Genomewide unbiased identification of DSBs evaluated by sequencing (GUIDE-Seq)
09822407 · 2017-11-21
Assignee
Inventors
Cpc classification
International classification
Abstract
Unbiased, genomewide and highly sensitive methods for detecting mutations, e.g., off-target mutations, induced by engineered nucleases.
Claims
1. A method for detecting double stranded breaks (DSBs) in genomic DNA (gDNA) of a cell, the method comprising: contacting the cell with a blunt-ended double-stranded oligodeoxynucleotide (dsODN), wherein both strands of the dsODN are orthogonal to the genome of the cell, and further wherein (a) the 5′ ends of the dsODN are phosphorylated, and (b) phosphorothioate linkages are present on both 3′ ends, or phosphorothioate linkages are present on both 3′ ends and both 5′ ends; expressing or activating an exogenous engineered nuclease in the cell, for a time sufficient for the nuclease to induce DSBs in the genomic DNA of the cell, and for the cell to repair the DSBs, integrating a dsODN at one or more DSBs; amplifying a portion of genomic DNA comprising an integrated dsODN; and sequencing the amplified portion of the genomic DNA, thereby detecting a DSB in the genomic DNA of the cell.
2. The method of claim 1, wherein amplifying a portion of the genomic DNA comprises: fragmenting the DNA; ligating ends of the fragmented genomic DNA from the cell with a universal adapter; and performing polymerase chain reaction (PCR) on the ligated DNA.
3. The method of claim 1, wherein the engineered nuclease is selected from the group consisting of meganucleases, zinc-finger nucleases, transcription activator effector-like nucleases (TALEN), and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas RNA-guided nucleases (CRISPR/Cas RGNs).
4. The method of claim 1, wherein the DSBs are off-target DSBs.
5. The method of claim 1, wherein the cell is a mammalian cell.
6. The method of claim 1, wherein the engineered nuclease is a Cas9 nuclease, and the method also includes expressing in the cells a guide RNA that directs the Cas9 nuclease to a target sequence in the genome.
7. The method of claim 1, wherein the dsODN is 30-35 nts long.
8. The method of claim 1, wherein the dsODN is phosphorylated on the 5′ ends, and phosphorothioated on the 3′ ends.
9. The method of claim 1, wherein the dsODN contains a randomized DNA barcode.
10. The method claim 1, comprising: shearing the gDNA into fragments; and preparing the fragments for sequencing by end-repair, a-tailing, and ligation of a single-tailed sequencing adapter.
11. The method of claim 1, wherein the dsODN is between 15 and 50 nts long.
12. A method of determining which of a plurality of guide RNAs is most specific, the method comprising: contacting a first population of cells with a first guide RNA and a blunt-ended double-stranded oligodeoxynucleotide (dsODN), wherein both strands of the dsODN are orthogonal to the genome of the cell, and further wherein (a) the 5′ ends of the dsODN are phosphorylated, and (b) phosphorothioate linkages are present on both 3′ ends, or phosphorothioate linkages are present on both 3′ ends and both 5′ ends; expressing or activating an exogenous Cas9 engineered nuclease in the first population of cells, for a time sufficient for the nuclease to induce DSBs in the genomic DNA of the cells, and for the cells to repair the DSBs, integrating a dsODN at one or more DSBs; amplifying a portion of genomic DNA from the first population of cells comprising an integrated dsODN; sequencing the amplified portion of the genomic DNA from the first population of cells; determining a number of sites at which the dsODN integrated into the genomic DNA of the first population of cells; contacting a second population of cells with a second guide RNA and a blunt-ended double-stranded oligodeoxynucleotide (dsODN), wherein both strands of the dsODN are orthogonal to the genome of the cell, and further wherein (a) the 5′ ends of the dsODN are phosphorylated, and (b) phosphorothioate linkages are present on both 3′ ends, or phosphorothioate linkages are present on both 3′ ends and both 5′ ends; expressing or activating an exogenous Cas9 engineered nuclease in the second population of cells, for a time sufficient for the nuclease to induce DSBs in the genomic DNA of the second population of cells, and for the cells to repair the DSBs, integrating a dsODN at one or more DSBs; amplifying a portion of genomic DNA comprising an integrated dsODN from the second population of cells; sequencing the amplified portion of the genomic DNA from the second population of cells; determining a number of sites at which the dsODN integrated into the genomic DNA of the second population of cells; and comparing the number of sites at which the dsODN integrated into the genomic DNA of the first population of cells to the number of sites at which the dsODN integrated into the genomic DNA of the second population of cells to determine if the first or second guide RNA is more specific.
Description
DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6) TABLE-US-00001 TARGET SITE SEQ ID NO: VEGFA SITE 1 273 VEGFA SITE 2 274 RNF2 275 HEK293 SITE 1 276 VEGFA SITE 3 277 EMX1 278 HEK293 SITE 2 279 HEK293 SITE 3 280 FANCF 281 HEK293 SITE 4 282 (E) Numbers of previously known and novel off-target cleavage sites identified by GUIDE-Seq for the ten RGNs analyzed in this study. All previously known off-target cleavage for 4 RGNs were identified by GUIDE-seq. (F) Scatterplot of on-target site orthogonality to the human genome (y-axis) versus total number of off-target sites detected by GUIDE-Seq for the ten RGNs of this report. Orthogonality was calculated as the total number of sites in the human genome bearing 1 to 6 mismatches relative to the on-target site. (G) Scatterplot of on-target site GC content (y-axis) versus total number of off-target sites detected by GUIDE-Seq for the ten RGNs of this report. (H) Chromosome ideogram of CRISPR/Cas9 on- and off-target sites for the RGN that targets EMX1. Additional ideograms for the remaining RGNs can be found in
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
DETAILED DESCRIPTION
(27) The Genomewide Unbiased Identification of DSBs Evaluated by Sequencing (GUIDE-Seq) methods described herein provide highly sensitive, unbiased, and genome-wide methods for identifying the locations of engineered nuclease cleavage sites in living cells, e.g., cells in which the non-homologous end-joining (NHEJ) repair pathway is active. In some embodiments, the method relies on the capture of short double-stranded oligodeoxynucleotides (dsODNs) into nuclease-induced breaks (a process presumed to be mediated by the NHEJ pathway) and then the use of the inserted dsODN sequence to identify the sites of genomic insertion, e.g., using a PCR-based deep sequencing approach in which the inserted dsODN sequence is used to selectively amplify the sites of genomic insertion for high-throughput sequencing, or selectively pulling down genomic fragments including the inserted dsODNs using an attached tag such as biotin, e.g., using solution hybrid capture. Described herein is the development and validation of the GUIDE-Seq method in cultured human cells; the general approach described herein should work in all mammalian cells and in any cell type or organism in which the NHEJ pathway is active or presumed to be active.
(28) The potential off-target sites identified by this initial sequencing process might also be analyzed for indel mutations characteristic of NHEJ repair in cells in which only the nuclease components are expressed. These experiments, which could be performed using amplification followed by deep sequencing, would provide additional confirmation and quantitation of the frequency of off-target mutations induced by each nuclease.
(29) Double-Stranded Oligodeoxynucleotides (dsODNs)
(30) In the methods described herein, a non-naturally occurring dsODN is expressed in the cells. In the present methods, both strands of the dsODN are orthogonal to the genome of the cell (i.e., are not present in or complementary to a sequence present in, i.e., have no more than 10%, 20%, 30%, 40%, or 50% identity to a sequence present in, the genome of the cell). The dsODNs can preferably be between 15 and 75 nts long, e.g., 15-50 nts, 50-75 nts, 30-35 nts, 60-65 nts, or 50-65 nts long, or between 15 and 50 nts long, e.g., 20-40 or 30-35, e.g., 32-34 nts long. Each strand of the dsODN should include a unique PCR priming sequence (i.e., the dsODN includes two PCR primer binding sites, one on each strand). In some embodiments, the dsODN includes a restriction enzyme recognition site, preferably a site that is relatively uncommon in the genome of the cell.
(31) The dsODNs are preferably modified; preferably, the 5′ ends of the dsODN are phosphorylated; and also preferably, two phosphorothioate linkages are present on both 3′ ends and both 5′ ends. In preferred embodiments, the dsODN is blunt ended. In some embodiments, the dsODNs include a random variety of 1, 2, 3, 4 or more nucleotide overhangs on the 5′ or 3′ ends.
(32) The dsODN can also include one or more additional modifications, e.g., as known in the art or described in PCT/US2011/060493. For example, in some embodiments, the dsODN is biotinylated. The biotinylated version of the GUIDE-seq dsODN tag is used as a substrate for integration into the sites of genomic DSBs. The biotin can be anywhere internal to the dsODN (e.g., a modified thymidine residue (Biotin-dT) or using biotin azide), but not on the 5′ or 3′ ends. As shown in Example 4, it is possible to integrate such an oligo efficiently. This provides an alternate method of recovering fragments that contain the GUIDE-seq dsODN tag. Whereas in some embodiments, these sequences are retrieved and identified by nested PCR, in this approach they are physically pulled down by using the biotin, e.g., by binding to streptavidin-coated magnetic beads, or using solution hybrid capture; see, e.g., Gnirke et al., Nature Biotechnology 27, 182-189 (2009). The primary advantage is retrieval of both flanking sequences, which reduces the dependence on mapping sequences to a reference genome to identify off-target cleavage sites.
(33) Engineered Nucleases
(34) There are four main classes of engineered nucleases: 1) meganucleases, 2) zinc-finger nucleases, 3) transcription activator effector-like nucleases (TALEN), and 4) Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Cas RNA-guided nucleases (RGN). See, e.g., Gaj et al., Trends Biotechnol. 2013 July; 31(7):397-405. The nuclease can be transiently or stably expressed in the cell, using methods known in the art; typically, to obtain expression, a sequence encoding a protein is subcloned into an expression vector that contains a promoter to direct transcription. Suitable eukaryotic expression systems are well known in the art and described, e.g., in Sambrook et al., Molecular Cloning, A Laboratory Manual (4th ed. 2013); Kriegler, Gene Transfer and Expression: A Laboratory Manual (2006); and Current Protocols in Molecular Biology (Ausubel et al., eds., 2010). Transformation of eukaryotic and prokaryotic cells are performed according to standard techniques (see, e.g., the reference above and Morrison, 1977, J. Bacteriol. 132:349-351; Clark-Curtiss & Curtiss, Methods in Enzymology 101:347-362 (Wu et al., eds, 1983).
(35) Homing Meganucleases
(36) Meganucleases are sequence-specific endonucleases originating from a variety of organisms such as bacteria, yeast, algae and plant organelles. Endogenous meganucleases have recognition sites of 12 to 30 base pairs; customized DNA binding sites with 18 bp and 24 bp-long meganuclease recognition sites have been described, and either can be used in the present methods and constructs. See, e.g., Silva, G, et al., Current Gene Therapy, 11:11-27, (2011); Arnould et al., Journal of Molecular Biology, 355:443-58 (2006); Arnould et al., Protein Engineering Design & Selection, 24:27-31 (2011); and Stoddard, Q. Rev. Biophys. 38, 49 (2005); Grizot et al., Nucleic Acids Research, 38:2006-18 (2010).
