TESC gene, MYH10 gene, TOMM40 gene, MRCL3 gene, and PCDHB12 gene) was introduced was decreased 50% or more (p<0.05) compared to that of cells into which the control siRNA was introduced. The results indicate that these host genes were involved in incorporation of vRNA or NP proteins into progeny virus particles, and incorporation of vRNA or NP proteins into progeny virus particles was suppressed and influenza virus replication was inhibited by decreasing expression of these host genes.
TABLE-US-00009 TABLE 9 Efficiency (%) of incorporation of vRNA into progeny virus Gene name Activity (%) AP2A2 64.90 ASCC3L1 N/A ATP5O N/A BAG3 N/A BRD8 N/A BUB3 N/A C19orf43 N/A CCDC135 N/A CCDC56 N/A CHERP 60.18 CIRBP 100.55 CLTC N/A CNOT1 N/A CYC1 N/A DDX21 22.01 DDX55 N/A DKFZp564K142 N/A DNAJC11 33.98 DPM3 N/A EEF1A2 30.38 EEF2 N/A FAM73B N/A FLJ20303 N/A GBF1 N/A GEMIN4 N/A HNRNPK 7.61 IARS 55.35 IGF2BP2 N/A ITGA3 104.80 ITGB4BP N/A ITM2B 43.04 KIAA0664 37.10 KRT14 N/A MRCL3 41.24 MYH10 102.84 NCAPD3 N/A NCLN N/A NDUFS8 59.61 NIBP N/A NUP160 N/A NUP205 N/A PSMA4 N/A PSMA5 N/A PSMB2 N/A PSMC1 N/A PSMC4 N/A PSMD11 N/A PSMD13 77.25 PSMD2 N/A PSMD6 N/A RPL26 69.12 S100A4 N/A SDF2L1 50.50 SDF4 48.77 SF3A2 N/A SF3B4 N/A SFRS2B 33.34 SNRPC 38.36 SNRPD3 N/A SQSTM1 34.21 TAF15 44.19 TOMM40 62.85 TRIM28 56.47 UAP1 73.58 USP9X 51.30 VCP N/A ZC3H15 N/A BASP1 34.55 C14orf173 N/A CTNNB1 N/A PSMC6 N/A PSMD12 N/A PSMD14 N/A SAMHD1 N/A SF3B2 N/A SNRP70 N/A THOC2 69.69 XPO1 N/A ANP32B N/A CAPRIN1 N/A LRPPRC N/A NFIA 114.66 PHB N/A PPP6C 40.69 SFRS10 N/A STK38 105.10 TESC 65.09 JAK1 29.55 PCDHB12 35.01 NDUFA10 103.50 RCN1 N/A
TABLE-US-00010 TABLE 10 Efficiency (%) of incorporation of NP proteins into progeny virus Gene name Activity (%) AP2A2 100.03 ASCC3L1 N/A ATP5O N/A BAG3 N/A BRD8 N/A BUB3 N/A C19orf43 N/A CCDC135 N/A CCDC56 N/A CHERP 35.95 CIRBP 35.27 CLTC N/A CNOT1 N/A CYC1 N/A DDX21 24.15 DDX55 N/A DKFZp564K142 N/A DNAJC11 75.70 DPM3 N/A EEF1A2 24.53 EEF2 N/A FAM73B N/A FLJ20303 N/A GBF1 N/A GEMIN4 N/A HNRNPK 17.88 IARS 126.54 IGF2BP2 N/A ITGA3 118.53 ITGB4BP N/A ITM2B 17.88 KIAA0664 17.38 KRT14 N/A MRCL3 44.54 MYH10 42.45 NCAPD3 N/A NCLN N/A NDUFS8 21.10 NIBP N/A NUP160 N/A NUP205 N/A PSMA4 N/A PSMA5 N/A PSMB2 N/A PSMC1 N/A PSMC4 N/A PSMD11 N/A PSMD13 30.63 PSMD2 N/A PSMD6 N/A RPL26 20.81 S100A4 N/A SDF2L1 21.32 SDF4 28.85 SF3A2 N/A SF3B4 N/A SFRS2B 11.18 SNRPC 15.81 SNRPD3 N/A SQSTM1 18.59 TAF15 32.28 TOMM40 44.32 TRIM28 27.83 UAP1 53.41 USP9X 29.00 VCP N/A ZC3H15 N/A BASP1 11.72 C14orf173 N/A CTNNB1 N/A PSMC6 N/A PSMD12 N/A PSMD14 N/A SAMHD1 N/A SF3B2 N/A SNRP70 N/A THOC2 15.61 XPO1 N/A ANP32B N/A CAPRIN1 N/A LRPPRC N/A NFIA 72.47 PHB N/A PPP6C 17.55 SFRS10 N/A STK38 123.81 TESC 40.75 JAK1 23.93 PCDHB12 49.28 NDUFA10 65.44 RCN1 N/A
Example 2
