METHOD FOR BREAKING NUCLEIC ACID AND ADDING ADAPTOR BY MEANS OF TRANSPOSASE, AND REAGENT

Abstract

Provided are a method for breaking a nucleic acid and adding an adaptor by means of a transposase, and a reagent. The method comprises the following steps: conducting random breaking of a nucleic acid by using a transposase-embedded complex, wherein the transposase-embedded complex comprises a transposase and a first adaptor comprising a transposase identification sequence, and two ends of the broken nucleic acid are separately connected to the first adaptor and are separately provided with a gap; by means of purification or chemical reagent treatment, eliminating the influence of the transposase in the system on a follow-up reaction; connecting to a second adaptor at the gap by using a ligase, wherein a sequence of the second adaptor is different from a sequence of the first adaptor; and conducting a PCR reaction by using primers targeted to and combined with the first adaptor and the second adaptor respectively, so as to obtain a product whose both ends are respectively connected to different adaptor sequences.

Claims

1. A method for breaking a nucleic acid and adding an adaptor by means of a transposase, comprising the following steps: randomly interrupting a nucleic acid by using a transposase-embedded complex, wherein the transposase-embedded complex comprises a transposase and a first adaptor comprising a transposase identification sequence, and both ends of the interrupted nucleic acid are separately ligated to the first adaptor to form a gap at each end; eliminating the influence of the transposase in the system on a follow-up reaction by means of purification or chemical reagent treatment; ligating to a second adaptor at the gap by using a ligase, wherein the sequence of the second adaptor is different from that of the first adaptor, wherein the second adaptor having a modification preventing self-ligation and the modification on the second adaptor is a 3′ terminal base dideoxv modification; and performing a PCR reaction by using primers targeted to the first adaptor and the second adaptor respectively, so as to obtain a product whose both ends are respectively ligated to different adaptor sequences.

2. The method of claim 1 wherein the first adaptor having a modification to prevent self-ligation or a modification to ligate with the second adaptor.

3. The method of claim 2 wherein the modification on the first adaptor comprises any one of the following or combination thereof: (a) the 3′ terminal base of the first adaptor dideoxy modification; (b) introducing a dUTP into a chain of the first adaptor for subsequent enzymatic cleavage of excess adaptors; (c) introducing a base pair at the outside of the transposase identification sequence of the first adaptor, wherein the 3′ terminal base dideoxy modification; and (d) the first adaptor consisting of a complete sequence, internally complementary to form a 3′-5′ phosphodiester bond cross-linked double stranded sequence.

4. The method of claim 3 wherein the modification on the first adaptor is the 3′ terminal base of the first adaptor dideoxy modification.

5. (canceled)

6. The method of claim 1 wherein one of the primers used in the PCR reaction is a terminal biotin-labeled primer for obtaining single-stranded molecules by biotin-streptavidin affinity reaction.

7. The method of claim 1 wherein the purification is purification by magnetic beads or a column.

8. The method of claim 1 wherein the chemical reagent treatment is a treatment to dissociate the transposase from a target sequence by degenerating or digesting the transposase.

9. The method of claim 8 wherein the chemical reagent comprises a first reagent and a second reagent; wherein the first reagent comprises one or more members of the group consisting of a protease solution, a SDS solution and a NT buffer for breaking the adsorption effect of the transposase and the target sequence of the nucleic acid; the second reagent comprises a Triton-X100 solution for weakening the influence of the first reagent on the subsequent enzymatic reactions.

10. The method of claim 9 wherein the first reagent further comprises an additional reagent containing EDTA; preferably, the second reagent further comprises a Tween-20 solution.

11. A reagent for breaking a nucleic acid and adding an adaptor by means of a transposase, comprising the following components: a transposase and a first adaptor comprising a transposase identification sequence for forming a transposase-embedded complex to randomly interrupt a nucleic acid, so as both ends of the interrupted nucleic acid are separately ligated to the first adaptor to form a gap at each end; a second adaptor and a ligase component for ligating the second adaptor at the gap. wherein the second adaptor having a modification preventing self-ligation, and the modification on the second adaptor is a 3′ terminal base dideoxy modification; and primers targeted to the first adaptor and the second adaptor respectively, so as to obtain a product whose both ends are respectively ligated to different adaptor sequences by performing a PCR reaction.

