USE OF INHIBITORS OF IL-36 PROTEOLYTIC PROCESSING FOR THE TREATMENT AND/OR REDUCTION OF INFLAMMATION

Abstract

This invention relates to the use of an agent capable of inhibiting IL-36 proteolytic processing for the treatment and/or reduction of inflammation in a subject. Advantageously, the agent prevents the production of a biologically active IL-36 to prevent and/or reduce the pro-inflammatory effects of IL-36. The invention also relates to a method for treatment and/or reduction of inflammation and compositions for treating and/or reducing inflammation.

Claims

1-34. (canceled)

35. A method for the treatment and/or reduction of inflammatory skin disorders in a subject comprising the step of administering an effective amount of an agent capable of inhibiting IL-36 activation that occurs via proteolytic processing, including IL-36α, IL-36β, or IL-36γ activation, and a combination thereof, to a subject in need thereof wherein the agent inhibits IL-36 activation by binding to at least one IL-36 protease cleavage site required for activation of IL-36; or the agent prevents and/or inhibits the activity of IL-36 activating proteases or activators thereof.

36. (canceled)

37. The method according to claim 35, wherein the agent is a small molecule, peptide, polypeptide, protein, siRNA, sgRNA, antibody, or a combination thereof.

38. The method according to claim 35, wherein the inflammatory skin disorder is selected from plaque psoriasis, guttate psoriasis, palmoplantar psoriasis, generalized pustular psoriasis, flexural psoriasis, inverse psoriasis, erythrodermic psoriasis, psoriasis vulgaris, arthritic psoriasis, eczema, granuloma annulare, lichen planus, bullous pemphigoid, molluscum contagiosum, dermatomyositis and ichthyosis vulgaris, dermatitis, and acne.

39. The method according to claim 35, wherein the agent is a serine protease inhibitor or a cysteine protease inhibitor.

40. The method according to claim 35, wherein the agent is a peptide comprising from 3 to 10 amino acids, or a derivative thereof, a peptidomimetic thereof, or a combination thereof.

41. The method according to claim 35, wherein the agent directly inhibits IL-36 activation via proteolytic processing by binding to at least one protease cleavage site within IL-36 required for activation of IL-36.

42. The method according to claim 41, wherein the agent competes with an IL-36 activating protease for binding to at least one protease cleavage site within IL-36 required for activation of IL-36.

43. The method according to claim 35, wherein the agent mimics and/or targets at least one protease cleavage site within IL-36 required for activation of IL-36 and/or amino acid residues downstream and/or upstream of the at least one cleavage site.

44. The method according to claim 35, wherein the agent targets one or more of the following a) the IL-36β protease cleavage site NPQR.sub.5 and/or one or more of upstream amino acid residues EAAP; b) the IL-36γ cleavage site GRAV.sub.15 and/or one or more of upstream amino acid residues YQSM; and/or c) the IL-36α protease cleavage sites MEK.sub.3 or and MEKA.sub.4 and/or one or more of upstream amino acid residues LKID.

45. The method according to claim 35, wherein the agent is a peptide which mimics at least one protease cleavage site within IL-36β, IL-36γ and/or IL-36α required for activation of IL-36β, IL-36γ and/or IL-36α respectively, and the agent binds said at least one protease cleavage site to inhibit IL-36β, IL-36γ and/or IL-36α activity; or peptide derivatives or peptidomimetics thereof.

46. The method according to claim 45, wherein the agent is a peptide from 3 to 10 amino acids in length, selected from one or more of the following: TABLE-US-00010 Lys-Ala-Leu (KAL); Ala-Leu-Ala (ALA); Met-Ala-Leu-Ala (MALA); Asp-Pro-Gln-Arg (NPQR); Pro-Gln-Arg (PQR); Gln-Arg-Glu-Ala (QREA); Arg-Ala-Val (RAV); Gly-Arg-Ala-Val (GRAV); Ala-Val-Tyr-Gln (AVYQ); Lys-Ala-Leu-CMK (KAL-CMK); Ala-Leu-Ala-CMK (ALA-CMK); Met-Ala-Leu-Ala-CMK (MALA-CMK); Asp-Pro-Gln-Arg-CMK (NPQR-CMK); Pro-Gln-Arg-CMK (PQR-CMK); Gln-Arg-Glu-Ala-CMK (QREA-CMK); Arg-Ala-Val-CMK (RAV-CMK); Gly-Arg-Ala-Val-CMK (GRAV-CMK); Ala-Val-Tyr-Gln-CMK (AVYQ-CMK); or a derivative thereof, a peptidomimetic thereof, or a combination thereof.

47. The method according to claim 35, wherein the agent indirectly inhibits IL-36 activation via proteolytic processing by preventing and/or inhibiting the activity of IL-36 activating proteases or activators thereof.

48. The method according to claim 47, wherein the IL-36 activating protease or activator thereof is selected from the group consisting of elastase, cathepsin G, cathepsin K, proteinase-3 and DPPI (Cathepsin C).

49. The method according claim 47, wherein the agent is a peptide, from 3 to 10 amino acids in length, that binds an IL-36 activating protease and/or competes with IL-36 activating proteases for access to at least one IL-36 cleavage site, said peptide selected from one or more of the following: TABLE-US-00011 Phe-Leu-Phe (FLF); Glu-Pro-Phe (EPF); Ala-Phe-Leu-Phe (ALPF); Lys-Ala-Leu (KAL); Phe-Leu-Phe-CMK (FLF-CMK); Glu-Pro-Phe-CMK (EPF-CMK); Ala-Phe-Leu-Phe-CMK (ALPF-CMK); Lys-Ala-Leu-CMK (KAL-CMK); Arg-Ala-Val (RAV); Asp-Thr-Glu-Phe (DTEF); Ala-Pro-Leu (APL); Pro-Gln-Arg (PQR); Arg-Pro-Leu (RPL); Arg-Ala-Val-CMK (RAV-CMK); Asp-Thr-Glu-Phe-CMK (DTEF-CMK); Ala-Pro-Leu-CMK (APL-CMK); Pro-Gln-Arg-CMK (PQR-CMK); Arg-Pro-Leu-CMK (RPL-CMK); or a derivative thereof, a peptiodmeimetic thereof, or a combination thereof.

50. The method according to claim 47, wherein the agent is a serine protease inhibitor or a cysteine protease inhibitor selected from cathepsin K inhibitor, cathepsin C(DPPI) inhibitor, an elastase inhibitor, cathepsin-G inhibitor or proteinase-3 inhibitor selected from Boswellic Acids, cathepsin G inhibitor I, Elastase inhibitor IV, Sodium Fluoride, 4-(2-Aminoethyl) benzenesulfonyl fluoride hydrochloride (AEBSF.HCl), phenylmethanesulfonylfluoride (PMSF), odanacatib, balicatib and MV061194.

51. The method according to claim 47, wherein the agent is aprotinin or leupeptin.

52. The method according to claim 47, wherein the agent is a peptide inhibitor dipeptide-derived diazoketone, preferably Gly-Phe-CHN2.

53. The method according to claim 47, wherein the agent is Ala-Hph-VS-Ph.

54. The method according to claim 47, wherein the agent is an antibody is a polyclonal or monoclonal antibody raised against at least one neutrophil-derived protease, wherein the antibody binds to the protease to prevent its binding to at least one protease cleavage site within IL-36 required for activation of IL-36.

55. The method according to claim 54, wherein the agent is a polyclonal or monoclonal antibody raised against at least one of the proteases elastase or cathepsin G or cathepsin K.

56. A composition for treatment and/or prevention of an inflammatory skin disorder, the composition comprising an agent capable of inhibiting IL-36 activation via proteolytic processing, and a suitable pharmaceutical excipient.

Description

FIGURE LEGENDS

[0141] The Invention will be more clearly understood from the following description of embodiments thereof, given by way of example only, with references to the accompanying drawings, in which—

[0142] FIG. 1 (A) is a schematic of modified forms of IL-36α, IL-36β and IL-36γ where a caspase-3-processing motif (DEVD) was inserted into the IL-36 sequence, N-terminal to the known processing sites. (B) IL-36α/β/γ and DEVD-IL-36α/β/γ were incubated at 37° C. for 2 h, either alone or in the presence of indicated concentrations of recombinant caspase-3, followed by analysis by immunoblot.

[0143] FIG. 2 (A) are graphs showing HeLa.sup.Vector and HeLa.sup.IL36R stimulated with caspase-3 cleaved DEVD-IL36α, β and γ. After 24 h, cytokine concentrations in culture supernatants were determined by ELISA. (B) are graphs showing HeLa.sup.IL36R stimulated with full-length or caspase-3 cleaved DEVD-IL-36α, β and γ. At indicated time-points cytokine concentrations in culture supernatants were determined by ELISA.

[0144] FIG. 3 are graphs showing HeLa.sup.IL36R were stimulated with (A) full-length DEVD-IL-36α or caspase-3 cleaved DEVD-IL-36α, (B) full-length DEVD-IL-36β or caspase-3 cleaved DEVD-IL-36β, (C) full-length DEVD-IL-36γ or caspase-3 cleaved DEVD-IL-36γ at the indicated concentrations. (D) showing HaCat stimulated with full-length DEVD-IL-36β or caspase-3 cleaved DEVD-IL-36β at the indicated concentrations. After 24 h, cytokine concentrations in culture supernatants were determined by ELISA.

[0145] FIG. 4 (A) are photographs showing primary blood derived neutrophils stimulated in the presence or absence of PMA (50 nM) for 3 h. (B) are graphs showing HeLa.sup.IL36R were stimulated with 500 pM IL36α, β and γ pre-incubated for 2 h at 37° with indicated dilutions of either control or PMA-activated degranulates. After 24 h, cytokine concentrations in culture supernatants were determined by ELISA.

