<i>Lactobacillus fermentum </i>GKF3, composition comprising the strain and method for improving psychataxia using the same

Abstract

The present invention provides a Lactobacillus fermentum GKF3, a composition comprising the strain and their use, in which the aforementioned Lactobacillus fermentum GKF3, deposited with accession numbers of BCRC 910824 and CGMCC 15203, can increase the levels of dopamine or/and serotonin in brain tissues, thereby improving the symptoms of the psychataxia such as decreased focus.

Claims

1. A method of improving psychataxia in a subject comprising orally administering to said subject a composition comprising an effective dosage of Lactobacillus fermentum, wherein the Lactobacillus fermentum is Lactobacillus fermentum GKF3 that is deposited in China General Microbiological Culture Collection Center (CGMCC), Chinese Academy of Sciences, Beijing 100101, People's Republic of China, on Jan. 12, 2018 with the accession number CGMCC 15203.

2. The method of claim 1, wherein the composition increases the dopamine release in the brain tissues of the subject orally administered with the composition when compared to a corresponding subject not orally administered with the composition.

3. The method of claim 1, wherein the composition increases the serotonin release in the brain tissues of the subject orally administered with the composition when compared to a corresponding subject not orally administered with the composition.

4. The method of claim 1, wherein symptoms of the psychataxia comprise insomnia, dysautonomia, decreased focus, depression and combination thereof.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The invention can be more fully understood by reading the following detailed description of the embodiment, with reference made to the accompanying drawings as follows.

(2) FIG. 1 is the phylogenetic tree of the recN gene of Lactobacillus fermentum GKF3 and other strains; and

(3) FIG. 2 shows the viable cell numbers of Lactobacillus fermentum GKF3 and other strains in the acid tolerance test.

(4) FIG. 3 shows the viable cell numbers of Lactobacillus fermentum GKF3 and other strains in the bile tolerance test.

(5) FIG. 4 shows the viable cell numbers of Lactobacillus fermentum GKF3 and other strains in the heat tolerance test.

(6) FIG. 5 shows the dopamine levels in the brain tissues of the mice.

(7) FIG. 6 shows the serotonin levels in the brain tissues of the mice.

DETAILED DESCRIPTION

(8) Origin of Strain

(9) A strain of lactic acid bacteria (LAB) used in the experiment was Lactobacillus fermentum of the Lactobacillus genus. In a preferred embodiment, the species was collected from the traditionally pickled and fermented kimchi sold by a street vendor in Beipu Township, Hsinchu County 314, Taiwan. After collection, the samples of strains were sent to a laboratory for isolation.

(10) Strain Screening and Culturing

(11) Bags of the samples were placed in a laminar flow cabinet and were homogenized in ten times the weight of water by a blazer to obtain homogenized samples. Afterwards, 1 mL of each homogenized sample was transferred into De Man, Rogosa and Sharpe (MRS) medium containing 0.1% bromocresol green at 37° C. for 16 hours to increase populations of the Lactobacillus fermentum in the homogenized sample, as well as to increase other lactic acid bacteria (LAB) strains that were found in lower numbers. The homogenized samples were serially diluted after the enrichment culture, thereby obtaining diluted samples. After 10.sup.5-fold and 10.sup.6-fold serial dilution, 0.1 mL aliquots of each diluted sample were respectively transferred onto sterilized Petri dishes, each of which respectively contained culture media such as Rogosa agar, Bifidobacterium lodoacetate Medium 25 (BIM-25) agar, potato starch/yeast extract agar, bromocresol green MRS agar or bromocresol purple MRS agar. After an anaerobic incubation at 37° C. for 40 hours, 15 to 20 single colonies on each agar were isolated to be tested in the following biological assay. RAW 264.7 cells induced by lipopolysaccharide (LPS) was a classical cell model for inflammation research and could be an excellent platform for the investigation of the anti-inflammatory effect of lactic acid bacteria. After the screening test, the high-performance bacterial strains with greater than 80% inhibitory rate of NO and tumor necrosis factor α (TNF-α) in the cell model were first selected. Among these strains with high anti-inflammatory activities, strains with high activities of the tryptophan decarboxylase were further selected for subsequent experiments as they are precursors for the biosynthesis of serotonin.