(37) CRISPR-Cas Nucleases
(38) Recent work has demonstrated that clustered, regularly interspaced, short palindromic repeats (CRISPR)/CRISPR-associated (Cas) systems (Wiedenheft et al., Nature 482, 331-338 (2012); Horvath et al., Science 327, 167-170 (2010); Terns et al., Curr Opin Microbiol 14, 321-327 (2011)) can serve as the basis of a simple and highly efficient method for performing genome editing in bacteria, yeast and human cells, as well as in vivo in whole organisms such as fruit flies, zebrafish and mice (Wang et al., Cell 153, 910-918 (2013); Shen et al., Cell Res (2013); Dicarlo et al., Nucleic Acids Res (2013); Jiang et al., Nat Biotechnol 31, 233-239 (2013); Jinek et al., Elife 2, e00471 (2013); Hwang et al., Nat Biotechnol 31, 227-229 (2013); Cong et al., Science 339, 819-823 (2013); Mali et al., Science 339, 823-826 (2013c); Cho et al., Nat Biotechnol 31, 230-232 (2013); Gratz et al., Genetics 194(4):1029-35 (2013)). The Cas9 nuclease from S. pyogenes (hereafter simply Cas9) can be guided via simple base pair complementarity between 17-20 nucleotides of an engineered guide RNA (gRNA), e.g., a single guide RNA or crRNA/tracrRNA pair, and the complementary strand of a target genomic DNA sequence of interest that lies next to a protospacer adjacent motif (PAM), e.g., a PAM matching the sequence NGG or NAG (Shen et al., Cell Res (2013); Dicarlo et al., Nucleic Acids Res (2013); Jiang et al., Nat Biotechnol 31, 233-239 (2013); Jinek et al., Elife 2, e00471 (2013); Hwang et al., Nat Biotechnol 31, 227-229 (2013); Cong et al., Science 339, 819-823 (2013); Mali et al., Science 339, 823-826 (2013c); Cho et al., Nat Biotechnol 31, 230-232 (2013); Jinek et al., Science 337, 816-821 (2012)).
(39) In some embodiments, the present system utilizes a wild type or variant Cas9 protein from S. pyogenes or Staphylococcus aureus, either as encoded in bacteria or codon-optimized for expression in mammalian cells. The guide RNA is expressed in the cell together with the Cas9. Either the guide RNA or the nuclease, or both, can be expressed transiently or stably in the cell.
(40) TAL Effector Repeat Arrays
(41) TAL effectors of plant pathogenic bacteria in the genus Xanthomonas play important roles in disease, or trigger defense, by binding host DNA and activating effector-specific host genes. Specificity depends on an effector-variable number of imperfect, typically ˜33-35 amino acid repeats. Polymorphisms are present primarily at repeat positions 12 and 13, which are referred to herein as the repeat variable-diresidue (RVD). The RVDs of TAL effectors correspond to the nucleotides in their target sites in a direct, linear fashion, one RVD to one nucleotide, with some degeneracy and no apparent context dependence. In some embodiments, the polymorphic region that grants nucleotide specificity may be expressed as a triresidue or triplet.
(42) Each DNA binding repeat can include a RVD that determines recognition of a base pair in the target DNA sequence, wherein each DNA binding repeat is responsible for recognizing one base pair in the target DNA sequence. In some embodiments, the RVD can comprise one or more of: HA for recognizing C; ND for recognizing C; HI for recognizing C; HN for recognizing G; NA for recognizing G; SN for recognizing G or A; YG for recognizing T; and NK for recognizing and one or more of: HD for recognizing C; NG for recognizing T; NI for recognizing A; NN for recognizing G or A; NS for recognizing A or C or G or T; N* for recognizing C or T, wherein * represents a gap in the second position of the RVD; HG for recognizing T; H* for recognizing T, wherein * represents a gap in the second position of the RVD; and IG for recognizing T.
(43) TALE proteins may be useful in research and biotechnology as targeted chimeric nucleases that can facilitate homologous recombination in genome engineering (e.g., to add or enhance traits useful for biofuels or biorenewables in plants). These proteins also may be useful as, for example, transcription factors, and especially for therapeutic applications requiring a very high level of specificity such as therapeutics against pathogens (e.g., viruses) as non-limiting examples.
(44) Methods for generating engineered TALE arrays are known in the art, see, e.g., the fast ligation-based automatable solid-phase high-throughput (FLASH) system described in U.S. Ser. No. 61/610,212, and Reyon et al., Nature Biotechnology 30, 460-465 (2012); as well as the methods described in Bogdanove & Voytas, Science 333, 1843-1846 (2011); Bogdanove et al., Curr Opin Plant Biol 13, 394-401 (2010); Scholze & Boch, J. Curr Opin Microbiol (2011); Boch et al., Science 326, 1509-1512 (2009); Moscou & Bogdanove, Science 326, 1501 (2009); Miller et al., Nat Biotechnol 29, 143-148 (2011); Morbitzer et al., T. Proc Natl Acad Sci USA 107, 21617-21622 (2010); Morbitzer et al., Nucleic Acids Res 39, 5790-5799 (2011); Zhang et al., Nat Biotechnol 29, 149-153 (2011); Geissler et al., PLoS ONE 6, e19509 (2011); Weber et al., PLoS ONE 6, e19722 (2011); Christian et al., Genetics 186, 757-761 (2010); Li et al., Nucleic Acids Res 39, 359-372 (2011); Mahfouz et al., Proc Natl Acad Sci USA 108, 2623-2628 (2011); Mussolino et al., Nucleic Acids Res (2011); Li et al., Nucleic Acids Res 39, 6315-6325 (2011); Cermak et al., Nucleic Acids Res 39, e82 (2011); Wood et al., Science 333, 307 (2011); Hockemeye et al. Nat Biotechnol 29, 731-734 (2011); Tesson et al., Nat Biotechnol 29, 695-696 (2011); Sander et al., Nat Biotechnol 29, 697-698 (2011); Huang et al., Nat Biotechnol 29, 699-700 (2011); and Zhang et al., Nat Biotechnol 29, 149-153 (2011); all of which are incorporated herein by reference in their entirety.
(45) Zinc Fingers
(46) Zinc finger proteins are DNA-binding proteins that contain one or more zinc fingers, independently folded zinc-containing mini-domains, the structure of which is well known in the art and defined in, for example, Miller et al., 1985, EMBO J., 4:1609; Berg, 1988, Proc. Natl. Acad. Sci. USA, 85:99; Lee et al., 1989, Science. 245:635; and Klug, 1993, Gene, 135:83. Crystal structures of the zinc finger protein Zif268 and its variants bound to DNA show a semi-conserved pattern of interactions, in which typically three amino acids from the alpha-helix of the zinc finger contact three adjacent base pairs or a “subsite” in the DNA (Pavletich et al., 1991, Science, 252:809; Elrod-Erickson et al., 1998, Structure, 6:451). Thus, the crystal structure of Zif268 suggested that zinc finger DNA-binding domains might function in a modular manner with a one-to-one interaction between a zinc finger and a three-base-pair “subsite” in the DNA sequence. In naturally occurring zinc finger transcription factors, multiple zinc fingers are typically linked together in a tandem array to achieve sequence-specific recognition of a contiguous DNA sequence (Klug, 1993, Gene 135:83).
(47) Multiple studies have shown that it is possible to artificially engineer the DNA binding characteristics of individual zinc fingers by randomizing the amino acids at the alpha-helical positions involved in DNA binding and using selection methodologies such as phage display to identify desired variants capable of binding to DNA target sites of interest (Rebar et al., 1994, Science, 263:671; Choo et al., 1994 Proc. Natl. Acad. Sci. USA, 91:11163; Jamieson et al., 1994, Biochemistry 33:5689; Wu et al., 1995 Proc. Natl. Acad. Sci. USA, 92: 344). Such recombinant zinc finger proteins can be fused to functional domains, such as transcriptional activators, transcriptional repressors, methylation domains, and nucleases to regulate gene expression, alter DNA methylation, and introduce targeted alterations into genomes of model organisms, plants, and human cells (Carroll, 2008, Gene Ther., 15:1463-68; Cathomen, 2008, Mol. Ther., 16:1200-07; Wu et al., 2007, Cell. Mol. Life Sci., 64:2933-44).
(48) One existing method for engineering zinc finger arrays, known as “modular assembly,” advocates the simple joining together of pre-selected zinc finger modules into arrays (Segal et al., 2003, Biochemistry, 42:2137-48; Beerli et al., 2002, Nat. Biotechnol., 20:135-141; Mandell et al., 2006, Nucleic Acids Res., 34:W516-523; Carroll et al., 2006, Nat. Protoc. 1:1329-41; Liu et al., 2002, J. Biol. Chem., 277:3850-56; Bae et al., 2003, Nat. Biotechnol., 21:275-280; Wright et al., 2006, Nat. Protoc., 1:1637-52). Although straightforward enough to be practiced by any researcher, recent reports have demonstrated a high failure rate for this method, particularly in the context of zinc finger nucleases (Ramirez et al., 2008, Nat. Methods, 5:374-375; Kim et al., 2009, Genome Res. 19:1279-88), a limitation that typically necessitates the construction and cell-based testing of very large numbers of zinc finger proteins for any given target gene (Kim et al., 2009, Genome Res. 19:1279-88).
(49) Combinatorial selection-based methods that identify zinc finger arrays from randomized libraries have been shown to have higher success rates than modular assembly (Maeder et al., 2008, Mol. Cell, 31:294-301; Joung et al., 2010, Nat. Methods, 7:91-92; Isalan et al., 2001, Nat. Biotechnol., 19:656-660). In preferred embodiments, the zinc finger arrays are described in, or are generated as described in, WO 2011/017293 and WO 2004/099366. Additional suitable zinc finger DBDs are described in U.S. Pat. Nos. 6,511,808, 6,013,453, 6,007,988, and 6,503,717 and U.S. patent application 2002/0160940.
(50) Cells
(51) The methods described herein can be used in any cell that is capable of repairing a DSB in genomic DNA. The two major DSB repair pathways in eukaryotic cells are Homologous recombination (HR) and Non-homologous end joining (NHEJ). Preferably, the methods are performed in cells capable of NHEJ. Methods for detecting NHEJ activity are known in the art; for a review of the NHEJ canonical and alternative pathways, see Liu et al., Nucleic Acids Res. Jun. 1, 2014; 42(10):6106-6127.
