Method for producing plastic raw material from blue-green algae

09783581 · 2017-10-10

Assignee

Inventors

Cpc classification

International classification

Abstract

An object of the present invention is to construct a production system that enables efficient production of organic acids using blue-green algae, which are photosynthetic microorganisms, by utilizing carbon dioxide and thereby increasing an amount of organic acids produced. The present invention relates to blue-green algae overexpressing a clock protein gene and a method for producing organic acids by culturing the blue-green algae.

Claims

1. Blue-green algae transformed by overexpressing clock protein genes, wherein the clock protein genes are kaiB gene and kaiC gene.

2. The blue-green algae according to claim 1, wherein the blue-green algae has an ability to produce polyhydroxyalkanoic acid.

3. The blue-green algae according to claim 1, wherein the blue-green algae has phaAB gene and phaEC gene.

4. The blue-green algae according to claim 1, wherein the blue-green algae belongs to genus Synechocystis.

5. A method for producing an organic acid, comprising culturing the blue-green algae of claim 1, and collecting an organic acid.

6. The method according to claim 5, wherein the organic acid is polyhydroxyalkanoic acid, and the blue-green algae has an ability to produce polyhydroxyalkanoic acid.

7. The method according to claim 6, wherein the blue-green algae has phaAB gene and phaEC gene.

8. The method according to claim 6, wherein the polyhydroxyalkanoic acid is polyhydroxybutyric acid.

9. The method according to claim 5, wherein the organic acid is succinic acid or lactic acid.

10. The method according to claim 5, wherein the blue-green algae belongs to genus Synechocystis.

11. The method according to claim 5, wherein the culture is performed under nitrogen-deficient conditions.

12. A method for enhancing an ability to produce an organic acid in blue-green algae, comprising overexpressing the clock protein genes of claim 1 in the blue-green algae, wherein the organic acid is polyhroxyalkanoic acid, and the blue-algae has phaAB gene and phaEC gene.

13. The method according to claim 12, wherein the polyhydroxyalkanoic acid is polyhydroxybutyric acid.

14. The method according to claim 12, wherein the blue-green algae belongs to genus Synechocystis.

15. The method according to claim 12, wherein the blue-green algae is cultured under nitrogen-deficient conditions.

Description

EXAMPLES

Example 1

Construction of Clock Protein Gene-overexpressing Strains

(1) Using Synechocystis sp. PCC 6803 (hereinbelow, referred to as Synechocystis) cells, which are unicellular cyanobacteria (unicellular blue-green algae), strains overexpressing seven clock protein genes (kaiA, kaiB1, kaiB2, kaiB3, kaiC1, kaiC2, and kaiC3) were constructed. Synechocystis sp. PCC 6803 is available from The Pasteur Institute (France) (http://www.pasteur.fr/ip/easysite/pasteur/en/research/collections/crbip/general-informations-conceming-the-collections/iv-the-open-collections/iv-iii-pasteur-culture- collection-of-cyanobacteria).

(2) Specifically, a promoter of psbAII, which encodes the photosystem II reaction center protein, is attached to the ORF of the gene, and the resulting gene was introduced into a region in the genome that would result in less impact. As the vector, pTKP2031V was used (Osanai et al., 2011, J. Biol. Chem. 286; 30962 to 30971). Specifically, the clock protein-overexpressing strains were produced as follows.

(3) Using the genomic DNA of Synechocystis as a template, the ORF region of each of the clock proteins kaiA, kaiB1, kaiB2, kaiB3, kaiC1, kaiC2, and kaiC3 was amplified by PCR using KOD polymerase (TOYOBO CO., LTD.) and primers (see Table 1 below). The fragments thus obtained were cleaved at the termini with NdeI and HpaI (TAKARA BIO INC.) and then introduced into the NdeI-HpaI region of pTKP2031V, a vector for Synechocystis. For ligation, DNA Ligation kit (TAKARA BIO INC.) was used. The sequences of the plasmids thus completed were confirmed by sequencing.