12. The reagent of claim 11 wherein the first adaptor having a modification to prevent self-ligation or a modification to ligate with the second adaptor.

13. The reagent of claim 12 wherein the modification on the first adaptor comprises any one of the following or combination thereof: (a) the 3′ terminal base of the first adaptor dideoxy modification; (b) introducing a dUTP into a chain of the first adaptor for subsequent enzymatic cleavage of excess adaptors; (c) introducing a base pair at the outside of the transposase identification sequence of the first adaptor, wherein the 3′ terminal base dideoxy modification; and (d) the first adaptor consisting of a complete sequence, internally complementary to form a 3′-5′ phosphodiester bond cross-linked double stranded sequence.

14. (canceled)

15. The reagent of claim 11 wherein one of the primers used in the PCR reaction is a terminal biotin-labeled primer for obtaining single-stranded molecules by biotin-streptavidin affinity reaction.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0050] FIG. 1 is a schematic flow diagram of a technical solution in which a transposase interrupting a nucleic acid and ligating a gap adaptor (i.e., No. 2 adaptor) in the present invention;

[0051] FIG. 2 is a result of the gel electrophoresis of the PCR product after the ligation of a gap adaptor (i.e., No. 2 adaptor) in Example 1 of the present invention, wherein lane 1 is the annealing product at 60° C. after the interruption by single-adaptor-2 and after the ligation of the gap adaptor; lane 2 is the annealing product at 55° C. after the interruption by single-adaptor-2 and after the ligation of the gap adaptor; lane 3 is the annealing product at 60 ° C. after the interruption by single-adaptor-3 and after the ligation of the gap adaptor; lane 4 is the annealing product at 55° C. after the interruption by single-adaptor-3 and after the ligation of the gap adaptor; lane 5 is the annealing product at 60° C. after the interruption by single-adaptor-1 and after the ligation of the gap adaptor; lane 6 is the annealing product at 55° C. after the interruption by single-adaptor-1 and after the ligation of the gap adaptor; lane 7 is the annealing product at 60 ° C. after the interruption by double-adaptors and after the direct PCR; lane 8 is the annealing product at 55° C. after the interruption by double-adaptors and after the direct PCR; M1 is the DL2000 DNA Marker; M2 is the 50 bp DNA Marker; N is the negative control.

[0052] FIG. 3 is a base quality diagram by the sequencing of ligation method in Example 1 of the present invention;

[0053] FIG. 4 is a result of the gel electrophoresis of the PCR product after the No.1 adaptor single-adaptor transposase complex interrupting a nucleic acid and after the introduction of the No. 2 adaptor in Example 1 of the present invention, wherein D2000 is the lane of DNA Ladder; lane 1 is the result after treatment of 2 μL protease +1% Triton-X100; lane 2 is the result after treatment of NT buffer+1% Triton-X100; lane 3 is the result after treatment of 1% SDS +1% Triton-X100+0.5% Tween-20; lane 4 is the result after treatment of 2 μL protease +14 mM EDTA+1% Triton-X100; lane 5 is the result after treatment of 1×PBI, 1.3×Ampure XP beads; lane 6 is the result of a negative control (without template).

DETAILED DESCRIPTION OF THE INVENTION

[0054] The invention will now be described in further detail by way of specific examples. Unless otherwise specified, the techniques used in the examples below are conventional techniques known to those skilled in the art; the instruments and reagents used are accessable to those skilled in the art through public approaches such as commercial approaches and so on.

[0055] The terms used in the present invention are set forth as follows: the first adaptor is referred to as a No.1 adaptor in a specific embodiment; the second adaptor is referred to as a No. 2 adaptor or gap adaptor in a specific embodiment; the first reagent is referred to as a No. 1 reagent in a specific embodiment; and the second reagent is referred to as a No. 2 reagent in a specific embodiment.

