PREPARATION OF ADAPTER-LIGATED AMPLICONS

20170283869 · 2017-10-05

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention is directed to novel methods and kits to be employed for preparing adapter-ligated amplicons or a sequencing library of a target DNA, respectively.

    Claims

    1. A method of preparing adapter-ligated amplicons, comprising the steps of: (i) contacting double-stranded amplicons with at least one polynucleotide kinase, at least one DNA ligase, and DNA adapter molecules, to obtain a reaction mixture, (ii) incubating said reaction mixture under conditions simultaneously allowing a 5′ phosphorylation of said double-stranded amplicons by said polynucleotide kinase, and a joining of said DNA adapter molecules to at least one end of said double-stranded amplicons by said DNA ligase, to obtain adapter-ligated amplicons.

    2. The method of claim 1, characterized in that said double-stranded amplicons are double-stranded PCR amplicons.

    3. The method of claim 2, characterized in that said double-stranded PCR amplicons resulting from a PCR using a DNA polymerase comprising terminal adenylyltransferase activity.

    4. The method of claim 3, characterized in that said DNA polymerase is selected from the group consisting of: Taq polymerase, Klenow fragment, TopTaq polymerase, Tfl-Polymerase, Tma-Polymerase, Tne-Polymerase and Tth-Polymerase.

    5. The method of claim 1, characterized in that said DNA adapter molecules comprising a T overhang.

    6. The method of claim 1, characterized in that said polynucleotide kinase is selected from the group consisting of: T4 polynucleotide kinase, T4 polynucleotide kinase (3′ phosphatase minus).

    7. The method of claim 1, characterized in that said DNA ligase is selected from the group consisting of: T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, E. coli DNA Ligase, Taq DNA ligase, and 9°N DNA ligase.

    8. The method of claim 1, characterized in that said DNA adapter molecules are sequencing DNA adapter molecules, preferably DNA adapter molecules for next generation sequencing (NGS).

    9. The method of claim 1, characterized in that in step (i) said contacting is realized by subjecting said double-stranded amplicons, said at least one polynucleotide kinase, said at least one DNA ligase, and said DNA adapter molecules to one single reaction container.

    10. The method of claim 1, characterized in that after step (ii) the following step is performed: (iii) isolating adapter-ligated PCR amplicons.

    11. A method of preparing a sequencing library of a target DNA, comprising the steps of: (i) subjecting said target DNA to a PCR under conditions resulting in double-stranded PCR amplicons of said target DNA, (ii) contacting said double-stranded PCR amplicons with at least one polynucleotide kinase, at least one DNA ligase, and DNA adapter molecules, preferably comprising a T-overhang, to obtain a reaction mixture, (iii) incubating said reaction mixture under conditions simultaneously allowing a 5′ phosphorylation of said double-stranded PCR amplicons by said DNA ligase, and a joining of said DNA adapter molecules to at least one end of said double-stranded PCR amplicons by said DNA ligase, to obtain a sequencing library of said target DNA.

    12. A kit for preparing adapter-ligated PCR amplicons, comprising (i) at least one polynucleotide kinase, (ii) at least one DNA ligase, (iii) DNA adapter molecules, preferably comprising a T-overhang, (vi) reaction buffer configured to simultaneously allowing the enzymatic functioning of said at least one polynucleotide kinase and said at least one DNA ligase, and (v) a manual for performing the method according to claim 1.

    13. A kit for preparing a sequencing library of a target DNA, comprising (i) at least one DNA polymerase, preferably comprising terminal adenylyltransferase activity, (ii) at least one polynucleotide kinase, (iii) at least one DNA ligase, (iv) DNA adapter molecules, preferably comprising a T-overhang, (v) PCR buffer, (vi) reaction buffer configured to simultaneously allowing the enzymatic functioning of said at least one polynucleotide kinase and said at least one DNA ligase, and (vi) a manual for performing the method according to claim 9.