[0104] In Example 1, in 299 host genes in which an influenza virus titer was reduced by a common logarithmic value of 2 or more due to siRNA introduction, it was examined whether a known inhibitor could be used as an anti-influenza virus agent.
[0105] First, using a DrugBank database (refer to Non Patent Literature 12), IPA (Ingenuity), and a database of a pharmaceutical manufacturer (Millipore, Sigma Aldrich, Selleck Chemicals), compounds serving as inhibitors of functions of these host genes were examined. As a result, 61 compounds were found as inhibitors for 44 host genes.
[0106] 11 inhibitors shown in Table 11 were selected from the 61 compounds and an influence of these compounds on influenza virus replication was examined. Among them, Bortezomib and Colchicine are known as influenza virus replication inhibitors (refer to Non Patent Literatures 13 and 14).
TABLE-US-00011 TABLE 11 Drug name Target protein Function Bortezomib PSMB2, PSMD2 Proteasome inhibitor 2,3-Butanedione 2-Monoxime BAT1, DHX15, HSPD1, Myosin ATPase inhibitor PSMC1, PSMC3, PSMC4, PSMC6, PSMD6, VCP Carboxyatractyloside SLC25A5 A highly selective and strong inhibitor (Ki < 10 nM) of an adenine nucleotide transporter (ANT) and an inducing factor of an opening of a membrane permeable transition hole (PTP). A nucleoside binding site of the ANT is stabilized on a cytoplasmic side of the intima and an exchange between ATP in mitochondria and ADP in the cytoplasm is blocked. Colchicine TUBA1, TUBB, TUBB2A Antimitotic agent (binds to tubulins and disrupts microtubules by inhibiting its polymerization) 17-Dimethylaminoethylamino- HSP90AB1 HSP90 inhibitor 17-demethoxygeldanamycin (17-DMAG) Golgicide A GBF1 A cell-permeable quinoline compound (reversibly reduces intracellular vesicle transportation through GBF1) selectively targeting ArfGEF and GBF1 (but not targeting BIG1/2) PPIase-Parvulin Inhibitor PPIB Pin1/Par14 PPIase inhibitor Decitabine DNMT1 DNMT inhibitor Ruxolitinib JAK1 JAK1/JAK2 inhibitor Pepstatin A CTSD Cathepsin D, pepsin, and renin inhibitor WP1130 USP9X Deubiquitinating enzyme (DUB) inhibitor
[0107] Specifically, HEK293 cells or A549 cells were infected with an influenza virus with an MOI of 0.001. Cells 1 hour after the infection were washed and then cultured in a culture solution containing inhibitors, a DMSO solution (final concentration: 1 volume %) was used as a control instead of the inhibitors. After culture for 48 hours in the presence of the inhibitor, a culture supernatant was collected, and a virus titer was obtained in the same manner as in Example 1. In addition, a cell viability (%) was calculated using a CellTiter-Glo assay system (commercially available from Promega Corporation) according to the appended instructions. The number of cells cultured in a medium containing the inhibitors with respect to the number of living cells in cells cultured in a medium containing the control (the DMSO solution) was calculated as the cell viability (%).
