A COMPOSITION OF PHOTOAUTOTROPHIC MICROORGANISMS AND CHEMOHETEROTROPHIC MICROORGANISMS IN A BIOFILM
20220049210 · 2022-02-17
Inventors
- Rohan KARANDE (Leipzig, DE)
- Ingeborg HEUSCHKEL (Leipzig, DE)
- Katja BÜHLER (Leipzig, DE)
- Anna Hoschek (Leipzig, DE)
- Andreas Schmid (Leipzig, DE)
Cpc classification
C12P17/08
CHEMISTRY; METALLURGY
C12P39/00
CHEMISTRY; METALLURGY
International classification
C12M1/12
CHEMISTRY; METALLURGY
C12P17/08
CHEMISTRY; METALLURGY
C12P39/00
CHEMISTRY; METALLURGY
Abstract
A composition of microorganisms, comprising photoautotrophic microorganisms (16) which produce oxygen by photosynthetic water oxidation chemoheterotrophic microorganisms (17) which respire oxygen, wherein the photoautotrophic microorganisms (16) and the chemoheterotrophic microorganisms (17) are comprised in a biofilm (13), the biofilm further comprising components (15) which were secreted by the photoautotrophic microorganisms (16) and/or the chemoheterotrophic microorganisms (17),
and a reactor (1), a method for forming a biofilm, and a method for biocatalytic conversion employing such composition.
Claims
1. A composition of microorganisms in a biofilm, comprising: photoautotrophic microorganisms which produce oxygen by photosynthetic water oxidation and chemoheterotrophic microorganisms which respire oxygen, wherein the photoautotrophic microorganisms and the chemoheterotrophic microorganisms are comprised in the biofilm, the biofilm further comprising components which were secreted by the photoautotrophic microorganisms and/or the chemoheterotrophic microorganisms.
2. The composition of claim 1, wherein the photoautotrophic microorganisms and/or the chemoheterotrophic microorganisms are capable of catalyzing the conversion of a substrate into a product.
3. The composition of claim 2, wherein in case of the chemoheterotrophic microorganisms the substrate is a substrate which is not naturally metabolized by the chemoheterotrophic microorganisms, wherein the ability of converting the substrate was introduced into the chemoheterotrophic microorganisms by genetic modification.
4. The composition of claim 2, wherein in case of the photoautotrophic microorganisms the substrate is a substrate which is not naturally metabolized by the photoautotrophic microorganisms, wherein the ability of converting the substrate was introduced into the photoautotrophic microorganisms by genetic modification.
5. The composition of claim 1, wherein the photoautotrophic microorganisms are algae and/or cyanobacterium.
6. The composition of claim 1, wherein the photoautotrophic microorganisms are from the genus Synechocystis.
7. The composition of claim 1, wherein the chemoheterotrophic microorganisms are bacteria.
8. The composition of claim 1, wherein the chemoheterotrophic microorganisms are from the genus Pseudomonas.
9. The composition of claim 1, wherein the biofilm is adhered to a surface of a carrier.
10. The composition of claim 1, wherein the carrier is a flat carrier, a tube or a capillary.
11. The composition of claim 1, wherein the thickness of the biofilm is from about 10 μm to about 500 μm.
12. A reactor, comprising the composition of claim 1, wherein the biofilm extends along a surface of the reactor.
13. The reactor of claim 12, wherein the reactor is a capillary reactor comprising at least one capillary member made from a translucent material, and wherein the biofilm adheres to an inner surface of an at least one capillary member.
14. A method for producing a composition according to claim 1, the method comprising: cultivating a mixture of photoautotrophic microorganisms and chemoheterotrophic microorganisms on a surface.
15. The method of claim 14, further comprising: exposing the mixture to light.
16. The method of claim 14, further comprising: adding a substrate which is naturally metabolized by the chemoheterotrophic microorganisms.
17. The method of claim 14, wherein cultivating is done in a capillary reactor on a surface of a capillary member, the method further comprising: passing segments of a gaseous phase and segments of at least one of a liquid phase through the capillary member, wherein segments of a gaseous phase and segments of the at least one of a liquid phase flow through the capillary member in alternatingly fashion.
18. A method for reacting a substrate to a product, comprising: providing a reactor according to claim 12, contacting the composition with the substrate, exposing the composition to light, and reacting the substrate to obtain a product.
19. The method of claim 18, further comprising: adding a further substrate which is naturally metabolized by the chemoheterotrophic microorganisms.
20. The method of claim 18, wherein the reactor is a capillary reactor comprising a capillary member, the method further comprising passing segments of a gaseous phase and segments of at least one of a liquid phase through the capillary member, wherein: segments of a gaseous phase and segments of the at least one of a liquid phase flow through the capillary member in alternatingly fashion, the gaseous phase and/or the liquid phase comprises the substrate, and, if used, the further substrate, and the gaseous phase and/or the liquid phase takes up the product, and optionally oxygen that is produced by the photoautotrophic microorganisms.