[0146] FIG. 5 are graphs showing HeLa.sup.IL36R stimulated with IL36α, IL36β and IL36γ, pre-incubated for 2 h at 37° with neutrophils degranulates in the presence or absence of PMSF (1 mM), leupeptin (10 μg/ml), aprotinin (10 mg/ml), Cathepsin G inhibitor 1 (10 μM), zVAD-fmk (10 μM), Elastase Inhibitor IV (10 μM), ALLN (5 μM), Antipain (100 μM). After 24 h, cytokine concentrations in culture supernatants were determined by ELISA.

[0147] FIG. 6 (A and B) are graphs showing Control and PMA-activated neutrophil degranulates that were pre-incubated with biotin-VAD-CMK (10 μM), biotin-FLF-CMK (10 μM) or Elastase Inhibitor IV (10 μM) for 30 min on ice followed by incubation with strepavidin agarose beads. Degranulates were subsequently assessed for Cathepsin G activity by FLF-sBzl hydrolysis assay (A) or Elastase activity was assessed by AAPV-AMC hydrolysis. HeLa.sup.IL36R were stimulated with IL36β (A) or IL36γ (B) pre-incubated for 2 h at 37° with mock, biotin-VAD-CMK (10 μM) or biotin-FLF-CMK (10 μM) treated degranulates. After 24 h, cytokine concentrations in culture supernatants were determined by ELISA.

[0148] FIG. 7 (A) are graphs showing hydrolysis of the synthetic caspase peptide (WEHD-AMC), by caspase-1; the caspase peptide (DEVD-AMC), by caspase-3; the cathepsin peptide (Suc-FLF-sBzL), by purified neutrophil cathepsin G; the elastase peptide (AAPV-AMC), purified neutrophil elastase. (B) are graphs showing HeLa.sup.IL36R stimulated with 500 pM IL-36α, β and γ pre-incubated for 2 h at 37° with indicated concentrations of recombinant caspase-1,-3 or purified cathepsin-G and elastase. IL-1β p17 served as a positive control for caspase titrations. After 24 hr, cytokine concentrations in culture supernatants were determined by ELISA.

[0149] FIG. 8 are graphs showing HeLa.sup.IL36R stimulated with a titration of IL-36α, β and γ pre-incubated for 2 hr at 37° with fixed concentrations of purified cathepsin-G (50 nM) and elastase (200 nM). After 24 hr, cytokine concentrations in culture supernatants were determined by ELISA.

[0150] FIG. 9 (A) is a Coomassie blue stained gel of recombinant IL-36β that was incubated in the presence or absence of Cathepsin G (50 nM). Indicated fragments were analysed by Edman Degradation sequencing and novel N-termini were identified as (.sup.6EAAP) and (.sup.54SDKE). (B) is schematics representing NPQR.sup.5 and DTEF.sup.53 cleavage motifs within IL-36β and point mutants IL-36β F53A and IL-36β R5A.

[0151] FIG. 10 is a Coomassie blue stained gel of recombinant Recombinant IL-360, IL-36β.sup.F53A and IL-36β.sup.R5A were incubated with fixed concentration of cathepsin-G, as indicated, followed by analysis by SDS-PAGE and Coomassie stain. Representative gel is shown from at least two independent experiments.

[0152] FIG. 11 (A) are graphs showing HeLa.sup.IL36RSEAP stimulated with a titration of IL36β and IL36β.sup.R5A pre-incubated for 2 h at 37° with cathepsin-G (50 nM). After 24 h, NF-kB activity was measured as a fold induction of SEAP in the supernatant and cytokine concentrations in culture supernatants were determined by ELISA. (B) HeLa.sup.IL36R stimulated with 500 pM of IL36β, IL-36β.sup.R5A and IL36β.sup.F53A pre-incubated for 2 h at 37° with a titration of cathepsin-G. After 24 h, NF-kB activity was measured as a fold induction of SEAP in the supernatant and cytokine concentrations in culture supernatants were determined by ELISA.

[0153] FIG. 12 are graphs showing HeLa.sup.IL36R stimulated with 500 pM of IL36β, IL-36β.sup.R5A and IL36β.sup.F53A pre-incubated for 2 h at 37° with a titration of PMA-activated neutrophil degranulate. After 24 hr, NF-kB activity was measured as a fold induction of SEAP in the supernatant and cytokine concentrations in culture supernatants were determined by ELISA.

[0154] FIG. 13 (A) is a Coomassie blue stained gel of recombinant IL-36γ that was incubated in the presence or absence of Elastase (100 nM). Indicated fragment was analysed by Edman Degradation sequencing and novel N-terminus was identified as (.sup.16YQSM). (B) is schematics representing GRAV.sup.15 cleavage motif within IL-36γ and the point mutant IL-36γ V15A.

[0155] FIG. 14 (A) is a graph showing recombinant IL-36γ and IL-36γ.sup.V15A incubated with a titration of Elastase or (B) fixed dose of Elastase (80 nM). After 24 hr, cytokine concentrations in culture supernatants were determined by ELISA.

[0156] FIG. 15 are graphs showing recombinant IL-36γ and IL-36γ.sup.V15A incubated with a titration of PMA-activated neutrophil degranulate. After 24 hr, (A) NF-κB activity was measured as a fold induction of SEAP in the supernatant and (B) cytokine concentrations in culture supernatants were determined by ELISA.

[0157] FIG. 16 are graphs showing HaCat stimulated with indicated titration of IL36α, β and γ pre-incubated for 2 h at 37° with cathepsin-G (50 nM), elastase (100 nM). After 24 h, cytokine concentrations in culture supernatants were determined by ELISA.

[0158] FIG. 17 are graphs showing primary keratinocytes stimulated with indicated titration of IL36α, β and γ pre-incubated for 2 h at 37° with cathepsin-G (50 nM), elastase (100 nM). After 24 h, cytokine concentrations in culture supernatants were determined by ELISA.

[0159] FIG. 18 are photographs of graphs showing Organotypic skin reconstructs cultivated at the air to liquid interface were topically stimulated with either cathepsin-G alone (We applied 2 μl in 10 μl MM), 2 nM IL-36β.sup.FL or IL-36β.sup.CatG in a volume of 10 μl MM, respectively, every other day. Application of 10 μl MM only served as negative control. After 15 days skin reconstructs were harvested, fixed in paraffin, and sections stained with H&E, against filaggrin, involucrin, cytokeratin 10 and 14 as indicated to display epidermal thickness and differentiation.

[0160] FIG. 19 is a gene expression heat map of IL-36β.sup.CatG induced in primary keratinocytes at 8 h.

[0161] FIG. 20 are graphs showing primary keratinocytes stimulated with IL-36β.sup.FL (5 nM) and IL-36β.sup.CatG (5 nM). At indicated time-points mRNA levels of cytokine were determined by RT-PCR.

[0162] FIG. 21 (A-B) are graphs showing primary keratinocytes stimulated with IL-36β.sup.FL (5 nM) and IL-36β.sup.CatG (5 nM). At indicated time-points levels of cytokine were determined by ELISA. (C) graphs showing primary keratinocytes stimulated with indicated concentrations of recombinant IL-17C. After 48 h, levels of cytokine were determined by ELISA.

[0163] FIG. 22 are immunoblots showing the specificity and cross-reactivity of IL-36 rabbit polyclonal antibodies tested against indicated protein amounts of recombinant IL-36 ligands.

[0164] FIG. 23 (A) are immunoblots showing Primary keratinocytes treated with a titration of IL-36β.sup.CatG (10, 5, 2.5 nM), PMA (40, 20, 10 nM) and Poly:IC (100, 50, 25 mg/ml). Recombinant IL-36 (500 pg) serves as a positive control for each immunoblot. (B) Primary keratinocytes treated with fixed concentrations of IL-36β.sup.CatG (5 nM), PMA (20 nM) and Poly:IC (100 μg/ml) over indicated time-points. Recombinant IL-36 (500 pg) serves as a positive control for each immunoblot.

[0165] FIG. 24 (A) are immunoblots showing HaCat treated with a titration of IL-36β.sup.CatG (10, 5, 2.5 nM), PMA (40, 20, 10 nM) and Poly:IC (100, 50, 25 mg/ml). Recombinant IL-36 (500 pg) serves as a positive control for each immunoblot. (B) HaCat treated with fixed concentrations of IL-36β.sup.CatG (5 nM), PMA (20 nM) and Poly:IC (100 μg/ml) over indicated time-points. Recombinant IL-36 (500 pg) serves as a positive control for each immunoblot.

[0166] FIG. 25 (A) are photographs showing primary keratinocytes incubated in the presence or absence of PMA (20 nM) for 12 h, followed by 1 h incubation with SLO (5 μg/ml). (B) is a graph showing primary keratinocytes incubated with indicated concentrations of SLO, followed by transfers of the supernatants onto Hela.sup.IL36R cells. After 24 h, cytokine concentrations in culture supernatants were determined by ELISA. Cell death is measured by annexin V/PI staining and quantified by flow cytometry. Cells and supernatants were analysed for indicated proteins by immunoblot.

[0167] FIG. 26 (A) is an immunoblot showing endogenous and recombinant IL-36γ incubated for 1 h at 37° with buffer, elastase (100 nM), cathepsin-G (50 nM), and neutrophil degranulate (1/4 dilution). (B) is an immunoblot showing endogenous IL-36γ incubated for 1 h at 37° with indicated concentrations of elastase, cathepsin-G and neutrophil degranulate.

[0168] FIG. 27 (A) is an immunoblot of control versus psoriatic biopsy samples, analysed for indicated proteins. Recombinant IL-36 (500 pg) serves as a positive control for each immunoblot. (B) is an immunoblot showing endogenous IL-36γ from psoriatic skin incubated for 1 h at 37° in the presence or absence of elastase (100 nM).