(52) Sequencing
(53) As used herein, “sequencing” includes any method of determining the sequence of a nucleic acid. Any method of sequencing can be used in the present methods, including chain terminator (Sanger) sequencing and dye terminator sequencing. In preferred embodiments, Next Generation Sequencing (NGS), a high-throughput sequencing technology that performs thousands or millions of sequencing reactions in parallel, is used. Although the different NGS platforms use varying assay chemistries, they all generate sequence data from a large number of sequencing reactions run simultaneously on a large number of templates. Typically, the sequence data is collected using a scanner, and then assembled and analyzed bioinformatically. Thus, the sequencing reactions are performed, read, assembled, and analyzed in parallel; see, e.g., US 20140162897, as well as Voelkerding et al., Clinical Chem., 55: 641-658, 2009; and MacLean et al., Nature Rev. Microbiol., 7: 287-296 (2009). Some NGS methods require template amplification and some that do not. Amplification-requiring methods include pyrosequencing (see, e.g., U.S. Pat. Nos. 6,210,89 and 6,258,568; commercialized by Roche); the Solexa/Illumina platform (see, e.g., U.S. Pat. Nos. 6,833,246, 7,115,400, and 6,969,488); and the Supported Oligonucleotide Ligation and Detection (SOLiD) platform (Applied Biosystems; see, e.g., U.S. Pat. Nos. 5,912,148 and 6,130,073). Methods that do not require amplification, e.g., single-molecule sequencing methods, include nanopore sequencing, HeliScope (U.S. Pat. Nos. 7,169,560; 7,282,337; 7,482,120; 7,501,245; 6,818,395; 6,911,345; and 7,501,245); real-time sequencing by synthesis (see, e.g., U.S. Pat. No. 7,329,492); single molecule real time (SMRT) DNA sequencing methods using zero-mode waveguides (ZMWs); and other methods, including those described in U.S. Pat. Nos. 7,170,050; 7,302,146; 7,313,308; and 7,476,503). See, e.g., US 20130274147; US20140038831; Metzker, Nat Rev Genet 11(1): 31-46 (2010).
(54) Alternatively, hybridization-based sequence methods or other high-throughput methods can also be used, e.g., microarray analysis, NANOSTRING, ILLUMINA, or other sequencing platforms.
EXAMPLES
(55) The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
Example 1
(56) In initial experiments, the process of integrating a dsODN cassette into nuclease-induced double-stranded breaks (DSBs) was optimized. Previously published experiments had demonstrated that dsODNs bearing two phosphorothiorate linkage modifications at their 5′ ends could be captured into a zinc finger nuclease (ZFN)-induced DSB in mammalian cells (Orlando et al., Nucleic Acids Res. 2010 August; 38(15):e152). However, to use the capture of such ssODNs to identify even very low frequency DSBs, the characteristics of the dsODN were optimized to improve its rate of capture into such breaks. Initial efforts were focused on capture of the dsODN into DSBs induced by the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) RNA-guided nuclease Cas9 from Streptococcus pyogenes. Cas9 has been reported to induce DSBs with blunt ends and therefore dsODN variants were designed that were blunt-ended. Optimization experiments showed that the phosphorylation of both 5′ ends and the introduction of two phosphorothiorate linkages on both 3′ ends (in addition to the ones on the 5′ ends) led to substantially increased rate of capture of a dsODN into a Cas9-induced DSB (
(57) Having established that dsODNs can be efficiently integrated into Cas9-induced DSBs, the next experiments sought to determine whether next-generation deep sequencing methods could be used to capture, amplify and identify the sites of dsODN integrations in the genomes of mammalian cells. To do this, a 34 bp dsODN was utilized that contains two PCR primer binding sites (one on each strand); these sequences were chosen because they are each orthogonal to the human genome.
(58) The sequence of the dsODN used is provided in Table 1:
(59) TABLE-US-00002 TABLE 1 SEQ ID Strand Sequence (5′ to 3′) NO: FWD /5Phos/G*T*TTAATTGAGTTGTCATATGTTAATAACGGT*A*T 1 REV /5Phos/A*T*ACCGTTATTAACATATGACAACTCAATTAA*A*C 2 /5Phos/ denotes 5′ phosphorylation. *denotes phosphorothioate linkage between adjacent nucleotides.
(60) This dsODN was transfected into human U2OS cells together with plasmids encoding Cas9 and one of four different target-specific gRNAs, each targeted to a different endogenous human gene sequence (EMC1 and VEGFA sites 1, 2, and 3). These four particular gRNAs were chosen because bona fide off-target sites had been previously identified for each of them (Fu et al., Nat Biotechnol. 2013; Table 1). The transfections were performed as follows: dsODN is annealed in STE (100 mM TrisHcl, 500 mM NaCl, 10 mM EDTA) at a concentration of 100 uM each. For U2OS cells, 500 ng of Cas9 expression plasmid, 250 ng gRNA expression plasmid, and 100 pmol of dsODN were used to nucleofect 2E5 cells with solution SE and program DN-100.
(61) Genomic DNA was harvested three days post-transfection (Agencourt AMPURE XP automated PCR purification system) and a PCR-based restriction fragment length polymorphisms (RFLP) assay was used to verify that the dsODN had been efficiently integrated into the on-target site in these cells based on the presence of a restriction site encoded in the dsODN.
(62) To comprehensively identify the locations of dsODN integration in the genomes of the transfected cells, a PCR-based method was used that selectively amplifies these insertion sites and also enables them to be sequenced using next-generation sequencing technology. A general overview of the strategy is shown in
(63) DNA fragments bearing the dsODN sequence were then amplified using a primer specific to the dsODN together with a primer that anneals to the sequencing adapter. Because there are two potential priming sites within the dsODN (one on each strand as noted above), two independent PCR reactions were performed to selectively amplify the desired sequences as follows.
(64) Two rounds of nested PCR were performed to generate a targeted sequencing library. The first round of PCR was performed using a primer complementary to the integration dsODN (primer A) and a primer complementary to the universal adapter (primer B). The second round of PCR was performed using a 3′ nested primer complementary to primer A (primer C), a 3′ nested primer complementary to primer B (primer D), and a primer that was complementary to primer D (primer E) that added a flow-cell binding sequence and random molecular index to make a ‘complete’ molecule that was ready for sequencing. SPRI magnetic beads were used to clean up each round of PCR. (Agencourt AMPURE XP automated PCR purification system).
(65) The amplification of dsODN-containing genomic sequences by this approach neither depends on nor is biased by flanking sequence adjacent to the insertion point because the sequencing adapter is ligated to breaks induced by random sharing of genomic DNA. An additional round of PCR was performed to add next-generation sequencing adapter sequences and an indexing barcode on the end closest to the dsODN, resulting in a library of fragments that is ready for next-generation sequencing. This general method is referred to herein as GUIDE-Seq, for Genomewide Unbiased Identification of DSBs Evaluated by Sequencing.
(66) Deep sequencing of the libraries constructed using GUIDE-Seq revealed a wide range of genomic loci into which the dsODN had become inserted in the presence of each of the four co-expressed gRNA/Cas9 nucleases. In analyzing the raw deep sequencing data, it was reasoned that bona fide sites of insertion could be identified as genomic loci that were covered by at least one read in both orientations. Reads in both directions were possible both because the dsODN could insert in either orientation and because amplifications were performed using primers specific for either one or the other strand in the dsODN sequence. A total of 465 genomic loci were identified that met this criterion for the four gRNAs examined. For 36% of these 465 loci a sequence within 25 bps of the insertion point was also identified that was similar to the on-target site of the gRNA used and bearing as many as six mismatches relative to the on-target site (
Example 2
(67) Customizable CRISPR-Cas RNA-guided nucleases (RGNs) are robust, customizable genome-editing reagents with a broad range of research and potential clinical applications.sup.1, 2; however, therapeutic use of RGNs in humans will require full knowledge of their off-target effects to minimize the risk of deleterious outcomes. DNA cleavage by S. pyogenes Cas9 nuclease is directed by a programmable ˜100 nt guide RNA (gRNA)..sup.3, Targeting is mediated by 17-20 nts at the gRNA 5′-end, which are complementary to a “protospacer” DNA site that lies next to a protospacer adjacent motif (PAM) of the form 5′-NGG. Repair of Cas9-induced DNA double-stranded breaks (DSBs) within the protospacer by non-homologous end-joining (NHEJ) can induce variable-length insertion/deletion mutations (indels). Our group and others have previously shown that unintended RGN-induced indels can occur at off-target cleavage sites that differ by as many as five positions within the protospacer or that harbor alternative PAM sequences.sup.4-7. Chromosomal translocations can result from joining of on- and off-target RGN-induced cleavage events.sup.8-11. For clinical applications, identification of even low frequency alterations will be critically important because ex vivo and in vivo therapeutic strategies using RGNs are expected to require the modification of very large cell populations. The induction of oncogenic transformation in even a rare subset of cell clones (e.g., inactivating mutations of a tumor suppressor gene or formation of a tumorigenic chromosomal translocation) is of particular concern because such an alteration could lead to unfavorable clinical outcomes.
(68) The comprehensive identification of indels or higher-order genomic rearrangements that can occur anywhere in the genome is a challenge that is not easily addressed, and unfortunately sensitive methods for unbiased, genome-wide identification of RGN-induced off-target mutations in living cells have not yet been described.sup.12, 13. Whole genome re-sequencing has been used to attempt to identify RGN off-target alterations in edited single cell clones.sup.14, 15 but the high cost of sequencing very large numbers of genomes makes this method impractical for finding low frequency events in cell populations.sup.12. We and others have used focused deep sequencing to identify indel mutations at potential off-target sites identified either by sequence similarity to the on-target site.sup.4, 5 or by in vitro selection from partially degenerate binding site libraries.sup.6. However, these approaches make assumptions about the nature of off-target sequences and therefore may miss other mutation sites elsewhere in the genome. ChIP-Seq has also been used to identify off-target binding sites for gRNAs complexed with catalytically dead Cas9 (dCas9), but the majority of published work suggests that very few, if any, of these sites represent off-target sites of cleavage by active Cas9 nuclease.sup.16-19.
(69) Here we describe the development of a novel method for Genome-wide Unbiased Identification of DSBs Evaluated by Sequencing (GUIDE-Seq), which enabled us to generate the first global specificity landscapes for ten different RGNs in living human cells. These profiles revealed that the total number of off-target DSBs varied widely for individual RGNs and suggested that broad conclusions about the specificity of RGNs from S. pyogenes or other species should be based on large surveys and not on just small numbers of gRNAs. Our findings also expanded the range and nature of sequences at which off-target effects can occur. Direct comparisons demonstrated that GUIDE-Seq substantially outperformed two widely used computational approaches and a ChIP-Seq method for identifying RGN off-target sites. Unexpectedly, GUIDE-Seq also identified RGN-independent DNA breakpoint hotspots that can participate together with RGN-induced DSBs in higher-order genomic alterations such as translocations. Lastly, we show in direct comparisons that truncating the complementarity region of gRNAs greatly improved their genome-wide off-target DSB profiles, demonstrating the utility of GUIDE-Seq for evaluating advances designed to improve RGN specificities. The experiments outlined here provide the most rigorous strategy described to date for evaluating the specificities of RGNs, as well as of any improvements to the platform, that may be considered for therapeutic use.
