Human coagulation factor light chain protein and use of the same
09782461 · 2017-10-10
Assignee
Inventors
- Xu Song (Sichuan, CN)
- Ling Li (Sichuan, CN)
- Jinwu Chen (Sichuan, CN)
- Dongsheng Liao (Sichuan, CN)
- Dengjiao Ma (Sichuan, CN)
Cpc classification
A61P7/00
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61P7/02
HUMAN NECESSITIES
International classification
Abstract
In the invention, the minimum inhibitory concentrations of human coagulation factor light-chain proteins against different Gram-negative bacteria are detected with the in vitro antibacterial activity and the inhibiting effect of the human coagulation factor light-chain proteins against different Gram-negative bacteria is detected with the in vivo antibacterial activity. It has been shown that human coagulation factor light-chain proteins have an obvious inhibitory effect on the Gram-negative bacteria, so as to develop a novel class of medicaments for treating Gram-negative bacteria infection. It has been demonstrated by mass spectrometry and silver staining that human coagulation factor light-chain proteins have the effect on hydrolyzing and eliminating the endotoxin, which facilitates the development of a novel class of medicaments for treating endotoxemia. The human coagulation factor light-chain proteins are light chain proteins of human coagulation factors VII, IX, and X, as well as a protein having homology of more than 50% thereof.
Claims
1. A method for treating a disease caused by Gram-negative bacteria infection, said method comprises administering an effective amount of protein encoded by a human coagulation factor light-chain gene or a pharmaceutical composition thereof to a subject.
2. The method of claim 1, wherein the disease caused by Gram-negative bacteria infection is endotoxemia.
3. The method of claim 1, wherein the protein encoded by a human coagulation factor light-chain gene comprises amino acid sequence SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or combinations thereof.
4. The method of claim 2, wherein the protein encoded by a human coagulation factor light-chain gene comprises amino acid sequence SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or any combination thereof.
5. The method of claim 1, wherein the Gram-negative bacteria is one or more of Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumonia, Enterobacter cloacae, Aeromonas hydrophila, Citrobacter diversus, Moraxella catarrhalis, Proteus mirabilis, Proteus vulgaris and Serratia marcescens.
6. The method of claim 2, wherein the Gram-negative bacteria is one or more of Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumonia, Enterobacter cloacae, Aeromonas hydrophila, Citrobacter diversus, Moraxella catarrhalis, Proteus mirabilis, Proteus vulgaris and Serratia marcescens.
7. The method of claim 3, wherein the Gram-negative bacteria is one or more of Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumonia, Enterobacter cloacae, Aeromonas hydrophila, Citrobacter diversus, Moraxella catarrhalis, Proteus mirabilis, Proteus vulgaris and Serratia marcescens.
8. The method of claim 4, wherein the Gram-negative bacteria is one or more of Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumonia, Enterobacter cloacae, Aeromonas hydrophila, Citrobacter diversus, Moraxella catarrhalis, Proteus mirabilis, Proteus vulgaris and Serratia marcescens.
9. A method for hydrolyzing a lipopolysaccharide, said method comprising contacting a lipopolysaccharide with an effective amount of protein encoded by a human coagulation factor light-chain gene or a pharmaceutical composition thereof to hydrolyze the lipopolysaccharide.
10. The method of claim 9, wherein the lipopolysaccharide is a lipopolysaccharide of a Gram-negative bacteria.
11. The method of claim 10, wherein the Gram-negative bacteria is one or more of Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumonia, Enterobacter cloacae, Aeromonas hydrophila, Citrobacter diversus, Moraxella catarrhalis, Proteus mirabilis, Proteus vulgaris and Serratia marcescens.
12. The method of claim 9, wherein the protein encoded by a human coagulation factor light-chain gene comprises amino acid sequence SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or any combination thereof.
13. The method of claim 10, wherein the protein encoded by a human coagulation factor light-chain gene comprises amino acid sequence SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or any combination thereof.
14. The method of claim 11, wherein the protein encoded by a human coagulation factor light-chain gene comprises amino acid sequence SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or any combination thereof.
Description
BRIEF DESCRIPTION OF ACCOMPANYING DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22) Control: the control group without addition of protein;
12.5 μg/ml: the experimental group with 12.5 μg/mL of the recombinant protein LhF VII;
25 μg/ml: the experimental group with 25 μg/mL of the recombinant protein LhF VII;
50 μg/ml; the experimental group with 50 μg/mL of the recombinant protein LhF VII.
(23) Control: the control group without addition of protein;
12.5 μg/ml: the experimental group with 12.5 μg/mL of the recombinant protein LhF IX;
25 μg/ml: the experimental group with 25 μg/mL of the recombinant protein LhF IX;
50 μg/ml: the experimental group with 50 μg/mL of the recombinant protein LhF IX.
(24) Control: the control group without addition of protein;
12.5 μg/ml: the experimental group with 12.5 μg/mL of the recombinant protein LhF X;
25 μg/ml: the experimental group with 25 μg/mL of the recombinant protein LhF X;
50 μg/ml: the experimental group with 50 μg/mL of the recombinant protein LhF X.