[0169] FIG. 28 are graphs showing Neutrophils degranulates pre-incubated for 30 min on ice in the presence or absence of a titration of peptide (20, 10, 5, 2.5, 1.25, 0.625 μM) followed by addition of IL36α for 2 h at 37°. HeLa.sup.IL36R were stimulated for 24 h. IL-8 cytokine concentrations in culture supernatants were determined by ELISA. Note: AFLF, GLF peptides and Elast I-IV serve as negative controls for IL-36α assay.

[0170] FIG. 29 are graphs showing Neutrophils degranulates pre-incubated for 30 min on ice in the presence or absence of a titration of peptide (20, 10, 5, 2.5, 1.25, 0.625 μM) followed by addition of IL36β for 2 h at 37°. HeLa.sup.IL36R were stimulated for 24 h. IL-6 cytokine concentrations in culture supernatants were determined by ELISA. Note: Elast I-IV serves as negative controls for IL-36β assay.

[0171] FIG. 30 are graphs showing cathepsin-G were pre-incubated for 30 min on ice in the presence or absence of peptide (10 μM) followed by incubation with IL36β. HeLa.sup.IL36RSEAP were stimulated with samples of each reaction taken at indicated timepoints. NF-kB activity was measured as a fold induction of SEAP in the supernatant and cytokine concentrations in culture supernatants were determined by ELISA.

[0172] FIG. 31 are graphs showing Neutrophils degranulates pre-incubated for 30 min on ice in the presence or absence of a titration of peptide (20, 10, 5, 2.5, 1.25, 0.625 M) followed by addition of IL36γ for 2 h at 37°. HeLa.sup.IL36R were stimulated for 24 h. IL-6 cytokine concentrations in culture supernatants were determined by ELISA. Note: b-FLF, FLF, GLF, KAL, AFLF, EPF peptides and CatG I-1 serve as negative controls for IL-36γ assay.

[0173] FIG. 32 are graphs showing Neutrophils degranulates pre-incubated for 30 min on ice in the presence or absence of a titration of peptide (200, 100, 50, 25, 12.5 μM) followed by addition of IL36γ for 2 h at 37°. HeLa.sup.IL36R were stimulated for 24 h. IL-6 cytokine concentrations in culture supernatants were determined by ELISA.

[0174] FIG. 33 are graphs showing Neutrophils degranulates pre-incubated for 30 min on ice in the presence or absence of a titration of peptide (200, 100, 50, 25, 12.5 μM) followed by addition of IL36β for 2 h at 37°. HeLa.sup.IL36R were stimulated for 24 h. IL-6 cytokine concentrations in culture supernatants were determined by ELISA. Note: AAPV, API, ARPV, DTEF, RPI, RPL, APL, APV, PQR, RAV, and RPV peptides serve as negative controls for IL-36β assay.

[0175] FIG. 34 (A) is a Coomassie blue stained gel of recombinant IL-36β that was incubated with a titration of purified cathepsin K. Indicated fragment was analysed by Edman Degradation sequencing and novel N-terminus was identified as (.sup.6EAAP). (B) is schematics representing NPQR.sup.5 cleavage motif within IL-36β and the point mutant IL-36β R5A.

[0176] FIG. 35 (A) are graphs showing HeLa.sup.IL-36R stimulated with recombinant IL-36β and IL-36β.sup.R5A (625 pM) incubated with indicated concentrations of cathepsin K. After 24 hr, cytokine concentrations in culture supernatants were determined by ELISA.

[0177] FIG. 36 is the complete DNA coding sequence (SEQ ID No. 3) and corresponding amino acid sequence (SEQ ID No. 4) for the IL-36β gene (Homo sapiens interleukin 1 family, member 8 (eta), mRNA (cDNA clone MGC:126882 IMAGE:8069339), complete cds)

[0178] FIG. 37 is the complete DNA coding sequence (SEQ ID No. 5) and corresponding amino acid sequence (SEQ ID No. 6) for the IL-36γ gene (Homo sapiens interleukin 1 family, member 9, mRNA (cDNA clone MGC:119102 IMAGE:40003612), complete cds)

[0179] FIG. 38 is the complete DNA coding sequence (SEQ ID No. 26) and corresponding amino acid sequence (SEQ ID No. 27) for the IL-36α gene (Homo sapiens interleukin 1 family, member 6, mRNA (cDNA clone MGC:129553 IMAGE:40002576), complete cds)

[0180] FIG. 39 (A) is a Coomassie blue stained gel of recombinant IL-36α that was incubated with a titration of purified cathepsin-G and elastase. Indicated fragment was analysed by Edman Degradation sequencing and novel N-terminus was identified as (.sup.4ALKI) for cathepsin-G and (.sup.5LKID) elastase, respectively. (B) is a schematic representing cathepsin-G and elastase cleavage motifs within IL-36α.

[0181] FIG. 40 (A and B) are graphs showing control and psoriatic skin elutes that were assessed for Cathepsin G activity by FLF-sBzl hydrolysis assay (A) or Elastase activity (B). (C) is a graph showing HeLa.sup.IL36R cells incubated with equal concentrations of IL-36α, β, γ cytokines (500 pM) that had been pre-incubated for 2 h at 37° with either control or psoriatic skin elutes in the presence or absence of either cathepsin G inhibitor 1 (10 μM) or elastase inhibitor IV (10 μM). IL-8 cytokine concentrations in culture supernatants were determined by ELISA.

[0182] FIG. 41 (A) are graphs showing HeLa.sup.IL-36R stimulated with recombinant IL-36β and IL-36β.sup.R5A (500 pM) incubated with indicated concentrations of proteinase-3 (B) are graphs showing HeLa.sup.IL-36R stimulated with recombinant IL-36γ and IL-36γ.sup.V15G (500 pM) incubated with indicated concentrations of proteinase-3. After 24 hr, cytokine concentrations in culture supernatants were determined by ELISA.

EXPERIMENTAL PROCEDURES

Reagents

[0183] Polyclonal antibodies were generated against IL-36α, β and γ by repeated immunization of rabbits with the full-length recombinant IL-36 proteins (Biogenes, Germany). anti-IL-1α and anti-IL-1β were purchased from R&D systems (UK). anti-Actin (clone C4) was from MP Biomedicals, anti-Bax (clone 6A7) was from Sigma, anti-Cullin-3 was from BD antibodies. Synthetic peptides, Ac-DEVD-AMC (SEQ ID No. 9), Ac-WEHD-AMC (SEQ ID No. 10), and biotin-VAD-FMK were all purchased from Bachem (Germany); Suc(oMe)-AAPV-AMC (SEQ ID No. 11) was purchased from Peptanova (Germany); biotin-VAD-FMK was purchased from ICN (UK). Novel synthetic peptides biotin-FLF-CMK, z-FLF-CMK, z-AFLF-CMK, z-EPF-CMK, z-GLF-CMK, z-KAL-CMK, z-GLK-CMK and z-GLW-CMK were synthesised by Boston Open Labs (USA). Chemical inhibitors Cathepsin G Inhibitor I and Elastase Inhibitor IV were purchased from Calbiochem (UK). Purified Neutrophil-derived Cathepsin G was purchased from Calbiochem (UK). Purified Neutrophil-derived Elastase was purchased from Serva (Germany). Unless otherwise indicated, all other reagents were purchased from Sigma (Ireland) Ltd.

Expression and Purification of Recombinant IL-36 and Caspases

[0184] Full-length poly-histidine-tagged IL-36α, β and γ proteins was generated by cloning the human coding sequence in frame with the poly-histidine tag sequence in the bacterial expression vector pET45b. Protein was expressed by addition of 600 μM IPTG to exponentially growing cultures of BL21 strain E. coli followed by incubation for 3 h at 37° C. Bacteria were lysed by sonication and poly-histidine tagged proteins were captured using nickel-NTA agarose (Qiagen, UK), followed by elution into PBS, pH 7.2, in the presence of 100 mM imidazole. Modified forms of IL-36 where cloned that included a caspase-3-processing motif (DEVD) into the IL-36 sequences, N-terminal to the known processing sites.sup.22. All IL-36 mutants were expressed and purified in the same way. Recombinant poly-histidine-tagged caspases-1, and -3, were also expressed and purified as described above.

Site-Directed Mutagenesis

[0185] Site-directed mutagenesis was carried out using the QuikChange kit (Stratagene). Mutagenesis of IL-36 genes was verified by sequencing (Eurofins MWG Operon).

Coupled In Vitro Transcription/Translation Reactions

[0186] In vitro transcription/translation reactions were carried out using purified plasmid templates added to a rabbit reticulocyte lysate system (Promega, UK).

Immunoblotting of Lysates and Precipitated Supernatants

[0187] To precipitate protein from supernatant, TCA was added at a 1:4 ratio to supernatant volume (250 μl to 1 ml supernatant) and incubated on rotation for 10 min. Supernatants were centrifuged at 15,000 g for 10 min. Top layer was removed without disturbing the pellet. 200 μl pre-chilled acetone was added to each pellet and mixed by several inversions. Samples were centrifuged for a further 10 min at 15,000 g. Samples were then put on heating block to burn off the acetone. 1×SDS-PAGE loading buffer (Tris.Cl, 50 mM, SDS, 2%, Glycerol 10%, Bromophenol Blue, 0.05%, β-mercaptoethanol, 2.5%) was added to each sample pellet. Samples were then boiled for a further 5 mins. Cell lysates were prepared using SDS-PAGE loading buffer and were electrophoresed on 8-13% SDS-polyacrylamide gels followed by transfer onto nitrocellulose membranes. Protein expression was subsequently examined by immunoblotting with the appropriate antibodies.

Purification of Primary Cell Populations and Preparation of Degranulates

[0188] Primary neutrophils were purified from donor human blood using the plasma-Percoll gradient method. Purity of cell preparations (>90%) was determined by Hematoxylin and Eosin staining of cytospins. To prepare degranulates, neutrophils (10.sup.7 per treatment) were stimulated in the presence or absence of 50 nM PMA in HBSS/0.25% BSA for 1-3 h at 37° C. in a humidified atmosphere with 5% CO.sub.2. Supernatants were harvested and clarified by centrifugation. Degranulate aliquots were stored at −80°.