[0056] Referring to FIG. 1, the operation flow of the method of the present invention mainly comprises: (1) a NO. 1 adaptor where a specific modification sequence is embedded by a transposase is used to randomly interrupte nucleic acid sequences, such as genomic sequences, whole genome amplification sequences, or PCR product sequences, etc, wherein both ends of the interrupted DNA are ligated to the first adaptor and form a 9nt base deletion gap; (2) eliminating the influence of the transposase in the system on a follow-up reaction by means of purification or chemical reagent treatment; (3) introducing a No. 2 adaptor by a way of ligating the No. 2 adaptor at the 9nt base deletion gap, so as the adaptor base sequence adjacent to fragmented target sequence is changed, so that the sequences on both sides of the target sequence are completely different, wherein one remains the NO. 1 adaptor sequence containing the transposase identification sequence, while the other is a second adaptor completely arbitrarily designed.

[0057] In the present invention, a transposase kit of domestic production (S50 series of Truprep kit of Nanjing Nuoweizan Ltd.) was used to carry out the following experiment. The kit containes two doses respectively for 5 ng genomic DNA and 50 ng genomic DNA.

[0058] A variety of adaptor sequences (the NO. 1 adaptor) for embedding was designed in the present invention, and a transposase and said adaptor sequences for embedding were used to prepare the transposase complex.

EXAMPLE 1

[0059] In this example, 5 ng or 50 ng of high quality genomic DNA was first interrupted by the embedded transposase complex; the free unembedded No. 1 adaptors were removed after purification by magnetic beads or column purification; then a No. 2 adaptor (a gap adaptor) was inventively ligated, and the free No. 2 adaptors were removed by purification, and thus a linear genome sequence with different adaptor sequences at both ends were constructed; a PCR amplification was performed by using PCR primers targeted respectively to the No. 1 adaptor and the No. 2 adaptor, enriching the PCR product with different adaptor sequences at both ends.

[0060] One application of the PCR product of this example is by labeling the PCR primers in a biotin-labeled manner, and a single-stranded molecule of a particular sequence is obtained, and a single-stranded cyclic molecule is prepared by a single-stranded cyclization or by a cyclization with a short nucleic acid sequence as a bridge-mediated sequence. The formed single-stranded cyclic molecule can be used for the preparation of solid dense DNA nanospheres.

[0061] Multiple pairs of primer sequences (Sequence A and sequence B) with a l9bp transposase identification sequence were designed and manufactured, for the preparation of a single-adaptor (the No. 1 adaptor) for embedding, and three different single-adaptors (i.e., single-adaptor 1 sequence, single-adaptor 2 sequence and single-adaptor sequence) and a standard double-adaptors sequence (Sequence A+sequence B; sequence A+sequence C) were tested in the present example.

[0062] Wherein a dUTP is introduced into a strand (strand A) of the single-adaptor 1 sequence for subsequent digest of excess adaptors; a base pair is introduced into the outside of the 19 bp transposase identification sequence of the single-adaptor 2 sequence, wherein the 3′ end base is a dideoxy-modified base; the whole double-stranded sequence of the single-adaptor 3 sequence consists of a complete sequence, which is internally complementary to form a double-stranded sequence crosslinked by a 3′-5′ phosphodiester bond. In addition, the modification modes of the above-mentioned three kinds of adaptors have at least one strand containing a 3′-end dideoxy modification, which helps to prevent the self-ligation of the No. 1 adaptor and inter-ligation with the No. 2 adaptor. Each of the first adaptors sequences is shown as follows:

TABLE-US-00001 Sequence A of single-adaptor 1: (SEQ ID NO: 1) CTGTCUCTTAUACACATC ddT; Sequence B of single-adaptor 1: (SEQ ID NO: 2) GCTTCGACTGGAGACAGATGTGTATAAGAGACAG; Sequence A of single-adaptor 2: (SEQ ID NO: 3) GCTGTCTCTTATACACATC ddT; Sequence B of single-adaptor 2: (SEQ ID NO: 4) GCTTCGACTGGAGACAGATGTGTATAAGAGACAG ddC; Sequence of single-adaptor 3: (SEQ ID NO: 5) GCTTCGACTGGAGACAGATGTGTATAAGAGACAGCTGTCTCTTATAC ACATC ddT; Sequence A of double-adaptors: (SEQ ID NO: 6) CTGTCTCTTATACACATCT; Sequence B of double-adaptors: (SEQ ID NO: 7) TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG; Sequence C of double-adaptors: (SEQ ID NO: 8) GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG.

[0063] 2. Each pair of single-adaptor sequence was diluted to 100 μM, fully mixed and centrifuged, annealing to form NO. 1 adaptor (stored at −20° C.) in a PCR instrument according to the following procedure (Table 1), for the preparation of embedded complex. The sequence A, B and C of double-adaptors were diluted to 100 μM, sequence A+sequence B combined, sequence A+sequence C combined, fully mixed and centrifuged, annealing to form NO. 1 adaptor (stored at −20° C.) in a PCR instrument according to the following procedure (Table 1), for the preparation of embedded complex.

TABLE-US-00002 TABLE 1 Temperature Time 75° C. 15 min 60° C. 10 min 50° C. 10 min 40° C. 10 min 25° C. 30 min Hot-lid 105° C.

[0064] 3. The NO. 1 adaptor and the transposase were embedded into a transposase-embedded complex according to the following system (Table 2), after gently blowing 20 times and incubating 1 hour at 30° C., the complex embedding was completed. The complex was stored at −20° C.

TABLE-US-00003 TABLE 2 Component Content Transposase  85 μL NO. 1 adaptor  30 μL Coupling buffer  85 μL Total 200 μL

[0065] 4. 50 ng of high quality genome and transposase complex were mixed according to the following system (Table 3), after gently mixing 20 times and incubating for 10 minutes at 55° C., and then cooling to 4° C., genome interruption is completed.

TABLE-US-00004 TABLE 3 Component Content Water  5 μL 5 × interruption buffer  2 μL gDNA (50 ng/μL)  1 μL Transposase complex  2 μL Total 10 μL

[0066] 5. Purification was carried out according to the following two methods. Method 1: A 1-fold volume of PBI (Qiagen PCR Purification Kit) was added and mixed evenly, and purified with 1.3-fold Ampure XP beads (automated operation); Method 2: Purification with QIAGEN PCR Column. After purification, the product was dissolved with pure water.

[0067] 6. As for the single-adaptor 1, after the interruption, USER enzyme was added to digest, and then a purification was carried out similarly to the previous steps, and the reaction system as follows (Table 4):

TABLE-US-00005 TABLE 4 Component Content DNA 10 μL 10 × Buffer  2 μL USER enzyme  1 μL Water  7 μL Total 20 μL

[0068] 7. The product after purification is submitted to the ligation of a gap adaptor (i.e., No. 2 adaptor) in accordance with the following system (Table 5), the ligation was completed after incubation for 60 minutes at 25° C.

TABLE-US-00006 TABLE 5 Component Content Water  8 μL 3 x ligation buffer 20 μL No. 2 adaptor 10 μL (5 μM) Ligasc  2 μL DNA 20 μL Total 30 μL Note: The sequences of the No. 2 adaptor arc as follows: Sequence A of the No. 2 adaptor: p AAGTCGGAGGCCAAGCGGTCGT ddC (SEQ 10 NO: 9); Sequence B of the No. 2 adaptor: TTGGCCTCCGACT ddT (SEQ 10 NO: 10); wherein p represents a 5′ terminal phosphorylation modification and dd represents a 3′ end dideoxy modification.

[0069] 8. As for the product after ligation, purification was carried out according to the following two methods. Method 1: A 1-fold volume of PBI (Qiagen PCR Purification Kit) was added and mixed evenly, and purified with 1.3-fold Ampure XP beads (automated operation); Method 2: Purification with QIAGEN PCR Column. After purification, the product was dissolved with pure water.