(25) Control: the infected mice with no medicament injected; ※ meropenem: the infected mice injected with meropenem; ∇ penicillin: the infected mice injected with penicillin; ∘ LhF VII: the infected mice injected with the recombinant protein LhF VII.
(26) Control: the infected mice with no medicament injected; ∇ penicillin: the infected mice injected with penicillin; ※ meropenem: the infected mice injected with meropenem; ∘ LhF IX: the infected mice injected with the recombinant protein LhF IX.
(27) Control: the infected mice with no medicament injected; ∇ penicillin: the infected mice injected with penicillin; ※ meropenem: the infected mice injected with meropenem; ∘ LhF X: the infected mice injected with the recombinant protein LhF X.
(28)
(29)
DETAILED DESCRIPTION
(30) The present invention will be further illustrated below in connection with the Examples. In the Examples described hereinafter, where the particular experiment conditions are not otherwise noted, they will follow the conventional conditions well known to the person of skill in the art, such as the conditions and experimental steps described in Molecular Cloning: A Laboratory Manual, Sambrook et al (Ed.), New York, Cold Spring Harbor Laboratory Press, 1989, An Conventional Manual for Laboratory Animals (National Center for Standard Laboratory Animals, November, 2004), and a Manual of Basic Technique, 5.sup.th Edition (John Wiley & Sons, Inc., 2005), or follow the conditions and experimental steps recommended by the manufacture.
Example 1
Obtaining the Gene Encoding the Recombination Protein LhF VII
(31) 1. The primers for PCR amplification as shown below were synthesized (by Invitrogen Biological Technology Co. Ltd.):
(32) TABLE-US-00002 Primer 1: SEQ ID NO: 7 5′-TAACCATGGGCCATCATCATCATCATCACGCCAACGCGTTCCTGGAG Nco I GA-3′ Primer 2: SEQ ID NO: 8 5′-TATCTCGAGTTATCGGCCTTGGGGTTTGCTGGCATT-3′ Xho I
(33) 2. PCR Amplification System
(34) The PCR amplification was performed with Primers 1 and 2 using a plasmid comprising the CDS region of human coagulation factor VII (FulenGen Co. Ltd., Guangzhou) as the template. An Nco I restriction site and a His×6 tag for protein purification were introduced into the sequence of Primer 1, and an Xho I restriction site was introduced into the sequence of Primer 2. After the amplification, a DNA fragment of 497 bp comprising the coding sequence for the human coagulation factor VII light chain was obtained. The PCR reaction system (50 μL) was as follows:
(35) Deionized water: 31.5 μL
(36) 5×Reaction buffer: 10 μL
(37) dNTP Mix: 4 μL
(38) Primer 1 (10 mM): 1 μL
(39) Primer 2 (10 mM): 1 μL
(40) Plasmid comprising the CDS region of human coagulation factor VII (100 ng/μL): 2 μL
(41) PrimeStar DNA polymerase: 0.5 μL
(42) 3. Reaction Conditions for the PCR Amplification
(43) The reaction condition for the PCR amplification was set with reference to the instruction of PrimeStar DNA polymerase (purchased from Takara): pre-denaturation at 98° C. for 2 min, 30 cycles of denaturation at 98° C. for 10 sec, annealing at 55° C. for 15 sec, and 72° C. elongation 50 sec, followed by elongation at 72° C. for 4 min
(44) 4. The amplified products were analyzed with 2% agarose gel electrophoresis (see
Example 2
Obtaining the Gene Encoding the Recombination Protein LhF IX
(45) 1. The primers for PCR amplification as shown below were synthesized (by Invitrogen Biological Technology Co. Ltd.):
(46) TABLE-US-00003 Primer 1: SEQ ID NO: 9 5′-ATACCATGGGCCATCATCATCATCATCATTATAATTCAGGTAAATT Nco I GGAAG-3′ Primer 2: SEQ ID NO: 10 5′-ATTCTCGAGTTAACGGGTGAGCTTAGAAGTTTGT-3′ Xho I
(47) 2. PCR Amplification System
(48) The PCR amplification was performed with Primers 1 and 2 using a plasmid comprising the CDS region of human coagulation factor IX (FulenGen Co. Ltd., Guangzhou) as the template. An Nco I restriction site and a His×6 tag for protein purification were introduced into the sequence of Primer 1, and an Xho I restriction site was introduced into the sequence of Primer 2. After the amplification, a DNA fragment of 476 bp comprising the coding sequence for human coagulation factor IX light chain was obtained. The PCR reaction system (50 μL) was as follows:
(49) Deionized water: 31.5 μL
(50) 5×Reaction buffer: 10 μL
(51) dNTP Mix: 4 μL
(52) Primer 1 (10 mM): 1 μL
(53) Primer 2 (10 mM): 1 μL
(54) Plasmid comprising the CDS region of human coagulation factor IX (100 ng/μL): 2 μL
(55) PrimeStar DNA polymerase: 0.5 μL
(56) 3. Reaction Conditions for the PCR Amplification
(57) The reaction condition for the PCR amplification was set with reference to the instruction of PrimeStar DNA polymerase: pre-denaturation at 98° C. for 2 min, 30 cycles of denaturation at 98° C. for 10 sec, annealing at 55° C. for 15 sec, and 72° C. elongation for 50 sec, followed by elongation at 72° C. for 4 min.