(4) TABLE-US-00001 TABLE 1 KaiA-TKPF: ATTATTCATATGCAGTCTCCCCTCTC (SEQ ID NO: 15) KaiA-TKPRHpa: AAACCCGTTAACTTAATCCGTCTGATAATA (SEQ ID NO: 16) KaiB1-TKPF: ATTATTCATATGAGCCCCTTTAAAAAA (SEQ ID NO: 17) KaiB1-TKPRHpa: AAACCCGTTAACCTATTGGTCTTCTGCTTC (SEQ ID NO: 18) KaiB2-TKPF: ATTATTCATATGGAAAATTTAAACGCT (SEQ ID NO: 19) KaiB2-TKPRHpa: AAACCCGTTAACCTAGATTTTCCAATCCAT (SEQ ID NO: 20) KaiB3-TKPF: ATTATTCATATGGATATGAATAGGATT (SEQ ID NO: 21) KaiB3-TKPRHpa: AAACCCGTTAACTTAATCCTCCGGCAAACG (SEQ ID NO: 22) KaiC1-TKPF: ATTATTCATATGAACTTACCGATTGTT (SEQ ID NO: 23) KaiC1-TKPREcoRV: AAAGGGGATATCCTACTCAGCGGTCTTGTC (SEQ ID NO: 24) KaiC2-TKPF: ATTATTCATATGACAGATAACAGCCAA (SEQ ID NO: 25) KaiC2-TKPRHpa: AAAGGGGTTAACTTAGGGGTTTTGATAAATG (SEQ ID NO: 26) KaiC3-TKPF: ATTATTCATATGATCGACCAAGAGACA (SEQ ID NO: 27) KaiC3-TKPRHpa: AAAGGGGTTAACCTATATTTTCTCATCGAA (SEQ ID NO: 28)

(5) Transformation of Synechocystis was carried out as follows. To 200 μl of culture solutions containing the wild-type strain of Synechocystis (GT strain) at a concentration of A.sub.730=2 to 3, about 100 ng of pTKP2031V-hik8 was added, and the bacteria were spread on the mixed cellulose membrane (MERCK MILLIPORE CORPORATION) placed on BG-11 plates. After culturing the bacteria in an incubator for cyanobacteria for one day, the membranes were transferred to BG-11 plates containing 50 μg/ml kanamycin, followed by about three weeks of culture. The colonies thus obtained were passaged three times on BG-11 plates containing the same concentration of kanamycin, whereby strains overexpressing each of the aforementioned clock proteins were established. The composition of the BG-11 medium is as follows.

(6) TABLE-US-00002 TABLE 2 <BG-11 medium composition> NaNO.sub.3 1.5 g (17.65 mM) K.sub.2HPO.sub.4 0.03 g (0.18 mM) MgSO.sub.4•7H.sub.2O 0.075 g (0.30 mM) CaCl.sub.2•2H.sub.2O 0.036 g (0.25 mM) Citric acid 0.006 g (0.03 mM) Ammonium ferric citrate 0.006 g (0.03 mM) EDTA 0.001 g (0.003 mM) Na.sub.2CO.sub.3 0.02 g (0.19 mM) HEPES-KOH(pH 8.0) 4.77 g (20 mM) Trace metal mixture A5 + Co 1 ml H.sub.2O Up to 1 L <Trace metal mixture A5 + Co> H.sub.3BO.sub.3 2.86 g MnCl.sub.2•4H.sub.2O 1.81 g ZnSO.sub.4•7H.sub.2O 0.222 g Na.sub.2MoO.sub.4•2H.sub.2O 0.390 g CuSO.sub.4•5H.sub.2O 0.079 g Co(NO.sub.3).sub.2•6H.sub.2O 0.049 g H.sub.2O Up to 1 L

(7) Hereinafter, in BG-11 liquid media, 17.65 mM NaNO.sub.3 was removed and 3 mM NH.sub.4Cl was used as a nitrogen source. Nitrogen-deficient conditions were created by allowing the ammonia source to be completely consumed or resuspending cells collected by filters in media from which the nitrogen source had been removed.

(8) With respect to each of the clock protein-overexpressing strains obtained and the parent strain (GT), the amount of mRNA of each clock protein was measured by real-time PCR. In each of the clock protein-overexpressing strains, the amount of mRNA of each clock protein was increased compared to the parent strain.