(12) Genotyping—Phylogenetic Tree

(13) To study the uniqueness of strain Lactobacillus fermentum GKF3 (GKF3) in the evolution of species L. fermentum, the gene sequences of GKF3 and that of five strains of the L. fermentum, BCRC 10360, BCRC 12190, BCRC 12194, BCRC 14056 (same as ATCC 9338, ATCC 14931 and ATCC 11739 which were also deposited American Type Culture Collection, ATCC, Virginia Va. 20110, USA; both of BCRC 12194 and BCRC 14056 were ATCC 11739) and ATCC 23271, purchased from the Bioresource Collection and Research Center (BCRC), Food Industry Research and Development Institute, Hsinchu 30062, Taiwan or American Type Culture Collection (ATCC), Virginia Va. 20110, USA, were compared. Briefly, the GKF3 and the five purchased strains were cultured in mass production, followed by the extraction of the genome DNA (gDNA). Then, PCR was conducted with the primer pairs listed in TABLE 1 with the following conditions: 94° C. for 3 min, 35 cycles of 94° C. for 30 sec, 58° C. for 30 sec and 72° C. for 1 min 10 sec, and finally 72° C. for 5 min.

(14) TABLE-US-00001 TABLE 1 Primer Pairs for recN in PCR Sequence  identifica- tion numbers Name Sequences (SEQ ID NO) Lf-recN-F 5′- ATCCAAGGTCAAAATGAGCA -3′ SEQ ID NO: 01 Lf-recN-R 5′- CTTCAACCCGTTGGTTAGTG -3′ SEQ ID NO: 02

(15) After the aforementioned reactions, DNA sequencing was performed to obtain recN gene sequences of GKF3 (SEQ ID NO: 03) and five purchased strains, followed by a recN gene phylogenetic tree constructed by a MEGA X software with a Neighbor-Joining mode. FIG. 1 was the phylogenetic tree of the recN gene of Lactobacillus fermentum GKF3 and other strains, in which the horizontal lines were branches representing evolutionary changes measured in a unit of genetic divergence, and the bar at the bottom was the scale of the branch lengths. Within the recN gene phylogenetic tree, GKF3 was a single branch itself separated from the other strains. The result indicated that in the view of genetic differences, the GKF3 was obviously different from known Lactobacillus spp. strains and was identified as a new Lactobacillus spp. strain. Therefore, the GKF3 was named as Lactobacillus fermentum GKF3 and deposited with the accession number of BCRC 910824 in Bioresource Collection and Research Center (BCRC), Food Industry Research and Development Institute, Hsinchu 30062, Taiwan, on Feb. 12, 2018, followed by a viability test on Mar. 1, 2018. The GKF3 was also deposited with an accession number of CGMCC 15203 in China General Microbiological Culture Collection Center (CGMCC), Chinese Academy of Sciences, Beijing 100101, People's Republic of China, on Jan. 12, 2018, followed by the viability test on the same day.

(16) Phenotypic Analysis—Acid Tolerance Test

(17) GKF3 and other four strains purchased from BCRC or ATCC, ATCC 23271, BCRC 12190, BCRC 12194 and BCRC 10360, were recovered. By adding HCl into original De Man, Rogosa and Sharpe (MRS) liquid media, a pH value of the original MRS liquid medium was adjusted from 6.5 to three different pH values: pH 3.2, pH 2.4 and pH 2.0. The strains were inoculated in the aforementioned MRS liquid media with different pH values and incubated at 37° C. for 3 hours, followed by serial dilution, spread plate, incubation and finally colony count. Experimental results were shown in TABLE 2 and FIG. 2.