    14. The kit of claim 13, characterized in that said DNA polymerase is a Taq polymerase.

    15. The kit of claim 12, characterized in that said polynucleotide kinase is selected from the group consisting of: T4 polynucleotide kinase, Klenow fragment, TopTaq polymerase, Tfl-Polymerase, Tma-Polymerase, Tne-Polymerase and Tth-Polymerase, preferably said DNA ligase is selected from the group consisting of: T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, E. coli DNA Ligase, Taq DNA ligase, and 9°N DNA ligase.

    16. The kit of claim 13, characterized in that said polynucleotide kinase is selected from the group consisting of: T4 polynucleotide kinase, Klenow fragment, TopTaq polymerase, Tfl-Polymerase, Tma-Polymerase, Tne-Polymerase and Tth-Polymerase, preferably said DNA ligase is selected from the group consisting of: T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, E. coli DNA Ligase, Taq DNA ligase, and 9°N DNA ligase.

    Description

    [0083] In the figures:

    [0084] FIG. 1 shows a scheme of the one-step construction of adapter-ligated PCR amplicons or the amplicon sequencing library according to the invention.

    [0085] FIG. 2 shows a diagram presenting the results of a first illustrating experiment.

    [0086] In all four samples the IL1R2 amplicon is present in similar amounts (A). The reaction with both T4 DNA ligase and T4 PNK enables a direct ligation of sequencing adapters to the amplicon (B).

    [0087] FIG. 3 shows a scheme illustrating the standard library prep construction work for Gene Read™ DNAseq targeted panels amplicon sequencing (A), and the one-step library prep construction workflow for Gene Read™ DNAseq targeted panels amplicon sequencing according to the invention (B).

    [0088] FIG. 4 shows the result of a second illustrating experiment. It was demonstrated that sequencing libraries generated with either the standard or the one-step method according to the invention show similar size distribution patterns.

    EXAMPLES

    1. Principle of the Invention

    [0089] The aim of this invention is to circumvent tedious and time-consuming end-repair and A-addition steps in the next generation library preparation workflow for amplicon sequencing. The inventors utilize the terminal adenylyl transferase activity of the PCR polymerase to generate an A-overhang at the 3′ termini of the amplicons during the PCR. Following PCR, the amplicons are subjected to a combined phosphorylation and ligation reaction. In this reaction, the amplicons with A-overhang are mixed with sequencing adapters containing a T-overhang at the 3′ termini of the respective strands, polynucleotide kinase (PNK), such as the T4 PNK, DNA ligase, and incubated in reaction buffer that functions for both the ligase and kinase; cf. FIG. 1. In this scheme gDNA stands for genomic DNA and Pi stands for an inorganic phosphate residue.

    2. Experimental Test 1

    [0090] To prove the principle of the invention, the inventors used the method described above to perform a PCR employing Taq polymerase, and then directly ligated the amplicons to Illumina® TruSeq sequencing adapters, which have a T-overhang. Briefly, four identical 50 μl PCR reactions were set up with 10 ng of human genomic DNA each as a template, QIAGEN® HotStar Plus Master Mix (containing chemically modified Taq polymerase) at 1× final concentration, and 0.2 μM each of PCR primers that specifically recognize the human IL1R2 gene, IL1R2 F (Seq_1) and IL1R2 R (Seq_2). PCR cycling conditions were as follows: 95° C., 5 min for initial denaturation; then 35 cycles of 94° C., 30 sec; 60° C., 30 sec; and 72° C., 60 sec; followed by 72° C., 20 min for final extension and A-addition. Once the PCR was completed, the PCR reaction was cleaned up with QIAGEN® MinElute PCR Purification Kit and the PCR product from each reaction was eluted in 20 μl RNase-free water and pooled together. One duplicate of 19 μl of purified PCR products (sample 1 and sample 2) was then subjected to a combined phosphorylation and ligation reaction with 1× Rapid Ligation Buffer (Enzymatice), 1 μM of Illumina® sequencing adapter that was generated by annealing two oligos to form a duplex (IDT, Seq_3 and Seq_4), 3 pl of T4 DNA ligase (T4 DNA Ligase Rapid, 600 U/μl, Enzymatics®) and 2 μl of T4 polynucleotide kinase (T4 PNK, 10 U/μl, New England)Biolabs®). Another duplicate of 19 μl of purified PCR products (sample 3 and sample 4) were subjected to a ligation reaction only with above-mentioned components, however without the T4 poly-nukleotide kinase; cf. Table 1. All four reactions had a reaction volume of 50 μl and were carried out for 30 min at room temperature.

