METHOD AND PRODUCTS FOR PRODUCING FUNCTIONALISED SINGLE STRANDED OLIGONUCLEOTIDES

Abstract

The present invention relates to functionalized single stranded oligonucleotides and in particular to a method for producing functionalized single stranded oligonucleotides comprising: (a) providing a circular DNA molecule comprising an oligonucleotide sequence bordered by cleavage domains; (b) performing a rolling circle amplification (RCA) reaction with the circular DNA molecule of (a) as a template and one or more functionalized nucleotides (dNTPs); and (c) enzymatically cleaving the product of the RCA reaction at the cleavage domains to release the single stranded functionalized oligonucleotides.

Claims

1. A method for producing single stranded functionalized oligonucleotides, said method comprising: (a) providing a circular DNA molecule comprising an oligonucleotide sequence bordered by cleavage domains; (b) performing a rolling circle amplification (RCA) reaction with the circular DNA molecule of (a) as a template and one or more functionalized nucleotides (dNTPs); and (c) enzymatically cleaving the product of the RCA reaction at the cleavage domains to release the single stranded functionalized oligonucleotides.

2. The method of claim 1, wherein the circular DNA molecule is double stranded and wherein the method comprises an additional step of cleaving a single strand of the circular DNA molecule to provide an RCA template, before the RCA reaction is performed.

3. The method of claim 1, wherein the functionalized dNTPs are selected from the group consisting of: nucleotides comprising an alkyne group, fluorescently labeled nucleotides, nucleotides comprising a sterol group, nucleotides comprising a polyether group, nucleotides comprising a metal complex, nucleotides comprising a vinyl group, nucleotides comprising a thiol group, thionated nucleotides, nucleotides modified to have increased nuclease resistance, nucleotides comprising a chemical group capable of participating in a click chemistry reaction, and nucleotides that affect the thermostability of the oligonucleotide.

4. The method of any one of claim 1, wherein the functionalized dNTPs are nucleotides comprising an alkyne group, an alkene group, an azide group, a halogen group, an O-methyl group, a locked ribose sugar, preferably wherein the functionalized dNTPs are nucleotides comprising an alkyne group, a vinyl group or an azide group.

5. The method of claim 4, wherein the method further comprises a step of conjugating a molecule or component to the oligonucleotide via the alkyne, vinyl or azide group.

6. The method of claim 5, wherein the molecule or component is selected from the group consisting of: a fluorophore, a sterol, a polyether, a metal complex, molecule containing a thiol group, a molecule containing a group providing increased nuclease resistance and a molecule containing a group capable of participating in a click chemistry reaction.

7. The method of claim 1, wherein the cleavage domains (i) are directly adjacent to the oligonucleotide sequence; contain a sequence that is recognized by a cleavage enzyme; (iii) comprise or consist of a sequence capable of forming a hairpin structure; and/or (iv) that border the oligonucleotide sequence are the same.

8. (canceled)

9. (canceled)

10. The method of claim 7, wherein the double-stranded portion of the hairpin structure comprises a sequence that is recognized by a cleavage enzyme.

11. The method of claim 7, wherein the cleavage enzyme is a type II restriction endonuclease, optionally a type IIS restriction endonuclease, such as BseGI or BtsCI.

13. The method of claim 2, wherein the step of cleaving a single strand of the circular DNA molecule to provide an RCA template comprises cleaving a single strand of the circular DNA molecule with a cleavage enzyme.

14. The method of claim 13, wherein the circular DNA molecule contains a sequence that is recognized by the cleavage enzyme.

15. The method of claim 14, wherein the sequence that is recognized by the cleavage enzyme is between the cleavage domains that border the oligonucleotide sequence and is not in the oligonucleotide sequence.

16. The method of claim 13, wherein the cleavage enzyme is a nickase, optionally wherein the cleavage enzyme is Nb.BsrDI, Nt.BspQI or a combination thereof.

17. The method of claim 1, wherein the RCA reaction uses phi29 DNA polymerase or Bst DNA polymerase.

18. (canceled)

19. The method of claim 1, wherein the circular DNA molecule comprises a plurality of oligonucleotide sequences, wherein each oligonucleotide sequence is bordered by cleavage domains.

20. The method of claim 19, wherein the oligonucleotide sequences are different.

21. The method of claim 1, wherein step (a) comprises: (i) cloning into a DNA plasmid a linear DNA molecule comprising the oligonucleotide sequence bordered by cleavage domains; (ii) amplifying said plasmid; (iii) excising part of the plasmid containing the DNA molecule comprising the oligonucleotide sequence bordered by cleavage domains; and (iv) circularizing the part of the plasmid obtained in step (iii).

22. The method of claim 21, wherein step (ii) comprises transfecting said DNA plasmid into bacteria and growing the bacteria.

23. The method of claim 21, wherein the linear DNA molecule comprising the oligonucleotide sequence bordered by cleavage domains further comprises a 5′ end region and a 3′ end region each comprising a cleavage domain and wherein step (iii) comprises cleaving the cleavage domains in the end regions with a cleavage enzyme, optionally wherein said cleavage enzyme is BsmBI or BsaI.

24. The method of claim 1, further comprising a step of isolating or purifying the single stranded functionalized oligonucleotides.