(18) FIG. 2 represented cell numbers of L. fermentum GKF3 and other strains in the acid tolerance test. The horizontal axis represented the pH values, and the vertical axis showed the cell numbers as log colony-forming units per milliliter (CFU)/mL. The bars 201, 203, 205, 207 and 209 represented the GKF3, ATCC 23271, BCRC 12190, BCRC 12194 and BCRC 10360, respectively. The symbols “*” and “#” represented significant differences in cell numbers between GKF3 and the other purchased strains at pH 2.4 and pH 2.0, respectively (p<0.05).

(19) As shown in TABLE 2 and FIG. 2, the cell numbers of GKF3 (bar 201) and the other four strains (bars 203, 205, 207 and 209) reached 10.sup.10 CFU/mL when cultured in the original pH value of about 6.5. When the pH value was set to 3.2, the cell numbers of all the strains slightly decreased, and there was no statistically significant difference in the cell number between GKF3 and the other four strains. When the pH value of the culture medium decreased to pH 2.4, the cell numbers of ATCC 23271 (bar 203), BCRC 12190 (bar 207) and BCRC 10360 (bar 209) were significantly lower than that of GKF3 (bar 201, p<0.05), except for BCRC 12194 (bar 205). When the pH value of the culture medium decreased to pH 2.0, the cell numbers of ATCC 23271 (bar 203), BCRC 12190 (bar 205), BCRC 12194 (bar 207) and BCRC 10360 (bar 209) decreased to about 10.sup.4 CFU/mL and were significantly lower than that of GKF3 (bar 201, p<0.05), which remained its cell number to be 10.sup.5 CFU/mL. Accordingly, the viable cell number of GKF3 was significantly higher than that of other strains in an acidic environment, indicating that GKF3 had a better acid tolerance than that of the other strains, and thus GKF3 was more resistant to gastric acid when passing through the stomach.

(20) TABLE-US-00002 TABLE 2 Cell Numbers of GKF3 and Other Strains in Acid Tolerance Test pH value GKF3 ATCC 23271 BCRC 12190 BCRC 12194 BCRC 10360 pH 6.5 10.0 ± 0.20  9.7 ± 0.30 9.9 ± 0.30 9.9 ± 0.41 10.0 ± 0.50 .sup.  pH 3.2 9.6 ± 0.59 9.5 ± 0.11 9.2 ± 0.20 9.8 ± 0.20 9.4 ± 0.30.sup.  pH 2.4 7.9 ± 0.00  6.1 ± 0.22* 7.1 ± 0.67  6.8 ± 0.34* .sup. 5.3 ± 0.34* pH 2.0 5.1 ± 0.15 .sup. 3.1 ± 0.39.sup.# .sup. 3.1 ± 0.31.sup.# .sup. 4.2 ± 0.30.sup.# 3.5 ± 0.20.sup.# Values were presented as mean ± standard deviation (SD) (n = 3) and the unit was log CFU/mL. *represented a significant difference compared to GKF3 (pH 2.4; p < 0.05). .sup.#represented a significant difference compared to GKF3 (pH 2.0; p < 0.05).

(21) Phenotypic Analysis—Bile Tolerance Test

(22) GKF3, ATCC 23271, BCRC 12190, BCRC 12194 and BCRC 10360, were recovered. These strains were inoculated in an MRS liquid medium with 0.3% bile salt and cultured at 37° C. for half an hour, followed by serial dilution, spread plate, incubation and finally colony count. Experimental results were shown in TABLE 3 and FIG. 3.

(23) FIG. 3 represented cell numbers of L. fermentum GKF3 and other strains in the bile tolerance test. The horizontal axis represented the medium content, and the vertical axis represented the cell numbers. The bars 301, 303, 305, 307 and 309 represented the GKF3, ATCC 23271, BCRC 12190, BCRC 12194 and BCRC 10360, respectively. The symbol “*” represented a significant difference in cell numbers between GKF3 and the other strains (p<0.05).

