Method for activating Oct4 for induction of pluripotent stem cells

Abstract

The invention relates to a method for inducing pluripotent stem cells, wherein a mammalian cell is contacted with a compound characterized by a general formula 1 wherein R.sup.1 is (CH.sub.2).sub.mE, with E being CCH or CN and m being 0, 1, or 2, and R.sup.2 is selected from F, CI, Br, OR.sup.3 and R.sup.3, with R.sup.3 being selected from H, (CH.sub.yF.sub.2-y).sub.n CH.sub.XF.sub.3-X, with n=0 or 1. The invention further relates to stem cells obtained by the method of the invention, and culture media comprising the compound of the invention.

Claims

1. A method for inducing a pluripotent mammalian stem cell, comprising contacting a mammalian donor cell with a compound represented by formula 1: ##STR00009## wherein R.sup.1 is (CH.sub.2).sub.mE, with E being CCH or CN and m being 0, 1, or 2, and R.sup.2 is selected from F, Cl, Br, NO.sub.2, OR.sup.3 and R.sup.3, with R.sup.3 being selected from H, CH.sub.xF.sub.3-x, wherein x equals 0, 1, 2, or 3.

2. The method according to claim 1, wherein R.sup.1 is CH.sub.2CN.

3. The method according to claim 1, wherein R.sup.2 is OCF.sub.3, OCH.sub.3 or F.

4. The method according to claim 1, where said compound is: 2-[4-[(4-methoxyphenyl)methoxy]phenyl]acetonitrile (2); 2-[4-[(4-fluorophenyl)methoxy]phenyl]acetonitrile (3) or 2-[4-[[4-(trifluoromethoxy)phenyl]methoxy]phenyl]acetonitrile (4).

5. The method according to claim 1, wherein the mammalian donor cell is a cell derived from skin tissue, bone, blood, muscle, heart, or liver.

6. The method according to claim 1, comprising the steps of: providing said mammalian donor cell ex-vivo in a cell culture medium; adding said compound to achieve a defined final concentration of said compound; maintaining said donor cells under conditions of cell culture for a defined amount of time; collecting said pluripotent mammalian stem cell.

7. The method according to claim 6, wherein said defined final concentration is between 1 μmol/l and 15 μmol/l.

8. The method according to claim 6, wherein said defined amount of time is between 5 days and 30 days.

9. The method according to claim 6, wherein collecting said pluripotent mammalian stem cells comprises a selection step, whereby said pluripotent mammalian stem cells are selected that express a gene selected from the group comprised of Nanog, SOX2, LIN28, SSEA-4, TRA-1-60, TRA-1-81, CD133 and Alkaline Phosphatase and/or do not express CD13.

10. A cell culture medium comprising a compound represented by formula 1: ##STR00010## wherein R.sup.1 is (CH.sub.2).sub.mE, with E being CCH or CN and m being 0, 1, or 2, and R.sup.2 is selected from F, Cl, Br, NO.sub.2, OR.sup.3 and R.sup.3, with R.sup.3 being selected from H, (CH.sub.xF.sub.3-x, wherein x equals 0, 1, 2, or 3.

11. The cell culture medium according to claim 10, wherein R.sup.1 is CN.

12. The cell culture medium according to claim 10, wherein R.sup.2 is OCF.sub.3, OCH.sub.3 or F.

13. A cell culture medium according to claim 10, wherein said compound is: 2-[4-[(4-methoxyphenyl)methoxy]phenyl]acetonitrile (2); 2-[4-[(4-fluorophenyl)methoxy]phenyl]acetonitrile (3) or 2-[4-[[4-(trifluoromethoxy)phenyl]methoxy]phenyl]acetonitrile (4).

14. The cell culture medium according to claim 10, wherein said compound has a concentration between 1 μmol/l to 25 μmol/l.

15. A method for inducing OCT4 and NANOG in a cell, comprising contacting a mammalian donor cell with a compound represented by formula 1: ##STR00011## wherein R.sup.1 is (CH.sub.2).sub.mE, with E being CCH or CN and m being 0, 1, or 2, and R.sup.2 is selected from F, Cl, Br, NO.sub.2, OR.sup.3 and R.sup.3, with R.sup.3 being selected from H, (CH.sub.xF.sub.3-x, wherein x equals 0, 1, 2,or 3.

16. The method according to claim 15, wherein R.sup.1 is CH.sub.2CN.

17. The method according to claim 15, wherein R.sup.2 is OCF.sub.3, OCH.sub.3 or F.

18. The method according to claim 15, where said compound is: 2-[4-[(4-methoxyphenyl)methoxy]phenyl]acetonitrile (2); 2-[4-[(4-fluorophenyl)methoxy]phenyl]acetonitrile (3) or 2-[4-[[4-(trifluoromethoxy)phenyl]methoxy]phenyl]acetonitrile (4).

19. The method according to claim 15, wherein the mammalian donor cell is a cell derived from skin tissue, bone, blood, muscle, heart, or liver.