(58) 4. The amplified products were analyzed with 2% agarose gel electrophoresis (see
Example 3
Obtaining the Gene Encoding the Recombination Protein LhF X
(59) 1. The primers for PCR amplification as shown below were synthesized (by Invitrogen Biological Technology Co. Ltd.):
(60) TABLE-US-00004 Primer 1: SEQ ID NO: 11 5′-ATACCATGGGCCATCATCATCATCATCATGCCAATTCCTTTCTTGA Nco I AGAG-3′ Primer 2: SEQ ID NO: 12 5′-ATTCTCGAGTTAGCGTTCCAGGGTCTGTTTCC-3′ Xho I
(61) 2. PCR Amplification System
(62) The PCR amplification was performed with Primers 1 and 2 using a plasmid comprising the CDS region of human coagulation factor X (FulenGen Co. Ltd., Guangzhou) as the template. An Nco I restriction site and a His×6 tag for protein purification were introduced into the sequence of Primer 1, and an Xho I restriction site was introduced into the sequence of Primer 2. After the amplification, a DNA fragment of 458 bp comprising the coding sequence for the human coagulation factor X light chain was obtained. The PCR reaction system (50 μL) was as follows:
(63) Deionized water: 31.5 μL
(64) 5×Reaction buffer: 10 μL
(65) dNTP Mix: 4 μL
(66) Primer 1 (10 mM): 1 μL
(67) Primer 2 (10 mM): 1 μL
(68) Plasmid comprising the CDS region of human coagulation factor X (100 ng/μL): 2 μL
(69) PrimeStar DNA polymerase: 0.5 μL
(70) 3. Reaction Conditions for the PCR Amplification
(71) The reaction condition for the PCR amplification was set with reference to the instruction of PrimeStar DNA polymerase: pre-denaturation at 98° C. for 2 min, 30 cycles of denaturation at 98° C. for 10 sec, annealing at 55° C. for 15 sec, and 72° C. elongation for 50 sec, followed by elongation at 72° C. for 4 min.
(72) 4. The amplified products were analyzed with 2% agarose gel electrophoresis (see
Example 4
Construction of the Recombinant Prokaryotic Plasmids for Expressing the Recombinant Proteins LhF VII, LhF IX, and LhF X
(73) 1. Pre-Treatment of the Gene Fragments and the Prokaryotic Expression Vector
(74) The LhF VII gene fragment cloned in Example 1, the LhF IX gene fragment cloned in Example 2, the LhF X gene fragment cloned in Example 3, and the prokaryotic expression vector pET19b (a product from Novagen) were individually double digested with the restriction endonucleases Nco I and Xho I (both purchased from TaKaRa or Fermentas), at 37° C. over night, and the reaction systems were set as follows:
(75) TABLE-US-00005 LhF VII LhF IX LhF X pET19b Reagent (μL) (μL) (μL) (μL) DNA 20 20 20 20 Nco I 1 1 1 1 Xho I 1 1 1 1 10 x Buffer 6 6 6 6 Double distilled water 2 2 2 2 Total volume 30 30 30 30
(76) After completion of the double digestion, the reaction products were analyzed with 1% agarose gel electrophoresis and the fragments of interest were recovered under the ultraviolet lamp of a gel imaging system according to the instruction of a gel recovery kit (purchased from Omega).
(77) 2. Ligation of LhF VII, LhF IX, and LhF X Genes to the Prokaryotic Expression Vector pET19b and Transformation
(78) (1) The gene fragments LhF VII, LhF IX, and LhF X and the prokaryotic vector fragment obtained in the above steps were quantified approximately and then subjected to ligation according to the ligation reaction principle where a ratio of the molecule number of the gene fragment to the molecule number of the prokaryotic vector is 3:1. The ligation reaction system was set up as follows:
(79) TABLE-US-00006 Reagent Volume (μL) pET19b DNA 1.5 LhF VII, LhF IX or LhF X DNA 7 T4 ligase 0.5 10 x Buffer 1 Total volume 10
(80) (2) The entire ligation reaction was proceeded at 16° C. over night under the action of T4 DNA ligase (purchased from Fermentas). Each of the three gene fragments amplified above was inserted into the prokaryotic expression vector pET19b and the construction of the recombinant prokaryotic plasmids were schematically shown in
(81) (3) Each of the ligation products was transformed into the competent cells (prepared according to Molecular Cloning: a Laboratory Manual) of E. coli Top10 (purchased from Invitrogen company). The main steps of the procedure for transforming the ligation products were as follows:
(82) 1) 5 μL of the ligation product was pipetted into 100 μl of the competent cells of E. coli Top10 placed in a 1.5 mL Eppendorf tube, and the negative control is 100 μl of the competent cells of E. coli Top10 placed in a 1.5 mL Eppendorf tube;
(83) 2) the tubes were placed on ice for 30 min;
(84) 3) the competent cells were shocked in a metal bath at 42° C. for 90 s;
(85) 4) the tubes were transferred rapidly into a ice-bath to be cooled for 2 min;
(86) 5) 900 μL of SOC medium (10 g peptone, 5 g yeast extract, 0.5 g NaCl, 0.186 g KCl, 0.95 g MgCl.sub.2, dissolved with ddH.sub.2O and made up to a volume of 980 mL, autoclaved, cooled to room temperature and then 20 mL of sterile 20% aqueous glucose solution was added) was added, and placed on ice;
(87) 6) the tubes were incubated at 37° C. for 1 h with shaking at 180 rpm;
(88) 7) the bacterial suspension was centrifuged at 4000×g for 3 min, and the excessive medium was removed except 200 μL supernatant was kept. 200 μL of the remaining supernatant was used to resuspend the bacteria;
(89) 8) the resuspended transformants were plated uniformly onto the solid LB medium containing 0.1 g/mL ampicillin and incubated in a constant-temperature incubator at 37° C. over night.