Protease Activity Assays

[0189] Reactions (50 μl final volume) were carried out in protease reaction buffer (50 mM Hepes, pH 7.4/75 mM NaCl/0.1% CHAPS/2 mM DTT) containing 50 μM Ac-DEVD-AFC, Ac-WEHD-AMC, Suc(oMe)-AAPV-AMC. Samples were measured by using an automated fluorimeter (Spectrafluor Plus; TECAN) at wavelengths of 430 nm (excitation) and 535 nm (emission). For suc-FLF-sBzl assay, substrate was diluted to a final concentration of 300 μM in protease reaction buffer (50 mM Hepes, pH 7.4/75 mM NaCl/0.1% CHAPS/DTNB 300 μM). Samples were measured by automated fluorimeter (Spectrafluor Plus; TECAN) at an absorbance wavelength of 430 nM.

Protease Cleavage Assays

[0190] Reactions (40-100 μl final volume) were carried out in protease reaction buffer (50 mM Hepes, pH 7.4/75 mM NaCl/0.1% CHAPS) for 2 h at 37°.

Measurement of Cytokines and Chemokines

[0191] Cytokines and chemokines were measured from cell culture supernatants using specific ELISA kits obtained from R&D systems (human IL-6, IL-8, CXCL1, MCP-1, IL-17C). Each assay was repeated a minimum of three times and all cytokine assays were carried out using triplicate samples from each culture.

Cell Culture

[0192] HeLa were cultured in RPMI media (Gibco), supplemented with 5% fetal calf serum (FCS). HaCat were cultured in DMEM (Gibco) supplemented with FCS (10%). Primary neonatal foreskin derived Keratinocytes P0 were purchased from Cell Systems (Germany) and cultured in serum-free Dermalife K media (Cell Systems, Germany). HeLa.vector or HeLa.IL-36R cell lines were generated by transfection with pCDNA3 or pCDNA3.IL-1rrp2 followed by selection using G-418 antibiotic (Sigma). IL-1rrp2 over-expressing clones were confirmed by immunoblotting and the final clone selected by demonstration of acquired responsiveness to active forms of IL-36. All cells were cultured at 37° C. in a humidified atmosphere with 5% CO.sub.2.

Generation and Immunhistochemical Analyses of Organotypic Skin Equivalents.

[0193] Skin models were generated using 24 well inserts (Nunclon™ Δ, Nunc, Rochester, N.Y.) in 24 well plates (Greiner-bio-one). Per insert 1×10.sup.5 fibroblasts in GNL (322.5 ml 2×DMEM; 7.5 ml 3 M HEPES; 1.25 ml chondroitin-4-sulfate; 1.25 ml chondroitin-6-sulfate; 7.5 ml FCS) were mixed 1:3 with collagen I isolated from rat tails to a final volume of 500 μl and cultivated in DMEM/4.5 g/l glucose/1% L-glutamine/10% FCS/-L-pyruvate over night at 37° C. Next day dermal gels were equilibrated with EGM/10% FCS/1% PenStrep/10 mg/ml gentamycine for 2 h at 37° C. The medium was withdrawn and 1×10.sup.5 keratinocytes in EGM carefully seeded on top and incubated for 1.5 h at 37° C. to allow adhesion. Subsequently, skin equivalent were covered with EGM and cultivated for 7 days—changing the medium every other day. At day 7 skin equivalents were transferred to 6 well plates and cultivated/treated at the air-liquid interface in MM for 15 more days at 37° C., changing the medium every other day. Skin reconstructs were fixed in Roti-Histofix (Roth; Karlsruhe, Germany) for 3 h at RT released from the insert and embedded into paraffin. Sections of 3 μm were cut using a RM 2145-microtome (Leica, Biberach, Germany), transferred onto slides (LABOnord; Greiner-bio-one) for hematoxylin-eosin (HE)-staining or onto sialynized slides (Menzel GmbH, Braunschweig, Germany) for immunhistochemical analysis and dried at 37° C. over night. Sections were released from paraffin using Roticlear (Roth) and subjected to HE-staining at RT or were incubated with primary antibodies against keratin 10 (Dako, Hamburg, Germany), keratin 14, filaggrin (Biomedia, Singapore) and involucrin (Acris, Herford, Germany), respectively, as recommended by the manufacturer at 4° C. over night. Secondary polyclonal goat-anti-mouse-FITC (Dako) or goat-anti-mouse-Cy3 IgG (Jackson ImmunoResearch) antibodies were used, slides mounted in ProLong® Gold with or without DAPI (MolecularProbes® Life Technologies™) and analyzed using an Apotom1-Axio Imager and CEN software (Zeiss).

Gene Expression Microarray

[0194] Primary human neonatal foreskin-derived Keratinocytes (P3) were used for gene expression analysis. Primary Keratinocytes were stimulated with IL-36β for 8 and 24 h timepoints. Cells were harvested with RNAprotect cell reagent (Qiagen) and stored at −80°. Analysis of samples were performed using SurePrint G3 Human Gene Expression 8x60K v2 Microarray using a one-color based hybridization protocol and preformed by IMGM Laboratories (Germany).

RNA Analysis by Real-Time PCR (RT-PCR)

[0195] RNA was extracted from cells using the RNeasy Kit (Qiagen) as per manufacturer's instructions. cDNA was generated using the Omniscript RT Kit (Qiagen) and used to seed RT-PCR reactions (LightCycler® FastStart DNA Master Mix Sybr Green I). Quantification of cytokine gene products was preformed using the Roche Light Cycler 1.5 software and normalized to the β-Actin housekeeping gene.

Primers for RT-PCR

[0196] Primer sequence design for cytokine gene expression by real-time RT-PCR.

TABLE-US-00008 IL-17C Forward (SEQ ID No. 12) 5′ TTG GAG GCA GAC ACC CAC C 3′ IL-17C Reverse (SEQ ID No. 13) 5′ GAT AGC GGT CCT CAT CCG TG 3′ IL-36γ Forward (SEQ ID No. 14) 5′ GAA ACC CTT CCT TTT CTA CCG TG 3′ IL-36γ Reverse (SEQ ID No. 15) 5′ GCT GGT CTC TCT TGG AGG AG 3′ IL-8 Forward (SEQ ID No. 16) 5′ TCTGCAGCTCTGTGTGAAGG 3′ IL-8 Reverse (SEQ ID No. 17) 5′ ACT TCT CCA CAA CCC TCT GA 3′ G-CSF Forward (SEQ ID No. 18) 5′ GCT TAG AGC AAG TGA GGA AG 3′ G-CSF Reverse (SEQ ID No. 19) 5′ AGG TGG CGT AGA ACG CGG TA 3′ GM-CSF Forward (SEQ ID No. 20) 5′ GAG CAT GTG AAT GCC ATC CAG GAG 3′ GM-CSF Reverse (SEQ ID No. 21) 5′ CTC CTG GAC TGG CTC CCA GCA GTC AAA 3′ β-defensin-2 Forward (SEQ ID No. 22) 5′ ATG AGG GTC TTG TAT CTC CT 3′ β-defensin-2 Reverse (SEQ ID No. 23) 5′ TAT CTT TGG ACA CCA TAG TT 3′ β-Actin Forward (SEQ ID No. 24) 5′ ATG TTT GAG ACC TTC AAC AC 3′ β-Actin Reverse (SEQ ID No. 25) 5′ CAC GTC ACA CTT CAT GAT GG 3′

Psoriatic Patient Samples

[0197] 4 mm punch biopsies were obtained from 3 individuals presenting with clinical features of psoriais. The punch biopsies were obtained from uninvolved as well as involved areas of epidermis. Samples were homogenized using a dounce homogenizer in protease reaction buffer (50 mM Hepes, pH 7.4/75 mM NaCl/0.1% CHAPS. 1×SDS-PAGE loading buffer (Tris.Cl, 50 mM, SDS, 2%, Glycerol 10%, Bromophenol Blue, 0.05%, β-mercaptoethanol, 2.5%) was added to each sample pellet. Samples were then boiled for a further 5 mins. Cell lysates were prepared using SDS-PAGE loading buffer and were electrophoresed on 8-13% SDS-polyacrylamide gels followed by transfer onto nitrocellulose membranes. Protein expression was subsequently examined by immunoblotting with the appropriate antibodies.

Tape-Strip Samples from Control and Psoriatic Skin

[0198] Fixomull (2 cm×2 cm) adhesive tape strips were applied to a healthy or psoriatic skin, under firm pressure for 10 seconds. The tape-strip was placed in sterile 1.5 ml eppendorfs and eluated with protease reaction buffer (50 mM Hepes, pH 7.4/75 mM NaCl/0.1% CHAPS) under constant rotation for 1 h at 4° C. Sample eluates were stored at −80° C. Enzymatic assays and bioassays were setup using control and psoriatic eluates as described above.

Assessment of Agents as Capable of Inhibiting IL-36 Activation Via Proteolytic Processing

[0199] To identify whether IL-36 isoforms are proteolytically processed and activated by a particular protease, IL-36 is incubated with the protease for approximately 2 hours at 37° C. The reaction is then added to a cell line and the biological activity of the IL-36 protein is determined by the ability of IL-36 receptor (IL-36R) expressing cells, such as HeLa cells, Primary Keratinocytes, HaCat cells, to secrete factors into the cell culture medium. These secreted factors are quantified by ELISA (as shown in for example, FIG. 4B, FIG. 7, FIG. 8, FIG. 16, FIG. 17, FIG. 21A).