(24) As shown in TABLE 3 and FIG. 3, the cell number of GKF3 (bar 301) and that of the other four strains (bars 303, 305, 307 and 309) reached 10.sup.9 CFU/mL when the culture took place in the original MRS liquid medium. In the MRS liquid medium with 0.3% bile salt, the cell numbers of all strains except GKF3 decreased to 10.sup.7 CFU/mL and were statistically lower than that of GKF3 (p<0.05). Accordingly, the viable cell number of the GKF3 was significantly higher than that of the other strains in an environment with a bile salt, indicating that the GKF3 had a better bile resistance than that of the other strains, and thus the GKF3 had a better ability to endure bile salt when passing through the digestive tract.

(25) TABLE-US-00003 TABLE 3 Cell Numbers of GKF3 and Other Strains in Bile Tolerance Test. Bile salt amount GKF3 ATCC 23271 BCRC 12190 BCRC 12194 BCRC 10360 MRS 9.1 ± 0.95 9.2 ± 0.68  9.4 ± 0.23  9.0 ± 0.57  9.4 ± 0.70  MRS + 8.1 ± 0.56 7.1 ± 0.47* 7.3 ± 0.34* 7.2 ± 0.24* 7.2 ± 0.50* 0.3% bile salt Values were presented as mean ± SD (n = 3) and the unit was log CFU/mL. *represented a significant difference compared to the GKF3 (MRS + 0.3% bile salt, p < 0.05).

(26) Phenotypic Analysis—Heat Tolerance Test

(27) GKF3 was compared with other strains in the heat tolerance test after GKF3 and other four strains, ATCC 23271, BCRC 12190, BCRC 12194 and BCRC 10360, were recovered. These five strains were heated respectively at 70° C. for 5, 10 and 15 min in a water bath, followed by serial dilution, spread plate, incubation and finally colony count. Experimental results were shown in TABLE 4 and FIG. 4.

(28) FIG. 4 represented cell numbers of L. fermentum GKF3 and other strains in the heat tolerance test. The horizontal axis represented the time period of heating, and the vertical axis represented the cell numbers. The bars 401, 403, 405, 407 and 409 represented the GKF3, ATCC 23271, BCRC 12190, BCRC 12194 and BCRC 10360, respectively. The symbol “*” and “#” represented a significant difference in cell numbers between GKF3 and the other purchased strains heated for 10 min and 15 min, respectively (p<0.05).

(29) As shown in TABLE 4 and FIG. 4, the cell numbers of the GKF3 and the other four strains reached 10.sup.9 CFU/mL without being heated (0 min). When heated at 70° C. for 5 min, the cell numbers of all the strains decreased to 10.sup.6 CFU/mL. When heated at 70° C. for 15 min, the cell numbers of ATCC 23271 (bar 403), BCRC 12190 (bar 405), BCRC 12194 (bar 407) and BCRC 10360 (bar 409) dramatically decreased to about 10.sup.4 CFU/mL and were significantly lower than that of the GKF3 (bar 401), which remained its cell numbers at 10.sup.5 CFU/mL (p<0.05). Accordingly, the viable cell number of the GKF3 was significantly higher than that of other strains in a high-temperature environment, indicating that the GKF3 has a better heat tolerance and better stability in the high-temperature environment.