[0070] 9. PCR amplification was carried out according to the following PCR reaction system (Table 6) and reaction conditions (Table 7).

TABLE-US-00007 TABLE 6 Component Content DNA product after 30 μL purification 5x PCR buffer 10 μL 10 mM dNTP  1 μL Primer 1  2 μL Primer 2  2 μL PCR enzyme  1 μL Pure water  4 μL Total 50 μL Note: the PCR primers are as follows: Primer 1 of single-adaptor: AGACAAGCTCGAGCTCGAGCGATCGGGCTTCGACTGGAGAC (SEQ ID NO: 11); Primer 2 of double-adaptors: TCCTAAGACCGCTTGGCCTCCGACT (SEQ ID NO: 12); Primer 1 of double-adaptors: AATGATACGGCGACCACCGA (SEQ ID NO: 13); Primer 2 of single-adaptor: CAAGCAGAAGACGGCATACGA (SEQ ID NO: 14).

TABLE-US-00008 TABLE 7 Temperature Time Cycle 72° C. 3 min 1 Cycle 98° C. 30 sec 1 Cycle 98° C. 10 sec 15 Cycles 60° C./55° C. 30 sec 72° C. 3 min 72° C. 5 min 1 Cycle  4° C. ∞ —

[0071] 10. The PCR product test results after ligation of gap adaptor (No. 2 adaptor) are shown in FIG. 2, and the PCR product concentration determination results are as follows (Table 8):

TABLE-US-00009 TABLE 8 Adaptor Single- Single- Single- Single- Single- Single- Negative Double- Double- adaptor-2 adaptor-2 adaptor-3 adaptor-3 adaptor-1 adaptor-1 control adaptors adaptors Annealing 60° C. 55° C. 60° C. 55° C. 60° C. 55° C. — 60° C. 55° C. Product 11.8 13.8 9.6 10.1 8.24 10.3 1.64 29.8 25.8 concen- tration (ng/μL)

[0072] PCR results show that the method of the present invention has successfully introduced the gap adaptor.

[0073] 11. After single-stranded separation of the PCR product, the target band is submitted to single-stranded cyclization, according to the current common means of sequencing, resulting in single-stranded circular DNA molecules for preparation of DNA nanoball by rolling ring replication on a whole genome sequencing platform and for ligation sequencing. The single-stranded separation and cyclization operation is as follows:

[0074] (1) The PCR product was subjected to thermal denaturation at 95° C. and then immediately ice bath for 5 min;

[0075] (2) 3 pmol of single-stranded molecules of the PCR product that were denatured were subjected to single-stranded cyclization according to the following reaction system (Table 9);

TABLE-US-00010 TABLE 9 Component Content Mediating sequences (20 μM)  20 μL Pure water 158.3 μL 10 x ligation buffer  35 μL l00 mMATP   3.5 μL Ligase   1.2 μL PGR product after denature 112 μL Total 350 μL Note: Mediating sequences are as follows: Mediating sequence for single-adaptor: TCGAGCTTGTCTTCCTAAGACCGC (SEQ ID NO: 15); Mediating sequence for double-adaptors: CGCCGTATCATTCAAGCAGAAGAC (SEQ ID NO: 16).

[0076] (3) The single-strand without cyclization is digested, a reaction system is configured according to the following system (Table 10), after mixing and briefly centrifuging, 20 μL was added to the previous reaction system, incubating for 30 minutes at 37° C., followed by purification with 1.8-fold Ampure XP beads to prepare a single-stranded cyclic molecule for sequencing.