21. (canceled)
22. The composition of claim 2, wherein the substrate is an organic compound.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0209] Reference Symbols in the Figures are explained in the List of Reference Symbols.
[0210]
[0211] (A) Top: Scheme of a segmented-flow capillary reactor. Bottom: Basic principle of proto-cooperation between two microbial species with complementary metabolic activities (chemoheterotrophic and photoautotrophic). Cells of both species are embedded in extracellular polymeric substances and form a three-dimensional biofilm on the inner surface of the capillary. O.sub.2 respiration (chemoheterotrophic strain) and O.sub.2 evolution (photoautotrophic strain) balance the O.sub.2 environment.
[0212] (B) Microscopic image of a mixed-species biofilm containing Synechocystis sp. PCC 6803_Km (Syn_Km) and Pseudomonas VLB120_Km (Ps_Km), harvested from a capillary reactor. Scale bar equal to 10 μm. (C) Pictures of capillary reactors taken five weeks after inoculation. Syn_Km=Synechocystis sp. PCC 6803_Km, Ps_Km=Pseudomonas VLB120_Km, w/o=without
[0213]
[0214] (A) Scheme of biofilm-based capillary reactor.
[0215] (B) Schematic representation of proto-cooperation and cyclohexane oxidation reaction within mixed-species biofilm containing Synechocystis sp. PCC 6803_CHX and Pseudomonas sp. VLB120_CHX.
[0216] (C) Demonstrating application of the concept looking at continuous cyclohexanol production at the capillary outlet. The activity is depending on the availability of light.
[0217]
[0218] (A) Scheme of biofilm-based tubular capillary reactor.
[0219] (B) Schematic representation of proto-cooperation and cyclohexanone conversion to ε-caprolactone reaction within mixed-species biofilm containing Synechocystis sp. PCC 6803_alkBGT and Pseudomonas sp. VLB120_CHXON.
[0220] (C) Demonstrating application of the concept looking at continuous cyclohexanone conversion to ε-caprolactone at the capillary outlet.
[0221]
[0222] Technical setup of a segmented flow biofilm capillary reactor system.
BRIEF DESCRIPTION OF THE SEQUENCES IN THE SEQUENCE LISTING
[0223] SEQ ID NO: 1 Primer PAH091 used in plasmid construction during cloning;
[0224] SEQ ID NO: 2 Primer PAH092 used in plasmid construction during cloning;
[0225] SEQ ID NO: 3 Primer PAH093 used in plasmid construction during cloning;
[0226] SEQ ID NO: 4 Primer PAH094 used in plasmid construction during cloning;
[0227] SEQ ID NO: 5 Primer PAH077 used in plasmid construction during cloning;
[0228] SEQ ID NO: 6 Primer PAH078 used in plasmid construction during cloning.
EXAMPLES
[0229] 1. Methods
[0230] Chemicals
[0231] All chemicals used in this invention were purchased in the highest purity available from Carl-Roth GmbH (Karlsruhe, Germany), Merck (Darmstadt, Germany) or Sigma-Aldrich (Steinheim, Germany) and applied without any further purification.
[0232] Bacterial Strains and Plasmids
[0233] All strains and plasmids used in this method
TABLE-US-00001 # Description Ref Strains 1 Pseudomonas sp. Wild-type Pseudomonas; styrene prototroph [1] VLB120 2 Ps_Km Strain #1 harboring pRSF_Ptrc1O: Term This (plasmid #10) invention 3 Ps_CYP strain #1 harboring pCom10_CYP This (plasmid #11) invention 4 Ps_BVMO strain #1 harboring pRSF_Ptrc1O: BVMO This (plasmid #15) invention 5 Synechocystis sp. Geographical origin: California, USA; [2] PCC 6803 Received from Pasteur Culture Collection of Cyanobacteria (PCC, Paris, France) 6 Syn6803_Km Strain #5 harboring pRSF_Ptrc1O: Term This (plasmid #10) invention 7 Syn_CYP strain #5 harboring pRSF_Ptrc1O: CYP This (plasmid #12) invention 8 Syn_BGT Strain #5 harboring pRSF_Ptrc1O: BGT [6] 9 E. coli DH5α Cloning strain; genomic markers: F.sup.