HERBICIDAL AND FUNGICIDAL COMPOSITIONS AND THEIR USES
20170280718 · 2017-10-05
Inventors
Cpc classification
C07C211/56
CHEMISTRY; METALLURGY
C07C211/52
CHEMISTRY; METALLURGY
A01N31/16
HUMAN NECESSITIES
C07C243/22
CHEMISTRY; METALLURGY
A01N33/06
HUMAN NECESSITIES
C07C323/20
CHEMISTRY; METALLURGY
International classification
A01N33/26
HUMAN NECESSITIES
C07C323/20
CHEMISTRY; METALLURGY
A01N31/16
HUMAN NECESSITIES
C07C243/22
CHEMISTRY; METALLURGY
A01N33/06
HUMAN NECESSITIES
C07C211/52
CHEMISTRY; METALLURGY
Abstract
Described herein are compounds of Formulas I-XIII and agrochemically acceptable salts thereof having herbicidal and fungicidal activity. Also disclosed herein are herbicidal and fungicidal compositions, including compounds of Formula I-XIII or agrochemically acceptable salts thereof, and methods of controlling unwanted vegetation or fungus using compositions including the compound of Formula I-XIII or an agrochemically acceptable salt thereof.
Claims
1. An herbicidal or fungicidal composition comprising an effective amount of a compound of Formula I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII or XIII.
2. The composition of claim 1, wherein the composition is an herbicidal composition.
3. The composition of claim 2, wherein the herbicidal composition further comprises at least one of a solvent, a surfactant, and a dispersing medium.
4. The composition of claim 2, wherein the composition is in the form of an emulsion or emulsifiable liquid concentrate.
5. The composition of claim 2, wherein the composition includes a solid carrier.
6. The composition of claim 5, wherein the composition is in the form of a wettable powder or a paste.
7. The composition of claim 1, wherein the composition is a fungicidal composition.
8. The composition of claim 7, wherein the composition further comprises at least one of a solvent, a surfactant, and a dispersing media.
9. The composition of claim 7, wherein the composition is in the form of an emulsion or emulsifiable liquid concentrate.
10. The composition of claim 7, wherein the composition includes a solid carrier.
11. The composition of claim 10, wherein the composition is in the form of a wettable powder or a paste.
12. A method of controlling unwanted vegetation, the method comprising applying an effective amount of the composition of claim 1.
13. A method of controlling unwanted fungus, the method comprising applying an effective amount of the composition of claim 1.
14. A method of inhibiting cellulose biosynthesis, the method comprising applying an effective amount of the composition of claim 1.
15. A method of inhibiting cellulose biosynthesis, the method comprising applying an effective amount of the composition of claim 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
DETAILED DESCRIPTION OF THE INVENTION
[0037] Novel cellulose deposition and trafficking inhibitor, CESTRIN, which specifically alters the trafficking of CSCs and their interacting proteins, enriching the CSC population in SYP61 compartments, has been identified. CESTRIN also inhibits Phytophtora capsici growth. CESTRIN affords novel avenues to study and understand the mechanism under which PM associated CSCs are maintained, interact with MTs, and identify exocytic routes that deliver them.
[0038] Although recent studies have identified a molecular component that mediates the interaction between CESAs and MTs, many unknown players potentially await discovery. In addition, the cellular determinants that control CSC delivery to, and internalization from, the PM remain ill understood. Such novel components could be critical for regulating the stability and activity of CSCs and may reveal new aspects of anisotropic cell growth. A compound, CESTRIN, which alters the trafficking of CSCs and their associated proteins CSI1/POM2 and KOR1, leading to MT instability and a reduction in cellulose content, has been identified. CESTRIN did not affect the localization patterns of a variety of endomembrane compartments, including ER, Golgi, TGN, and vacuole, demonstrating that the subcellular phenotype is not the result of broad cell toxicity. Strikingly, neither general secretion nor cytosolic clathrin compartments were affected, indicating that CESTRIN's mode of action does not affect indiscriminately endocytic or secretion pathways but rather specialized pathways involved in CESA delivery.