(30) TABLE-US-00004 TABLE 4 Cell Numbers of GKF3 and Other Strains in Heat Tolerance Test. Heating time GKF3 ATCC 23271 BCRC 12190 BCRC 12194 BCRC 10360 0 9.3 ± 1.3 9.2 ± 1.0 9.2 ± 0.6 9.2 ± 0.9 9.4 ± 0.7  5 min 6.8 ± 1.1 6.3 ± 0.6 6.6 ± 1.0 6.4 ± 1.0 6.0 ± 0.6 10 min 6.4 ± 1.2 6.1 ± 0.4 6.0 ± 0.8 5.7 ± 0.6  5.1 ± 0.5* 15 min 5.7 ± 0.3 .sup. 5.0 ± 0.4.sup.# .sup. 4.2 ± 0.3.sup.# .sup. 4.3 ± 0.5.sup.# .sup. 4.1 ± 0.4.sup.# Values were presented as mean ± SD (n = 3) and the unit was log CFU/mL. *represented a significant difference compared to the GKF3 (10 min) (p < 0.05). .sup.#represented a significant difference compared to the GKF3 (15 min) (p < 0.05)

(31) Strain Culture

(32) An isolated colony of the aforementioned L. fermentum GKF3 was inoculated into a liquid culture medium to perform a liquid culture. In a preferred embodiment, the liquid culture was performed under a condition with a temperature of 25 to 40° C., ventilation of 0 to 1 vvm of N.sub.2 or CO.sub.2, and a rotational speed of 250 to 1000 rounds per minutes (rpm). In a preferred embodiment, the time period for the liquid culture was 16 to 24 hours, but best for 18 hours, at which viable cell numbers reached the highest point. In a preferred embodiment, the liquid culture medium was the MRS liquid culture medium. In a preferred embodiment, a formula of the liquid culture medium was shown in TABLE 5. Then, the mass production of GKF3 was performed to obtain a whole fermented liquid.

(33) TABLE-US-00005 TABLE 5 Ingredient Ratio (weight percentage) Glucose 1.00 to 10.00% Yeast extract 0.10 to 5.00% Peptone 0.10 to 5.00% Micronutritions 0.01 to 2.00% Cysteine 0.01 to 0.10% Tween-80 0.05 o 1.00%

(34) Preparation of Lyophilized Powder

(35) After the L. fermentum GKF3 underwent the mass production, the whole fermented liquid was collected and centrifuged to obtain pellets. In a preferred embodiment, 15 weight % (wt %) skim milk powder was added into the whole fermented liquid and incubated for 1 to 4 hours, so that the bacteria gathered into clots to increase the recovery rate, followed by centrifuging at a rotational speed of 1000 to 15000 rpm. The obtained pellet was mixed with a protection agent (6 wt % to 50 wt % skim milk powder) and lyophilized to obtain a lyophilized powder. Finally, the lyophilized powder was placed in the cold room for cryopreservation. In a preferred embodiment, the temperature and the time period for the lyophilization was programmed in gradients, in which the pellet was lyophilized first at 0° C. to −20° C. for 1 to 4 hours, −15° C. to −40° C. for the next 4 to 8 hours, and then frozen under −196° C. to −40° C. for more than 8 hours. In a preferred embodiment, the pellet was lyophilized under −5° C. for 2 hours, followed by −20° C. for 6 hours, and then the pellet is frozen under −50° C. for 16 hours. In a preferred embodiment, a temperature for the cryopreservation was −30° C. to 0° C. The lyophilized powder was then used as a test sample for animal administration for the following animal experiments. The dosage forms of the L. fermentum GKF3 in use of this invention could include but be not limited to the aforementioned lyophilized powder, the aforementioned whole fermented liquid including the bacteria and the liquid culture medium, as well as the pellet obtained by centrifuging the whole fermented liquid.

(36) Experimental Animal

(37) 30 male ICR mice weighed about 20 g to 25 g per mice, were purchased from BioLASCO, Nangang District, Taipei, Taiwan. The mice were kept in regular cages having a stable environment of 23±2° C. room temperature, 50±5% humidity and a 12:12 light/dark cycle. The mice were given ad libitum accesses to feed and sterilized reverse osmosis water. All the process of the animal experiment was reviewed and approved by the regulation of Institutional Animal Care and Use Committee (IACUC) of Hung Kuang University, Taiwan.