− Invitrogen ϕ80IacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17 (rK.sup.−, mK.sup.+) phoA supE44 λB.sup.− thi.sup.−1 gyrA96 relA1 Plasmids 10 pRSF _ Ptrc1O: Term pPMQAK1 based, RSF, P.sub.mpB: lacl, P.sub.trc1O: Term, [6] empty cloning vector 11 pCom10_CYP pCom10 derivative, with genes encoding for [3] CypP450 monooxygenase (CHX), ferredoxin reductase (FdR), ferredoxin (Fd), from Acidovorax CHX100 12 pRSF_Ptrc1O: CYP pPMQAK1 derivative, containing the P.sub.trc1O as well This as lacl promoter controlling the expression of invention CYP (Cytochrome P450 enzyme), ferredoxin (Fd) and ferredoxin reductase (FdR), from Acivodorax CHX100 13 pCom10_capro pCom10 derivative, with genes encoding for [4] CypP450 monooxygenase (CHX), ferredoxin reductase (FdR), ferredoxin (Fd), cyclohexanone monooxygenase (CHXON) and cyclohexanol dehydrogenase (CDH) from Acidovorax CHX100 14 pSB1AC3_Ptrc1O: pMB1, biobrick #BBa_B0015 terminator sequence [5] GFPm ut3B 15 pRSF_Ptrc1O: BVMO originating from Acidovorax sp. CHX100 This BVMO (=pAH49) under control of P.sub.trc1O promoter, with optimized invention ribosomal binding site RBS* in front of BVMO with C-terminal Strep-tag II 16 pRSF_Ptrc1O: AlkBGT (alkane monooxygenase AlkB, [6] BGT (=pAH042) rubredoxin AlkG and rubredoxin reductase AlkT) originating from Pseudomonas putida GPo1 under control of P.sub.trc1O promoter, with optimized ribosomal binding site RBS* in front of each gene with C-terminal Strep-tag II
[0234] Construction of Plasmids
[0235] Plasmid construction was based on standard cloning procedures. E. coli DH5a was used for cloning purposes. Overnight cultures were inoculated from cryo-stock and grown in LB medium at 30° C. and 180 rpm (2.5 cm amplitude)..sup.[4] Primers used in this work are listed in the table below and were obtained from Eurofins Genomics (Ebersberg, Germany). The cloning strategy for constructing the plasmid pRSF_Ptrc1O:CYP and pRSF_Ptrc1O:BVMO is described below. Transformation of Synechocystis sp. PCC 6803 with the respective plasmids was performed by electroporation as described in Hoschek et al. 2017..sup.[6]
TABLE-US-00002 Primer used during cloning; binding region, overlap to vector, scar, RBS*, , StrepTagII Primer# Function Sequence PAH091 BVMO fwd TGAGCGGATAACAATTTCACACATACTAGAGTAGTGGAGGTTACTA GATGAAAAAAACCCAACATCTGG PAH092 BVMO rev TCGTTTTATTTGATGCCTGGCTGCA
TTTTTCGAACTGCGGGTG GCTCCAAGCGCTCTGGAATACGAAACCCTCG PAH093 CYP fwd TGAGCGGATAACAATTTCACACATACTAGAGTAGTGGAGGTTACTA GATGACTCAGACTGCTGCGGC PAH094 CYP rev CTTTCGTTTTATTTGATGCCTGGTATCAGTGCTGCCCTTGCG PAH077 Term fwd GGGAGGTATTGGACCGCATTGAACTCTAGTATATAAACGCAGAAAG GCCC PAH078 Term rev ACGAGCCGGATGATTAATTGTCAATCTAGAGCCAGGCATCAAATAA AACG
[0236] Construction of pRSF_Ptrc1O:CYP [0237] Restriction: pRSF_Ptrc1O:Term with SpeI [0238] Amplification: CYP from pCom10_capro (PAH093+PAH094.fwdarw.2970 BP, TAn: 72° C., tElong: 60 sec) [0239] Gibson assembly: pRSF_Ptrc1O:Term (SpeI)+CYP.fwdarw.pRSF_Ptrc1O:CYP_pre (without Termcentral) Restriction: pRSF_Ptrc1O:CYP_pre with XbaI [0240] Amplification: Term from pSB1AC3_Ptrc1O:GFPmut3B (PAH077+PAH087.fwdarw.191 BP, TAn: 60° C., tElong: 5 sec) [0241] Gibson assembly: pRSF_Ptrc1O:CYP_pre (XbaI)+Term.fwdarw.pRSF_Ptrc1O:CYP