[0039] Exposure to CESTRIN increased the colocalization of SYP61 vesicles with CESA, suggesting that CESTRIN bodies are enriched in the syntaxin. Mannitol treatment is thought to tether MT to SmaCCs. Corroborating our findings, mannitol induced SmaCCs only colocalized partially with SYP61 among different TGN markers tested. Moreover, proteomic analysis of SYP61 vesicles has established that they contain CESAs involved in primary cell wall biosynthesis and KOR1, suggesting a role of SYP61 in trafficking of CSCs. A recent TGN proteomic analysis identified CESA1 in VHA-a1 fractions, however neither CESA3/6 nor KOR1 could be detected. A plausible explanation might be that SYP61 defines a population that is distinct from VHA-a1 vesicles involved in the delivery of CSCs.
[0040] Cellulose synthase inhibitors (CBIs) influence the trafficking and dynamics of CESAs or MT. Small molecules such as isoxaben, CGA, or mannitol deplete CSCs from the plasma membrane, leading to their subsequent accumulation in SmaCCS/MASCS. CESTRIN is unique in causing CSC accumulation in CESTRIN bodies while concurrently affecting MT organization. The way CESTRIN influences the stability of MTs is markedly different from that observed for CBIs and oryzalin. Application of oryzalin at a concentration depolymerizing MTs, has no significant effect on the velocity and localization of CSCs; however, extended oryzalin treatment results in a complete removal of microtubules and a uniform distribution of CSCs at the PM. Further, under MT depolymerization conditions no dissociation of POM2 with CSCs is observed, despite their localization in less defined trajectories. The only previously described effect of oryzalin in CSC trafficking is in combination with other CBIs. In contrast to oryzalin, which inhibits tubulin polymerization in vitro at concentrations of 5 μM, CESTRIN application at a concentration inducing CESTRIN bodies (15 μM), does not inhibit in vitro tubulin polymerization. This suggests that MT instability or depolymerization are not the primary effects of the small molecule, but rather a feedback mechanism, through an intermediate component associating with both cellulose synthases and MT. The CBIs morlin and cobtorin (4-[(2-chlorophenyl)-methoxy]-1-nitrobenzene) affect cytoskeleton organization but do not cause CSCs accumulation in intermediate bodies. The distinct subcellular phenotypes caused by CESTRIN compared to oryzalin, morlin, and cobtorin illustrate that CESTRIN has a markedly different mode of action, featuring an altered trafficking of extended CSCs and causing their accumulation in intermediate “CESTRIN induced bodies,” while affecting MT-CSC interaction.
[0041] Further corroborating that CESTRIN affects cellulose synthesis is the fact that seedlings grown on the compound display a ˜30% reduction in cellulose. In addition, in vitro data show that CESTRIN does not act on microtubule polymerization, which supports a role for CESTRIN in cellulose synthesis rather than microtubule formation. The notion of feedback disruption from cell wall to cytoskeleton organization is supported by genetic studies in which it was shown that mutations in the genes encoding the glucanase KOR1 and CESA6 (kor1-3, prc1-20 and jiaoyao1) resulted in changes of MT organization. It is plausible that CESTRIN's inhibition of the CSCs provides feedback to the microtubules which in turn leads to a dis-organized or collapsing MT array.
[0042] CESTRIN may target a link between CSCs and MTs. Studies show that the two CESA interacting proteins POM2/CSI1 and KOR1 are affected by CESTRIN; however, subtly different behaviors were observed for the two. The nature of these proteins might give clues about their subcellular behavior after CESTRIN treatment. CSI1/POM2 is currently the most well characterized protein that serves as a linker between MT and CSCs. In vitro assays demonstrated that it interacts both with MT and CESAs involved in primary cell wall synthesis, while in planta studies have shown that it colocalizes with CESAs while traveling along trajectories aligned with MT CSCs. In addition, genetic lesions in csi1 null mutants exhibit both CSCs and cortical microtubule defects.
[0043] The glucanase KOR1 interacts with CESAs involved in the primary cell wall formation and colocalizes with CESAs at the PM following linear trajectories. Moreover, KOR1-GFP is present in SmaCCs/MASCS, at the Golgi, TGN, and late endosome compartments. Under CESTRIN treatment, KOR1-GFP displays subcellular patterns similar to that of GFP-CESA3; both localize in bright fluorescence punctae. This observation suggests that the membrane association of CESAs and KOR1 is maintained upon chemical treatment, leading to their enhanced localization in CESTRIN bodies. This is contrasted by partial cytoplasmic localization of CSI1/POM2 upon chemical treatment, which suggests dissociation from CSCs. The fact that CESTRIN targets both proteins associated with CSCs underscores the specificity of CESTRIN towards a pathway controlling the interaction between the two.
