PHYTOPHTHORA RESISTANT PLANTS BELONGING TO THE SOLANACEAE FAMILY

Abstract

The present invention relates to a plant belonging to the Solanaceae family wherein said plant comprises a genetic trait providing Phytophthora resistance and wherein said resistance trait is encoded by a combination of at least two genes having a reduced expression, or transcription, of said genes or a reduced activity of proteins encoded by said genes as compared to said plant belonging to Solanaceae family being susceptible to Phytophthora.

Claims

1-11. (canceled)

12. A Phytophthora infestans resistant tomato plant, wherein the resistant tomato plant has a reduced activity of a first protein having amino acid sequence SEQ ID NO: 5 and a reduced activity of a second protein having amino acid sequence SEQ ID NO: 6, and wherein the activity of the first protein and the activity of the second protein are reduced in the resistant tomato plant compared to the activity of the first protein and the activity of the second protein in a tomato plant that is not resistant to Phytophthora infestans.

13. The resistant tomato plant of claim 12, wherein the resistant tomato plant has a non-natural mutation introduced into its genome that results in reduced expression or reduced transcription of a gene encoding the first protein and a non-natural mutation introduced into its genome that results in reduced expression or reduced transcription of a gene encoding the second protein.

14. The resistant tomato plant of claim 12, wherein the-non-natural mutations comprise gene silencing.

15. The resistant tomato plant of claim 12, wherein the resistant tomato plant has a non-natural mutation introduced into a gene having nucleotide sequence SEQ ID NO: 11 and a non-natural mutation introduced into a gene having nucleotide sequence SEQ ID NO: 12.

16. The resistant tomato plant of claim 15, wherein the-non-natural mutations comprise gene silencing.

17. The resistant tomato plant of claim 16, wherein the gene having nucleotide sequence SEQ ID NO: 11 is silenced, and the gene having nucleotide sequence SEQ ID NO: 12 is silenced.

18. The resistant tomato plant of claim 15, wherein the non-natural mutation in the gene having nucleotide sequence SEQ ID NO: 11 reduces expression or transcription of the gene.

19. The resistant tomato plant of claim 15, wherein the non-natural mutation in the gene having nucleotide sequence SEQ ID NO: 12 reduces expression or transcription of the gene.

20. A seed, tissue, or plant part of the tomato plant of claim 12, wherein the seed, tissue, or plant part comprises a reduced activity of the first protein and a reduced activity of the second protein.

21. The seed, tissue, or plant part of the tomato plant of claim 20, wherein the seed, tissue, or plant part comprises a non-natural mutation in a gene having nucleotide sequence SEQ ID NO: 11 and a non-natural mutation in a gene having nucleotide sequence SEQ ID NO: 12.

22. A method for obtaining a Phytophthora infestans resistant tomato plant comprising: reducing activity of a first protein having amino acid sequence SEQ ID NO: 5 and reducing activity of a second protein having amino acid sequence SEQ ID NO: 6 in a tomato plant.

23. The method of claim 22, wherein reducing activity of the first protein is achieved in the tomato plant by introducing a non-natural mutation into its genome that results in reduced expression or reduced transcription of a gene encoding the first protein, and wherein reducing activity of the second protein is achieved in the tomato plant by introducing a non-natural mutation into its genome that results in reduced expression or reduced transcription of a gene encoding the second protein.

24. The method of claim 23, wherein the gene encoding the first protein has the nucleotide sequence SEQ ID NO: 11, and the gene encoding the second protein has the nucleotide sequence SEQ ID NO: 12.

25. The method of claim 23, wherein the non-natural mutations comprise gene silencing.

26. The method of claim 25, wherein the gene having nucleotide sequence SEQ ID NO: 11 is silenced, and the gene having nucleotide sequence SEQ ID NO: 12 is silenced.

27. A Phytophthora infestans resistant tomato plant produced by the method of claim 22, wherein the tomato plant has a reduced activity of the first protein and a reduced activity of the second protein.

28. A seed, tissue, or plant part of the resistant tomato plant of claim 27, wherein the seed, tissue, or plant part has a reduced activity of the first protein and a reduced activity of the second protein.