[0242] Construction of pRSF_Ptrc1O:BVMO Plasmid [0243] Restriction: pRSF_P.sub.trc1O:Term with SpeI [0244] Amplification: BVMO from pCom10_capro (PAH091+PAH092.fwdarw.1689 BP, T.sub.An: 72° C., t.sub.Elong: 45 sec) [0245] Gibson assembly: pRSF_Ptrc1O:Term (SpeI)+BVMO.fwdarw.pRSF_P.sub.trc1O:BVMO_pre (without Term.sub.central) [0246] Restriction: pRSF_P.sub.trc1O:BVMO_pre with XbaI [0247] Amplification: Term from pSB1AC3_Ptrc1O:GFPmut3B (PAH077+PAH087.fwdarw.191 BP, T.sub.An: 60° C., t.sub.Elong: 5 sec) [0248] Gibson assembly: pRSF_P.sub.trc1O:BVMO_pre (XbaI)+Term.fwdarw.pRSF_P.sub.trc1O:BVMO
[0249] Mixed Species Biofilm Cultivation in Capillary Reactors Harboring Pseudomonas VLB120 and Synechocystis PCC 6803
[0250] Pre-Cultivation of Syn6803_Km
[0251] Pre-cultures of Syn6803_Km were grown in YBG11 medium: 1.49 g L.sup.−1 NaNO.sub.3, 0.074 g L.sup.−1 MgSO.sub.4.7 H.sub.2O, 0.305 g L.sup.−1 K.sub.2HPO.sup.4, 10 mL L.sup.−1 YBG11 trace elements (100×), 0.019 g L.sup.−1 Na.sub.2CO.sub.3, 50 mM HEPES (pH 7.2); YBG11 trace elements (100×): 0.36 g L.sup.−1 CaCl.sub.2.2 H.sub.2O, 0.28 g L.sup.−1 boric acid, 0.11 g L.sup.−1 MnCl.sub.2.4 H.sub.2O, 0.02 g L.sup.−1 ZnSO.sub.4.7 H.sub.2O, 0.039 g L.sup.−1 Na.sub.2MoO.sub.4.2 H.sub.2O, 0.007 g L.sup.−1 CuSO.sub.4.5 H.sub.2O, 0.003 g L.sup.−1 Co(NO.sub.3).sub.2.6 H.sub.2O, 0.1 g L.sup.−1 FeCl.sub.3.6 H.sub.2O, 0.6 g L.sup.−1 Na.sub.2EDTA 2 H.sub.2O, 4.2 g L.sup.−1 NaHCO.sub.3, supplemented with 50 μg/mL kanamycin as antibiotic selection marker.
[0252] Pre-cultures were inoculated in 20 mL medium in a 100 mL baffled shake flask using 200 μL of cryo-stock and cultivation was carried out at 30° C., 50 μmol m.sup.−2 s.sup.−1 (LED), ambient CO.sub.2 (0.04%), 150 rpm (2.5 cm amplitude), and 75% humidity in an orbital shaker (Multitron Pro shaker, Infors, Bottmingen, Switzerland) for 4 days. From this pre-culture, main-cultures were inoculated starting with an OD.sub.750 of 0.08 and cultivation was continued for another 4 days.
[0253] Pre-Cultivation of Ps_Km
[0254] Overnight cultures of Ps_Km were inoculated from a cryo-stock using 5 mL LB medium and grown at 30° C. and 200 rpm (2.5 cm amplitude) in an orbital shaker (Multitron Pro shaker, Infors, Bottmingen, Switzerland)..sup.[4] Pre-cultures were inoculated by adding 200 μL of this overnight-culture to 20 mL M9 medium (5 g L.sup.−1 citrate, US* trace elements) and growth was continued for 24 h..sup.[7] Main-cultures were grown for 8 h in 50 mL M9 medium (5 g L.sup.−1 citrate, US* trace elements) in 250 mL baffled shake flasks starting with an OD.sub.450 of 0.2.
[0255] Pre-Mixing of Bacterial Strains
[0256] 20 mL of each main culture (Syn_Km and Ps_Km) were centrifuged (5000 g, room temperature, 7 min), washed in 20 mL YBG11 (w/o citrate, 50 mM NaHCO.sub.3) and resuspended in 40 mL YBG11 medium (supplemented with 50 mM NaHCO.sub.3 to ensure sufficient carbon supply). Optical densities after resuspension were OD.sub.750=2.3 and OD.sub.450=2.3, respectively. 50 mL of Syn6803_Km were mixed with 50 mL of Ps_Km in a 500 mL baffled shake flask and cultivation was continued at 30° C., 50 μmol m.sup.−2 s.sup.−1 (LED), ambient CO.sub.2 (0.04%), 150 rpm (2.5 cm amplitude), and 75% humidity in an orbital shaker (Multitron Pro shaker, Infors, Bottmingen, Switzerland) for 24 h. 10 mL of each single species control cultures were mixed with 10 mL of YBG11 medium (50 mM NaHCO.sub.3) in a 100 mL baffled shake flask.
[0257] For biofilm cultivation, a capillary reactor 1 system adapted from David et al. 2015 was applied (analogous to
[0258] Instead of the shown reactor design, reactor designs shown and described in WO 2012/152337 A1, particularly FIG. 1-5 of WO 2012/152337 A1, may be used.