[0108] As a result, it was found that 2,3-Butanedione 2-Monoxime (30 mM), and WP1130 (50 μM) could reduce a virus titer by a common logarithmic value of 5 or more, but cell viability was significantly reduced and toxicity to host cells was strong. Bortezomib (0.2 μM) and Colchicine (2.5 μM), which are known anti-influenza virus agents, could reduce a virus titer by a common logarithmic value of 4 (Bortezomib) or 2 (Colchicine) in A549 cells without showing severe cytotoxicity. On the other hand, Golgicide A (10 μM) and Ruxolitinib (30 μM), whose relationships with influenza virus replication had not been indicated, significantly reduced a virus titer. Ruxolitinib (30 μM) did not show remarkable cytotoxicity. In Golgicide A (10 μM), a decrease in the cell viability was confirmed in HEK293 cells and was not confirmed in A549 cells. The result of Golgicide A is shown in
Example 3
[0109] Ruxolitinib is an inhibitor for JAK1 which is tyrosine kinase. As described in Example 1, a VLP production efficiency based on the M1 protein in cells in which expression of JAK1 was reduced due to siRNA introduction was 57.7% and was close to the set cutoff value of 50%. Therefore, cells into which siRNA of JAK1 was introduced were observed with an electron microscope and an influence of a decrease in expression of JAK1 genes on virus particle formation of influenza viruses was examined.
[0110] Specifically, first, in the same manner as in <siRNA>, siRNA of JAK1 genes or a control siRNA was transfected into HEK293 cells. Cells after the second transfection were infected with an influenza virus with an MOI of 5. Cell ultrathin sections were prepared from cells 12 hours after the infection according to Noda's method (Non Patent Literature 15) and observed with an electron microscope. The Tecnai (registered trademark) F20 electron microscope (commercially available from FEI) was used as the electron microscope.
[0111] An electron micrographic image (an upper side) of cells into which the control siRNA was introduced and an electron microscope image (a lower side) of cells into which siRNA of JAK1 genes was introduced are shown in
Example 4
[0112] Using protein inhibitors shown in Table 12 as test compounds, cell toxicity and an effect on influenza virus replication were examined.
TABLE-US-00012 TABLE 12 Inhibitor name CAS number Function J1 Tofacitinib (CP-690550) 477600-75-2 JAK inhibitor Citrate J4 Tyrphostin B42 133550-30-8 JAK inhibitor J6 Baricitinib 1187594-09-7 JAK inhibitor J7 AT9283 896466-04-9 JAK inhibitor J8 Momelotinib 1056634-68-4 JAK inhibitor J11 CEP33779 1257704-57-6 JAK inhibitor J13 NVP-BSK805 2HCl 1092499-93-8 JAK inhibitor (free base) J15 ZM39923 HCl 1021868-92-7 JAK inhibitor J19 Filgotinib 1206161-97-8 JAK inhibitor J20 JANEX-1 202475-60-3 JAK inhibitor J21 NVP-BSK805 dihydrochloride 1092499-93-8 JAK inhibitor (free base) J23 SB1317 937270-47-8 JAK inhibitor J25 WP1130 856243-80-6 DUB inhibitor
<Cytotoxicity Test>
[0113] First, as test compound solutions, test compounds were prepared in 1% dimethylsulfoxide-containing MEMs so that a final concentration was 1000, 100, 10, 1, 0.1, 0.01, or 0.001 μM.