(38) Feed and distilled drinking water were given to the experimental animals for a week to allow them to acclimatize in the laboratory environment. Then, the experimental animals were randomly grouped into five groups, a control group and four experimental groups A to D, with six mice each.

(39) Experimental Design

(40) The four different strains used for the experimental groups A to D were listed in TABLE 6. The four LAB mixed with saline solutions were orally administered to the mice once per day for four weeks while an equal volume of 0.9% saline was fed to the control group. This route of administration is carried out using a stainless steel-made feeding needle, which was usually soaked in the 75% ethanol solution, was rinsed and washed with the 0.9% saline before use.

(41) TABLE-US-00006 TABLE 6 Group Feeding sample Control None Experimental Lactobacillus plantarum (BCRC 910787; CGMCC 14565) Group A Experimental Lactobacillus fermentum (ATCC 23271) Group B Experimental Lactobacillus fermentum GKF3 (BCRC 910824; CGMCC Group C 15203) Experimental Lactobacillus acidophilus (BCRC 14064; ATCC 314) Group D

(42) Before administration, all the mice were weighed once a week to calculate the average weights for each group. The daily oral administration dosage was calculated based on the body surface area, in which the conversion factor of a human adult to a mouse is 12.3. Therefore, the daily oral administration dosage for the mouse (body weight 25 g for a mouse) was converted from the daily dosage (1000 mg, equivalent to about 10.sup.11 viable bacteria) of a human adult (body weight 60 kg) according to the formula (I) listed below:
The daily oral administration dosage of the test sample for a mouse (g)={Daily dosage for a human adult/60 kg (the weight of a human adult)}×weight of a mouse (kg)×12.3 (the conversion factor of a human adult a mouse)  (I)

(43) According to the aforementioned formula (I), the daily oral administration dosage for the experimental groups was 205 mg/kg, equivalent to 5.125 mg for a 25 g mouse.

(44) The mice from each experimental group were restrained for 14 days to induce psychataxia prior to the initiation of any procedures. The mice were restrained in a transparent restrainer (100×40 mm) for two hours per day. After the four week period, the mice were anesthetized and then sacrificed. The blood samples were collected in ethylenediaminetetraacetic acid (EDTA) tubes, centrifuged at 4° C. and preserved at −80° C. The total hippocampi of the mice were removed immediately, homogenized in a cold saline solution and centrifuged at 4° C. for 10 min (13000×g). The supernatant was collected and preserved at −80° C. for subsequent biochemical evaluation.

(45) Determination of Dopamine Levels

(46) Usually, mice with low levels of dopamine and/or serotonin would have symptoms such as insomnia, dysautonomia, reduced focus, depression, i.e., having psychataxia. Therefore, the dopamine level in the brain was analyzed by a commercially available ELISA kit (Novus Biologicals, Littleton Colo., USA).

(47) The dopamine levels in the brain tissues of the mice for each group were shown in FIG. 5. FIG. 5 showed the dopamine levels in the brain tissues of the mice, in which the vertical axis represented the dopamine level, and the bars 501, 503, 505, 507 and 509 represented the control group, the experimental groups A, B, C and D, respectively. The symbol “*” represented a significant difference. The dopamine levels of the mice that were restrained to induce psychataxia were significantly lower. The mice administered with the L. fermentum GKF3 (the experimental group C) during the experiment process had significantly higher dopamine levels in the brain tissues compared to that of the control group (p<0.05). Compared to the other LAB strains, e.g., L. plantarum (BCRC 910787), L. fermentum (ATCC 23271) and L. acidophilus (BCRC 14064), L. fermentum GKF3 had a more statistically significant effect on dopamine release.