(70) Methods
(71) The following materials and methods were used in this Example.
(72) Human Cell Culture and Transfection
(73) U2OS and HEK293 cells were cultured in Advanced DMEM (Life Technologies) supplemented with 10% FBS, 2 mM GLUTAMAX media supplement (Life Technologies), and penicillin/streptomycin at 37° C. with 5% CO.sub.2. U2OS cells (program DN-100) and HEK293 cells (program CM-137) were transfected in 20 μl Solution SE on a Lonza NUCLEOFECTOR 4-D transfection system according to the manufacturer's instructions. dsODN integration rates were assessed by restriction fragment length polymorphism (RFLP) assay using NdeI. Cleavage products were run and quantified by a QIAXCEL capillary electrophoresis instrument (Qiagen) as previously described (Tsai et al., Nat. Biotechnol 32, 569-576 (2014)).
(74) Isolation and Preparation of Genomic DNA for GUIDE-Seq
(75) Genomic DNA was isolated using solid-phase reversible immobilization magnetic beads (Agencourt DNAdvance), sheared with a Covaris 5200 sonicator to an average length of 500 bp, end-repaired, A-tailed, and ligated to half-functional adapters, incorporating a 8-nt random molecular index. Two rounds of nested anchored PCR, with primers complementary to the oligo tag, were used for target enrichment. Full details of the exemplary GUIDE-Seq protocol can be found herein.
(76) Processing and Consolidation of Sequencing Reads
(77) Reads that share the same six first bases of sequence as well as identical 8-nt molecular indexes were binned together because they are assumed to originate from the same original pre-PCR template fragment. These reads were consolidated into a single consensus read by selecting the majority base at each position. A no-call (N) base was assigned in situations with greater than 10% discordant reads. The base quality score was taken to be the highest among the pre-consolidation reads. Consolidated reads were mapped to human genome reference (GrCh37) using BWA-MEM (Li and Durbin, Bioinformatics 26, 589-595 (2010)).
(78) Identification of Off-Target Cleavage Sites
(79) Start mapping positions for reads with mapping quality ≧50 were tabulated, and regions with nearby start mapping positions were grouped using a 10-bp sliding window. Genomic windows harboring integrated dsODNs were identified by one of the following criteria: 1) two or more unique molecular-indexed reads mapping to opposite strands in the reference sequence or 2) two or more unique molecular-indexed reads amplified by forward and reverse primers. 25 bp of reference sequence flanking both sides of the inferred breakpoints were aligned to the intended target site and RGN off-target sites with eight or fewer mismatches from the intended target sequence were called. SNPs and indels were called in these positions by a custom bin-consensus variant-calling algorithm based on molecular index and SAMtools, and off-target sequences that differed from the reference sequence were replaced with the corresponding cell-specific sequence.
(80) AMP-Based Sequencing
(81) For AMP validation of GUIDE-Seq detected DSBs, primers were designed to regions flanking inferred double-stranded breakpoints as described previously (Zheng, Z. et al. Anchored multiplex PCR for targeted next-generation sequencing. Nat Med 2014 Nov. 10. doi: 10.1038/nm.3729 (2014)), with the addition of an 8-nt molecular index. Where possible, we designed two primers to flank each DSB.
(82) Analysis of AMP Validation Data
(83) Reads with average quality scores >30 were analyzed for insertions, deletions, and integrations that overlapped with the GUIDE-Seq inferred DSB positions using Python. 1-bp indels were included only if they were within 1-bp of the predicted DSB site to minimize the introduction of noise from PCR or sequencing error. Integration and indel frequencies were calculated on the basis of consolidated molecular indexed reads.
(84) Structural Variation
(85) Translocations, large deletions, and inversions were identified using a custom algorithm based on split BWA-MEM alignments. Candidate fusion breakpoints within 50 bases on the same chromosome were grouped to accommodate potential resection around the Cas9 cleavage site. A fusion event was called with at least 3 uniquely mapped split reads, a parameter also used by the segemehl tool (Hoffmann, Genome biology, 2014)). Mapping strandedness was maintained for identification of reciprocal fusions between two involving DSBs, and for determining deletion or inversion. Fusions involved DSBs within 1 kb chromosomal positions were discarded for consideration of large indels caused by single Cas9 cleavage. Remaining fusion DSBs were classified in four categories: ‘on-target’, ‘off-targe’ or ‘background’ based on GUIDE-seq or, else, ‘other’.
(86) Comparison of Sites Detected by GUIDE-Seq and ChIP-Seq and in Silico Predictions
(87) We used the MIT CRISPR Design Tool to identify potential off-target sites for all ten RGNs. This tool assigns each potential off-target site a corresponding percentile. We then grouped these percentiles into quintiles for visualization purposes. Because the E-CRISP tool does not rank off-targets, we simply found the GUIDE-seq off-targets that were correctly predicted by E-CRISP. For both of these GUIDE-Seq vs. in silico predictions, we also split the GUIDE-Seq results that were not predicted by the in silico method into off-targets that have mismatch numbers within the range of the MIT tool (maximum of 4) and E-CRISPR (maximum of 3), and those with mismatch numbers greater than the threshold of these prediction tools. In comparing the GUIDE-Seq off-targets with ChIP-Seq predictions, the same technique was used to find the GUIDE-Seq off-targets correctly predicted by the ChIP-Seq. For each of these comparisons, every grouping that was made was subdivided by off-target mismatch number to better characterize the properties of correctly and incorrectly predicted RGN off-targets.
(88) Analysis of Impact of Mismatches, DNA Accessibility and Local PAM Density on Off-Target Cleavage Rate
(89) We assessed the impact of mismatch position, mismatch type and DNA accessibility on specificity using linear regression models fit to estimated cleavage rates at potential off-target sites with four or less mismatches. Mismatch position covariates were defined as the number of mismatched bases within each of five non-overlapping 4-bp windows upstream of the PAM. Mismatch type covariates were defined as i) the number mismatches resulting in wobble pairing (target T replaced by C, target G replaced by A), ii) the number of mismatches resulting in a non-wobble purine-pyrimidine base-pairing (target C replaced by T, target A replaced by G), and iii) the number as mismatches resulting in purine-purine or pyrimidine-pyrimidine pairings.
(90) Each of the three factors was used in separate model as a predictor of relative cleavage rates, estimated by log.sub.2(1+GUIDE-Seq read count). The effect size estimates were adjusted for inter-target site variability. The proportion of intra-site cleavage rate variability explained by each factor was assessed by the partial eta-squared statistic based on the regression sums of squares (SS): η.sup.2.sub.p=SS.sub.factor/(SS.sub.factor+SS.sub.error). In addition to the single-factor models, we also fit a combined linear regression model including all three factors, expression level, and PAM density in a 1-kb window to assess their independent contribution to off-target cleavage probability.
(91) Exemplary Reagents and Equipment for Guide-Seq Library Preparation
(92) TABLE-US-00003 Item Vendor Store at Room Temperature Covaris S220 microTube, Covaris Ethanol, 200-proof (100%) Sigma Aldrich MICROAMP Optical 96-well Plates Applied Biosystems Nuclease-free H.sub.2O Promega QUBIT fluorometric quantitation Invitrogen Assay Tubes, 500 tubes/pack QUBIT fluorometric quantitation Invitrogen dsDNA BR Kit - 500 Assays TMAC Buffer, 5M Sigma Aldrich Tetramethylammonium Chloride 1X TE Buffer/10 mM Tris-HCl, pH 8.0 Invitrogen UltraPure 0.5M EDTA, pH 8.0 Life Technologies (Gibco) (4 × 100 mL) Store at 4° C. Agencourt AMPURE XP Beads- 60 mL Beckman Coulter Item Catalog # Store at −20° C. 25 mM dNTP Solution Mix Enzymatics, Inc. Slow ligation buffer Enzymatics, Inc. End-repair mix (low concentration) Enzymatics, Inc. T4 DNA Ligase Enzymatics, Inc. 10X T4 DNA Ligase Buffer (Slow Ligation Buffer) Platinum ® Taq DNA Polymerase Life Technologies 10X PCR Buffer (no MgCl.sub.2) 50 mM MgCl.sub.2 qPCR Illumina Library Quantification Kits KAPA Biosystems, Inc. Equipment 96-well Plate Magnetic Stand Invitrogen QUBIT Fluorometer 2.0 Life Technologies Covaris S-2 Focused Covaris Ultra-sonicator ™ Instrument Tabletop centrifuge Thermo Scientific Tabletop vortexer Thermo Scientific Thermocycler Eppendorf MISEQ genome sequencer Illumina
(93) Exemplary Protocol for GUIDE-Seq Library Preparation
(94) Y-Adapter Preparation
(95) The Y-adapter is made by annealing the MISEQ genome sequencer common oligo with each of the sample barcode adapters (A01 to A16, see Table 4). The adapters also contain 8-mer NNWNNWNN (N=A, C, T, or G; W=A or T) molecular indexes.
(96) TABLE-US-00004 1X TE Buffer 80.0 μL A## (100 μM) 10.0 μL MISEQ genome sequencer Common 10.0 μL Adapter_MI (100 μM) Total 100.0 μL
(97) Annealing program: 95° C. for 1 s; 60° C. for 1 s; slow ramp down (approximately −2° C./min) to 4° C.; hold at 4° C. Store in −20° C.
(98) Input Quantification and Shearing 1. dsDNA is quantified by QUBIT fluorometric quantitation and 400 ng is brought to a final volume of 120 ul using 1× TE Buffer. 2. Each sample is sheared to an average length of 500 bp according to the standard operating protocol for the Covaris S2. 3. A cleanup with 120 ul of AMPURE XP SPRI PCR purification beads (1× ratio) is performed according to manufacturer protocol, and eluted in 15 ul of 1×TE Buffer.
End Repair, A-Tailing and Ligation
(99) End Repair 4. To a 200 μL PCR tube or well in a 96-well plate, add the following (per reaction):
(100) TABLE-US-00005 Nuclease-free H.sub.2O 0.5 μL dNTP mix, 5 mM 1.0 μL SLOW Ligation Buffer, 10X 2.5 μL End-repair mix (low concentration) 2.0 μL Buffer for Taq Polymerase, 10X 2.0 μL (Mg2 + free) Taq Polymerase (non-hot start) 0.5 μL Total 8.5 μL +DNA sample (from previous step) 14.0 μL Total 22.5 μL
(101) End Repair Thermocycler Program: 12° C. for 15 min, 37° C. for 15 min; 72° C. for 15 min; hold at 4° C.