Assessment and Determination of Protease Cleavage Sites

[0200] To determine the proteolytic cleavage site(s) that activate IL-36, the protease is incubated with IL-36 for approximately 2 hours at 37° C., and the resulting reaction is analyzed by gel electrophoresis using an SDS-PAGE gel to separate denatured protein by the length of the polypeptide. The SDS-PAGE gel is then transferred onto PDVF membrane. This embeds the protein content of the SDS-PAGE gel onto the PVDF membrane. The PDVF membrane is stained with Coomassie blue. This dye stains the protein content of the PDVF and resolves the IL-36 protein and any cleavage bands are also made visible. These cleavage bands are subsequently excised and analysed by conventional Edman degradation sequencing to determine what is the N-terminus amino acid for the particular cleavage band that has been analysed. This is shown in, for example, IL-36α (see FIG. 39), IL-36β (see FIG. 9-12, FIG. 34) and IL-36γ (see FIG. 13-15).

[0201] Once this has been determined, this enables the particular residue(s) to be mutated via site-directed mutagenesis, whereby the cleavage site residue is changed to some other amino acids, typically a Glycine (Gly) or Alanine (Ala) (FIG. 9-12, FIG. 13-15, FIG. 39). The proteolytic reaction is now repeated using this mutant version of IL-36 (whereby the cleavage site has to be changed) with the protease. Again, this is shown FIG. 9-12, FIG. 13-15, FIG. 34, FIG. 39, whereby point mutants within IL-36 block activation by either cathepsin-G, Elastase, proteinease-3 or cathepsin K.

Design of Peptides Mimicking the Protease Cleavage Site for Use as Agents

[0202] Based on the cleavage sites identified within the IL-36 isoforms, peptides, including tri-/tetra-peptides, can be designed that mimic these cleavage motifs using conventional techniques.

[0203] Typically, a tri-/tetra-peptide will encompass the residues upstream and downstream of the cleavage site. The general nomenclature of cleavage site positions of the substrate were formulated by Schechter and Berger.sup.32-33. They designate the cleavage site between P1-P1′, incrementing the numbering in the N-terminal direction of the cleaved peptide bond (P2, P3, P4, etc.). On the carboxyl side of the cleavage site the numbering is incremented in the same way (P1′, P2′, P3′ etc.).

[0204] This has enabled the design and synthesis of suitable peptide. For example, RAV peptide (FIG. 32, second row) mimics the cleavage site of IL-36α GRAV.sub.15, (G-R-A-V-P1′-P2′-P3′). Additionally, KAL peptide (FIG. 28, second row) mimics the cleavage site of IL-36α MEK.sub.3AL, (M-E-K-P1′-P2′-P3′) by cathepsin-G and the cleavage site of IL-36α MEKA.sub.4L, (M-E-K-A-P1′-P2′-P3′) by elastase.

[0205] It is standard practice to synthesize peptides that reproduce the P1, P2, P3 or P1, P2, P3 and P4 amino acid residues in the substrate cleavage motif (i.e. the region at which the protease cleaves the substrate) to mimic the substrate itself and therefore compete with the protease for access to the substrate. It is also standard practice to choose chemically similar peptides to those specified in the P1, P2, P3 or P1, P2, P3 and P4 amino acid residues of the substrate to generate alternative peptide mimetics that would achieve the same effect. Thornberry et al., (Thornberry N A, Bull H G, Calaycay J R, Chapman K T, Howard A D, Kostura M J, Miller D K, Molineaux S M, Weidner J R, Aunins J, et al. A novel heterodimeric cysteine protease is required for interleukin-1 beta processing in monocytes. Nature. 1992 Apr. 30; 356(6372):768-74) and Nicholson et al., (Nicholson D W, Ali A, Thornberry N A, Vaillancourt J P, Ding C K, Gallant M, Gareau Y, Griffin P R, Labelle M, Lazebnik Y A, et al. Identification and inhibition of the ICE/CED-3 protease necessary for mammalian apoptosis. Nature. 1995 Jul. 6; 376(6535):37-43) are examples of the approach.

Design of Peptides that Binds an IL-36 Activating Protease or Activator Thereof for Use as Agents

[0206] Based on the identification of the proteases responsible for activating IL-36 isoforms, peptides, including tri-/tetra-peptides, can be designed that bind these proteases using conventional techniques.

[0207] As described above it is standard practice to synthesize peptide which target and/or inhibit a protease (e.g. Thornberry et al., (Thornberry N A, Bull H G, Calaycay J R, Chapman K T, Howard A D, Kostura M J, Miller D K, Molineaux S M, Weidner J R, Aunins J, et al. A novel heterodimeric cysteine protease is required for interleukin-1 beta processing in monocytes. Nature. 1992 Apr. 30; 356(6372):768-74) and Nicholson et al., (Nicholson D W, Ali A, Thornberry N A, Vaillancourt J P, Ding C K, Gallant M, Gareau Y, Griffin P R, Labelle M, Lazebnik Y A, et al. Identification and inhibition of the ICE/CED-3 protease necessary for mammalian apoptosis. Nature. 1995 Jul. 6; 376(6535):37-43)).

Synthesis of Tri/Tetra Peptide and Derivatives Thereof (Chemical Modification) for Use as Agents

[0208] In the most common strategy of solid phase peptide synthesis, as described by Merrifield (37), an amino acid with both α-amino group and side chain protection is immobilized to a resin. The α-amino-protecting group is usually an acid-sensitive tert-butoxycarbonyl (Boc) group or a base-sensitive 9-fluorenylmethyloxycarbonyl (Fmoc) group. These α-amino-protecting groups can be efficiently removed, and a protected amino acid with an activated carboxyl group can then be coupled to the unprotected resin-bound amine. The coupling reactions are forced to completion by using an excess of activated soluble amino acid. The cycle of deprotection and coupling is repeated to complete the sequence. With side chain deprotection and cleavage, the resin yields the desired peptide (36, 37).

[0209] For chloromethyl ketone (CMK)-modified peptides, the CMK chemical group located at the C-terminus of the peptide will occupy the active site but will form a covalent bond resulting in irreversible inhibition of the protease. More specifically, CMK are transition-state irreversible inhibitors. The active site Ser 195 of the enzyme forms a tetrahedral adduct with the carbonyl group of the inhibitor, and the active site histidine is alkylated by the CMK functional group (See REF:35)

Results

Truncated IL-36 Proteins Exhibit Biological Activity

[0210] To identify the proteases responsible for processing and activation of IL-36 cytokines, we established an IL-36 bioassay by stably transfecting HeLa cells with the human IL-36 receptor (IL-1Rrp2). Sims and colleagues have reported that artificial truncation of IL-36α, β and γ at particular N-terminal residues dramatically increases the activity of these proteins.sup.24 (FIG. 1a). To confirm that HeLa.sup.IL-36R cells were IL-36-responsive, we created modified forms of IL-36α, β and γ by inserting a caspase-3 cleavage motif, DEVD, proximal to the residues identified by Towne et al. to lead to IL-36-dependent NFkB activation when exposed at the N-termini of IL-36 cytokines (FIG. 1a). As FIG. 1b illustrates, DEVD-modified IL-36β (IL-36b.sup.DEVD) and DEVD-modified IL-36γ (IL-36g.sup.DEVD) was readily processed by caspase-3 whereas IL-36b.sup.wt and IL-36g.sup.wt were not. HeLawi cells failed to respond to either full length or caspase-3-cleaved IL-36β.sup.DEVD, while HeLa.sup.IL-36R cells secreted multiple cytokines in response to caspase-3-processed IL-36β.sup.DEVD, but not full length unprocessed IL-36β.sup.DEVD (FIG. 2a, b, FIG. 3). Similar data were obtained for a DEVD-modified form of IL-36α (FIG. 3a, b). Furthermore, the transformed skin line HaCat, which naturally express IL-1Rrp2, also responded to the caspase-3-cleaved IL-36.sup.DEVD forms. (FIG. 3d). These data confirmed that proteolytic processing of IL-36α, β and γ dramatically increase the biological activity of these cytokines and established a bioassay to screen for proteases that naturally process and activate IL-36 cytokines.

Neutrophil-Derived Proteases Activate IL-36 Cytokines

[0211] One of the hallmarks of psoriatic lesions is persistent infiltration of the epidermis by neutrophils.sup.23,25. Neutrophil granule proteases contain three major seine proteases (elastase, cathepsin G and proteinase-3) that are involved in bacterial killing as well as in the processing of certain cytokines and chemokines.sup.27. Indeed, previous studies have found that neutrophil elastase can process and activate IL-1α.sup.28 and that cathepsin G and elastase can activate IL-33.sup.29. To explore whether neutrophil-derived proteases can process and activate IL-36 cytokines, we induced human peripheral blood neutrophils to degranulate with PMA, thereby liberating granule proteases and generating reactive oxygen species (ROS).sup.30-31 (FIG. 4a, b). Robust ROS production and protease activity was found in supernatants from PMA-treated neutrophils, as expected (FIG. 4b). Purified full-length IL-36a, b and g were then incubated with supernatants from untreated versus PMA-treated neutrophils, followed by assessment of IL-36 activity using HeLa.sup.IL-36R cells. As shown in FIG. 4c, incubation of IL-36 cytokines in the presence of PMA-activated neutrophil 20 degranulates resulted in robust activation of IL-36β and IL-36γ, whereas IL-36α was poorly activated under the same conditions.