TABLE-US-00011 TABLE 10 Component Content 10 × ligation buffer  3.7 μL  20 U/μL Exonuclease I 11.1 μL 100 U/μL Exonuclease III  5.2 μL Total   20 μL

[0077] 12. Sequencing can be carried out from the 5′ and 3′ ends, and the target fragment with different sequences at both ends has a 19 bp transposase identification sequence only at one end, thus avoiding the specific annealing of the 19 bp transposase identification sequence at both ends and competition with the sequencing adaptors, and thus greatly improve the quality of sequencing, the results shown in FIG. 3. The data shown in FIG. 3 are mostly between 80 and 90, generally above 75, which is acceptable, whereas the data of the conventional sequencing results with the 19 bp transposase identification sequence at both ends are generally not so high, which is even between 30 and 40, indicating that the sequencing probe complementary to the 19 bp sequence of the present invention can be well matched to the sequencing template, that is, to solve the effect of the two 19 bp reverse complementary sequences on sequencing.

EXAMPLE 2

[0078] In this example, 50 ng of high quality genomic DNA was first interrupted by an embedded transposase complex, followed by treating with protease, SDS, NT or a composition of protease and EDTA to remove the transposase protein bound to DNA; and then after the ligation of a gap adaptor, directly amplified using PCR primers, with a certain concentration of TritonX-100 is added into the PCR reaction system.

[0079] 1. A pair of primer sequences with a 19 bp transposase identification sequence, sequence A and sequence B, were designed and prepared, for preparation of NO. 1 adaptor in the form of single-adaptor:

[0080] Sequence A of the NO. 1 adaptor in the form single-adaptor:

[0081] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (SEQ ID NO: 17);

[0082] Sequence B of the NO. 1 adaptor in the form single-adaptor:

[0083] CTGTCTCTTATACACATC ddT (SEQ ID NO: 18, dd represents a dideoxy modification).

[0084] 2. The sequence A and sequence B were diluted to 10004, fully mixed and centrifuged, annealing to form the No. 1 adaptor (stored at −20° C.) in a PCR instrument according to the following procedure (Table 11), for the preparation of embedded complex.

TABLE-US-00012 TABLE 11 Temperature Time 75° C. 15 min 60° C. 10 min 50° C. 10 min 40° C. 10 min 25° C. 30 min Hot-lid 105° C.

[0085] 3. The NO. 1 adaptor and the transposase were embedded into a transposase-embedded complex according to the following system (Table 12), after gently blowing 20 times and incubating 1 hour at 30° C., the complex embedding was completed. The complex was stored at −20° C.

TABLE-US-00013 TABLE 12 Component Content Transposase  85 μL NO. 1 adaptor  30 μL Coupling buffer  85 μL Total 200 μL

[0086] 4. 50 ng of high quality genome and transposase complex were mixed according to the following system (Table 13), after gently mixing 20 times and incubating for 10 minutes at 55° C., and then cooling to 4° C., genome interruption is completed.

TABLE-US-00014 TABLE 13 Component Content Water  5 μL 5 × interruption buffer  2 μL gDNA (50 ng/μL)  1 μL Transposase complex  2 μL Total 10 μL

[0087] 5. The sample processing methods after the interruption comprises the following options. Method 1: 0.1-5 μL of protease (750 mAU/mL) was added, in this example preferred 2 μL of protease, and at the same time 0.1 μL protease and 5 μL of protease was tested respectively. Method 2: adding the final concentration of commercial 1× NT buffer (a matching reagent in Truprep kit S5 series). Method 3: adding 0.01% to 1.5% (by volume) of SDS, preferably 1% (by volume) of SDS in this example, and 0.01% (by volume) and 1.5% (by volume) concentrations were tested separately. Method 4: 0.1-5 μL of protease (750 mAU/mL) was added and then added to a final concentration of 1-50 mM EDTA. This example preferred 2 μL of protease and final concentration of 14 mM EDTA, and at the same time 0.1 μL protease plus 1 mM EDTA and 5 μL of protease plus 50 mM EDTA was tested. Method 5: adding 1 times of the volume of PBI (a commercial reagent in Qiagen PCR purification kit), after mixing evenly, purifying with 1.3 times of Ampure XP beads, and dissolving with pure water.