(90) 3. Identification of the Recombinant Plasmid
(91) The single clone of transformed E. coli Top 10 mentioned above was picked, cultured in a small quantity and subjected to plasmid extraction with a plasmid extraction kit (purchased from OMEGA), followed by double digestion with Nco I/Xho I for identification. The double digested product was identified by gel-electrophoresis. The electrophoregrams for identification of the restriction-endonuclease digested fragments of three recombinant plasmids are shown in
(92) The plasmids which had been identified by double digestion to be correct ones were send to Beijing Genomics Institute for sequencing of the inserted fusion gene fragments. Finally, the recombinant prokaryotic plasmid comprising the LhF VII gene with the correct sequencing result is designated as pET19blhf VII, the recombinant prokaryotic plasmid comprising the LhF IX gene as pET19blhf IX, and the recombinant prokaryotic plasmid comprising the LhF X gene as pET19blhf X.
Example 5
Expression of the Recombinant Prokaryotic Plasmid in E. coli
(93) 1. Each of the recombinant plasmids pET19blhf VII, pET19blhf IX, and pET19blhf X constructed in Example 4 was transformed into E. coli BL21 (DE3) (purchased from Invitrogen). The single clone was picked into the LB medium containing 0.1 g/mL of ampicillin and incubated at 37° C. to OD.sub.600 of about 0.6 with shaking at 185 rpm. 1 mL of the bacterial suspension was taken and frozen at −20° C. Then, IPTG (isopropyl-p-D-thiogalactoside) was added to the remaining bacterial suspension at a final concentration of 0.8 mM. The incubation was proceeded for 6 h and 1 mL of the bacterial suspension was taken and frozen at −20° C.
(94) 2. The above-mentioned samples before and after IPTG induction were assayed by SDS-PAGE electrophoresis with 5% of the stacking gel and 12% of the separating gel, in order to analyze expression of the proteins of interest. The pictures of SDS-PAGE analysis on inducible expression of the recombinant proteins from the three recombinant plasmids in E. coli are seen in
(95) 3. Western-blot identification of the proteins of interest. The proteins on the gel were electrotransfered onto a nitrocellulose filter membrane (GE). The electrotransfered membrane was blocked at room temperature with a blocking solution (PBST containing about 5% nonfat milk powder) in a shaking incubator for 2 h. Then, the dilutions of the mouse monoclonal antibodies directed against FVII, FIX, and FX (the products of Santa) were added respectively and incubated at 4° C. over night. After thorough washing, the enzymatically-labeled secondary antibody (goat anti-mouse IgG) was added and incubated at room temperature in a shaking incubator for 2 h. After thorough washing, the ECL (Thermo) reaction solution was added and incubated for 5 min, the blot was exposed to film and visualized. Western-blot images for analyzing and identifying the inducible expression of the three recombinant proteins are shown in
(96) The results show that the fusion proteins are expressed obviously after IPTG induction. The strain expressing the LhF VII is designated as LhF VII-pET19bBL21-(DE3), the strain expressing the LhF IX as LhF IX-pET19bBL21-(DE3), and the strain expressing the LhF X as LhF X-pET19bBL21-(DE3).
Example 6
Purification of the Recombinant Proteins LhF VII, LhF IX, and LhF X by Affinity Chromatography
(97) 1. The bacteria LhF VII-pET19bBL21-(DE3), LhF IX-pET19bBL21-(DE3), and LhF X-pET19bBL21-(DE3) were cultured in large scale according to the method in Example 5, induced by addition of IPTG, and then cultured over night at 18° C., with shaking at 175 rpm.
(98) 2. The above-mentioned bacterial suspension was centrifuged at 4000×g for 3 min to collect the bacteria. The bacterial pellet was washed by resuspension in the EW buffer (20 mM sodium phosphate, 500 mM NaCl, 1 mM DTT, 0.1 mM PMSF, pH 7.4). The bacterial suspension was centrifuged at 4000×g for 3 min, and the supernatant was discarded. Again, the bacterial pellet was resuspended with 10 mL of the EW buffer.