[0044] Changes in cellulose content suggest that CESA might be the direct target of the small molecule. It is reasoned, however, that though CESA3 is the target for isoxaben, a different mode of action for affecting CESAs is observed for CESTRIN. The sensitivity of the ixr1-1 mutant to CESTRIN, contrasting that of isoxaben resistance, implies that even if a CESA subunit is targeted by CESTRIN, it does not correspond to the ixr1-1 locus on CESA3. A number of mechanisms can account for the cumulative observed behavior of CESTRIN, though it is challenging to ascribe with certainty likelihoods to these. Plausible hypotheses are presented here.
[0045] It is possible that the small molecule acts on a linker protein between CSCs and MTs such as the CSI1/POM2 or other not-yet identified proteins involved in this interaction. Alternatively, CESTRIN might affect a signaling mechanism regulating the activity of CSCs, potentially mediated by phosphorylation. It is known that changes in CESA phosphorylation alter their motility and reduce anisotropic growth. Further interactions of MT associated proteins (MAP65s) and MTs can be modulated via phosphorylation by altering protein surface charge. It is hence tempting to suggest that CESTRIN targets phosphorylation; however, on the basis of the observed reduction in cellulose content and the formation of CESTRIN bodies, without affecting MT polymerization in vitro, this seems unlikely. Another possible mechanism is that signaling events may take place that cause accumulation of CSCs into CESTRIN bodies and feedback altering MT stability. Only future studies that identify the target of CESTRIN can conclusively determine which hypotheses are correct, and these efforts are currently under way.
[0046] Accordingly, compounds described herein include CESTRIN and agrochemically acceptable salts thereof. These compounds have herbicidal and fungicidal activity and are useful alone or in combination with other herbicidal and/or fungicidal compounds in compositions as described herein.
[0047] Also described herein are herbicidal compositions including the compound of Formula I, or an agrochemically acceptable salt thereof. Also described herein are herbicidal compositions including one or more of the compounds of Formulas II-XIII, or agrochemically acceptable salts thereof.
[0048] Also described herein are fungicidal compositions including the compound of Formula I, or an agrochemically acceptable salt thereof. Also described herein are fungicidal compositions including one or more of the compounds of Formulas II-XIII, or agrochemically acceptable salts thereof.
[0049] Also described herein are methods of controlling unwanted vegetation or fungus using herbicidal compositions including one or more of the compounds of Formulas I-XIII, or agrochemically acceptable salts thereof.
[0050] Herbicidal and fungicidal compositions described herein include CESTRIN, the compound of Formula I, one or more of the compounds of Formulas II-XIII, or agrochemically acceptable salts thereof. The compositions may be formulated as solids, including but not limited to, dusts, granulates, coated granules, impregnated granules, and homogeneous granules; as liquids, including but not limited to, solutions, dispersions, emulsions, and aerosols; and/or as concentrates, including but not limited to the listed solids and liquids in a concentration suitable for dilution prior to use as well as wettable powders and pastes. Thus, the composition may be suitable for direct application or may be prepared in concentrated form suitable for dilution prior to use.
[0051] Compositions formulated as liquids or liquid concentrates include one or more of the compounds of Formulas I-XIII or agrochemically acceptable salts thereof, and may further include one or more of a solvent, a liquid dispersing media, surfactant, and emulsifier.
[0052] When the compositions described herein are used in the form of solutions, the compound of Formula I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII or XIII, or the agrochemically acceptable salt thereof, is dissolved in suitable organic solvents, mixtures of solvents, or water using methods well known to those skilled in the art. Suitable organic solvents include, but are not limited to, aromatic hydrocarbons, aliphatic hydrocarbons, cycloaliphatic hydrocarbons and mixtures thereof, such as petroleum distillates. In use, the solvents preferably include the active substances in a concentration range of 1 to 20% based on the total weight of the resulting solution, but may include more or less of the active substance as can be determined by one of skill in the art based on intended use.