Identification of IL-36-Activating Proteases

[0212] To identify the specific protease(s) involved in IL-36β and γ activation, we initially used a panel of broad-spectrum protease inhibitors. As FIG. 5 illustrate, the serine protease inhibitor PMSF, as well a specific chemical inhibitor of cathepsin G robustly inhibited the activation of IL-36α and IL-36β while a specific chemical inhibitor of elastase inhibited the activation of IL-36γ by activated neutrophil degranulates. To explore the identity of the IL-36 processing protease(s) further, we designed a panel of peptides based upon optimal cathepsin G cleavage motifs. These peptides were then assessed for their ability to inhibit activation of IL-36 cytokines by PMA-activated neutrophil degranulates. As FIG. 6, FIG. 29, FIG. 30 demonstrate, the cathepsin G-inhibitory peptides, FLF-CMK, AFLF-CMK and EPF-CMK, proved to be the most potent inhibitors of IL-36β activation by neutrophil degranulates. In contrast, IL-36γ activation was antagonized by a specific chemical inhibitor of elastase (FIG. 6). We also generated a biotin-conjugated form of the cathepsin G inhibitor, biotin-FLF-CMK, to ask whether this depleted the IL-36b activating activity from neutrophil degranulates. As FIG. 6a illustrates, selective depletion of cathepsin G activity from PMA-treated neutrophil degranulates using biotin-FLF-CMK largely eliminated activation of IL-36b but not of IL-36g (FIG. 6b).

Purified Cathepsin G and Elastase Activate IL-36 Cytokines

[0213] We next compared the ability of purified cathepsin G, elastase and proteinase-3 to process and activate IL-36 cytokines. The activity of all purified proteases employed was confirmed using synthetic substrate peptides (FIG. 7a). As FIG. 7b demonstrates, cathepsin G selectively promoted IL-36β activation, whereas elastase and proteinase-3 preferentially activated IL-36γ. Furthermore, IL-36α is activated by cathepsin-G and proteinase-3 (FIG. 7b). Because caspase-1 processes and activates the IL-1 family cytokines, IL-1β and IL-18, we also explored whether caspase-1 or caspase-3 could process and activate IL-36 family cytokines.

[0214] However, as FIG. 7b illustrates, neither caspase activated any of the IL-36 cytokines. To exclude the possibility that the concentrations of IL-36α we used in the above experiments were too low to detect biological activity, we also titrated IL-36 cytokines over a wide concentration range in the presence and absence of cathepsin G, elastase or proteinase-3. As FIG. 8 shows, once again cathepsin G was found to preferentially activate IL-36β and to some extent proteinase-3 while elastase and proteinase-3 preferentially activate IL-36γ. Cathepsin G also exhibiting modest activation of IL-36γ at higher molar concentrations. Finally, all three neutrophils proteases activate IL-36α at higher molar concentrations (FIG. 8).

Mapping of Cathepsin G and Elastase Cleavage Sites in IL-36 Cytokines

[0215] To identify the cathepsin G cleavage site(s) within IL-36β that result in activation, we performed N-terminal sequencing of cathepsin G-treated IL-36β preparations. This analysis identified two candidate sites at Arg5 and Phe53 (FIG. 9). Thus, we generated mutations at both of these sites to assess their role in cathepsin G-mediated activation of IL-36β. We initially tested each mutant for resistance to proteolysis by cathepsin G. As FIG. 10 shows, IL-36β.sup.F53A suppresses appearance of the two major cleavage bands (˜10 and ˜4 kDa), yet still generates a third cleavage band (˜17 kDa) just below the full-length protein. In contrast, IL-36β.sup.R5A largely attenuates the appearance of the ˜17 kDa band just below the full-length band while the appearance of the cleavage bands (˜10 and ˜4 kDa) are significantly diminished. As FIG. 11, FIG. 12 illustrate, whereas mutation of Phe53 had no effect on cathepsin G-mediated IL-36β activation, mutation of Arg5 dramatically abolished activation of this cytokine. Furthermore, mutation of Arg5 also abolished activation of IL-36β by PMA-activated neutrophil degranulates (FIG. 11, FIG. 12). Using a similar approach, we identified Va115 in IL-36γ as the residue cleaved by elastase to promote activation of the latter (FIG. 13). Mutation of this residue also significantly attenuated activation of the latter by elastase, as well as by PMA-activated neutrophil degranulates (FIG. 14, FIG. 15).

Activated IL-36 Promotes Robust Cytokine Production by Keratinocytes

[0216] To explore the biological activity of IL-36β in a physiologically relevant cell type, we used transformed HaCat keratinocytes as well as primary human epidermal keratinocytes to ask whether cathepsin G-processed IL-36β or elastase-processed IL-36γ were capable of triggering the production of pro-inflammatory cytokines from these cells. As illustrated in FIG. 16, whereas full length IL-36β or IL-36γ exhibited little activity on HaCaT cells, cathepsin G-treated IL-36β and elastase-processed IL-36γ induced robust production of chemokines from these cells. Essentially identical results were seen with primary human keratinocytes (FIG. 17). Furthermore, using a reconstituted human 3D skin model, we also found that cathepsin G-processed IL-360 was sufficient to perturb skin differentiation to produce features resembling psoriasis, such as acanthosis and marked hyperkeratosis of the cornified layer (FIG. 18).

IL-36b is Sufficient to Drive IL-17 Production in Keratinocytes

[0217] To explore the biological effects of IL-36 further, we conducted gene expression array analyses in primary keratinocytes. As FIG. 19 demonstrates, cathepsin G-activated IL-36β induced robust expression of a diverse array of pro-inflammatory cytokines and chemokines from these cells. Of particular note, IL-36 induced strong transcriptional upregulation of IL-17C (˜50-fold within 8 hours), a cytokine that has been implicated as a key driver of the pathology observed in psoriasis and other conditions. IL-36β also induced robust expression of multiple additional inflammatory factors, such as complement C3, b-defensin-2, S100A9, TNFα, and G-CSF which are frequently elevated in lesional skin from psoriatic patients.sup.19 (FIG. 19). Interestingly, we also found that IL-36γ induced a strong signature of IL-36γ upregulation in primary keratinocytes, suggesting that this cytokine can promote a positive feedback loop for IL-36 cytokine expression. We validated IL-36-induced expression of several of these cytokines at the mRNA level (FIG. 20), as well as by ELISA, including IL-8, CXCL1 and IL-17C (FIG. 21a, b). Furthermore, IL-17C can itself promote cytokine production from primary keratinocytes (FIG. 21c).

Endogenous IL-36 Cytokines are Induced by Poly:(IC) as Well as IL-36

[0218] To explore the expression of endogenous IL-36 cytokines in keratinocytes, we generated polyclonal antibodies against all three IL-36 cytokines (FIG. 22). Whereas little endogenous IL-36α or β could be detected constitutively, IL-36γ was detected in primary keratinocytes (FIG. 22a). However, treatment of these cells with IL-36, PMA or the Toll-3 agonist poly:(IC) robustly induced the expression of endogenous IL-36γ (FIG. 23a, b). HaCat were also found to upregulate IL-36γ after IL-36 and PMA treatment (FIG. 24a, b). Primary human keratinocytes are reported to express the full-length forms of pro-IL-1α and pro-IL-1β at the protein level.sup.25. Indeed, we detected both, pro-IL-1α and pro-IL-1β constitutively expressed in primary keratinocytes (FIG. 22a, b). Furthermore, these cytokines were upregulated further in response to IL-36 and Poly:(IC) (FIG. 22a, b). Similar observations were made with HaCat cells (24 a, b).

Endogenous IL-36γ is Cleaved by Neutrophil Proteases

[0219] Consistent with previous data on other IL-1 family members IL-1β and IL-18, we failed to detect IL-36-dependent activity in the supernatants of SLO-lysed keratinocytes containing full-length IL-36γ (FIG. 7a, b). Of particular note, we also observed release of the full-length forms of IL-1α and IL-1β along with release of irrelevant proteins Cullin-3 and Actin into the cell supernatants, indicative of the non-selective nature of necrotic cell death (FIG. 7a). Furthermore, supernatants from SLO-lysed keratinocytes cells displayed activity that was IL-36-independent, but was dependent on IL-1α (FIG. 25a, b). To explore if IL-36γ, both intracellularly and extracellularly is subject to cleavage by neutrophil elastase, we generated cell extracts and supernatants followed by incubation with neutrophil proteases. As FIG. 26 a, b, illustrates, IL-36γ incubated with elastase resulted in robust IL-36γ proteolysis both intracellularly as well as extracellularly, with the resulting cleavage fragments running at a similar mobility to that produced through proteolysis of recombinant IL-36γ by elastase. Collectively these data indicate a role for IL-36 cytokines as targets of neutrophil serine proteases.

IL-36γ is Greatly Elevated within Lesional Skin from Psoriatic Individuals

[0220] To explore whether IL-36 ligands was elevated in lesional skin from psoriatic individuals, we generated homogenates from skin samples obtained from uninvolved as well as involved areas from psoriatic individuals. As FIG. 27a shows, these experiments revealed that IL-36g was greatly elevated in psoriatic tissue, while IL-36α and IL-36β were undetectable in these patient samples. Furthermore, incubating these psoriatic homogenates with neutrophil elastase resulted in IL-36γ proteolysis, with the resulting cleavage fragments running at a similar mobility to that produced through proteolysis of recombinant IL-36γ (FIG. 27b).

Psoriatic Lesional Skin Displays a Predominantly Cathepsin-G Like Activity that Activates IL-36 Cytokines

[0221] To explore the role of neutrophil proteases in a disease relevant setting, we generated control skin and psoriatic skin samples via the tape-strip method. As FIG. 40a, b show, these experiments revealed that psoriatic skin eluates contains a significantly elevated cathepsin-G like protease activity as demonstrated by robust FLF-sBzl hydrolysis, while Elastase-like activity was not elevated in psoriatic skin measured using the AAPV-AMC peptide. Next, we incubated these control and psoriatic skin eluates with equal molar concentrations of IL-36 cytokines. As FIG. 40c demonstrates, IL-36β was robustly activated by psoriatic skin eluates, with IL-36α activated but to much less efficient degree. Control skin eluates failed to activate IL-36 cytokines. Consistent with the cathepsin-G-like enzymatic activity, a specific cathepsin-G inhibitor attenuated IL-36β and IL-36α activation by the psoriatic skin eluates, while an elastase inhibitor failed to attenuate IL-36 activation. These data, are consistent with a cathepsin-G like enzymatic activity in psoriatic skin that is capable of activating IL-36β.