(99) 3. The bacteria were disrupted by sonication (power: 300 W; duration for sonication: 10 s; interval: 10 s; total time for sonication: 3 min; performed in ice-bath). After completion of the sonication, the bacterial suspension was centrifuged at 48400×g at 4° C. for 30 min. The supernatant was collected and placed on ice.
(100) 4. The chromatographic column was preloaded according to the instruction of Co.sup.2+ purification system (Talon Metal Affinity Resin, Clontech company product), and the sample was loaded. The column was washed twice with 10 mL EW buffer and the protein impurities were washed out with 10 mM imidazole solution. Finally, the protein was eluted with 100 mM imidazole. SDS-PAGE images for analyzing and identifying the three recombinant proteins purified by affinity chromatography are seen in
(101) 5. The eluent comprising the proteins of interest was ultrafiltrated with Tris-Cl buffer (pH 7.4) for buffer exchange and concentration. After ultrafiltration, the high concentrations of the recombinant proteins, i.e. LhF VII, LhF IX, and LhF X, can be obtained. Protein quantitation showed that 15 mg of the proteins of interest with more than 90% of purity can be obtained per liter of the expressing bacterium suspension.
Example 7
Construction of the Recombinant Eukaryotic Plasmids for Expressing the Recombinant Proteins LhF VII, LhF IX, and LhF X
(102) 1. The primers for PCR amplification as shown below were synthesized (by Invitrogen Biological Technology Co. Ltd.):
(103) TABLE-US-00007 Primer 1: SEQ ID NO: 13 TAAGGATCCTGCAGAGATTTCATCATGGTCTCCCA BamH I Kozak Primer 2: SEQ ID NO: 14 TATCTCGAGTTAATGATGATGATGATGATGTCGGCCTTGG Xho I 6×His Primer 3: SEQ ID NO: 15 TAAGGATCCTGCAGAGATTTCATCATGCAGCGCGTGAAC BamH I Kozak Primer 4: SEQ ID NO: 16 TATCTCGAGTTAATGATGATGATGATGATGACGGGTGAGCT Xho I 6×His Primer 5: SEQ ID NO: 17 TAAGGATCCTGCAGAGATTTCATCATGGGGCGCCCA BamH I Kozak Primer 6: SEQ ID NO:18 TATCTCGAGTTAATGATGATGATGATGATGGCGTTCCA Xho I 6×His
(104) 2. PCR Amplification System
(105) The PCR amplification was performed with Primers 1 and 2 using a plasmid comprising the CDS region of human coagulation factor VII (FulenGen Co. Ltd., Guangzhou) as the template. A BamH I restriction site and a Kozak sequence were introduced into the sequence of Primer 1, and an Xho I restriction site and a His×6 tag for protein purification were introduced into the sequence of Primer 2. The PCR amplification was performed with Primers 3 and 4 using a plasmid comprising the CDS region of human coagulation factor IX (FulenGen Co. Ltd., Guangzhou) as the template. A BamH I restriction site, a Kozak sequence and a signal peptide sequence were introduced into the sequence of Primer 3, and an Xho I restriction site and a His×6 tag for protein purification were introduced into the sequence of Primer 4. The PCR amplification was performed with Primers 5 and 6 using a plasmid comprising the CDS region of human coagulation factor X (FulenGen Co. Ltd., Guangzhou) as the template. A BamH I restriction site, a Kozak sequence and a signal peptide sequence were introduced into the sequence of Primer 5, and an Xho I restriction site and a His×6 tag for protein purification were introduced into the sequence of Primer 6.
(106) The PCR reaction was performed with reference to Example 1.
(107) 3. Construction of the Recombinant Plasmids for Eukaryotic Expression of the Recombinant Proteins LhF VII, LhF IX, and LhF X
(108) The gene fragments LhF VII, LhF IX, and LhF X cloned in Example 7 and the eukaryotic expression vector pcDNA3.1 (+) (the product from Novagen) were individually double digested with the restriction endonucleases BamH I and Xho I (both purchased from TaKaRa Fermentas), and the reaction systems were set up with reference to Example 4. The steps for ligating the genes to the eukaryotic expression vector and for transforming and identifying the recombinant plasmids were referred to Example 4.
(109) Finally, the recombinant plasmid comprising the LhF VII gene with the correct sequencing result is designated as pcDNA3.1-LhF VII, the recombinant plasmid comprising the LhF IX gene as pcDNA3.1-LhF IX, and the recombinant plasmid comprising the LhF X gene as pcDNA3.1-LhF X. The plasmid maps can be seen in
Example 8
Construction of Stable Cell Lines for Expressing the Recombinant Proteins LhF VII, LhF IX, and LhF X
(110) 1. Cell Preparation
(111) DG44 cells (purchased from ATCC) were cultured in the α-MEM (containing L-glutamine, ribonucleic acid and deoxyribonucleic acid) complete culture medium (purchased from Hiclony) supplemented with 10% FBS (fetal bovine serum, purchased from Hiclony). On the day before transfection, DG44 cells were seeded in a 6-well plate at 4×10.sup.5 cells/mL with 2 mL per well.