[0053] Emulsifiable liquid concentrates can be prepared by incorporating one or more of the compounds of Formula I-XIII, or agrochemically acceptable salts thereof, and an emulsifying agent in a suitable water-immiscible organic liquid. Such concentrates may be further diluted with water to form spray mixtures in the form of oil-in-water emulsions. In use, the compound of Formula I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII or XIII, or the agrochemically acceptable salt thereof, preferably is present in amounts ranging from about 1 to about 30 percent by weight of the total composition, but may be present in greater or lesser amounts as can be determined by one of skill in the art based on intended use. Suitable emulsifying agents can be non-ionic, ionic, or blends thereof. Suitable water immiscible organic liquids include aromatic hydrocarbons, aliphatic hydrocarbons, cycloaliphatic hydrocarbons and mixtures thereof, such as petroleum distillates.
[0054] Compositions formulated as liquids or liquid concentrates include one or more of the compounds of Formula I-XIII, or agrochemically acceptable salts thereof, and may further include one or more of a solid carrier, dispersing agent, and/or a solvent. Production of the solid herbicidal and fungicidal compositions described herein is carried out in a manner well-known to those skilled in the art by the intimate mixing and grinding of the active substance, with suitable carriers and optionally dispersing agents, and/or solvents that preferably are inert to the active substances.
[0055] Suitable carriers include, but are not limited to, bentonite, kaolin, Fuller's earth, silica, talc, chalk, limestone, ground limestone, dolomite, diatomaceous earth, precipitated silicic acid, alkaline earth silicates, sodium and potassium aluminum silicates (feldspar and mica), calcium and magnesium sulfates, magnesium oxide, ground synthetic plastics, fertilizers such as ammonium sulfate, ammonium phosphate, ammonium nitrate, ureas, ground vegetable products such as grain flour, bark flour, sawdust, ground nut shells, cellulose powder, residues of plant extractions, activated charcoal, etc. These carriers can be used separately or in combination. The grain size of the carriers is from about 0.075 mm to 0.2 mm, and may be larger. For dusts the grain size preferably is less than or equal to 0.1 mm. For sprinkling agents the grain size preferably is about 0.075 mm to about 0.2 mm.
[0056] In other embodiments, compositions can be formulated as spreadable granules. The spreadable granules can be prepared using any solid diluent known in the art, but preferably are prepared using calcined attapulgite clay as the solid diluent. For granulates the grain size preferably is equal to or greater than 0.2 mm. Dry dispersions can be prepared on herbicidally and/or fungicidally inert carriers, such as vermiculite, peat moss, and the like.
[0057] The concentrations of active substances in the solid preparations preferably are about 0.5 wt % to about 90 wt % of the total composition, and more preferably are about 0.5 wt % to about 80 wt %.
[0058] Wettable powders and pastes are examples of concentrates of active substances which can be diluted with water to give any desired concentration. They include one or more of the compounds of Formula I-XIII, or an agrochemically acceptable salt thereof, and one or more carriers, and may optionally include solvents, additives that stabilize the active substance, surfactants, dispersing agents, wetting agents, and/or antifoaming agents. The wettable powder concentrates preferably have concentrations in the range of from about 1 to about 75 percent by weight of the compound of Formula I-XIII, or agrochemically acceptable salt thereof. The wettable powder can be dispersed in water or other hydroxylated carrier to form spray compositions.
[0059] Suitable carriers for wettable powders and pastes are, for example, those previously mentioned for solid preparations. Suitable solvents include, but are not limited to, alcohols, benzene, xylenes, toluene, dimethyl sulfoxide and mineral oil fractions boiling between 120° and 350° C. The solvents preferably are practically without smell, not phytotoxic, inert to the active substances, and not easily flammable.
[0060] The wettable powders and pastes are obtained by mixing and grinding the active substances with carriers in suitable devices until homogeneity is attained, using methods well known to those skilled in the art. The solid particle size in wettable powders preferably is less than or equal to 0.04 mm and, more preferably, is less than or equal to 0.02 mm. The solid particle size in pastes preferably is less than or equal to 0.003 mm.
[0061] Other biocidal active substances or agents can be mixed with the described compositions. Thus, in addition to the stated compounds of Formula I-XIII, or agrochemically acceptable salts thereof, the compositions can also contain, for example, insecticides, fungicides, bactericides, fungistatics, bacteriostatics, or nematocides in order to widen the range of action. The compositions described herein can also contain fertilizers, micronutrients, etc.