29. A Phytophthora infestans resistant tomato plant produced by the method of claim 24, wherein the tomato plant comprises the non-natural mutation in the gene having nucleotide sequence SEQ ID NO: 11 and the non-natural mutation in the gene having nucleotide sequence SEQ ID NO: 12, and wherein the tomato plant has a reduced activity of the first protein and a reduced activity of the second protein.

30. A seed, tissue, or plant part of the resistant tomato plant of claim 29, wherein the seed, tissue, or plant part comprises the non-natural mutation in the gene having nucleotide sequence SEQ ID NO: 11 and the non-natural mutation in the gene having nucleotide sequence SEQ ID NO: 12, and wherein the seed, tissue, or plant part has a reduced activity of the first protein and a reduced activity of the second protein.

Description

[0025] The invention is further illustrated in the examples below, with reference to the figures, wherein:

[0026] FIG. 1 shows a detached leaf assay of control potato plants after infection with Phytophthora infestans, wherein all leaves are infected by Phytophthora infestans.

[0027] FIG. 2A and FIG. 2B shows a detached leaf assay of SEQ ID NOS. 7 & 8 silenced potato plants after infection with Phytophthora infestans, wherein each leaf is from an independent plant. FIG. 2A shows leaves from plants silenced with a middle construct, silencing both SEQ ID NOS. 7&8. FIG. 2B shows leaves from chimeric silenced plants.

[0028] FIG. 3 shows the percentage of plants which are infected by Phytophthora infestans, wherein the first bar shows a control group (about 10% is partially)infected, the second bar shows plants of which only SEQ ID NO 7 is silenced (about 10% partially infected), the third bar shows plants of which both SEQ ID NO 7 and 8 is silenced in the middle part of the respective sequences (about 50% clean), the fourth bar shows plants of which both SEQ ID NO 7 and 8 is silenced at the 5′end (about 40% clean).

[0029] FIG. 4 shows the percentages of living petunia plants after inoculation with Phytophthora nicotianae, wherein the first bar shows wild type control plant (0% living), the second bar shows SEQ ID NO 9 mutants (20% living plants), the third bar shows SEQ ID NO 10 mutants (20% living plants) and the fourth bar shows double mutants, i.e. both SEQ ID NO 9 and 10 (45% living plants).

[0030] FIG. 5 shows leaves of tomato plants from a Phytophthora infestans disease test.

EXAMPLES

Example 1

(Potato)

[0031] RNAi Constructs Targeting Potato SEQ ID NOS. 7 and 8

[0032] 3 different RNAi constructs were made, harboring/targeting:

[0033] 1.5′ end of SEQ ID NO 7: equivalent to coding sequence −159-200

[0034] (−159 from start means in 5′utr).

[0035] 2. Chimera of 5′ end of SEQ ID NOS. 7 and 8: equivalent to coding sequence 4-199+1-204.

[0036] 3. Middle part of SEQ ID NO. 7 (highly homologous to middle of SEQ ID NO 8): equivalent to coding sequence 334-743.

[0037] The fragments were amplified from genomic DNA and cloned into the pENTR-D-TOPO vector. For the chimeric construct, 2 fragments were coupled using primers with complementary overhangs, and subsequent extension and amplification to create the fused fragment. Fragments were transferred using a Gateway LR reaction to the RNAi vector pK7GWiWG2 (Karimi et al., 2002, Trends Plant Sci 7), creating an inverted repeat with hairpin structure. Because the pK7GWiWG2 vector requires Streptomycin for bacterial selection, and the Agrobacterium strain used for potato transformation (LBA4404) already carries a Streptomycin selection marker, the complete RNAi (hairpin) cassette was transferred to a different plant transformation vector, pGreen0029 (bacterial as well as plant selection marker=Kanamycin) (Hellens et al., 2000, Plant Mol Biol 42). The final constructs allow stable expression of a 35S-promoter driven hairpin RNA that forms a silencing-inducing dsRNA, after the hairpin-loop forming intron gets spliced out. At least six independent T1 transformants were maintained for each construct.

[0038] Phytophthora infestans Assay Details

[0039] Detached leaves were taken from T1 (first generation transgenics) plants, and placed in a tray with 100% RH with petioles in wet cotton-wool or Oasis. Phytophthora infestans (P.inf) zoospores/sporangia were harvested from P.inf cultures (rye-sucrose-agar plates), and a 10 ul drop of spore suspension containing 10e3 sporangia (10e5/ml) was placed on each side of the midvein. Trays were incubated at 18C. Leaf infection rates were scored on day 11, as 1. Completely infected/overgrown, 2. Partially infected (10-50% area), and 3. Clean (<10% area).