(112) 2 Cell Transfection
(113) Cells were transfected with liposomes, following the instruction of Lipofectamine™2000 kit (purchased from Invitrogen). The detailed steps are as follows:
(114) 1) The cell culture medium was replaced with a serum-free α-MEM medium, 2 mL/well.
(115) 2) The eukaryotic recombinant plasmids pcDNA3.1-LhF VII, pcDNA3.1-LhF IX, and pcDNA3.1-LhF X (total amount of 4.0 μg) were individually mixed with 250 μL Opti-MEM, while 10 μl of lipo2000 was mixed with 250 μL of Opti-MEM and incubated for 5 min 3) The two solutions were mixed well and incubated for 20 min. The liposome complex was added into the well with cells, gently mixed, placed into an incubator and cultured at 37° C.
(116) 4) After 5 h, the medium was replaced with the α-MEM complete culture medium supplemented with 10% FBS;
(117) 3. Screening and Expanding of the Positive Cell Clones
(118) After 24 h of transfection with the recombinant plasmids, the cells were transferred into 100 mm petri dishes at a ratio of 1:2000. G418 (purchased from Gibco) was added at a final concentration of 800 μg/mL for screening. Cells transfected with an empty vector or not transfected were used as controls. After 15 days, the single clones were picked into and cultured in 24-well plates, and sequentially transferred into 6-well plates and into 100 mm petri dishes for expanding culture once cellular confluence was reached. When the cell confluency was 90%, cells were frozen at a rate of 1:4 in FBS with 10% DMSO (purchased from Gibco).
(119) 4. Identification of the Positive Cell Clones
(120) The picked positive cell clones were identified by the genomic PCR and RT-PCR. The fragments of interest could be amplified by both of the techniques, which demonstrated that the fusion gene has been integrated into the genome of the cell and a functional mRNA is transcribed. The stable cell lines obtained were designated as DG44-LhF VII, DG44-LhF IX, and DG44-LhF X, respectively.
Example 9
Collection of the Recombinant Proteins LhF VII, LhF IX, and LhF X Expressed by the Recombinant Eukaryotic Plasmids
(121) 1. The cells DG44-LhF VII, DG44-LhF IX, DG44-LhF X were cultured respectively in the α-MEM complete culture medium containing 10% FBS supplemented with 400 μg/mL G418, and passaged into 10 plates.
(122) 2. When the cell confluency in each plate reached more than 90%, the α-MEM complete culture medium containing 10% FBS was replaced with CHO serum-free medium, and supplemented with Vitamin K (Sigma) to a final concentration of 1 μg/mL.
(123) 3. After 3 days of cultivation, the culture supernatant was collected and centrifuged. The cellular pellet was discarded. The supernatant was five-fold concentrated with PEG20000 (Merck), purified by cobalt ion affinity chromatography and identified by SDS-PAGE and Western Blot. All steps were referred to those in Example 6.
Example 10
Detection of the Antibacterial Activity of the Recombinant Proteins LhF VII, LhF IX, and LhF X
(124) 1. E. coli DH5α was exemplified. E. coli DH5α was streaked and cultured on LB solid medium. Then, a typical clone was picked and inoculated into common LB liquid medium, cultured at 37° C. with shaking at 185 rpm until the logarithmic growth phase was reached (OD.sub.600 of about 0.5). The bacterial culture was centrifuged at 4000×g for 3 min, the supernatant was discarded, and the thalli were resuspended with fresh LB medium.
(125) 2. The above-mentioned bacterial suspension was diluted and inoculated into a 96-well plate with the total volume of 100 μL per well and a bacterial count of 5×10.sup.5 CFU/mL.
(126) 3. The recombinant proteins LhF VII, LhF IX, and LhF X were added individually to the above-mentioned wells with the final protein concentration in the well of the highest protein concentration being 50 μg/mL. Basing on this final concentration, a two-fold serial dilution was performed till a protein concentration gradient consisting of 50, 25, and 12.5 μg/mL was set up. Three parallel wells were set up for each concentration in the gradient. Meanwhile, a blank well with no bacteria and a protein-free well with bacteria alone were set up, three parallel wells per group.
(127) 4. The above-mentioned 96-well plate was placed and cultured at 37° C. in a shaking incubator shaking at 175 rpm. Samples were taken every 30 min, the absorbance values were determined at 600 nm wavelength under an ultra violet spectrophotometer, and an inhibition curve was plotted. Judgement on MIC: After 8 h of cultivation, the growth was observed with naked eyes or judged under the ultra violet spectrophotometer at a wavelength of 600 nm. The minimal inhibitory concentration MIC is defined as the lowest concentration of the recombinant protein at which there is no growth of the bacteria.