CONCLUSION

[0222] Our findings show that IL-36 cytokines are activated by neutrophil granule proteases. In particular, IL-36β and IL36γ are processed by cathepsin G, elastase and proteinase-3, respectively and proteolysis of these cytokines releases their full biological potency. Previous reports by Sims and colleagues.sup.24 suggested that IL-36 cytokines have limited biological activity as full-length proteins, and require processing at their N-termini to activate them. However, the latter authors did not identify the proteases that naturally process and activate these cytokines, but mapped their active forms using artificial truncations. We have also found that IL-36 cytokines have very limited biological activity as full-length proteins, however proteolysis by cathepsin G, elastase and proteinase-3 greatly enhanced the biological activity of IL-36β and IL-36γ respectively.

[0223] Proteolysis of IL-36 cytokines may induce a profound conformational change in these proteins that increase their affinity for the IL-36 receptor (IL-1 Rrp2), thereby increasing biological potency. Alternatively, the IL-36 N-termini may partly occlude the receptor binding domain, removal of which permits a more stable interaction with the IL-36R complex. Previously, Hazuda and colleagues have reported that pro-IL-1α and pro-IL-1β cytokines undergo profound conformational changes upon removal of their N-termini and, as a consequence, the mature regions of these molecules switch from a proteinase K-sensitive to a proteinase K-insensitive state. This change is most likely reflected in an altered conformation that increase their affinity for the IL-1 receptor.sup.26.

[0224] Immune cell infiltration is a hallmark of a number of skin-related inflammatory diseases. In particular, psoriatic plaques are heavily infiltrated with neutrophils, dendritic cells, macrophages, and T-cells.sup.26. Neutrophils are critical first responder cells in our innate immune system and play a critical role in the initial response to infection or tissue damage. Neutrophils perform a range of functions in their role in immune defence and inflammation which includes: engulfment and destruction of microbes via ROS production, release of neutrophil extracellular traps to sequester and kill microbes, release of cytokines to orchestrate immune responses, as well as the production of a vast repertoire of antimicrobial molecules such as defensins, and granule proteases such as elastase and cathepsin G.sup.27. Furthermore, mice doubly deficient in the neutrophil granule proteases cathepsin G and elastase have deficiencies in bacterial clearance as well as increased mortality to streptococcus, pseudomonas, and mycobacterial infections.sup.28-29. While the degranulation and release of neutrophil proteases exert profound antimicrobial and protective effects during infection, in excess they can cause extensive tissue damage through ROS production, inflammatory cytokine activation, as described herein, and protease degradation of the extracellular matrix.sup.31. Excessive neutrophil protease activity is typically prevented by serum anti-proteases such as α-1-antitrypsin and 2-macroglobulin that are also typically synthesized during inflammatory responses.sup.27.

[0225] Interestingly, the onset of psoriasis symptoms in affected individuals often follows a streptococcal A infection, which is likely to be associated with both necrosis of infected, as well as surrounding tissue and with robust neutrophil and macrophage infiltration. If necrosis is not a direct consequence of pathogen activities, necrosis of barrier tissues as a result of compression injuries or burns, for example, is likely to lead to infection. Thus, the immune system recognizes this as potential danger and mounts an innate immune response characterized by the infiltration immune cells such as neutrophils and macrophages into the site of injury.sup.9,30. Curiously, clinicians have observed that the development of psoriatic lesions can develop as a result of the epidermis experiencing physical injuries such as lacerations, burns or after surgical incisions. This trauma-induced psoriasis is often described as the ‘Koebner phenomenon’, which was first described in 1877.sup.35. An important feature that unites all of the above diverse scenarios is that all are capable of triggering necrotic cell death in the epidermis. As a direct consequence of necrosis, non-classical cytokines such as IL-36, IL-33 and IL-1α are released into the extracellular space where they can act on local epithelia to drive further inflammation. Necrosis can also lead to robust activation and infiltration of the injured site by cells of the immune systems such as neutrophils, macrophages and mast cells. It is under these conditions that extracellular IL-36 ligands may encounter and become processed by neutrophil serine proteases as these proteases are frequently found at elevated levels within psoriatic lesions. Indeed, our results show that activated IL-36 is capable of driving a robust inflammatory response in primary keratinocytes, including the induction of IL-1α, TNFα, IL-17C, G-CSF, IL-8, S100 proteins, as well as IL-36 itself. Keratinocytes make up the majority of cells within the epidermis, which constitutes a very important barrier against infection. In addition to serving as a physical barrier against the entry of microorganisms, it is now well appreciated that keratinocytes are capable of directly responding to damage or infection by releasing a number of key cytokines, such as IL-1α, IL-1β and IL-36 cytokines to activate local macrophages and dendritic cells to initiate immune responses.sup.5. In this respect keratinocytes serve as key sentinel cells that alert the immune system to potential danger. Moreover, our results show that IL-36γ as well as IL-1α/β, are endogenously expressed by keratinocytes and subject to modulation by either IL-36 signalling or Toll-receptor engagement. Therefore, keratinocytes are posed to release cytokines such as IL-36γ and IL-1α upon tissue injury. Thus, damage to keratinocytes, either as a result of microbial infection or through tissue trauma, is likely to play an important initiating role in psoriasis, especially in individuals carrying genetic predispositions to this disease (such as deficiency in the IL-36R antagonist). This leads to the triggering of an inflammatory reaction, of which IL-36 cytokines play a critical role, leading to further amplification of damage in a self-sustaining inflammatory loop.

[0226] In summary, we have shown that IL-36 cytokines are robustly activated by the neutrophil proteases, cathepsin G, elastase and proteinase-3, as well as cathepsin K, and that this proteolysis increases their biological activity ˜500-fold. Collectively these results show an important role for neutrophil proteases as potent activators of IL-36 cytokines and suggest that targeted inhibition of these proteases, as described here, may have therapeutic benefits in inflammatory skin conditions such as psoriasis and other similar conditions.

[0227] The invention is not limited to the embodiment(s) described herein but can be amended or modified without departing from the scope of the present invention.