[0259] Inoculation of Capillary Reactor System
[0260] The capillaries of the reactor system were inoculated with single and mixed species cultures, respectively, by purging with ca. 5 mL of each culture through the capillaries. Medium flow was started 15-18 h after inoculation at a rate of ˜55 μL min.sup.−1. If indicated, air segments were introduced 6-9 days after inoculation at a rate of ˜55 μL min.sup.−1, resulting in an increased overall flow rate of ˜110 μL min.sup.−1 in these tubes.
[0261] Light Spectra
[0262] Light spectra of applied light sources (LED in orbital shakers and fluorescence light-tubes in tubular capillary reactor setup) are given in Hoschek et al. 2017..sup.[6]
[0263] Cultivation in the Capillary Reactor System without Organic Carbon Source
[0264] The mixed trophies biofilm consisting of Syn6803_Km and Ps_Km were supplied continuously with YBG11 medium supplemented with 50 mM NaCO.sub.3 and 50 mg/L kanamycin as selection marker.
[0265] Cultivation Supplying Citrate as an Organic Carbon Source
[0266] Supplying citrate as organic carbon source during cultivation will facilitate Ps_Km growth. In such experiments, YBG11 medium was supplemented with 50 mM NaCO3, 50 mg/L kanamycin and 0.4 g/L citrate as organic carbon source.
[0267] Mixed Species Biofilm Cultivation in Capillary Reactors Harboring Ps_CYP and Syn_CYP Producing Cyclohexanol from Cyclohexane
[0268] Pre-Cultivation of Synechocystis sp. PCC 6803 with pRSF_Ptrc1O:CYP (Syn_CYP) and Pseudomonas sp. VLB120 with pCom10 CYP (Ps_CYP)
[0269] Cultures of Synechocystis sp. PCC 6803 with pRSF_Ptrc1O:CYP (Syn_CYP) and Pseudomonas sp. VLB120 with pCom10_CYP (Ps_CYP) were grown separately in YBG11 as described above.
[0270] Pre-Mixing of Ps_CYP and Syn_CYP and Inoculation of the Capillary Reactor
[0271] For the inoculation of the mixed species biofilm both species have been mixed as described above and subsequently the capillary reactor was inoculated with the mixed trophies culture.
[0272] Cyclohexanol Production Utilizing Mixed Trophies Biofilms of Ps_CYP and Syn_CYP in Capillary Reactors
[0273] Gene expression of cyp in Syn_Cyp was induced after 21 days of cultivation by the addition of 2 mM IPTG supplied with the YBG11 medium. At day 22, cyclohexane feed was started. Cyclohexane, the substrate for the biotransformation, was delivered via air phase. The air flow was passed through a silicone tube, dipped into liquid cyclohexane allowing the cyclohexane to diffuse through the silicone tube into the air stream. The biotransformation was started with an equal ratio of medium (51 μL/min) and air flow and the product formed was measured at the outflow.
[0274] After 20 days of biotransformation, the light was turned off for 24 h and subsequently turned on again for 48 h. This process of tuning light off for 24 h was repeated once again.
[0275] Quantification of Cyclohexane and Cyclohexanol Using Gas Chromatography (GC)
[0276] For substrate (cyclohexane) and product (cyclohexanol) quantification in the liquid phase, reactor outflow was collected. 900 μL of sample were mixed with 900 μL of ice-cold ether, vortexed for 2 min, and centrifuged (17,000 g, 2 min, room temperature (rt)). The ether phase was removed and dried over anhydrous Na.sub.2SO.sub.4 and analyzed by gas chromatography.
[0277] In addition, cyclohexane was quantified in the gas phase. Headspace samples of the gas phase were collected in a bubble trap and manually applied to GC analysis using a Hamilton gas-tight syringe.
[0278] GC Method
[0279] Reactants were quantified using gas chromatography (GC Trace 1310, Thermo Fisher Scientific, Waltham, USA) equipped with a TG-5MS capillary column (5% diphenyl/95% dimethyl polysiloxane, 30 m, I.D.: 0.25 mm, film thickness: 0.25 μm, ThermoFisher Scientific, Waltham, USA) and a flame ionization detector (FID) operating at 320° C., 350 mL min.sup.−1 air flow, 30 mL min.sup.−1 makeup gas flow and 35 mL min.sup.−1 hydrogen gas flow. Nitrogen gas was applied as a carrier gas with a constant flow of 1.5 mL min.sup.−1.
[0280] Liquid- and gas-sample injection volumes were 1 μL and 100 μL, respectively. The PTV inlet was programmed with a temperature gradient of 10° C. s.sup.−1 from 90-300° C. A split ratio of 11 was applied. The temperature profile of the oven was set to: 1) 40° C. for 1 min, 2) 40-80° C. with 10° C. min-1, 3) 80-250° C. with 100° C. min-1, and 4) 250° C. for 2 min for both sample types.