[0040] As shown in FIGS. 1 and 2, the double silenced (SEQ ID NO. 7 & 8) plants of FIG. 2A show that only 50% is infected, the double silenced (chimeric) plants of FIG. 2B show that only 60% is infected, whereas the control group of FIG. 1 shows that all plants were infected. As shown in FIGS. 3, 40 to 50% of the both SEQ ID NO. 7 and SEQ ID NO. 8 silenced plants are clean, whereas the plants having only SEQ ID NO. 7 silenced only 10% of the plants score partially infected. Accordingly, silencing of both SEQ ID NO. 7 and 8 provides resistance to Phytophthora infestans.

Example 2

(Petunia)

[0041] Transposon insertion lines were identified from a collection/library (Vandenbussche et al., 2008, Plant Journal 54). 2 dTphl transposon insertion alleles were found in SEQ ID NO 9 and 3 dTph1 transposon insertion alleles in SEQ ID NO 10. Several crosses were made to generate double mutants.

[0042] Phytophthora nicotianae Assay Details

[0043] Plants were grown in standard potting soil, individually potted, at 23C.

[0044] P. nicotianae spores were harvested from cultures (lima-bean-agar or V8-agar plates), and 2 ml of spore suspension containing 10e4 (assay Sept) spores was dripped onto the soil with each plant. Plant collapse was monitored regularly.

[0045] As shown in FIG. 4, double mutants, i.e. plants having mutations in both SEQ ID NO 9 and SEQ ID NO 10 have a percentage of living plants of 45%, whereas the percentage of living plants of single mutants (mutant in SEQ ID NO. 9 or SEQ ID NO. 10) is only 20%.

Example 3

(Tomato)

[0046] Tomato plants were transformed with two constructs, either for providing over expression of both SEQ ID NO. 11 and 12, or for providing silencing of both SEQ ID NO. 11 and 12. Tomato SEQ ID NO. 11 silencing constructs were generated using Gateway cloning of a 300 bp fragment identical to the middle part of the CDS of SEQ ID NO. 11.

TABLE-US-00001 Sequence: TTGGGTGAACAAGGACAACATATGGCTATCAATTATTATCCTCCTTGTCCA CAACCAGAACTTACTTATGGGCTTCCGGCCCATACTGATCCAAATTCACTT ACAATTCTTCTTCAAGACTTGCAAGTTGCGGGTCTTCAAGTTCTTAAAGAT GGCAAATGGTTAGCTGTAAAACCTCAACCTGACGCCTTTGTCATTAATCTT GGGGATCAATTGCAGGCAGTAAGTAACGGTAAGTACAGAAGTGTATGGCAT CGAGCTATTGTGAATTCAGATCAAGCTAGGATGTCAGTGGCTTCGTTT Using primers: S. Lycopersicum AttB1-F aaaaagcaggcttcttgggtgaacaag gacaaca S. Lycopersicum AttB2-R agaaagctgggtaaaacgaagccactg acatcc

[0047] The generated ENTRY vector was Gateway cloned into the pHellsgate12 binary vector. Following Agrobacterium transformation according standard procedure for tomato. The silencing constructs were able to silence both SEQ ID NO. 11 and 12, due to similarities in the sequences.

[0048] Offspring from transformed tomato plants were subjected to a disease test by inoculation of Phytophthora infestans isolate US11. 7 days after inoculation the plants were visually analysed by scoring leaves on a visual scale from 1 to 9, wherein 1 means susceptible and 9 means resistant. As a control for susceptible the plants TS33, TS19 and OT9 were used. As control for resistant the known resistant wild accession LA1269 is used. Per plant 8 leaves were measured. Table below provides the average score from the 8 leaves per plant.

[0049] In the table is shown that the SEQ ID NO. 11 and 12overexpressing plants are susceptible for isolate US11. The silenced plant provides significant higher scores than the susceptible control LA1269. For example plant 556-01-08 has an average score of 8.5. A sample of this plant is shown in FIG. 5 in box G10, and is not infected similar to resistant control plant LA1296 as shown in box D8. Accordingly, silencing of both SEQ ID NO. 11 and 12 provides resistance to Phytophthora infestans.