[0062] The novel compounds described herein can be used for treating a desired area with a dust, granular formulation, or spray containing one or more of the compounds of Formula I-XIII, or an agrochemically acceptable salt thereof, as the herbicidally and/or fungicidally active ingredient. Typical of areas which can be treated are crop growing areas in which tolerant crops are being grown and other areas where control of vegetation is desired, such as gravel driveways, clay tennis courts, walks, road shoulders, and the like.
[0063] As is well understood in the art, application rates required when the compounds are to be used in the field are greater than those required in the greenhouse. Compositions containing one or more of the compounds of Formula I-XIII, or an agrochemically acceptable salt thereof, can be sprayed, dusted, or spread by methods well known to the art onto the desired area at the rate of around 1.12 to 56 kilogram of active ingredient per hectare, or preferably 1.12 to 36 kilogram of active ingredient per hectare.
[0064] The concentration of the compound in these compositions may vary depending on whether the composition is intended for direct application or is a concentrate designed to be subsequently diluted with additional inert carrier, such as water, to produce the ultimate treating composition.
Examples
Material and Methods
[0065] Plant Materials and Growth:
[0066] Arabidopsis seeds were sterilized using 30% (v/v) sodium chlorate in ethanol (absolute) with 30 μL Triton X-100 (Sigma) per 50 mL of solution. Seeds were plated on 0.5× Arabidopsis growth medium (AGM) with phytagar (2.3 g/L Murashige and Skoog minimal organics medium, 10 g/L sucrose and 8 g/L phytagar), and cold vernalized for 48 hours at 4° C. in the dark. Plates were transferred to a 24° C. growth chamber, exposed upright to light for 3 hours and etiolated in the dark for 3 days prior to chemical treatment and further examination.
[0067] Transgenic lines expressing MAN-YFP (Nebenfuhr et al., 1999), HDEL-GFP (Nelson et al., 2007), VAMP711-YFP (Geldner et al., 2009), NTPP-RFP (Rosado et al.), THE1-GFP (Hematy et al., 2007), CLC-GFP (Konopka et al., 2008), VHA-RFP (Dettmer et al., 2006), VTI12-YFP (Geldner et al., 2009), CFP-SYP61 (Robert et al., 2008), sec-GFP (Goh et al., 2007), CESA6-YFP (Paredez et al., 2006), TUB-GFP (Nakamura et al., 2004), EB1-GFP (Bisgrove et al., 2008) and TALIN-GFP ((Mathur et al., 1999) were used. In addition, the mutant ixr1-1 (Scheible et al., 2001) and prc1-1 (Desnos et al., 1996) were used.
[0068] Plant Expression Vectors.
[0069] 3×Ypet-POM2/CSI1 was created using the basic experimental procedures described in (Zhou et al., 2011), by employing the TAC clone JAtY77F05 to generate an in frame C-terminal translational fusion between the CSI1/POM2 gene and the 3×Ypet tag (ABRC stock CD 1727). All of the Arabidopsis genomic sequences in the JAtY clone 77F05 10 Kb upstream and 5 Kb downstream of CSI1/POM2 were replaced by recombineering using the ampicillin- and tetracyclin-resistance genes, respectively. Primers used in this procedure and verification of insertion are shown in Table 1. The resulted plasmid was transformed into plants using GV3101 Agrobacterium tumefaciens standard protocols. T2 transformants were selected by BASTA (glufosinate ammonium 200 g/L) and the gene expression was validated by confocal microscopy.
TABLE-US-00001 TABLE 1 Primers sequence used in generation of 3xYpet-POM2/CSI1 Usage Name Sequence 1 POM2 CF 5′-GCAAAAGTGGTCCCAGAAACCTTGAGATAGAATTCCAGTGGT- CTAACAAG-GGAGGTGGAGGTGGAGCT-3′ POM2 CR 5′-TCGATTTAAGAAACCTCTCAAACAA- AAACAAAAAATGAAGTGGTGGTTTAGGCCCCAGCGGCCGCAGCAG CACC-3′ 2 POM2 CTF 5′-TACAGTTTGAAAATTTGCCGG-3′ POM2 CTR 5′-TGGGACAACAAAATGTTACAAATG-3′. 3 POM2 delRB 5′-TCGCTGCTGGACATGCTCAGTTTGGTAAAGCCGGGGG- GACCATTCTGAC-ttaccaatgcttaatcagtg-3′ replaRB- 5′-TATATTGCTAATAAATTTTTGGCGCGCCGGCCAA- ampuniversal TTAGGCCCGGGCGG-ttcaaatatgtatccgctcatg-3′, POM2 delLB 5′- TCTGATTAAATTTAATTAATATTATATTTTTAGAATCTTCTGAATA- TTTA-ccctcttgggttatcaagagg-3′, replaLB- 5′- tetuniversal TTAGTTGACTGTCAGCTGTCCTTGCTCCAGGATGCTGTTTTTGACA ACGG-taattcctaattatgttgacac-3' 1: 3xYpet cassette upstream of the stop codon of CSI1/POM2 2: Test and sequence the insertion of the 3xYpet cassette 3: Used to generate this trimmed TAC clone
[0070] Chemical Treatments and Microscopy.