    TABLE-US-00001 TABLE 1 Ct values of the ligation products (Sample 1 to Sample 4) that can be detected with qPCR primers recognizing either adapter sequences or IL1R2 amplicon sequences. Ct with Ct with Ligase T4 PNK Library Primers IL1R2 Primers Sample 1 Yes Yes 13.96 8.07 Sample 1 Yes Yes 13.18 7.96 Sample 2 Yes Yes 13.83 7.7 Sample 2 Yes Yes 14.05 7.75 Sample 3 Yes No not detected 8.16 Sample 3 Yes No not detected 8.05 Sample 4 Yes No not detected 7.79 Sample 4 Yes No not detected 8.02

    [0091] After the ligation reaction, the products were purified with QIAGEN® MinElute PCR purification kit and eluted in 20 μl of RNase-free water. The eluates were diluted with 1:1000 with RNase-free water and used as template in quantitative real-time PCR to detect the presence or absence of the ligation products. Two sets of primers were used: One set of the primers, library primer F and library primer R, recognizes Ill.sub.umi.sub.na® adapter sequences (Seq_5 and Seq_6); the other set of the primers is the same as used to generate the IL1R2 amplicon and recognizes all of the IL1R2 amplicon sequence (Seq_1 and Seq_2). A TaqMan probe with 5′ FAM label (Seq_7) that specifically recognizes internal IL1R2 amplicon sequence was used in combination with either library primers or IL1R2 primers to quantify the amount of Illumina® adapter-ligated amplicon or total IL1R2 amplicon, respectively. The qPCR reactions were set up with QuantiFast Probe PCR mix (1× final concentration), 0.4 μM of each of the primers, 0.2 μM of the TaqMan probe, and 2 μl of diluted ligation products from sample 1 to sample 4. The qPCR was performed on QIAGEN® Rotorgene real time PCR cycler with the following cycling conditions: 95° C., 3 min; and 40 cycles of 95° C., 3 sec; 60° C., 30 sec.

    [0092] The result of this experiment is shown in FIG. 2 and Table 1. All four samples (in duplicates) showed similar Ct values in the qPCR with IL1R2 primers, indicating similar amounts of the total IL1R2 amplicons; FIG. 2A. However, only sample 1 and sample 2, where T4 PNK was present in the ligation reaction, showed positive signals with low Ct values in the qPCR reactions with library primers F and R, while sample 3 and sample 4, where ligation reaction was absent of T4 PNK, did not generate detectable qPCR products with library primers F and R; FIG. 2B.

    [0093] The results positively proved the principle that next generation library for amplicon sequencing can be successfully and rapidly prepared with a one-step, combined phosphorylation and ligation step directly after the PCR, eliminating time-consuming and error-prone multiple enzyme steps that are commonly used in the art.

    3. Experimental Test 2

    [0094] The inventors further proved the principle of this invention with an amplicon sequencing experiment using the QIAGEN® GeneRead™ DNAseq Targeted Panel. The QIAGEN® GeneRead™ DNAseq Targeted Panel uses multiplex PCR to selectively amplify exons of the genes of interest. Following multiplex PCR, the amplicons need to be ligated with the platform-specific sequencing adapters for sequencing.

    [0095] The standard library construction method for target amplicon sequencing on Illumina® platforms involves three enzymatic steps: End-repair, A-addition, and ligation, in combination with several clean-up and size selection steps to remove non-specific side products. A PCR step after ligation is also included to amplify the sequencing library; cf. FIG. 3A, see also QIAGEN® GeneRead™ DNAseq Targeted Panels V2 handbook.