(128) The growth curves of E. coli DH5α treated with the recombinant proteins LhF VII, LhF IX, and LhF X are seen in
(129) 5. The effects of the recombinant proteins LhF VII, LhF IX, and LhF X on the growth of the Gram negative bacteria such as E. coli BL21, Pseudomonas aeruginosa, Klebsiella pneumonia, Enterobacter cloacae, Aeromonas hydrophila, Citrobacter diversus, Moraxella catarrhalis, Proteus mirabilis, Proteus vulgaris, Serratia marcescens were tested with the same method as that for E. coli DH5α. The MICs for these bacteria were listed in the table below:
(130) TABLE-US-00008 MIC (μg/mL) Strain LhF VII LhF IX LhF X E. coli BL21 50 50 50 P. aeruginosa 25 25 25 K. pneumonia 25 25 25 E. cloacae 25 50 50 A. hydrophila 25 25 25 C. diversus 50 50 25 M. catarrhalis 25 25 25 P. mirabilis 25 25 25 P. vulgaris 50 50 25 S. marcescens 25 50 25
(131) Conclusion: It can be known from the above-mentioned experimental results that the recombinant proteins LhF VII, LhF IX, and LhF X set forth in the present invention all have significant inhibitory effect on various Gram-negative bacteria.
Example 11
Determination of the Antibacterial Activity of the Recombinant Proteins LhF VII, LhF IX, and LhF X in Animals
(132) 1. The laboratory animal are male BAL B/C mice (body weight of about 18-22 g, from Sichuan University) and assigned into 11 groups with 8 animals/group, of which 3 groups are the experimental groups and the remainder are the various control groups.
(133) 2. The bacterial suspension of P. aeruginosa (derived from Sichuan University) was streaked and cultured on LB solid medium. Then, a typical clone was picked and inoculated into common LB liquid medium, cultured at 37° C. over night for about 12 h with shaking, and subsequently centrifuged at 4000×g for 3 min. The supernatant was discarded and the bacterial pellet was resuspended with physiological saline for the future use.
(134) 3. According to aseptic manipulation, the recombinant proteins LhF VII, LhF IX, and LhF X were individually formulated with physiological saline into a sample at a concentration of 100 μg/mL, and hold on ice for the future use.
(135) 4. Penicillin and meropenem were dissolved individually with sterile physiological saline and converted into the clinically equivalent dose in a male BAL B/C mouse on the basis of the body surface area of an adult of 60 kg. The clinically equivalent dose for penicillin is 9.1 mg/animal, and for meropenem 1.5 mg/animal.
(136) 5. The bacterial suspension comprising the lethal dose of P. aeruginosa was injected intraperitoneally into the male BAL B/C mice in the individual experimental groups and the three control groups at a dosage of 500 μL/animal.
(137) 6. After the male BAL B/C mice in the three experimental groups were infected with the bacteria for 30 min, the mice in the first experimental group was dosed with the recombinant protein LhF VII (50 μg/animal) via the tail, the mice in the second experimental group with the recombinant protein LhF IX (100 μg/animal) via the tail, the mice in the third experimental group with the recombinant protein LhF X (100 μg/animal) via the tail. After the male BAL B/C mice in the three control groups were infected with the bacteria for 30 min, the mice in the first and second control groups were dosed respectively with penicillin (9.1 mg/animal) and meropenem (1.5 mg/animal) via the tail, and the mice in the third control group were not dosed. The mice in the remaining control groups, i.e., the fourth, fifth, sixth, seventh, eighth control groups, were not injected with the bacterial suspension of P. aeruginosa, but were injected respectively with the same doses of the recombinant proteins LhF VII, LhF IX, and LhF X as those in the first, second, and third experimental groups, and respectively with the same doses of penicillin and meropenem as those in the first and second control groups.
(138) 7. At 72 h post-dosing, the male BAL B/C mice in the individual experimental groups and the individual control groups were dosed secondly with the same types and doses of the medicaments as those in the first administration.
(139) 8. After the dosing, the male BAL B/C mice were observed once every 24 h and the survival condition of the mice was documented. On the 15.sup.th day, all animals were sacrificed.
The survival rate=the surviving mice/8×100%
(140) The experimental results: The recombinant proteins LhF VII, LhF IX, and LhF X set forth in the present invention can keep the 100% of mice infected with the lethal dose of P. aeruginosa surviving for 14 days. The survival rate in the mice in the second control group (the meropenem group) was 100% after 14 days, however, all of the mice in the first control group (the penicillin group) died. The survival rates of the mice infected with the lethal dose of P. aeruginosa are shown in
(141) The experimental results show that the recombinant proteins LhF VII, LhF IX, and LhF X set forth in the present invention have an inhibitory effect on the Gram-negative bacteria in the animals, also have low toxicity, and do not result in the death of the animals.