[0071] For microscopy, seedlings were grown as described above for 3 days and then transferred to 24-well plates containing 0.8 mL of 0.5×AGM with phytagar supplemented with either 0.5% (v/v) dimethyl sulfoxide (DMSO, Sigma), 15 μM CESTRIN (12 mM stock), or 30 μM oryzalin (40 mM stock) (Fisher (50-748-30). To ensure consistency, all treatments were carried out in phytagar supplemented media. Pulse treatments of Arabidopsis seedlings with the desired chemicals were performed for 2 hours in the dark.
[0072] Spinning disk confocal microscopy to observe the dynamics of CESA3-GFP×TUA5-RFP, 3×Ypet-POM2, and KORRIGAN-GFP (Vain et al., 2014) was performed using two similar customized microscopes (3I, Denver, Colo.) equipped with spinning disk heads (Yokogawa), EMMCCD cameras (Andor UK, Photometrics Tucson Ariz.), and oil immersion objectives (100×NA 1.4). Time-lapse images were taken every 5 seconds with exposure times between 800 ms and 600 ms.
[0073] Confocal images for CFP-SYP61-×CESA3-GFP were obtained using a Leica SP5 microscope using a 63× water objective employing dual channel sequential line scanning. Fluorescent markers were excited at 442 nm (CFP) and 488 nm (GFP). Additional confocal images were obtained using a Zeiss 710 equipped with a 63× oil and a 40× water objective. A 561 nm diode laser was used for propidium iodide (PI, Sigma) and RFP, a 488 nm for GFP, a 514 nm for YFP, and a 405 nm for CFP. Image analysis was performed using a combination of software tools: ImageJ software (version 1.36b; http://rsbweb.nih.gov/ij/), Image Pro Plus (Media Cybernetics, Rockville, Md.), and Imaris (Bitplane, Saint Paul, Minn.).
[0074] Hypocotyl Growth Measurements.
[0075] For growth analysis, seedlings were germinated on AGM containing the chemicals CESTRIN or isoxaben solubilized in DMSO and grown as described above. When the experiment was complete, the plates were scanned using a flatbed scanner (Epson Perfection V300) and hypocotyl lengths were measured using the segmented line tool in the image analysis software, ImageJ (Rasband et al., 1997-2014). Statistical analyses were carried out using the statistical package, R (R Core Team, 2012).
[0076] Yeast and E. coli Growth.
[0077] Single colonies of Saccharomyces cerevisiae-Y2H Gold and Schizosaccharomyces pombe were grown in liquid yeast extract-peptone-dextrose (YPD) media (10 g yeast extract, 20 g peptone, and 20 g glucose per 1 L of media, pH 7), at 30° C. for 24 hours. Yeast cultures were transferred to 3 mL of YPD to grow until an OD of 0.7 was reached. Ten μL of liquid YPD containing yeast at an OD 0.7 were placed onto solid YPD (10 g yeast extract, 20 g peptone 20 g glucose and 11 g bacto-agar per 1 L of media, pH 7) in a 6 well plate containing the chemicals. Four serial dilutions (1:10) were spotted per well. Plates were incubated at 30° C. for 3 days for Saccharomyces cerevisiae-Y2H Gold and 5 days for Schizosaccharomyces pombe and imaged with a flatbed scanner.
[0078] Two mL of Luria-Bertani (LB) media (10 g tryptone, 5 g yeast extract, and 10 g NaCl, pH 7) were inoculated with a single colony of TOP 10 cells and incubated overnight at 37° C. Thirty μL of this culture was then used to inoculate 3 mL of LB media containing the chemical. The OD was measured every 30 minutes over 8 hours using a spectrometer.