[0088] 6. In the product after the above treatment, 0.1%-2% (by volume) of Triton-X100 was added, preferably 1% (by volume) in this example, while 0.1% (by volume) and 2% (by volume) of Triton-X100 was used to test.

[0089] 7. The product treated with the above Triton-X100 was ligated to a gap adaptor (the NO. 2 adaptor) according to the following system (Table 14) at 25° C. for 60 minutes, the adaptor ligation was completed.

TABLE-US-00015 TABLE 14 Component Content Water  8 μL 3 × ligation buffer 20 μL adaptor (5 μM) 10 μL Liagase  2 μL DNA 20 μL Total 30 μL

[0090] Note: Sequence A of the NO. 2 adaptor: 5′-pAAGTCGGAGGCCAAGCGGTCGT ddC-3′ (SEQ ID NO: 9); Sequence B of the NO. 2 adaptor: 5′-TTGGCCTCCGACT ddT-3′ (SEQ ID NO: 10)(p represents phosphorylation modification , dd represents dideoxy modification).

[0091] 8. PCR amplification was carried out according to the following PCR reaction system (Table 15) and reaction conditions (Table 16). For the experimental group with SDS added, a specific concentration of Tween-20 was added to the PCR system to partially increase the efficiency of the PCR. The working concentration of Tween-20 could be adjusted to different, such as 0.1% -2% (by volume), preferably 0.5% (by volume) in this example, while the working concentrations of 0.1% (by volume) and 2% (by volume) was tested.

TABLE-US-00016 TABLE 15 Component Content Processed DNA samples 30 μL 5xPCR buffer 10 μL 10 mM dNTP  1 μL Primer 1  2 μL Primer 2  2 μL PCR enzyme (DNA polymerase)  1 μL Pure water  4 μL Total 50 μL Note: Primer 1 of the NO. 1 adaptor in the form of single-adaptor: AGACAAGCTCGAGCTCGAGCGATCGGGATCTACACGACTCACTGATCGTCGGCAGCGTC (SEQ ID NO: 19); Primer 2 of the NO. 1 adaptor in the form of single-adaptor: TCCTAAGACCGCTTGGCCTCCGACT (SEQ ID NO: 20).

TABLE-US-00017 TABLE 16 Temperature Time Cycle 72° C. 3 min 1 Cycle 98° C. 30 sec 1 Cycle 98° C. 10 sec 15 Cycles 60° C. 30 sec 72° C. 3 min 72° C. 5 min 1 Cycle  4° C. ∞

[0092] 9. PCR product detection result of after interruption by single-adaptor embedding complex and ligation of the gap adaptor is shown in FIG. 4, and the PCR product concentration determination results are shown in Table 17.

TABLE-US-00018 TABLE 17 PCR product concentration Remarks Group Processing method after interruption (ng/μL) (FIG. 4) 1 2 μL protease + 1% Triton-X100 11.4 Lane 1 2 NT buffer + 1% Triton-X100 13 Lane 2 3 1% SDS + 1% Triton-X100 + 12.4 Lane 3 0.5% Tween-20 4 2 μL protease + 14 mM EDTA + 12 Lane 4 1% Triton-X100 5 1 × PBI, 1.3 × Ampure XP beads 13.5 Lane 5 6 0.1 μL protease + 1 mM EDTA + 6.2 — 0.1% Triton-X100 7 5 μL protease + 50 mM EDTA + 10.3 — 2% Triton-X100 8 0.01% SDS + 0.1% Triton-X100 + 5.3 — 0.1% Tween-20 9 1.5% SDS + 2% Triton-X100 + 9.1 — 2% Tween-20 10 0.1 μL protease + 0.1% Triton-X100 6 — 11 5 μL protease + 2% Triton-X100 10.1 —

[0093] The foregoing is a further detailed description of the present invention in reference with the specific embodiments, thus it cannot be determined that the specific implementation of the invention is limited to these above illustrations. It will be apparent to one skilled in the art to which the invention pertains that several simple deductions or substitutions may be made without departing from the inventive concept.