[0281] Mixed Species Biofilm Cultivation in Capillary Reactors Harboring Ps_BVMO and Syn_BGT Producing Caprolactone from Cyclohexanone
[0282] Pre-Cultivation of Synechocystis sp. PCC 6803 with pRSF_Ptrc1O:BGT (Syn_BGT) and Pseudomonas sp. VLB120 with pRSF_Ptrc1O:BVMO (Ps_BVMO)
[0283] Cultures of Synechocystis sp. PCC 6803 with pRSF_Ptrc1O:BGT (Syn_BGT) and Pseudomonas sp. VLB120 with pRSF_Ptrc1O:BVMO (Ps_BVMO) were grown separately in YBG11 as described above.
[0284] Pre-Mixing of Ps_BVMO and Syn_BGT and Inoculation of the Capillary Reactor
[0285] For the inoculation of the mixed species biofilm both species have been mixed as described above and subsequently the capillary reactor was inoculated with the mixed trophies culture.
[0286] ε-Caprolactone Production Utilizing Mixed Trophies Biofilms of Syn_BGT and Ps_BVMO in Capillary Reactors
[0287] After 15 days of cultivation gene expression of bvmo was induced using 2 mM of IPTG supplied with the YBG11 medium. After 24 hours of induction the substrate cyclohexanone was added to the YBG11 medium (5 mM) and was constantly supplied with the feed.
[0288] Quantification of Cyclohexanone and Caprolactone Using Gas Chromatography (GC)
[0289] After 12 minutes of sampling, 600 μL of the outflow from the capillary reactor were mixed with 600 μL of ice-cold diethyl ether (containing 0.2 mM decane as internal standard) and extraction of cyclohexanone and caprolactone in the ether phase was supported by vortexing and subsequent centrifugation (17000 g, 5 min, rt). The ether phase was dried over anhydrous Na.sub.2SO.sub.4 and subjected to gas chromatography (GC Trace 1310, Thermo Fisher Scientific, Waltham, USA) equipped with a TG-5MS capillary column (5% diphenyl/95% dimethyl polysiloxane, 30 m, I.D.: 0.25 mm, film thickness: 0.25 μm, ThermoFisher Scientific, Waltham, USA) and a flame ionization detector (FID) operating at 320° C., 350 mL min.sup.−1 air flow, 30 mL min.sup.−1 makeup gas flow and 35 mL min.sup.−1 hydrogen gas flow. Nitrogen gas was applied as carrier gas with a constant flow of 1.5 mL min.sup.−1. The injection volume was set to 1 μL using a PTV injector, programmed with a temperature gradient of 10° C. s.sup.−1 from 90-300° C. A split ratio of 11 was applied. The oven temperature profile was: 1) 40° C. for 3 min, 2) 40-170° C. with 15° C. min.sup.−1, 3) 170-300° C. with 100° C. min.sup.−1, and 4) 300° C. for 1 min.
REFERENCES (METHOD SECTION ONLY)
[0290] [1] M. G. Panke, S; Witholt, B; Schmid, A; Wubbolts, “Towards a biocatalyst for (S)-styrene oxide production: characterization of the styrene degradation pathway of Pseudomonas sp. strain VLB120,” Appl Env Microbiol 1998; 64:2032-2043. [0291] [2] R. Y. Stanier, R. Kunisawa, M. Mandel, and G. Cohen-Bazire, “Purification and properties of unicellular blue-green algae (Order Chroococcales),” Bacteriol Rev 1971; 35:171-205. [0292] [3] R. Karande et al., “Continuous cyclohexane oxidation to cyclohexanol using a novel cytochrome P450 monooxygenase from Acidovorax sp. CHX100 in recombinant P. taiwanensis VLB120 biofilms,” Biotechnol Bioeng 2016; 113:52-61. [0293] [4] T. Sambrook, J and Russell, D W and Maniatis, Molecular cloning. 2001. [0294] [5] A. David, C.; Buhler, K.; Schmid, “Stabilization of single species Synechocystis biofilms by cultivation under segmented flow,” J Ind Microbiol Biotechnol 2015; 42:1083-1089. [0295] [6] A. Hoschek, A.; Buhler, B.; Schmid, “Overcoming the Gas-Liquid Mass Transfer of Oxygen by Coupling Photosynthetic Water Oxidation with Biocatalytic Oxyfunctionalization,” Angew Chemie Int Ed 2017; 56:15146-15149. [0296] [7] Emmerling, M., et al., Metabolic flux responses to pyruvate kinase knockout in Escherichia coli. J Bacteriol 2002; 184:152-164.