Example 2

Measurement of the Amount of Polyhydroxybutyric Acid (PHB) Produced

(9) The amount of intracellular accumulation of polyhydroxybutyric acid (PHB) was measured with respect to each of the clock protein-overexpressing strains (kaiAox, kaiB1ox, kaiB2ox, kaiB3ox, kaiC1ox, kaiC2ox, kaiC3ox) produced in Example 1 and the wild strain (GT).

(10) In this example, 3 mM ammonium chloride was added to the media lacking the nitrogen source (BG-110) as the initial nitrogen source, which was then allowed to be completely consumed, whereby nitrogen-deficient conditions were created. All the cultures were performed under aerobic light conditions at 30° C. The light intensity was set at 50 to 80 micromole photons/m.sup.2s. Also, in aerobic culture, air mixed with 1% CO.sub.2 was introduced into the culture solutions. After nine days of culture, cells were collected by centrifugation. The collected cells were freeze-dried at −80° C. for three days, and then suspended in chloroform, and incubated for four days at 70° C., followed by five minutes of sonication. The process was performed eight times in total. The resulting disruption solutions were filtered, followed by extraction and purification using hexane, chloroform, methanol, and the like. The weight of the samples thus obtained was determined as the amount of PHB.

(11) It was found that the amount of PHB per L of culture solution was about 7 mg for the wild-type strain (GT), whereas that was increased to about 14 mg and about 10 mg for kaiB3-overexpressing strain and kaiC3-overexpressing strain (i.e., kaiB3ox and kaiC3ox), respectively.

Example 3

Measurement of the Production Amount of Succinic Acid, Lactic Acid, and Acetic Acid

(12) The production amount of succinic acid, lactic acid, and acetic acid was measured in each of the clock protein-overexpressing strains produced in Example 1 (kaiAox, kaiB1ox, kaiB2ox, kaiB3ox, kaiC1ox, kaiC2ox, and kaiC3ox) and the wild-type strain (GT).

(13) With respect to organic acids such as succinic acid, lactic acid, and acetic acid, the amount in culture solutions obtained under anaerobic dark conditions was measured. Firstly, each of the blue-green algae strains was cultured in 70 ml of normal media under aerobic light conditions at 30° C. In aerobic culture, air mixed with 1% CO.sub.2 was introduced into the culture solutions. After three days of culture, cells were concentrated and suspended in 10 ml of a 20 mM Hepes-KOH (pH 7.8) solution so that the turbidity A.sub.730=20, and transferred to vials for gas chromatography. The vials were plugged with butyl-rubber caps, which were pieced with two injection needles, through one of which nitrogen gas was introduced for one hour. Thereafter, the injection needles were removed, whereby the anaerobic conditions were created in the vials. Subsequently, the vials were wrapped with aluminum foil to create dark conditions, followed by shaking at 30° C. for three days. The culture solutions were then centrifuged to separate cells, and the supernatants were transferred to new tubes and then freeze-dried to solidify the contents. The solidified products were then suspended in perchloric acid and analyzed by high performance liquid chromatography (HPLC). Quantification was performed by the post-labeling method using bromothymol blue.

(14) Measurement 1:

(15) The production amount of succinic acid, lactic acid, and acetic acid by the wild-type strain per L of culture solution was about 20 mg, 275 mg, and 16 mg, respectively. It was found that the production amount of succinic acid per L of culture solution increased to 25 mg and 30 mg by overexpressing kaiB3 and kaiC3, respectively. The production amount of lactic acid increased to 546 mg, 447 mg, and 408 mg by overexpressing kaiB1, kaiB2, and kaiC1, respectively. Also, the production amount of acetic acid per L of culture solution increased to 21 mg by overexpressing kaiB3, respectively.

(16) Measurement 2:

(17) The production amount of succinic acid, lactic acid, and acetic acid by the wild-type strain per L of culture solution was about 13 mg, 5 mg or less, and 167 mg, respectively. It was found that the production amount of succinic acid per L of culture solution increased to 19 mg and 26 mg by overexpressing kaiB3 and kaiC3, respectively. The production amount of lactic acid increased to 16 mg, 10 mg, and 12 mg by overexpressing kaiB1, kaiB2, and kaiC1, respectively. Also, the production amount of acetic acid per L of culture solution increased to 266 mg and 279 mg by overexpressing kaiB3 and kaiC3, respectively.

(18) All references, including any publications, patents or patent applications cited in this specification are hereby incorporated by reference in their entirely.