Description

SHORT DESCRIPTION OF THE FIGURES

(1) FIG. 1 shows the results of an assay measuring OCT4-promoter driven luciferase expression in HEK293 cells at 48 h (A) and 72 h (B) after stimulation with compound 2.

(2) FIG. 2 shows the results of an assay measuring NANOG-promoter driven luciferase expression in HEK293 cells at 48 h after stimulation with compound 2.

(3) FIG. 3 shows a time course of NANOG-promoter (A) and OCT4-promoter (B) driven luciferase expression after stimulation with compound 2; the number 30 in the x-axis refers to 30 min, the numbers 1, 6, 24, 48 and 72 in the x-axis refer to 1, 6, 24, 48 and 72 hours, respectively.

(4) FIG. 4 shows the results of quantitative PCR measurement of stemness factor mRNAs as a function of compound concentration (compound 2) in HEK293 cells. Series of bars refer to (left to right) control, 0.5 μmol/l, 1 μmol/l, 5 μmol/l, 10 μmol/l, 20 μmol/l.

(5) FIG. 5 shows the results of an assay measuring OCT4-promoter (A) and NANOG-promoter (B) driven luciferase expression in HEK293 cells for compound 2,3,4. Series of bars refer to (left to right) control and compound 2 (dark), compound 3 (grey), and compound 4 (bright).

EXAMPLES

(6) Construction of Cell Lines

(7) The promoters of the human Oct4 (Entrez identifier No. 5460) and Nanog (Entrez identifier No. 79923) gene were cloned into a plasmid, respectively, driving the firefly luciferase gene from Photinus pyralis. Monoclonal cell lines were generated from human embryonic kidney cells (HEK293, ATCC CRL-1573) cells that contain stably the DNA of the plasmids.

(8) Cell Culture

(9) HEK293 cells were cultured in DMEM (Gibco, Germany) containing 10% FBS (PAA, Germany) and 1% Penicillin/Streptomycin (Pen/Strep, Gibco, Germany). The cells were maintained under 5% CO2 at 37° C. in a humidified atmosphere.

(10) Oct4 or Nanog Stable Reporter HEK293 cells were cultured in in DMEM medium containing high glucose without glutamin, 10% FCS, 1% 1M Hepes-Buffer, 0.5% Penicillin/Streptomycin and 0.5% with fresh 200 mM glutamin(L) before use.

(11) Assay

(12) Luciferase report assay was performed using Beatle juice kit (PJK, Germany) according to the manufacturer instruction. Briefly, Oct4 or Nanog stable reporter Hek293 cells were plated into 24-well tissue culture plates at a density of 200,000 or 300,000 cells per well for 24h. The cells were treated with compounds as indicated in context and harvested with 60 μL Beatle lysis-juice at room temperature for 15 min. The protein concentration was determined by Bradford assay (Sigma, Germany). 20 μL cell lysis was added to 100 μL reaction mixture containing luciferin and ATP, incubated for 3 min and measured by a Luminometer plate-reader. Data were normalized DMSO control, show the mean ±SD of duplicates and are representative of three independent experiments

(13) RT-PCR, Primers

(14) Quantitative real-time reverse-transcription-PCR was performed according to manufacturer's instructions (Light Cycler, Roche, Germany). Briefly, normal HEK293 cells were treated with compounds as indicated for 48 h. Total RNA was isolated using Qiagen total RNA extraction kit. cDNA was generated by reverse-transcription using AMV reverse transcriptase (Promega, Germany) of equivalent quantities of RNA and qRT-PCR was performed using SYBR Green PCR master mix on Light Cycler 480 (Roche, Germany). The following primer

(15) (Eurofins, Germany) pairs were used for the amplification of Oct3/4, Nanog, Sox2, Rex1 and Lin28A, respectively: (Oct3/4) 5s: GAAGTTGGAGAAGGTGGAAC (SEQ ID 01); 3as: GGTGATCCTCTTCTGCTTCAG (SEQ ID 02); (Nanog) 5s: GAACTGTGTTCTCTTCCACC (SEQ ID 03); 3as: CACCTGTTTGTAGCTGAGGTTC (SEQ ID 04); (Sox2): 5s: CAAGACGCTCATGAAGAAGG (SEQ ID 05); 3as: CATGTGCGCGTAACTGTCCATG (SEQ ID 06); (Rex1) 5s: GATCTTCAACGAGTCCACCAG (SEQ ID 07); 3as: GAAAGGTGGGAGATCCTCCTCTTC (SEQ ID 08); (Lin28A) 5s: GTGGATGTCTTTGTGCACCAG (SEQ ID 09); 3as: GACACGGATGGATTCCAGAC (SEQ ID 10). R-Actin 5s: CTGACTACCTCATGAAGATCCTC (SEQ ID 11); 3as: CATTGCCAATGGTGATGACCTG (SEQ ID 12) was used as an endogenous control. Data were normalized to the value of DMSO treated cells showing the mean ±SD of quadruplicates and are representative of two independent experiments