[0297] 2. Results Part 1—Mixed Species Biofilm Cultivation in Capillary Reactors Harboring Pseudomonas sp. VLB120 and Synechocystis sp. PCC 6803
[0298] To validate the technique of co-cultivating mixed-trophies biofilms in a capillary reactor, the two model strains Synechocystis sp. PCC 6803 and Pseudomonas sp. VLB120 were applied carrying a kanamycin resistance cassette, resulting in Syn6803_Km and Ps_Km, respectively. Both strains were pre-grown separately in shake flasks and subsequently mixed in a ratio of 1:1 (based on optical density) before inoculation of the capillary reactor. Serological pipettes (1.2 mL tube volume, 16.6 cm length, 3 mm inner diameter) functioned as light-transmissive capillary reactors for biofilm growth. The system was kept idle for 15 h to allow cell attachment before a constant medium flow of 55 μL min.sup.−1 through the capillaries was applied. The supplied YBG11 medium was supplemented with 50 mM NaHCO.sub.3, providing sufficient inorganic carbon (CO.sub.2) for Syn_Km growth. The principle of proto-cooperation was examined by measuring the O.sub.2 concentration in the liquid and gas phase, as well as citrate consumption. Cultivation was conducted for five weeks until the cultivation system was actively terminated and characterized regarding photo-pigment formation (macroscopic), bio-volume of each species (cell number and cell volume), and total biofilm dry weight (Table 1).
[0299] Four experimental setups, with and without citrate as an organic carbon source, and in the presence or absence of air segments were operated (
[0300] Mixed species biofilm (Syn_Km and Ps_Km)
[0301] i) without citrate/without air segments
[0302] ii) without citrate/with air segments
[0303] iii) 0.4 g/L citrate/without air segments
[0304] iv) 0.4 g/L citrate/with air segments
[0305] Single species biofilm as controls
[0306] v) Syn_Km without citrate/without air segments
[0307] vi) Syn_Km without citrate/with air segments
[0308] vii) Syn_Km 0.4 g/L citrate/without air segments
[0309] viii) Syn_Km 0.4 g/L citrate/with air segments
[0310] ix) Ps_Km 0.4 g/L citrate/without air segments
[0311] x) Ps_Km 0.4 g/L citrate/with air segments
[0312] Cultivation without Organic Carbon Source
[0313] Cultivating the biofilm only with inorganic carbon (NaHCO.sub.3), supports mainly the growth of the photoautotrophic strain. After five weeks of cultivation without air segments, the capillary was unevenly coated with cyanobacterial biofilm. Most of the biomass was located in the first part of the capillary (
[0314] The application of air segments clearly promoted biofilm formation resulting in a lush green biofilm throughout the length of the capillary (
[0315] Cultivation Supplying Citrate as an Organic Carbon Source
[0316] Supplying citrate as organic carbon source during cultivation will facilitate Ps_Km growth, while Syn_Km cells deliver O.sub.2 from photosynthetic water oxidation. After five weeks of cultivation in YBG11 medium supplemented with citrate, the capillaries were thoroughly coated with rich green biofilm (
[0317] Upon the addition of air segments, the citrate uptake rate increased and no residual citrate could be detected in the outflow of the reactor (Civ). Furthermore, O.sub.2 was stripped to the gas phase and increased oxygen partial pressure in the air segments by ˜3% in comparison to the Ps_Km single species (Cx). It seems as if the absence of air segments in this particular setting is beneficial for the development of Pseudomonas sp. VLB120 (Ciii). Introducing air segments leads to high fluidic and interfacial stresses in the capillary, which in turn might require more energy for Pseudomonas maintenance (Ciii).