[0079] MT Polymerization Assay.
[0080] The MT polymerization data was obtained using a polymerization assay kit (Cytoskeleton, Inc. Denver Colo.), employing OD measurements of polymerized tubulin as previously described (Shelanski et al., 1973; Lee and Timasheff, 1977).
[0081] Cellulose Content.
[0082] Etiolated WT Col-0 Arabidopsis thaliana seedlings were grown on AGM containing CESTRIN as described above. Hypocotyls were harvested after 8 days of growth. Cell wall materials were isolated into alcohol insoluble residues (AIR) (Gunl et al., 2010) and cellulose content was estimated using a modified Updegraff method (Updegraff, 1969). Briefly, insoluble trifluoroacetic acid hydrolyzed AIR pellets were quantified using the Anthrone assay as described earlier Viles & Silverman (1949) and Dische (1962).
[0083] Phytophthora Growth
[0084] Phytophtora capsici inoculates were grown in corn agar media supplemented either with DMSO or different concentrations of CESTRIN. After 3 weeks cultures were imaged using flatbed scanner.
Example 1
[0085] CESTRIN affects trafficking of cellulose synthase. Towards a better understanding of the CSCs trafficking, a library of 360 small molecules of pollen germination and endosomal trafficking inhibitors was screened (Drakakaki et al., 2011) for chemicals that specifically alter the localization of CESA in hypocotyls of three day-old etiolated Arabidopsis seedlings. A compound, 1-[2,6-dinitro-4-(trifluoromethyl)phenyl]-2-[6-methyl-4-(trifluoromethyl)pyridin-2-yl]hydrazine, Formula I, was identified that induces distinct and pronounced changes in the localization pattern of CSCs, as shown in
[0086] CSCs are enriched in SYP61 associated compartments upon CESTRIN treatment. The apparent redistribution of CSCs in the cell cortex prompted us to further investigate the identity of CESTRIN bodies. Previous studies have shown that CSCs are partially colocalized with SYP61/VHA-a1 in early endosome/TGN compartments (Crowell et al., 2009; Gutierrez et al., 2009). The presence of CESAs in SYP61 vesicles has been established by proteomic analysis (Drakakaki et al., 2012). Moreover, out of several endosomal/TGN markers previously investigated, SYP61 was shown to partially overlap with cortically tethered SmaCCs (Gutierrez et al., 2009). Hence, the behavior of GFP-CESA3 in relation to SYP61 under CESTRIN treatment was examined. Partial colocalization of the GFP-CESA3 and CFP-SYP61 compartments was observed under DMSO treatment, which was significantly enhanced (˜15%) upon CESTRIN application (p=0.0013, t-test). As previously shown, both SYP61 and SYP41/42 partially overlap with CESA6 under mock treatment, however only SYP61 remains partially colocalized after mannitol treatment (Gutierrez et al., 2009). Our data corroborate the presence of CSCs in SYP61 vesicles, which is increased by CESTRIN treatment.
[0087] Arabidopsis seedlings expressing GFP-CESA3 were grown in the dark for 3 days and imaged by spinning disk confocal microscopy.
[0088] In control, DMSO-treated plants, GFP-CESA3 follows linear trajectories at the PM as shown in
Example 2
[0089] In order to assess the specificity of CESTRIN, a variety of organelle markers and their subcellular localizations were examined in Arabidopsis etiolated hypocotyls. As shown in
[0090] CESTRIN activity and its mode of action is conserved across plants and yeast. In order to evaluate the effect of CESTRIN on different organisms, the growth of bacteria (E. coli) and two species of yeast cells (Saccharomyces cerevisiae and Schizosaccharomyces pombe) was analyzed. Evaluating whether CESTRIN causes a broad growth inhibition, its impact on bacteria (E. coli) was analyzed. As shown in
Example 3
[0091] CESTRIN inhibits cell elongation and reduces cellulose content. CESTRIN inhibits anisotropic growth in Arabidopsis.