Example 12
Mass Spectrometric Detection of Destruction of the Endotoxin (LPS) by the Recombination Proteins LhF VII, LhF IX, and LhF X
(142) 1. 1 mg/mL of E. coli K12 LPS (Sigma) was treated with the recombination protein LhF VII, LhF IX, or LhF X obtained in Example 6. The systems were set up as follows:
(143) TABLE-US-00009 The 0.5 μg/μL LhF VII, LhF IX, or LhF X 120 μL experimental group: 1 mg/mL LPS 250 μL Physiological saline 30 μL The control 0.5 μg/μL LhF VII, LhF IX, or LhF X 120 μL group 1: Physiological saline 280 μL The control TBS 120 μL group 2: 1 mg/mL LPS 250 μL Physiological saline 30 μL
(144) 2. The systems mentioned above were incubated overnight at 37° C. at 150 rpm. After completion of the incubation, samples were centrifuged at the maximal rotation speed of 17000 g for 5 min. The supernatants were collected after completion of centrifugation.
(145) 3. The supernatants were dialyzed for 16 h in a 100 D dialysis bag against dialysis buffer which was deionized water. After completion of the dialysis, the treated samples were analyzed by MALDI-TOF.
(146) 4. Firstly, 1 μL of 10 mg/mL 2,5-dihydroxybenzoic acid (DHB) dissolved in 33% alcohol was mixed well with 1 μL of the sample.
(147) 5 The sample mixed with DHB was dropped onto the stainless-steel target plate MTP 384 (Bruker Daltonics), followed by drying the sample completely on the target plate with hot air.
(148) 6. After drying, the analysis was performed using Autoflex TOF/TOF II apparatus (Bruker) with a nitrogen laser beam at 377 nm under positive ion mode. Operations were controlled by the software FlexControl 2.2. The whole mass spectra were acquired in the reflector mode at an accelerating voltage of 90 kV and a reflector voltage of 20 kV. Pulses were excited under positive ion mode for 140 ns. The scanning range is within the mass-to-charge ratio of 600 to 7000. The time of period for data collection was 500 laser pulses on average, of which the minimal laser energy must be capable of achieving the sufficient signal-to-noise ratio. The peaks generated in the mass spectrometry were acquired by using Bruker Flex analysis software (Version 3.0).
(149) 7. The post-source decay (PSD) mass spectra were recorded with the Bruker Daltonics LIFT system at a precursor-ion accelerating voltage of 18.96 kV and a fragment acceleration voltage of 4.37 kV (LIFT). The reflector voltages 1 and 2 were set at 23.49 kV and 9.69 kV, respectively.
(150) The spectrum of the experiment was exemplified by LhF VII and the result is shown in
Example 13
Silver Staining Detection of the E. coli K12 LPS Hydrolyzed by the Recombination Proteins LhF VII, LhF IX, and LhF X
(151) 1. The LPS samples were respectively incubated with the recombinant proteins LhF VII, LhF IX, and LhF X obtained in Example 6 and the control group was the LPS sample incubated with TBS buffer. The incubation lasted overnight. Then, the centrifugation was performed to collect the pellet.
(152) 2. The 1×loading buffer for LPS (0.05 M Tris-HCl, containing 10 g/L SDS, 100 g/L sucrose, 0.5% β-mercaptoethanol, 10 mg/L Bromophenol Blue, pH 6.8) was mixed with the sample of the treated pellet and incubated on a metal bath at 100° C. for 5 min.
(153) 3. 15% of the separating gel (containing 4 mol/L urea, Bio-Rad with a thickness of 1.0 mm, the detailed composition as follows: 1.15 mL of deionized water, 2.5 mL of 30% acrylamide, 1.3 mL of 1.5 mol/L Tris-HCl (pH 8.8, containing 10% SDS), 50 μL of 10% ammonium persulfate, 4 μL of TEMED) was mixed well and prepared. The top of the separating gel was overlaid with water.
(154) 4. 5% stacking gel was prepared as follows: 1.42 mL of deionized water, 0.33 mL of 30% acrylamide, 0.25 mL of 1 mol/L Tris-HCl (pH 6.8, containing 10% SDS), 20 μL of 10% ammonium persulfate, 2 μl of TEMED) were mixed well and poured. A ten-well comb was quickly inserted.
(155) 5. After the gel was prepared, the samples were loaded. Then, the gel was run at a voltage of 120 V to separate the samples. After running, gel was taken to start silver staining. The gel was transferred into a tray washed thoroughly with deionized water, followed by washing the gel three times with deionized water.
(156) 6. After completion of the washing, the gel was fixed with 50 mL of fixation solution (30% alcohol, 10% glacial acetic acid, 7 g/L periodic acid) for oxidation at room temperature for 25 min After completion of the fixation, the gel was washed three times each time with deionized water for 5 min.
(157) 7. After completion of the washing, the gel was stained in 100 mL of 1 g/L AgNO.sub.3 at room temperature for 40 min After completion of the staining, the gel was washed one time with ddH.sub.2O.
(158) 8. The gel was transferred into 50 mL of 30 g/L Na.sub.2CO.sub.3 pre-chilled on ice, to which 0.02% of formaldehyde was added just before visualization. When the band appeared or began to become dark, the reaction was stopped by adding 6 mL of glacial acetic acid. The stopping solution was removed upon completion of the termination reaction and the gel was kept in deionized water.
(159) The silver staining picture was exemplified by LhF VII, as shown in