(102) Adapter Ligation
(103) 5. To the sample reaction tube or well, add the following reagents in order (mix by pipetting):
(104) TABLE-US-00006 Annealed Y adapter_MI (10 μM) 1.0 μL T4 DNA Ligase 2.0 μL +DNA sample (from previous step) 22.5 μL Total 25.5 μL
(105) Adapter Ligation Thermocycler Program: 16° C. for 30 min, 22° C. for 30 min, hold at 4° C. 6. 0.9×SPRI clean (22.95 ul AMPURE XP PCR purification beads), elute in 12 uL of 1×TE buffer.
PCRs
PCR 1 (Oligo Tag Primer [Discovery] or Large Primer Pool [Deep-Sequencing Validation]) 7. Prepare the following master mix:
(106) TABLE-US-00007 Nuclease-free H.sub.2O 11.9 μL Buffer for Taq Polymerase, 10X 3.0 μL (MgCl.sub.2 free) dNTP mix, 10 mM 0.6 μL MgCl.sub.2, 50 mM 1.2 μL Platinum Taq polymerase, 5 U/μl 0.3 μL GSP1 Primer (10 uM)/Primer Pool (*) 1.0 μL* TMAC (0.5M) 1.5 μL P5_1, 10 μM 0.5 μL Total 20.0 μL +DNA sample (from Step 6) 10.0 μL Total 30.0 μL *For Discovery, make separate master mixes for +/(sense) and −/(antisense) reactions, and proceed with separate PCR reactions. *For deep-sequencing validation, one master mix can be made. Primer Pool should be normalized to a total amount of 30 pmol in the 30 ul reaction.
(107) Discovery Thermocycler Program (touchdown): 95° C. for 5 min, 15 cycles of [95° C. for 30 s, 70° C. (−1° C./cycle) for 2 min, 72° C. for 30 s], 10 cycles of [95° C. for 30 s, 55° C. for 1 min, 72° C. for 30 s], 72° C. for 5 min, 4° C. hold
(108) Validation Thermocycler Program: 95° C. for 5 min, 14 cycles of [95° C. for 30 s, 20% ramping down to 65° C., 65° C. for 5 min], 72° C. for 5 min, 4° C. hold 8. 1.2×SPRI clean (36.0 uL), elute in 15 ul of 1×TE Buffer.
PCR 2 (Oligo Tag Primer [Discovery] or Large Primer Pool [Deep-Sequencing Validation]) 9. Prepare the following master mix:
(109) TABLE-US-00008 Nuclease-free H.sub.2O 5.4 μL Buffer for Taq Polymerase, 10X 3.0 μL (Mg.sup.2+ free) dNTP mix, 10 mM 0.6 μL MgCl.sub.2, 50 mM 1.2 μL Platinum Taq polymerase, 5 U/μl 0.3 μL GSP2 Primer (10 uM)/Primer Pool(*) 1.0 μL TMAC (0.5M) 1.5 μL P5_2, 10 μM 0.5 μL Total 13.5 μL +P7_# (10 uM)* 1.5 μL +DNA sample with beads (from Step 8) 15.0 μL Total 30.0 μL Primer concentrations should follow the specifications described in PCR1 *For the P7_#, at least 4 should be used in one sequencing run for good image registration on Illumina sequencer (e.g. P701-P704 or P705-P708)
(110) Discovery Thermocycler Program (touchdown): same as for PCR1
(111) Validation Thermocycler Program: same as for PCR1 10. 0.7×SPRI clean (21.0 uL), elute in 30 ul of 1×TE Buffer.
Library Quantification by qPCR and Sequencing
(112) qPCR Quantification 11. Quantitate library using Kapa Biosystems kit for Illumina Library Quantification kit, according to manufacturer instruction.
Normalization and Sequencing 12. Using the mean quantity estimate of number of molecules per uL given by the qPCR run for each sample, proceed to normalize the total set of libraries to 1.2×10^10 molecules, divided by the number of libraries to be pooled together for sequencing. This will give a by molecule input for each sample, and also a by volume input for each sample. After pooling, dry down the library with a VACUFUGE vacuum concentrator to a final volume of 10 uL for sequencing. Denature the library and load onto the MISEQ genome sequencer according to Illumina's standard protocol for sequencing with an Illumina MISEQ genome sequencer Reagent Kit V2-300 cycle (2×150 bp paired end), except: 1) Add 3 ul of 100 μM custom sequencing primer Index 1 to MISEQ genome sequencer Reagent cartridge position 13 (Index Primer Mix). Add 3 ul of 100 μM custom sequencing primer Read 2 to MISEQ genome sequencer Reagent cartridge position 14 (Read 2 Primer Mix). 2) Sequence with the following number of cycles “151|8|16|151” with the paired-end Nextera sequencing protocol.
Submit sequencing data in either bcl or fastq format to relevant pipelines for downstream bioinformatics analysis.
(113) TABLE-US-00009 TABLE 3 Common Primers Needed for GUIDE-Seq P7 Adapters Sequence (5′.fwdarw.3′) SEQ ID NO: P701 CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTGACTGGAGTCCTCTCTATGG 3 GCAGTCGGTGA P702 CAAGCAGAAGACGGCATACGAGATCTAGTACGGTGACTGGAGTCCTCTCTATG 4 GGCAGTCGGTGA P703 CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTGACTGGAGTCCTCTCTATGG 5 GCAGTCGGTGA P704 CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTGACTGGAGTCCTCTCTATG 6 GGCAGTCGGTGA P705 CAAGCAGAAGACGGCATACGAGATAGGAGTCCGTGACTGGAGTCCTCTCTATG 7 GGCAGTCGGTGA P706 CAAGCAGAAGACGGCATACGAGATCATGCCTAGTGACTGGAGTCCTCTCTATGG 8 GCAGTCGGTGA P707 CAAGCAGAAGACGGCATACGAGATGTAGAGAGGTGACTGGAGTCCTCTCTATG 9 GGCAGTCGGTGA P708 CAAGCAGAAGACGGCATACGAGATCCTCTCTGGTGACTGGAGTCCTCTCTATGG 10 GCAGTCGGTGA P5 Adapters Sequence (5′.fwdarw.3′) P5_1 AATGATACGGCGACCACCGAGATCTA 11 P5_2 AATGATACGGCGACCACCGAGATCTACAC 12 Custom Sequencing Primers Sequence (5′.fwdarw.3′) Index1 ATCACCGACTGCCCATAGAGAGGACTCCAGTCAC 13 Read2 GTGACTGGAGTCCTCTCTATGGGCAGTCGGTGAT 14 Illumina Y- adapters 1- 16 (with Molecular Index tag NNWNNWNN) Sequence (5′.fwdarw.3′) MISEQ [Phos]GATCGGAAGAGC*C*A 15 Common Adapter A01 AATGATACGGCGACCACCGAGATCTACACTAGATCGCNNWNNWNNACACTCT 16 TTCCCTACACGACGCTCTTCCGATC A02 AATGATACGGCGACCACCGAGATCTACACCTCTCTATNNWNNWNNACACTCTT 17 TCCCTACACGACGCTCTTCCGATC*T A03 AATGATACGGCGACCACCGAGATCTACACTATCCTCTNNWNNWNNACACTCTT 18 TCCCTACACGACGCTCTTCCGATC*T A04 AATGATACGGCGACCACCGAGATCTACACAGAGTAGANNWNNWNNACACTCT 19 TTCCCTACACGACGCTCTTCCGATC*T A05 AATGATACGGCGACCACCGAGATCTACACGTAAGGAGNNWNNWNNACACTCT 20 TTCCCTACACGACGCTCTTCCGATC*T A06 AATGATACGGCGACCACCGAGATCTACACACTGCATANNWNNWNNACACTCT 21 TTCCCTACACGACGCTCTTCCGATC*T A07 AATGATACGGCGACCACCGAGATCTACACAAGGAGTANNWNNWNNACACTCT 22 TTCCCTACACGACGCTCTTCCGATC*T A08 AATGATACGGCGACCACCGAGATCTACACCTAAGCCTNNWNNWNNACACTCT 23 TTCCCTACACGACGCTCTTCCGATC*T A09 AATGATACGGCGACCACCGAGATCTACACGACATTGTNNWNNWNNACACTCT 24 TTCCCTACACGACGCTCTTCCGATC*T A10 AATGATACGGCGACCACCGAGATCTACACACTGATGGNNWNNWNNACACTCT 25 TTCCCTACACGACGCTCTTCCGATC*T A11 AATGATACGGCGACCACCGAGATCTACACGTACCTAGNNWNNWNNACACTCT 26 TTCCCTACACGACGCTCTTCCGATC*T A12 AATGATACGGCGACCACCGAGATCTACACCAGAGCTANNWNNWNNACACTCT 27 TTCCCTACACGACGCTCTTCCGATC*T A13 AATGATACGGCGACCACCGAGATCTACACCATAGTGANNWNNWNNACACTCT 28 TTCCCTACACGACGCTCTTCCGATC*T A14 AATGATACGGCGACCACCGAGATCTACACTACCTAGTNNWNNWNNACACTCT 29 TTCCCTACACGACGCTCTTCCGATC*T A15 AATGATACGGCGACCACCGAGATCTACACCGCGATATNNWNNWNNACACTCT 30 TTCCCTACACGACGCTCTTCCGATC*T A16 AATGATACGGCGACCACCGAGATCTACACTGGATTGTNNWNNWNNACACTCT 31 TTCCCTACACGACGCTCTTCCGATC*T Strand/ Primer Name Sequence (5′.fwdarw.3′) Direction Nuclease_off_ GGATCTCGACGCTCTCCCTATACCGTTATTAACATATGACA + 32 +_GSP1 Nuclease_off_ GGATCTCGACGCTCTCCCTGTTTAATTGAGTTGTCATATGTTAATA - 33 -_GSP1 AC Nuclease_off_ CCTCTCTATGGGCAGTCGGTGATACATATGACAACTCAATTAAAC + 34 +_GSP2 Nuclease_off_ CCTCTCTATGGGCAGTCGGTGATTTGAGTTGTCATATGTTAATAAC - 35 -_GSP2 GGTA *Indicates a Phosphorothioate Bond Modification
RESULTS
(114) Overview of Exemplary GUIDE-Seq Method
(115) In some embodiments, GUIDE-Seq consists of two stages (
(116) For Stage I, we optimized conditions to integrate a blunt, 5′ phosphorylated dsODN into RGN-induced DSBs in human cells. In initial experiments, we failed to observe integration of such dsODNs into RGN-induced DSBs. Using dsODNs bearing two phosphothiorate linkages at the 5′ ends of both DNA strands designed to stabilize the oligos in cells.sup.20, we observed only modest detectable integration frequencies (
(117) For Stage II, we developed a novel strategy that allowed us to selectively amplify and sequence, in an unbiased fashion, only those fragments bearing an integrated dsODN (
(118) Genome-Wide Off-Target Cleavage Profiles of CRISPR RGNs in Human Cells
(119) We performed GUIDE-Seq with Cas9 and ten different gRNAs targeted to various endogenous human genes in either U2OS or HEK293 human cell lines (Table 5). By analyzing the dsODN integration sites (Methods), we were able to identify the precise genomic locations of DSBs induced by each of the ten RGNs, mapped to the nucleotide level (
(120) TABLE-US-00010 TABLE 5 Target site name Cells Sequence SEQ ID NO: EMX1 U2OS GAGTCCGAGCAGAAGAAGAANGG 36 VEGFA site1 U2OS GGGTGGGGGGAGTTTGCTCCNGG 37 VEGFA site2 U2OS GACCCCCTCCACCCCGCCTCNGG 38 VEGFA site3 U2OS GGTGAGTGAGTGTGTGCGTGNGG 39 RNF2 U2OS GTCATCTTAGTCATTACCTGNGG 40 FANCF U2OS GGAATCCCTTCTGCAGCACCNGG 41 HEK293 site 1 293 GGGAAAGACCCAGCATCCGTNGG 42 HEK293 site 2 293 GAACACAAAGCATAGACTGCNGG 43 HEK293 site 3 293 GGCCCAGACTGAGCACGTGANGG 44 HEK293 site 4 293 GGCACTGCGGCTGGAGGTGGNGG 45 truncated VEGFA site 1 U2OS GTGGGGGGAGTTTGCTCCNGG 87 truncated VEGFA site 3 U2OS GAGTGAGTGTGTGCGTGNGG 88 Truncated EMX1 U2OS GTCCGAGCAGAAGAAGAANGG 89
(121) We next tested whether the number of sequencing reads for each off-target site identified by GUIDE-Seq (shown in
(122) Analysis of RGN-Induced Off-Target Sequence Characteristics
(123) Visual inspection of the off-target sites we identified by GUIDE-Seq for all ten RGNs underscores the diversity of variant sequences at which RGNs can cleave. These sites can harbor as many as six mismatches within the protospacer sequence (consistent with a previous report showing in vitro cleavage of sites bearing up to seven mismatches.sup.6), non-canonical PAMs (previously described NAG and NGA sequences.sup.5, 23 but also novel NAA, NGT, NGC, and NCG sequences), and 1 bp “bulge”-type mismatches.sup.24 at the gRNA/protospacer interface (