[0092] CESTRIN reduces anisotropic cell growth in a concentration dependent manner with an estimated IC.sub.50 of 4.9 μM as shown in
TABLE-US-00002 TABLE 2 CESTRIN treatment significantly reduces cellulose content in Arabidopsis etiolated seedlings Cellulose content, μg/mg AIR Treatment Hypocotyl DMSO 103.7 ± 6.4 CESTRIN (9 μM) 75.3 ± 2.7*
Example 4
[0093] CESTRIN alters the localization velocity of proteins interacting with CSCs GFP-KOR1 and 3×Ypet-POM2/CSI1. CESTRIN treatment induces mislocalization of the CESA interacting proteins POM2/CSI1 and KOR1. Recent studies have shown that the glucanase KOR1 is an integral part of the primary cell wall CSCs at the plasma membrane. Similar to CSCs, its localization pattern follows microtubule reorientation during epidermal cell elongation (Lei et al., 2014b; Vain et al., 2014). Whether CESTRIN affects CESAs or KOR1 in a differential manner was analyzed by comparing the respective localization patterns. Under control conditions, GFP-KOR1-labelled plasma membrane particles migrate along linear trajectories with comparable velocities (average of 220 nm/min) as those observed for GFP-CESAs, as shown in
[0094] Arabidopsis seedlings expressing GFP-KOR1 and 3×Ypet-POM2/CSI1 were grown in the dark for 3 days and imaged by spinning disk confocal microscopy. In
[0095] CESAs involved in primary cell wall biosynthesis are interacting with CSI/POM2, (Gu et al., 2010; Bringmann et al., 2012a); this prompted investigation into the trafficking dynamics of 3×Ypet-POM2 under chemical treatment in relation to CESAs. In control plants the localization pattern of 3×Ypet-POM2 showed distinct punctae that exhibit a directional motility, as shown in
Example 5
[0096] CESTRIN alters MT stability in a mechanism different from oryzalin. Given that CESAs interact closely with MTs, the effect of CESTRIN on MT stability in relation to CESA localization was studied using Arabidopsis seedlings expressing GFP-CESA3/mCherry-TUA5 (Gutierrez et al., 2009). Concurrent with pronounced mislocalizations of GFP-CESA3, CESTRIN treatment induced several marked changes in microtubule organization, including the reduction of clear transverse-oriented cortical arrays in comparison with DMSO-treated controls, as shown in
[0097] The majority of the treated cells featured disordered MT arrays or more diffuse fluorescent patterns (
[0098]
[0099] To further investigate the impacts of CESTRIN on the MT arrays, the localization pattern of the MT end plus binding protein (EB1) (Dixit et al., 2006) was examined. As previously described, GFP-EB1 localizes in distinct foci that dominantly label MT plus ends (
Example 6
[0100] Isoxaben-resistant plants are not cross-resistant to CESTRIN. To determine if CESTRIN has the same mechanism of action, as the well characterized cellulose inhibitor isoxaben, the hypocotyl growth in etiolated seedlings of the isoxaben-resistant CELLULOSE SYNTHASE 3 mutant ixr1-1 was compared with that of WT Col-0 and the CELLULOSE SYNTHASE 6 prc1-1 allele.
[0101] While the hypocotyl growth of ixr1-1 is not reduced under isoxaben treatment (P=0.2), a 62% reduction was observed for CESTRIN treatment (P=8.6×10.sup.−5); however, the reduction was more pronounced for the WT Col-0, exhibiting an 80% reduction (P=0.001). When comparing Col-0 and ixr1-1, the two genotypes showed significantly different responses to the two chemicals (Two-way ANOVA P=4.7×10.sup.−12). In addition, a significantly different response of prc1-1 compared to Col-0 was observed for both chemical treatments (Two-way ANOVA P=0.008). The prc1-1 mutant showed sensitivity to both isoxaben and CESTRIN, however to a lower degree, compared to the growth reduction in the WT Col-0. Taken together, these data establish that isoxaben and CESTRIN are acting on unique targets.
Example 7
[0102] Root growth experiments. For growth analysis, seedlings were germinated on AGM containing the chemicals CESTRIN or analogues solubilized in DMSO and grown vertically in the light for 7 days. When the experiment was complete, the plates were scanned using a flatbed scanner (Epson Perfection V300) and root lengths were measured using the segmented line tool in the image analysis software, ImageJ (Rasband et al., 1997-2014). Results are shown in
Example 8
[0103] CESTRIN inhibits phytophtora capsici growth Phytophthora cultures were grown for 3 weeks in media supplemented with DMSO control or CESTRIN.
[0113] All patents, patent applications, and publications cited herein are hereby incorporated by reference in their entireties.