(48) Determination of Serotonin Level

(49) A serotonin (5-HT) level in the brain was analyzed by a commercially available ELISA kit (Novus Biologicals, Littleton Colo., USA). The serotonin levels in the brain tissues of the mice for each group were shown in FIG. 6. FIG. 6 showed the serotonin levels in the brain tissues of the mice, in which the vertical axis represented the serotonin levels, and the bars 601, 603, 605, 607 and 609 represented the control group and the experimental groups A, B, C and D, respectively. The symbol “*” represented a significant difference. The serotonin levels of the mice that were restrained to induce psychataxia were significantly lower. The mice administered with the L. fermentum GKF3 (experimental group C) during the experiment process had significantly higher serotonin levels in the brain tissues compared to that of the control group (p<0.05). Compared to other LAB strains, e.g., L. plantarum (BCRC 910787), L. fermentum (ATCC 23271) and L. acidophilus (BCRC 14064), L. fermentum GKF3 had a more statistically significant effect on serotonin release.

(50) Statistical Data Analysis

(51) The experimental results were showed as means±SD and analyzed with commercially available analysis software, SPSS (the 12th edition). The differences were compared in the mean values between each group by one-way analysis of variance (ANOVA), followed by Duncan's multiple comparisons for post hoc tests. p<0.05 was considered statistical significance.

(52) To sum up, the L. fermentum GKF3 was able to effectively increase the dopamine level and the serotonin level in the brain tissues of the mice that were restrained to induce psychataxia and thus decreased the occurrence risk of the psychataxia resulted from stress.

(53) The present invention provides a composition including Lactobacillus fermentum GKF3, in which the composition has the effect to improve psychataxia.

(54) Optionally, the composition can further include an additive. In a preferred embodiment, the additive can be an excipient, a preservative, a diluent, filler, an absorbefacient and a sweetener and the combination thereof. The excipient can be essentially selected from citric acid, calcium carbonate, tricalcium diphosphate, sucrose, or any combination of the above. The preservative can extend the shelf life of the composition, such as benzyl alcohol and parabens. The diluent can be essentially selected from a group consisting of water, ethyl alcohol, propylene glycol, glycerol, or any combination of the above. The filler can be essentially selected from a group consisting of lactose, galactose, high molecular weight polyethylene glycol or any combination of the above. The absorbefacient can be essentially selected from dimethyl sulfoxide (DMSO), azone, propylene glycol, glycerol and any combination of the above. The sweetener can be essentially selected from Acesulfame K, aspartame, saccharin, sucralose, neotame or any combination of the above. Except for the additives listed above, other proper additives can be selected under the premise that the medical effects of the active substance of lactic acid bacteria are not affected.

(55) The composition can be developed into different products based on market demand. In a preferred embodiment, the composition can be developed into a drug, a feed, a drink, a nutritional supplement, a dairy product, a food or health food.

(56) The composition can be adapted to different forms based on the requirement of the subject. In a preferred embodiment, the form of the composition can be powder, a tablet, a pellet, a suppository, a microcapsule, an ampoule, a liquid or a spray.

(57) The composition can be applied to animals or humans. Without affecting the function of the Lactobacillus fermentum GKF3, the composition of the LAB can be made in any drug form and applied to animals or humans in a preferred way based on the drug form.

(58) Preparation of Composition

(59) The following aspect of composition 1 was shown as an example when GKF3 is applied in the use of food.

(60) Composition 1: The lyophilized powder of Lactobacillus fermentum GKF3 (20 weight %, or wt %) was mixed completely with the preservative benzyl alcohol (8 wt %), diluent glycerol (7 wt %) and pure water (65 wt %) before storing at 4° C. The aforementioned wt % denoted the weight ratio of each composite accounting in the total weight of the composition.

(61) The following aspect of composition 2 was shown as an example when the Lactobacillus fermentum GKF3 was applied as a liquid for medical use.

(62) Composition 2: The lyophilized powder of Lactobacillus fermentum GKF3 (20 wt %) are mixed completely with the preservative benzyl alcohol (8 wt %), diluent glycerol (7 wt %), excipient sucrose (10 wt %) and pure water (55 wt %) before storing at 4° C. The aforementioned wt % denoted the weight ratio of each composite accounting in the total weight of the composition.