(124) Quantitative analysis of our GUIDE-Seq data on all ten RGNs enabled us to quantify the contributions and impacts of different variables such as mismatch number, location, and type on off-target site cleavage. We found that the fraction of total genomic sites bearing a certain number of protospacer mismatches that are cleaved by an RGN decreases with increasing numbers of mismatches (
(125) Comparisons of GUIDE-Seq with Existing Off-Target Prediction Methods
(126) Having established the efficacy of GUIDE-Seq, we next performed direct comparisons of our new method with two popular existing computational methods for predicting off-target mutation sites: the MIT CRISPR Design Tool.sup.25 (crispr.mit.edu) and the E-CRISP program.sup.26 (www.e-crisp.org/E-CRISP/). Both of these programs attempt to identify potential off-target sites based on certain “rules” about mismatch number and position and have been used in previous publications to identify off-target sites. In our comparisons using the ten RGNs we characterized by GUIDE-Seq, we found that both programs failed to identify the vast majority of experimentally verified off-target sites (
(127) Comparison of GUIDE-Seq with the ChIP-Seq Method for Determining dCas9 Binding Sites
(128) We also sought to directly compare GUIDE-Seq with previously described ChIP-Seq methods for identifying RGN off-target sites. Four of the RGNs we evaluated by GUIDE-Seq used gRNAs that had been previously characterized in ChIP-Seq experiments with catalytically inactive Cas9 (dCas9), resulting in the identification of a large set of off-target binding site.sup.18. Direct comparisons show very little overlap between Cas9 off-target cleavage sites identified by GUIDE-Seq and dCas9 off-target binding sites identified by ChIP-Seq; among the 149 RGN-induced off-target cleavage sites we identified for the four gRNAs, only three were previously identified by the previously published dCas9 ChIP-Seq experiments using the same gRNAs (
(129) Identification of RGN-Independent DSB Hotspots in Human Cells by GUIDE-Seq
(130) Our GUIDE-Seq experiments also unexpectedly revealed the existence of a total of 30 unique RGN-independent DSB hotspots in the U2OS and HEK293 cells used for our studies (Table 2). We uncovered these sites when analyzing genomic DNA from control experiments with U2OS and HEK293 cells in which we transfected only the dsODN without RGN-encoding plasmids (Methods). In contrast to RGN-induced DSBs that map precisely to specific base pair positions, RGN-independent DSBs have dsODN integration patterns that are more broadly dispersed at each locus in which they occur (Methods). These 30 breakpoint hotspots were distributed over many chromosomes and appeared to be present at or near centromeric or telomeric regions (
(131) TABLE-US-00011 TABLE 2 Summary of RGN-independent breakpoint hotspots in human U2OS and HEK293 cells Cells Chromosome Start End Interval (bp) U2OS chr1 121484547 121485429 882 U2OS chr1 236260170 236260754 584 U2OS chr3 197900267 197900348 81 U2OS chr4 191044096 191044100 4 U2OS chr5 10020 10477 457 U2OS chr7 16437577 16439376 1799 U2OS chr7 158129486 158129491 5 U2OS chr9 140249964 140249977 13 U2OS chr9 140610510 140610516 6 U2OS chr10 42599569 42599575 6 U2OS chr11 129573467 129573469 2 U2OS chr11 134946499 134946506 7 U2OS chr12 95427 95683 256 U2OS chr12 29944278 29946544 2266 U2OS chr16 83984266 83984271 5 U2OS chr17 63965908 63967122 1214 U2OS chr18 63765 63769 4 U2OS chr18 37381409 37381971 562 U2OS chr2 9877829 9877857 28 U2OS chr2 182140586 182140587 1 U2OS chr2 209041635 209041637 2 U2OS chr2 242838677 242838859 182 U2OS chr22 49779897 49782342 2445 U2OS chr22 49780337 49780338 1 U2OS chrX 155260204 155260352 148 HEK293 chr1 121484526 121485404 878 HEK293 chr6 58778207 58779300 1093 HEK293 chr7 61968971 61969378 407 HEK293 chr10 42385171 42385189 18 HEK293 chr10 42400389 42400394 5 HEK293 chr10 42597212 42599582 2370 HEK293 chr19 27731978 27731991 13
(132) Participation of Both RGN-Induced and RGN-Independent DSBs in Large-Scale Genomic Rearrangements
(133) In the course of analyzing the results of our next-generation sequencing experiments designed to identify indels at RGN-induced and RGN-independent DSBs, we also discovered that some of these breaks can participate in translocations, inversions and large deletions. The AMP method used enabled us to observe these large-scale genomic alterations because, for each DSB site examined, this method uses only nested locus-specific primers anchored at only one fixed end rather than a pair of flanking locus-specific primers (
(134) For the five RGNs we examined, AMP sequencing revealed that RGN-induced on-target and off-target DSBs could participate in a variety of translocations (
(135) GUIDE-Seq Profiles of RGNs Directed by Truncated gRNAs
(136) Previous studies from our group have shown that use of gRNAs bearing truncated complementarity regions of 17 or 18 nts can reduce mutation frequencies at known off-target sites of RGNs directed by full-length gRNAs27. However, because this analysis was limited to a small number of known off-target sites, the genome-wide specificities of these truncated gRNAs (tru-gRNAs) remained undefined in our earlier experiments. We used GUIDE-Seq to obtain genome-wide DSB profiles of RGNs directed by three tru-gRNAs, each of which are shorter versions of one of the ten full-length gRNAs we had assayed above.
(137) Our results show that in all three cases, the total number of off-target sites identified by GUIDESeq decreased substantially with use of a tru-gRNA (
(138) Discussion
(139) GUIDE-Seq provides an unbiased, sensitive, and genome-wide method for detecting RGN-induced DSBs. The method is unbiased because it detects DSBs without making assumptions about the nature of the off-target site (e.g., presuming that the off-target site is closely related in sequence to the on-target site). GUIDE-Seq identifies off-target sites genome-wide, including within exons, introns, and intergenic regions, and harbored up to six protospacer mismatches and/or new mismatched PAM sites beyond the alternate NAG and NGA sequences described in earlier studies.sup.5, 23. For the RGNs we examined in this example, GUIDE-Seq not only successfully identified all previously known off-target sites but also unveiled hundreds of new sites as well.
(140) Although the current lack of a practical gold standard method for comprehensively identifying all RGN off-target sites in a human cell prevents us from knowing the sensitivity of GUIDE-Seq with certainty, we believe that it very likely has a low false-negative rate for the following reasons: First, all RGN-induced blunt-ended DSBs should take up the blunt-ended dsODN by NHEJ, a hypothesis supported by the strong correlations we observe between GUIDE-Seq read counts (which measure dsODN uptake) and indel frequencies in the presence of the RGN (which measure rates DSB formation and of their mutagenic repair) (
(141) Of note, one of the RGNs we assessed did not yield any detectable off-target effects (at the current detection limit of the GUIDE-Seq method), raising the intriguing possibility that some gRNAs may induce very few, or perhaps no, undesired mutations.
(142) Although our validation experiments show that GUIDE-Seq can sensitively detect off-target sites that are mutagenized by RGNs with frequencies as low as 0.1%, its detection capabilities might be further improved with some simple changes. Strategies that use next-generation sequencing to detect indels are limited by the error rate of the platform (typically ˜0.1%). By contrast, GUIDE-Seq uses sequencing to identify dsODN insertion sites rather than indels and is therefore not limited by error rate but by sequencing depth. For example, we believe that the small number of sites detected in our GUIDE-Seq experiments for which we did not find indels in our sequencing validation experiments actually represent sites that likely have indel mutation frequencies below 0.1%. Consistent with this, we note that all but three of these 26 sites had GUIDE-Seq read counts below 100. Taken together, these observations suggest that we may be able to increase the sensitivity of GUIDE-Seq simply by increasing the number of sequencing reads (and by increasing the number of genomes used as template for amplification). For example, use of a sequencing platform that yields 1000-fold more reads would enable detection
(143) Direct comparisons enabled by our GUIDE-Seq experiments show the limitations of two existing computational programs for predicting RGN off-target sites. These programs not only failed to identify bona fide off-target sites found by GUIDE-Seq but also overcalled many sites that do not show cleavage. This is not entirely surprising given that parameters used by these programs were based on more restrictive assumptions about the nature of off-target sites that do not account for greater numbers of protospacer mismatches and alternative PAM sequences identified by our GUIDE-Seq experiments. It is possible that better predictive programs might be developed in the future but doing so will require experimentally determined genome-wide off-target sites for a larger number of RGNs. Until such programs can be developed, identification of off-target sites will be most effectively addressed by experimental methods such as GUIDE-Seq.