[0114] Cell fluids in which MDCK cells, A549 cells, and HEK293 cells were prepared at concentrations of 6.25×10.sup.5 cells/mL, 2.5×10.sup.6 cells/mL, and 1.25×10.sup.5 cells/mL in minimum essential mediums (MEMs) were added to a 96-well plate at 0.1 ml/well and the cells were seeded. The cells in the 96-well plate were cultured in a carbon dioxide incubator at 37° C. and washed with MEM the day after the seeding date. In the washed cells in the 96-well plate, 0.1 mL of each test compound solution was added to three wells for each concentration and the cells in the 96-well plate were then cultured in a carbon dioxide incubator at 37° C. for 48 hours. After the culture, a Cell Counting Kit-8 solution (commercially available from Dojindo Molecular Technologies, Inc.) was added to each well at 10 μL and culture was additionally performed at 37° C. for several hours. After the culture, an absorbance at 450 nm of a solution of each well in the 96-well plate was measured using a microplate reader. An absorbance value when a solvent (1% dimethylsulfoxide-containing MEM) was added in place of the test compound was set to 100% at which the whole cells survived. A final concentration value of the test compound when an absorbance was 50% was calculated as a 50% cytotoxicity concentration (CC50 value).
<Antiviral Effect Test>
[0115] First, as test compound solutions, test compounds were prepared in 1% dimethylsulfoxide-containing MEMs so that a final concentration was 1000, 100, 10, 1, 0.1, 0.01, or 0.001 μM.
[0116] Cell fluids in which MDCK cells, A549 cells, and HEK293 cells were prepared at concentrations of 1.25×10.sup.6 cells/mL, 5×10.sup.6 cells/mL, and 2.5×10.sup.5 cells/mL in MEMs were added to a 96-well plate at 0.1 mL/well and the cells were seeded. The cells in the 96-well plate were cultured in a carbon dioxide incubator at 37° C. and washed with MEM the day after the seeding date. In the washed cells in the 96-well plate, 0.1 mL of each test compound solution was added to three wells for each concentration and the cells in the 96-well plate were then cultured in a carbon dioxide incubator at 37° C. for 1 hour. After the culture, the test compound solutions were removed from the wells, and 50 μL of influenza virus A/WSN RG#1-1 strains were infected so that an MOI (the number of virus infections per cell) was 0.001 and cultured in a carbon dioxide incubator at 37° C. for 1 hour. After the culture, the virus solutions were removed from the wells, a test compound solution containing 1 μg/mL trypsin was added at 0.1 mL/well, and culture was additionally performed at 37° C. for 48 hours. It was examined whether there were viruses in the wells after the culture. A final concentration value of the test compound calculated such that there were no viruses in half (50%) of culture wells to which test compounds with the same concentration were added was calculated as a 50% virus replication inhibitory concentration (IC50). Also, determination of whether there were viruses in the culture wells was performed by determining whether aggregation occurred when 50 μL of a red blood cell solution containing 1% guinea pig erythrocytes was added to 50 μL of a culture solution collected from the culture wells.
[0117] The common logarithmic values of CC50 and IC50 of the protein inhibitors are shown in Table 13. In the table, blanks indicate that a difference between IC50 and CC50 was less than 10 times (a difference as a common logarithmic value was less than 1). As a result, in at least any of MDCK cells, A549 cells, and HEK293 cells, these protein inhibitors had IC50 whose concentration was lower than CC50 by a factor of 10 or more. That is, these protein inhibitors can suppress influenza virus replication without significantly impairing a proliferative ability of host cells and were suitable as an active ingredient of an anti-influenza virus agent.
TABLE-US-00013 TABLE 13 Cell lines MDCK A549 293 Concentration (log.sub.10, nM) Compound IC50 CC50 IC50 CC50 IC50 CC50 J1 4.50 >5.5 J4 4.50 6.43 J6 4.50 >5.5 4.50 >5.5 J7 3.50 >5.5 J8 4.50 >5.5 J11 3.50 >5.5 J13 3.17 4.32 J15 2.50 4.68 J19 4.50 >5.5 4.50 >5.5 4.50 >5.5 J20 4.50 >5.5 J21 3.50 4.59 J23 1.50 3.90 1.50 4.55 1.50 4.72 J25 2.50 3.69