REFERENCES

[0228] 1. Marrakchi, S., Guigue, P., Renshaw, B. R., Puel, A., Pei, X. Y., Fraitag, S., Zribi, J., Bal, E., Cluzeau, C., Chrabieh, M., Towne, J. E., et al. Interleukin-36-receptor antagonist deficiency and generalized pustular psoriasis. N. Engl. J. Med. 365, 620-8 (2011) [0229] 2. Jesus, A. A., Goldbach-Mansky, R. IL-1 Blockade in Autoinflammtory syndromes Annu. Rev. Med. 65, 223-44 (2014) [0230] 3. Gottlieb, A. B Psoriasis: emerging therapeutic strategies Nat. Rev. Drug Discov 4, 19-34 (2005) [0231] 4. Lowes, M. A., Bowcock, A. M., Kruger, J. G. Pathogenesis and therapy of psoriasis Nature. 445, 866-873 (2007) [0232] 5. Pasparakis, M., Haase, I., Nestle, F. O. Mechanisms regulating skin immunity and inflammation. Nat. Rev. Immunol. 14, 289-301 (2014) [0233] 6. Taylor, P. C., Feldmann, M. Anti-TNF biologic agents: still the therapy of choice for rheumatoid arthritis. Nat. Rev. Rheumatol. 10, 578-82 (2009) [0234] 7. Chaudhari, U., Romano, P., Mulcahy, L. D, et al. Efficacy and safety of infliximab monotherapy for plaque-type psoriasis: a randomised trial. LANCET 357, 1842-1847 (2001) [0235] 8. Lowes, M. A., Russell, C. B., Martin, D. A., Towne, J. E., Krueger, J. G. The IL-23/T17 pathogenic axis in psoriasis is amplified by keratinocyte responses. Trends Immunol. 34, 174-81 (2013) [0236] 9. Kono, H., and Rock, K. L. How dying cells alert the immune system to danger. Nat. Rev. Immunol. 8, 279-89 (2008) [0237] 10. Sims, J. E., Smith, D. E., The IL-1 family: regulators of immunity. Nat. Rev. Immunol. 2, 89-102 (2010) [0238] 11. Lukens, J. R., Gross, J. M., Kanneganti, T. D. IL-1 family cytokines trigger sterile inflammatory disease. Front Immunol. 3, 315 (2012). [0239] 12. Dinarello, C. A. Immunological and inflammatory functions of the interleukin-1 family. Ann. Rev. Immunol. 27, 519-550 (2009) [0240] 13. Vigne, S., Palmer, G., Lammacchia, C., Martin, P., Talabot-Ayer, D., Rodriguez, E., Ronchi, F., Sallusto, F., Dinh, H., Sims, J. E., Gabay, C. IL-36R ligands are potent regulators of dendritic and T-cells. Blood 118, 5813-23 (2011) [0241] 14. Milovanovic, M., Volarevic, V., Radosavljevic, G., Jovanovic, I., Pejnovic, N., Arsenijevic, N., Lukic, M. L. IL-33/ST2 axis in inflammation and immunopathology. Immunologic Research 52, 89-99 (2012) [0242] 15. Towne, J. E., Sims, J. E. IL-36 in psoriasis. Curr. Opin. Pharmacol. 4, 486-90 (2012) [0243] 16. Farooq, M., Nakai, H., Fujimoto, A., Fujikawa, H., Matsuyama, A., Kariya, N., Aizawa, A., Fujiwara, H., Ito, M., Shimomura, Y. Mutation analysis of the IL36RN gene in 14 Japanese patients with generalized pustular psoriasis. Hum. Mutat. 34, 176-183 (2013) [0244] 17. Onoufriadis, A., Simpson, M. A., Pink, A. E., DiMeglio, P., Smith, C. H., Pullabhatla, V., Knight, J., Spain, S. L., Nestle, F. O., Burden, A. D., Capon, F., Trembath, R. C., et al. Mutations in IL36RN/IL1F5 are associated with the severe episodic inflammatory skin disease known as generalized pustular psoriasis. Am. J. Hum. Genet. 89, 432-437 (2011) [0245] 18. Kanazawa, N., Nakamura, T., Mikita, N., Furukawa, F. Novel IL-36RN mutation in a japanease case of early onset generalized pustular psoriasis. J Dermatol. 9, 749-51 (2013) [0246] 19. Johnston, A., Xing, X., Guzman, A. M., Riblett, M., Loyd, C. M., Ward, N. L., Wohn, C., Prens, E. P., Wang, F., Maier, L. E., Kang, S., Voorhees, J. J., Elder, J. T., Gudjonsson J. E. IL-1F5, -F6, -F8, -F9: a novel family signaling system that is active in psoriasis and promotes keratinocyte antimicrobial peptide expression. J. Immunol. 186, 2613-22 (2011) [0247] 20. Blumberg, H., Dinh, H., Trueblood, E. S., Pretorius, J., Kugler, D., Weng, N., Kanaly, S. T., Towne, J. E., Willis, C. R., Keuchle, M. K., Sims, J. E., Peschon, J. J. Opposing activities of two novel members of the IL-1 ligand family regulate skin inflammation. J. Exp. Med. 204, 2603-14 (2007) [0248] 21. Blumberg, H., Dinh, H., Dean, C. Jr., Trueblood, E. S., Bailey, K., Shows, D., Bhangavathula, N., Aslam, M. N., Varani, J., Towne, J. E., Sims, J. E. IL-1RL2 and its ligands contribute to the cytokine network in psoriasis. J. Immuno. 185, 4354-62 (2010) [0249] 22. Tortola, L., Rosenwald, E., Abel, B., Blumberg, H., Schafer, M., Coyle, A. J., Renauld, J. C., Werner, S., Kisielow, J., Kofp, M. Psoriasiform dermatitis is driven by IL-36-mediated D C-keratinocyte crosstalk. J Clin. Invest. 122, 3965-76 (2012) [0250] 23. Wu J K, Siller G, Strutton G. (2004). Psoriasis induced by topical imiquimod. Aust, J. Dermatol. 45, 47-50 [0251] 24. Towne, J. E, Renshaw, B. R., Douangpanya, J., Lipsky, B. P., Shen, M., Gabel, C. A., Sims, J. E. Interleukin-36 (IL-36) ligands require processing for full agonist (IL-36a, IL-36b, IL-36g) or antagonist (IL-36Ra) activity. J. Biol. Chem. 286, 42594-602 (2011) [0252] 25. Hazuda, D, J., Strickler, J., Simon, P., Young, P. R. Structure-function mapping of interleukin 1 precursors. Cleavage leads to a conformational change in the mature protein. J. Biol. Chen. 266, 7081-7086 (1991) [0253] 26. Frank, O., Nestle, M. D., Daniel, H., Kaplan, M. D., Barker, M. D. Psoriasis. N. Engl. J. Med. 361, 496-508 (2009) [0254] 27. Koloaczakowska, E., Kubes, P. Neutrophil recruitment and function in health and inflammation. Nat. Rev. Immunol. 13, 159-75 (2013) [0255] 28. Hahn, I., Klaus, A., Janze, A. K., Steinwede, K., Ding, N., Bohling, J., Brumshagen, C., Serrano, H., Gauthier, F., Paton, J. C., Welte, T., Maus, U. A. Cathepsin G and neutrophil elastase play critical and nonredundant roles in lung-protective immunity against Streptococcus pneumoniae in mice. Infect. Immunl. 12, 4893-901 (2011) [0256] 29. Steinwede, K., Maus, R., Bohling, J., Voedisch, S., Braun, A., Ochs, M., Schmiedl, A., Langer, F., Gauthier, F., Roes, J., Welte, T., Bange, F. C., Niederweis, M., Buhling, F., Maus, U. A. Cathepsin G and neutrophil elastase contribute to lung-protective immunity against mycobacterial infections in mice. J. Immunol. 199, 4476-87 (2012) [0257] 30. Martin, S. J., Henry, C. M., Cullen, S. P. A perspective on mammalian caspases as positive and negative regulators of inflammation. Mol. Cell. 46, 387-97 (2012) [0258] 31. Weiss, G., Shemer, A., Trau, H. The Koebner phenomenon: review of the literature. JEADV. 16, 241-248 (2002) [0259] 32. Schechter, I and Berger, A. On the size of the active site in proteases. I. Papain. Biochem Biophys Res Commun, 27(2):157-162. (1967) [0260] 33. Schechter, I. and Berger, A. On the active site of proteases. 3. Mapping the active site of papain; specific peptide inhibitors of papain. Biochem Biophys Res Commun, 32(5):898-902. (1968) [0261] 34. Bruno, B. J., Miller, G. D., Lim, C. S. Basics and recent advances in peptide and protein drug delivery. Ther. Deliv. 4, 1443-67 (2013) [0262] 35. Powers J C.sup.1, Asgian J L, Ekici O D, James K E. Irreversible inhibitors of serine, cysteine, and threonine proteases. Chem. Rev. 102, 4639-750. (2002) [0263] 36. Merrifield, R. B. Solid Phase Peptide Synthesis. I. The Synthesis of a Tetrapeptide J. Am. Chem. Soc., 85, 2149-2154 (1963) [0264] 37. Nilsson, B. L., Soellner, M. B., Raines, R. T. Chemical Synthesis of Proteins. Annu. Rev. Biophys. Biomol. Struct 2005; 34: 91-118 (2005)

[0265] The invention will now be described by the following numbered statements. [0266] 1. Use of an agent capable of inhibiting IL-36 proteolytic processing, including IL-36α, IL-36β and/or IL-36γ proteolytic processing, for the treatment and/or reduction of inflammation in a subject. [0267] 2. Use for the treatment according to statement 1 wherein the agent prevents the production of a biologically active IL-36 to prevent and/or reduce the pro-inflammatory effects of IL-36. [0268] 3. Use for the treatment according to statement 1 or 2 wherein the agent directly inhibits IL-36 proteolytic processing by either binding to one or more protease cleavage sites within IL-36 required for activation of IL-36 or competing with IL-36 activating protease(s) for binding to one or more protease cleavage sites within IL-36 required for activation of IL-36. [0269] 4. Use for the treatment according to statement 3 wherein the agent targets the protease cleavage sites within IL-36 and/or amino acid residues downstream and/or upstream of the cleavage site. [0270] 5. Use for the treatment according to statement 3 or statement 4 wherein the agent targets the IL-36β protease cleavage site NPQR.sub.5 and/or one or more of upstream amino acid residues EAAP or the agent targets IL-36γ cleavage site GRAV.sub.15 and/or one or more of upstream amino acid residues YQSM. [0271] 6. Use for the treatment according to statement 1 or 2 wherein the agent indirectly inhibits IL-36 proteolytic processing by preventing and/or inhibiting the activity of IL-36 activating proteases, or activators of IL-36 activating proteases, which proteolytically process IL-36. [0272] 7. Use for the treatment according to statement 6 wherein the IL-36 activating protease is selected from elastase, cathepsin G, cathepsin K or DPPI (Cathepsin C). [0273] 8. Use for the treatment according to any of the preceding statements wherein the agent is a small molecule, peptide, polypeptide, protein, siRNA, sgRNA, and/or antibody. [0274] 9. Use for the treatment according statement 6 wherein the peptide is at least a tripeptide or tetrapeptide or up to 8-10 peptide in length that binds the IL-36 activating protease and/or competes with IL-36 activating proteases for access to the IL-36 cleavage sites. [0275] 10. Use for the treatment according to statement 9 wherein the peptide is designed to mimic the protease cleavage sites within IL-36β and IL-36γ required for activation of IL-36 and bind the protease active site to inhibit its activity. [0276] 11. Use for the treatment according to statement 9 or statement 10 wherein the peptide is selected from one or more of the following:

TABLE-US-00009 Glu-Pro-Phe; Ala-Phe-Leu-Phe; Lys-Ala-Leu; Glu-Pro-Phe-CMK; Ala-Phe-Leu-Phe-CMK; Lys-Ala-Leu-CMK, Arg-Ala-Val, Asp-Thr-Glu-Phe, Ala-Pro-Leu, Pro-Gln-Arg, Arg-Pro-Leu [0277] or chemically modified derivatives thereof or combinations thereof. [0278] 12. Use for the treatment according to any of the preceding statements wherein the agent is a small molecule inhibitor of cathepsin G and elastase, including serine protease inhibitors, optionally selected from Boswellic Acids, cathepsin G inhibitor I, Elastase inhibitor IV, Sodium Fluoride, 4-(2-Aminoethyl) benzenesulfonyl fluoride hydrochloride (AEBSF.HCl), Aprotinin, Leupeptin, and/or phenylmethanesulfonylfluoride (PMSF). [0279] 13. Use for the treatment according to any of the preceding statements wherein the antibody is a polyclonal or monoclonal antibody raised against neutrophil-derived proteases, including the proteases elastase or cathepsin G or cathepsin K wherein the antibody binds to the protease to prevent its binding to the protease cleavage sites within IL-36 required for activation of IL-36. [0280] 14. Use according to any of the preceding statements for the treatment of inflammation of barrier organs in a subject, including inflammation of the skin, gut and/or lung, preferably inflammatory skin disorders, optionally selected from psoriasis, dermatitis and/or acne. [0281] 15. A composition, optionally a topical inflammatory skin disorder treatment, comprising an agent capable of inhibiting IL-36 proteolytic processing and a suitable pharmaceutical excipient.