(144) Our experimental results elaborate a clear distinction between off-target binding site of dCas9 and off-target cleavage sites of Cas9. Comparisons of dCas9 ChIP-Seq and Cas9 GUIDE-Seq data for four different gRNAs show that there is negligible direct overlap between the two sets of sites and that the mean number of mismatches in the two classes of sites are actually substantially different. Furthermore, we show that even the small number of dCas9 binding sites previously reported to be mutagenized by Cas9 are very likely not bona fide RGN-induced cleavage sites. Taken together, our results show that the binding of dCas9 to DNA sites being captured with ChIP-Seq represents a different biological process than cleavage of DNA sites by Cas9 nuclease, consistent with the results of a recent study showing that engagement of the 5′-end of the gRNA with the protospacer is needed for efficient cleavage.sup.19. Although ChIP-Seq assays will undoubtedly have a role in characterizing the genome-wide binding of dCas9 fusion proteins, the method is clearly not effective for determining genome-wide off-target cleavage sites of catalytically active RGNs.
(145) GUIDE-Seq has several important advantages over other previously described genome-wide methods for identifying DSB sites in cells. The recently described BLESS (breaks labeling, enrichment on streptavidin and next-generation sequencing) oligonucleotide tagging method is performed in situ on fixed, permeabilized cells.sup.27. In addition to being prone to artifacts associated with cell fixation, BLESS will only capture breaks that exist at a single moment in time. By contrast, GUIDE-Seq is performed on living cells and captures DSBs that occur over a more extended period of time (days), thereby making it a more sensitive and comprehensive assay. Capture of integration-deficient lentivirus (IDLV) DNA into regions near DSBs and identification of these loci by LAM-PCR has been used to identify a small number of off-target sites for engineered zinc finger nucleases (ZFNs).sup.22 and transcription activator-like effector nucleases (TALENs).sup.28 in human cells. However, IDLV integration events are generally low in number and widely dispersed over distances as far as 500 bps away from the actual off-target DSB.sup.22, 28, making it challenging both to precisely map the location of the cleavage event and to infer the sequence of the actual off-target site. In addition, LAM-PCR suffers from sequence bias and/or low efficiency of sequencing reads. Collectively, these limitations may also explain the apparent inability to detect lower frequency ZFN off-target cleavage sites by IDLV capture.sup.29. By contrast, dsODNs are integrated very efficiently and precisely into DSBs with GUIDE-Seq, enabling mapping of breaks with single nucleotide resolution and simple, straightforward identification of the nuclease off-target cleavage sites. Furthermore, in contrast to LAM-PCR, our STAT-PCR method allows for efficient, unbiased amplification and sequencing of genomic DNA fragments in which the dsODN has integrated. We note that the STAT-PCR may have more general utility beyond its use in GUIDE-Seq; for example, it may be useful for studies that seek to map the integration sites of viruses on a genome-wide scale.
(146) Although GUIDE-Seq is highly sensitive, its detection capabilities might be further improved with some simple changes. Strategies that use next-generation sequencing to detect indels are limited by the error rate of the platform (typically ˜0.1%). By contrast, GUIDE-Seq uses sequencing to identify dsODN insertion sites rather than indels and is therefore not limited by error rate but by sequencing depth. For example, we believe that the small number of sites detected in our GUIDE-Seq experiments for which we did not find indels in our sequencing validation experiments actually represent sites that likely have mutation frequencies below 0.1%. Consistent with this, we note that all but 3 of these 26 sites had GUIDE-Seq read counts below 100. Taken together, these observations suggest that we may be able to increase the sensitivity of GUIDE-Seq simply by increasing the number of sequencing reads (and by increasing the number of genomes used as template for amplification). For example, use of a sequencing platform that yields 1000-fold more reads would enable detection of sites with mutagenesis frequencies three orders of magnitude lower (i.e., 0.0001%), and we expect further increases to occur with continued improvements in technology.
(147) An unexpected result of our experiments was the realization that GUIDE-Seq could also identify breakpoint hotspots that occur in cells even in the absence of RGNs. We believe that these DSBs are not just an artifact of GUIDE-Seq because our AMP-based sequencing experiments verified not only capture of dsODNs but also the formation of indels at these sites. Of note, many hotspots are unique to each of the two cell lines examined in our study, but some also appear to be common to both. It will be interesting in future studies to define the parameters that govern why some sites are breakpoint hotspots in one cell type but not another. Also, because our results show that these breakpoint hotspots can participate in translocations, the existence of cell-type-specific breakpoint hotspots might help to explain why certain genomic rearrangements only occur in specific cell types but not others. To our knowledge, GUIDE-Seq is the first method to be described that can identify breakpoint hotspots in living human cells without the need to add drugs that inhibit DNA replication.sup.27. Therefore, we expect that it will provide a useful tool for identifying and studying these breaks.
(148) Our work establishes the most comprehensive qualitative approach described to date for identifying translocations induced by RGNs. AMP-based targeted sequencing of RGN-induced and RGN-independent DSB sites discovered by GUIDE-Seq can find large-scale genomic rearrangement that includes translocations, deletions, and inversions involving both classes of sites, highlighting the importance of considering both classes of breaks when identifying large-scale genomic rearrangements. In addition, presumably not all RGN-induced or RGN-independent DSBs will participate in large-scale alterations and understanding why some sites do and other sites do not contribute to these rearrangements will be an important area for further research.
(149) GUIDE-Seq will also provide an important means to evaluate specificity improvements to the RGN platform on a genome-wide scale. In this report, we used GUIDE-Seq to show how the implementation of truncated gRNAs can reduce off-target effects on a genome-scale, extending earlier results from our group that this approach can reduce mutations at known off-target sites of a matched full-length gRNA.sup.30. It might also be adapted to assess the genome-wide specificities of alternative Cas9 nucleases from other bacteria or archaea, or of nucleases such as dimeric ZFNs, TALENs, and CRISPR RNA-guided FokI nucleases.sup.31, 32 that generate 5′ overhangs or paired Cas9 nickases.sup.33, 34 that generate 5′ or 3′ overhangs; however, extending GUIDE-Seq to detect these other types of DSBs will undoubtedly require additional modification and optimization of the dsODN to ensure its efficient capture into such breaks. The method might also be used to assess the specificities of alternative Cas9 nucleases from other bacteria or archaea.sup.35. One important caveat is the need to examine a large number of gRNAs before broadly drawing conclusions about the specificity of any new Cas9 platform because we found very wide variability in the number of off-target sites for the ten gRNAs we assessed.
(150) Our exemplary approach using GUIDE-Seq and AMP-based sequencing establishes a new gold standard for the evaluation of off-target mutations and genomic rearrangements induced by RGNs. We expect that GUIDE-Seq can be extended for use in any cell in which NHEJ is active and into which the required components can be efficiently introduced; for example, we have already achieved efficient dsODN integration in human K562 and mouse embryonic stem cells (data not shown). Most importantly, the strategies outlined here can be used as part of a rigorous pre-clinical pathway for objectively assessing the potential off-target effects of any RGNs proposed for therapeutic use, thereby substantially improving the prospects for use of these reagents in the clinic.
Example 3
(151) Additional experiments were performed to explore the requirements for the dsODNs that can be used in some embodiments of the present methods.
(152) The following dsODNs were used in the experiments in Example 3:
(153) TABLE-US-00012 SEQ ID dsODN type Sequence NO: phosphorylated, 5′ overhang, /5Phos/N*N*NNGTTTAATTGAGTT 47 5′ end-protected F GTCATATGTTAATAACGGT*A*T phosphorylated, 5′ overhang, /5Phos/N*N*NNATACCGTTATTAA 48 5′ end-protected R CATATGACAACTCAATTAA*A*C phosphorylated, 3′ overhang, /5Phos/G*T*TTAATTGAGTTGTCAT 49 3′ end-protected F ATGTTAATAACGGTATNN*N*N phosphorylated, 3′ overhang, /5Phos/A*T*ACCGTTATTAACATA 50 3′ end-protected R TGACAACTCAATTAAACNN*N*N phosphorylated, blunt, 5′ /5Phos/G*T*TTAATTGAGTTGTCAT 1 and 3′ end-protected F ATGTTAATAACGGT*A*T phosphorylated, blunt, 5′ /5Phos/A*T*ACCGTTATTAACATA 2 and 3′ end-protected R TGACAACTCAATTAA*A*C phosphorylated, blunt, 3′ /5Phos/GTTTAATTGAGTTGTCATA 51 end-protected F TGTTAATAACGGT*A*T phosphorylated, blunt, 3′ /5Phos/ATACCGTTATTAACATATG 52 end-protected R ACAACTCAATTAA*A*C /5Phos/ indicates 5′ phosphorylation *indicates phosphorothioate linkage All oligos were annealed in STE.
(154) First, the integration frequencies of 3 types of dsODNs using TALENs, ZFNs, and RFNs targeted against EGFP were evaluated. 2E5 U2OS-EGFP cells were nucleofected with 500 ng each TALEN monomer (1 ug total), 500 ng each ZFN monomer (1 ug total), or 325 ng multiplex gRNA plasmid and 975 ng FokI-dCas9 expression plasmid and 100 pmol of dsODN. The three dsODNs used had either a 4-bp 5′ overhang with 5′ phosphorothioate linkages, a 4-bp 3′ overhang with 3′ phosphorothioate linkages, or were blunt with 5′ and 3′ phosphorothioate linkages. All dsODNs were 5′ phosphorylated. Integration frequency was estimated with NdeI restriction fragment length polymorphism (RFLP) assay and quantified using capillary electrophesis; briefly, target sites were amplified by PCRs from isolated genomic DNA. PCRs were digested with NdeI restriction enzyme (20 U) at 37° C. for 3 hours and purified with 1.8× AMPURE XP automated PCR purification. Purified cleavage products run and quantified by a QIAXCEL capillary electrophoresis instrument (Qiagen).
(155) The same oligos (SEQ ID NOs:1 and 2) used above were transfected into U2OS cells (program DN-100) in 20 μl Solution SE (Lonza) on a Lonza Nucleofector 4-D according to the manufacturer's instructions. 500 ng of each TALEN monomer (TAL1252/TAL1301 for CCR5 and TAL2294/2295 for APC) and 100 pmol of dsODN were transfected.
(156) Additional experiments were conducted with 2E5 U2OS-EGFP cells were nucleofected with 325 ng multiplex gRNA plasmid and 975 ng FokI-dCas9 expression plasmid and 100 pmol of dsODN. Additionally, 3E5 Mouse ES cells were nucleofected with 200 ng single gRNA plasmid and 600 ng Cas9 expression plasmid, and 100 pmol dsODN. Two dsODNs were compared: 1) blunt, phosphorylated, 5′ and 3′ phosphorothioate-modified and 2) blunt, phosphorylated, only 3′ phosphorothioate-modified. Integration frequency was estimated with NdeI restriction fragment length polymorphism (RFLP) assay and quantified using capillary electrophesis.