    [0096] The inventors compared the performance of the one step library construction method according to the invention with the standard library construction protocol. The one-step method according to the invention is outlined in FIG. 3B. Specifically, human genomic DNA (gDNA) from an anonymous donor was used as template and amplified with QIAGEN® GeneRead™ Human Carrier Panel V2 (Cat. # NGHS-011X). Following multiplex PCR, the amplicons were either subjected to standard library prep workflow (‘Control’), or one-step library prep protocol according to the invention (‘OneStep’). With the one step protocol, the purified PCR products were directly ligated to adapters with 3 μl of T4 DNA ligase (T4 DNA Ligase Rapid, 600 U/μl, Enzymatics®) and 2 μl of T4 polynucleotide kinase (T4 PNK, 10 U/μl, New England Biolabs®) in 1× Rapid Ligation Buffer (Enzymatics®) with a final volume of 90 μl. The one-step reaction with combined phosphorylation and ligation was carried out for 30 min at room temperature. Both sequencing libraries were characterized with an Agilent° High Sensitivity DNA chip on the Bioanalyzer.

    [0097] As shown in FIG. 4, the library constructed with the standard method (‘Control’) and the one-step method according to the invention (‘OneStep’) have very similar size distribution patterns.

    [0098] The two libraries were then sequenced on a miSeq instrument (Illumina®) using dual-layer 300 nt Flow Cells and Illumina® miSeq Reage nt Kit V2 (300). Paired-end sequencing mode with 2×150 nt read length was used for the run. Data were analyzed with QIAGEN® GeneRead Targeted Exon Enrichment Panel Data Analysis tool.

    [0099] The metrics for amplicon sequencing quality were summarized in Table 2 and demonstrated a good sequencing quality for amplicon sequencing libraries generated with both the standard method (‘Control’) and the novel one-step method according to the invention (‘OneStep’). As shown in the Table 2, libraries generated by both standard and the novel method according to the invention delivered similarly good sequencing results based on the metrics, such as total reads, percentage of reads aligned to the target region and control amplicons, percentage of based covered at >=20% of median, percentage of bases covered at >=10×, 30×, or 100× coverage, as well as mean and median coverage.

    TABLE-US-00002 TABLE 2 Sequencing quality metrics for amplicon sequencing libraries generated with either standard method (‘Control’) or one-step method (‘OneStep’). Sequencing Quality Metrics Control OneStep Total reads 3.088.012 4.030.836 % Reads >= 45 bp aligned to the target 95.8 92.7 region and control amplicons % of bases covered at >= 20% of median 83 81 % of bases covered at >= 10x 96 94 % of bases covered at >= 30x 91 88 % of bases covered at >= 100x 80 76 total sequenced bases on target 336.319.887 420.999.290 mean coverage 507 634 median coverage 364 355

    4. Conclusion

    [0100] Taken together, the novel one-step amplicon sequencing library prep method according to the invention has been demonstrated to be effective in generating a sequencing library with good quality. Furthermore, the one-step method also significantly streamlines the library prep workflow and can potentially reduce variations by remove multiplex enzymatics and handling steps in the protocol.

    TABLE-US-00003 Sequences Seq_1: 5′-cgg gta ggc gct ctc tat gt-3′ Seq_2: 5′-aag act gac aat ccc gtg taa gg-3′ Seq_3: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACA- CGACGCTCTTCCGATC*G-3′ (*: indicates phosphorothioate) Seq_4: 5′- GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATC- TCGTATGCCGTCTTCTGCTT*G-3′ (*: indicates phosphorothioate) Seq_5: 5′-AAT GAT ACG GCG ACC ACC GA-3′ Seq_6: 5′-CAA GCA GAA GAC GGC ATA CGA-3′ Seq_7: 5′-FAM-tgctgtggtggacggccaatga-TAMRA-3′ (FAM stands for 6-carboxyfluorescein; TAMRA  stands fortetramethylrhodamine)