TABLE-US-00003 TABLE 1 Quantitative data obtained from single and mixed species biofilm cultivation in a tubular capillary reactor. Syn. = Syn6803_Km, Ps. = Ps_Km, Mixed sp. = Co-culture of Syn6803_Km and Ps_Km, −Citrate = without organic carbon source, +Citrate = with 0.39 g L.sup.−1 citrate as carbon source, −Air = without air segments, +air = with air segments. O.sub.2 in O.sub.2 in Citrate Biovolume .sup.[2, 3, 4]/ Biofilm gas phase/ aq. phase .sup.[1]/ consumption/ mm.sup.3 mL.sup.−1 dry weight .sup.[3]/ Experimental setup % μM g L.sup.−1 Ps. Syn. g L.sup.−1 Mixed sp. −Air — 922 — 0.1 8.4 6 −Citrate +Air 24.1 — — 0.3 45 32 Mixed sp. −Air — 0 0.27 6.4 36 48 +Citrate +Air 16.3 — 0.39 1.5 17 19 Single Syn. −Air — 745 — — 1.4 2 −Citrate +Air 23.9 — — — 19 14 Single Syn. −Air — 993 0 — 1.4 1 +Citrate +Air 23.6 — 0 — 2.7 3 Single Ps. −Air — 0 0.03 0.3 — 1 +Citrate +Air 13.4 — 0.38 1.6 — 5 .sup.[1] Solubility of O.sub.2 (at 26° C., salinity of 3.5 g kg.sup.−1): ~250 μM (21% O.sub.2) and ~1190 μM (100% O.sub.2) .sup.[2] based on cell number and cell volume measured by Coulter Counter .sup.[3] based on 1.2 mL tube volume .sup.[4] a fraction of 0.2 mm.sup.3 mL.sup.−1 measured by Coulter Counter was attributed to elongated Ps_Km cells after microscopic analysis
[0318] Discussion/Conclusion of Results Part 1
[0319] The heterotrophic biocatalyst Pseudomonas sp. VLB120 was already investigated in several studies for the continuous production of chemicals in biofilm capillary reactors (Gross, R. et al., Biotechnol. Bioeng. 105, 705-717 (2010); Karande, R. et al., Org. Process Res. Dev. 20, 361-370 (2016)). In contrast, phototrophic organisms show biofilm formation mainly in wastewater treatment plants (Barros, A. C. et al., J. Appl. Phycol., 1-13 (2018)), whereas the cyanobacterial model strain Synechocystis sp. PCC 6803 was recently applied for studying the biofilm formation in capillaries (David, C. et al., J. Ind. Microbiol. Biotechnol. 42, 1083-1089 (2015)).
[0320] In this invention, co-cultivation of the two species significantly enhanced biofilm formation in comparison to the cultivation as single species. [0321] i) In a mixed trophies biofilm it was possible to cultivate the photoautotrophic Synechocystis sp. PCC 6803 over a time-period of five weeks to a high cell density of max. 48 g.sub.BDW L.sup.−1. [0322] ii) Growth of the heterotroph aerobe Pseudomonas sp. VLB120 was 20 times enhanced solely due to the in situ supply of O.sub.2 originating from the photosynthetic water oxidation of the co-cultured cyanobacterium.
[0323] This approach is based on proto-cooperation, which is the beneficial, but not essential, interaction of organisms resulting in e.g., enhanced growth. It is a simple way to operate high cell density biofilm capillary reactors for various biocatalytic applications in a continuous mode. The method allows high cell density cultivation of photoautotrophs, which is currently a key-bottleneck in photo-biotechnology. Furthermore, coupling photosynthetic O.sub.2 generation with bacterial respiration in a biofilm capillary reactor extends the process boundary of O.sub.2-limited bioprocesses.
[0324] This concept now awaits the implementation of biocatalytically active strains and scale-up for the eco-efficient production of chemicals. Next to biocatalytic applications, mixed-trophies biofilms could be a valuable tool for other research fields, such as bioremediation or ecotoxicology.
[0325] 3. Results Part 2—Mixed Species Biofilm Cultivation in Capillary Reactors Harboring Ps_CYP and Syn_CYP Producing Cyclohexanol from Cyclohexane
[0326] A scheme of biofilm-based tubular capillary reactor is shown in
[0327]
[0328]
[0329] Moreover,
[0330] 4. Results Part 3—Mixed Species Biofilm Cultivation in Capillary Reactors Harboring Ps_BVMO and Syn_BGT Producing Caprolactone from Cyclohexanone
[0331] A scheme of the biofilm-based capillary reactor is shown in
[0332]
[0333] In
[0334] a mixed species, without citrate/without air segments
[0335] b mixed species, without citrate/with air segments
[0336] c mixed species, 0.1 g/L citrate/without air segments
[0337] d mixed species, 0.1 g/L citrate/with air segments
[0338] e mixed species, 0.5 g/L citrate/without air segments
[0339] f mixed species, 0.5 g/L citrate/with air segments
[0340] g mixed species, 5 g/L citrate/without air segments
[0341] h mixed species, 5 g/L citrate/with air segments
[0342]
LIST OF REFERENCE SYMBOLS
[0343] 1 reactor (system) [0344] 2 capillary member [0345] 3 pump [0346] 4 T-connector [0347] 5 light source [0348] 6 filter [0349] 7 medium inlet [0350] 8 medium outlet [0351] 9 bubble trap [0352] 10 capillary member; tubular capillary reactor; carrier [0353] 11 air [0354] 12 medium [0355] 13 biofilm [0356] 14 segments of a gaseous phase: air segments [0357] 15 components of biofilm: extracellular polymeric substances [0358] 16 photoautotrophic microorganisms: cyanobacterial cells [0359] 17 chemoheterotrophic microorganisms: Pseudomonas cells [0360] 18 light [0361] 19 air+substrate cyclohexane (CHX) [0362] 20 aqueous medium+substrate cyclohexanone [0363] 21 segments of liquid phase