(157) The experiments, conducted with dimeric RNA-guided FokI nucleases in human U2OS cells (
(158) Additional experiments were performed to test different concentrations of 3′ phosphorothioate modified oligo in mouse ES cells. 3E5 Mouse ES cells were nucleofected with 200 ng single gRNA plasmid and 600 ng Cas9 expression plasmid, and varying amounts of dsODN as described below. Blunt, phosphorylated, only 3′ phosphorothioate-modified dsODNs were used in this experiment. Annealed oligos were purified using a SEPHADEX G-25 gel filtration resin column in a comparison between purified and unpurified dsODN. dsODNs were tested at concentrations of 1, 2, 5, 10, 25, 50, and 100 pmol. Integration frequency was estimated with NdeI restriction fragment length polymorphism (RFLP) assay and quantified using capillary electrophesis. The results, shown in
(159) The length of the dsODNs was also evaluated.
(160) TABLE-US-00013 ssODN Sequence SEQ ID NO: oSQT1255 /5Phos/C*C*GCTTGCAGAGGGTATATTTGGTTAT CATATG 53 GGACGAGTAGACTGAGATGAAGGTT*T*A oSQT1256 /5Phos/T*A*AACCTTCATCTCAGTCTACTCGTCC CATATG 54 ATAACCAAATATACCCTCTGCAAGC*G*G oSQT1257 /5Phos/A*G*GACTGCATTCTTGTATACTTAGACT CATATG 55 TTCCTCTGGTACCGCGTAGATGTTT*A*C oSQT1258 /5Phos/G*T*AAACATCTACGCGGTACCAGAGGAA CATATG 56 AGTCTAAGTATACAAGAATGCAGTC*C*T oSQT1259 /5Phos/A*C*CAATCAGTCACGAGCCTAGGAGATT CATATG 57 GGTAAGAGAGTCACATAATGCTTCC*G*G oSQT1260 /5Phos/C*C*GGAAGCATTATGTGACTCTCTTACC CATATG 58 AATCTCCTAGGCTCGTGACTGATTG*G*T *indicates phosphorothioate linkage
(161) These experiments show that the efficiency of dsODN tag uptake can be increased by using oligos that are modified only on the 3′ ends rather than on both the 5′ and 3′ ends, that are longer, and that efficient capture of the dsODN tag occurs in a variety of cell lines, including cells that are not from a transformed cancer cell line (e.g., mouse ES cells).
Example 4
(162) In this Example, a biotinylated version of the GUIDE-seq dsODN tag was used as a substrate for integration into the sites of genomic DSBs. As shown in Example 4, it was possible to integrate such an oligo efficiently. The experiments were performed as described above, using a biotinylated dsODN, obtained from IDT DNA.
(163) TABLE-US-00014 dsODN Sequence SEQ ID NO: oSQT1261 /5Phos/G*T*TTAATTGAG/iBiodT/TGTCATATG 59 TTAATAACGGT*A*T oSQT1262 /5Phos/A*T*ACCGTTA/iBiodT/TAA CATATG 60 ACAACTCAATTAA*A*C iBiodT—biotin dT tag * indicates phosphorothioate linkage
(164)
(165) Assuming that the biotinylation is preserved in cells, it can be used to physically pulldown DNA fragments including the biotinyulated ssODNs, and to sequence and map the captured fragments.
Example 5
(166) In this Example, an exemplary GUIDE-Seq method is used with variant Cas9 proteins.
(167) Variant Streptococcus pyogenes Cas9 (SpCas9) and Staphylococcus aureus Cas9 (SaCas9) proteins were generated as described in U.S. Ser. No. 61/127,634 and 62/165,517, incorporated herein by reference, and in Kleinstiver et al., “Engineered CRISPR-Cas9 nucleases with altered PAM specificities.” Nature (2015) doi:10.1038/nature14592. Off-target effects were evaluated as described above.
(168)
(169) TABLE-US-00015 TABLE 4 Spacer SEQ SEQ length ID ID Name (nt) Spacer Sequence NO: Sequence with extended PAM NO: EMX1 NGA 4-20 20 GCCACGAAGCAGGCCAATGG 61 GCCACGAAGCAGGCCAATGGGGAG 62 FANCF NGA 1- 20 GAATCCCTTCTGCAGCACCT 63 GAATCCCTTCTGCAGCACCTGGAT 64 20 FANCF NGA 3- 20 GCGGCGGCTGCACAACCAGT 65 GCGGCGGCTGCACAACCAGTGGAG 66 20 FANCF NGA 4- 20 GGTTGTGCAGCCGCCGCTCC 67 GGTTGTGCAGCCGCCGCTCCAGAG 68 20 RUNX1 NGA 1- 20 GGTGCATTTTCAGGAGGAAG 69 GGTGCATTTTCAGGAGGAAGCGAT 70 20 RUNX1 NGA 3- 20 GAGATGTAGGGCTAGAGGGG 71 GAGATGTAGGGCTAGAGGGGTGAG 72 20 VEGFA NGA 1- 20 GCGAGCAGCGTCTTCGAGAG 73 GCGAGCAGCGTCTTCGAGAGTGAG 74 20 ZNF629 NGA 1- 20 GTGCGGCAAGAGCTTCAGCC 75 GTGCGGCAAGAGCTTCAGCCAGAG 76 20 FANCF NGCG 3- 20 GCAGAAGGGATTCCATGAGG 77 GCAGAAGGGATTCCATGAGGTGCG 78 20 FANCF NGCG 4- 19 GAAGGGATTCCATGAGGTG 79 GAAGGGATTCCATGAGGTGCGCG 80 19 RUNX1 NGCG 1- 19 GGGTGCATTTTCAGGAGGA 81 GGGTGCATTTTCAGGAGGAAGCG 82 19 VEGFA NGCG 1- 20 GCAGACGGCAGTCACTAGGG 83 GCAGACGGCAGTCACTAGGGGGCG 84 20 VEGFA NGCG 2- 20 GCTGGGTGAATGGAGCGAGC 85 GCTGGGTGAATGGAGCGAGCAGCG 86 20
(170)
(171) GUIDE-seq dsODN tag integration was also performed at 3 genes with wild-type and engineered Cas9 D1135E variant. The results, shown in
REFERENCES
(172) 1. Sander, J. D. & Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol 32, 347-355 (2014). 2. Hsu, P. D., Lander, E. S. & Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell 157, 1262-1278 (2014). 3. Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821 (2012). 4. Fu, Y. et al. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol 31, 822-826 (2013). 5. Hsu, P. D. et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol 31, 827-832 (2013). 6. Pattanayak, V. et al. High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity. Nat Biotechnol 31, 839-843 (2013). 7. Cradick, T. J., Fine, E. J., Antico, C. J. & Bao, G. CRISPR/Cas9 systems targeting beta-globin and CCR5 genes have substantial off-target activity. Nucleic Acids Res 41, 9584-9592 (2013). 8. Cho, S. W. et al. Analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases. Genome Res 24, 132-141 (2014). 9. Ghezraoui, H. et al. Chromosomal translocations in human cells are generated by canonical nonhomologous end-joining. Mol Cell 55, 829-842 (2014). 10. Choi, P. S. & Meyerson, M. Targeted genomic rearrangements using CRISPR/Cas technology. Nat Commun 5, 3728 (2014). 11. Gostissa, M. et al. IgH class switching exploits a general property of two DNA breaks to be joined in cis over long chromosomal distances. Proc Natl Acad Sci USA 111, 2644-2649 (2014). 12. Tsai, S. Q. & Joung, J. K. What's changed with genome editing? Cell Stem Cell 15, 3-4 (2014). 13. Marx, V. Gene editing: how to stay on-target with CRISPR. Nat Methods 11, 1021-1026 (2014). 14. Veres, A. et al. Low incidence of off-target mutations in individual CRISPR-Cas9 and TALEN targeted human stem cell clones detected by whole-genome sequencing. Cell Stem Cell 15, 27-30 (2014). 15. Smith, C. et al. Whole-genome sequencing analysis reveals high specificity of CRISPR/Cas9 and TALEN-based genome editing in human iPSCs. Cell Stem Cell 15, 12-13 (2014). 16. Duan, J. et al. Genome-wide identification of CRISPR/Cas9 off-targets in human genome. Cell Res 24, 1009-1012 (2014). 17. Wu, X. et al. Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nat Biotechnol 32, 670-676 (2014). 18. Kuscu, C., Arslan, S., Singh, R., Thorpe, J. & Adli, M. Genome-wide analysis reveals characteristics of off-target sites bound by the Cas9 endonuclease. Nat Biotechnol 32, 677-683 (2014). 19. Cencic, R. et al. Protospacer Adjacent Motif (PAM)-Distal Sequences Engage CRISPR Cas9 DNA Target Cleavage. PLoS One 9, e109213 (2014). 20. Orlando, S. J. et al. Zinc-finger nuclease-driven targeted integration into mammalian genomes using donors with limited chromosomal homology. Nucleic Acids Res 38, e152 (2010). 21. Schmidt, M. et al. High-resolution insertion-site analysis by linear amplification-mediated PCR (LAM-PCR). Nat Methods 4, 1051-1057 (2007). 22. Gabriel, R. et al. An unbiased genome-wide analysis of zinc-finger nuclease specificity. Nat Biotechnol 29, 816-823 (2011). 23. Jiang, W., Bikard, D., Cox, D., Zhang, F. & Marraffini, L. A. RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol 31, 233-239 (2013). 24. Lin, Y. et al. CRISPR/Cas9 systems have off-target activity with insertions or deletions between target DNA and guide RNA sequences. Nucleic Acids Res 42, 7473-7485 (2014). 25. Ran, F. A. et al. Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281-2308 (2013). 26. Heigwer, F., Kerr, G. & Boutros, M. E-CRISP: fast CRISPR target site identification. Nat Methods 11, 122-123 (2014). 27. Crosetto, N. et al. Nucleotide-resolution DNA double-strand break mapping by next-generation sequencing. Nat Methods 10, 361-365 (2013). 28. Osborn, M. J. et al. TALEN-based gene correction for epidermolysis bullosa. Mol Ther 21, 1151-1159 (2013). 29. Sander, J. D. et al. In silico abstraction of zinc finger nuclease cleavage profiles reveals an expanded landscape of off-target sites. Nucleic Acids Res (2013). 30. Fu, Y., Sander, J. D., Reyon, D., Cascio, V. M. & Joung, J. K. Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nat Biotechnol 32, 279-284 (2014). 31. Tsai, S. Q. et al. Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol 32, 569-576 (2014). 32. Guilinger, J. P., Thompson, D. B. & Liu, D. R. Fusion of catalytically inactive Cas9 to FokI nuclease improves the specificity of genome modification. Nat Biotechnol 32, 577-582 (2014). 33. Mali, P. et al. CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol 31, 833-838 (2013). 34. Ran, F. A. et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154, 1380-1389 (2013). 35. Fonfara, I. et al. Phylogeny of Cas9 determines functional exchangeability of dual-RNA and Cas9 among orthologous type II CRISPR-Cas systems. Nucleic Acids Res 42, 2577-2590 (2014).
Other Embodiments
(173) It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.