25. (canceled)

26. (canceled)

27. A kit for use in the method of claim 1 comprising: (i) a circular DNA molecule comprising an oligonucleotide sequence bordered by cleavage domains, wherein the cleavage domains comprise or consist of a sequence capable of forming a hairpin structure and wherein the double-stranded portion of the hairpin structure comprises a sequence that is recognized by a cleavage enzyme; and (ii) functionalized dNTPs, optionally as defined in claim 3 or 4; and optionally (iii) one or more cleavage enzymes that cleave the cleavage domains of (i).

28. The kit of claim 27, wherein the cleavage domains are as defined in claim 7 and/or the DNA molecule is as defined in claim 19.

29. A single stranded functionalized oligonucleotide obtained by the method of claim 1, wherein; (i) the oligonucleotide contains at least 50 nucleotides; and (ii) at least 5% of the nucleotide residues contain a functional group selected from an alkyne group, an alkene group, an azide group, a halogen group, an O-methyl group, a locked ribose sugar or a combination thereof.

30. The single stranded functionalized oligonucleotide of claim 29, wherein (i) at least one of the nucleotide residues containing a functional group is an internal residue; and/or (ii) at least 10% of the nucleotide residues contain a functional group selected from an alkyne group, an alkene group, an azide group, a halogen group, an O-methyl group, a locked ribose sugar or a combination thereof.

31. (canceled)

32. A library comprising a plurality of single stranded functionalized oligonucleotides obtained by the method of claim 1, wherein the library includes a single stranded functionalized oligonucleotide as defined in claim 29.

33. The method of claim 1, being a method for producing a pool of single stranded functionalized oligonucleotides for use in single molecule fluorescence in situ hybridization (smFISH), wherein the functionalized nucleotides are; (i) fluorescently labeled nucleotides and wherein each single stranded functionalized oligonucleotide in the pool contains about 15-30, preferably about 20-25, nucleotides; or (ii) nucleotides comprising a chemical group capable of participating in click chemistry, and wherein the method further comprises a step of conjugating a fluorescent label to at least one functionalized nucleotide in each functionalized oligonucleotide via click chemistry, and wherein each single stranded functionalized oligonucleotide in the pool contains about 15-30, preferably about 20-25, nucleotides.

34. (canceled)

35. The method of claim 33, wherein the nucleotides comprising a chemical group capable of participating in click chemistry are nucleotides comprising an azide group, an alkyne group, an alkene group, a nitrone group, a tetrazine group or a tetrazole group, or a combination thereof.

36. The method of claim 33, wherein the step of conjugating a fluorescent label to at least one functionalized nucleotide in each functionalized oligonucleotide via click chemistry is carried out before the functionalized oligonucleotides are hybridized to a nucleic acid molecule comprising a target sequence.

37. The method of claim 33, wherein the step of conjugating a fluorescent label to at least one functionalized nucleotide in each functionalized oligonucleotide via click chemistry is carried out after the functionalized oligonucleotides are hybridized to a nucleic acid molecule comprising a target sequence.

Description

[0191] The invention will now be described in more detail in the following non-limiting Examples with reference to the following drawings:

[0192] FIG. 1 shows photographs of agarose gels visualized using UV light following ethidium bromide staining (top), and fluorescent imaging using wavelengths corresponding to the emission wavelengths of the fluorophores (bottom). The agarose gels show functionalized single stranded oligonucleotide products of the invention (containing 378 nucleotides) comprising fluorophores ATTO-488 (A) or Cy3 (B).

[0193] FIG. 2 shows the negative image of a photograph of an agarose gel visualized using UV light following ethidium bromide staining. The agarose gel shows functionalized single stranded oligonucleotide products of the invention (containing 420 nucleotides) comprising 5-ethnyl-dUTP (5-EdUTP) produced using various relative amounts of 5-EdUTP/dTTP nucleotides, i.e. 25%, 50%, 75% and 100% and phi29 DNA polymerase (A) or Bst DNA polymerase (B).

[0194] FIG. 3 shows a photograph of an agarose gel visualized using UV light following ethidium bromide staining (left), and fluorescent imaging using wavelengths corresponding to the emission wavelengths of the Cy3 fluorophores (right). The agarose gels show single stranded oligonucleotide products of the invention (containing 420 nucleotides) comprising 5-ethnyl-dUTP (5-EdUTP) or conventional dTTP that were subsequently reacted with Cy3 fluorophore-azide molecule (N3-Cy3). The shaded boxes denote the presence of the indicated species.

[0195] FIG. 4 shows negative images of photographs of agarose gels visualized using UV light following ethidium bromide staining. The agarose gels show functionalized single stranded oligonucleotide products of the invention (containing 420 nucleotides) comprising: (A) 2′-Fluoro-2′-deoxyuridine-5′-triphosphate (2′F-dUTP); (B) 2′-Deoxythymidine-5′-O-(1-Thiotriphosphate) (α-thiol-dTTP); and (C) 2-dNTP Alpha S nucleotides (Alpha S-dATP, Alpha S-dTTP, Alpha S-dCTP, Alpha S-dTTP, and an Alpha S-dNTP mixture), produced using various relative amounts of the functionalized nucleotides. The right panels in A and B show the lane corresponding to 100% functionalized nucleotides overexposed to show a band corresponding to the RCA product. The right panel in C show the lanes corresponding to Alpha S-dNTP mixture overexposed to show bands corresponding to the RCA product.

[0196] FIG. 5 shows negative images of photographs of agarose gels visualized using UV light following ethidium bromide staining. The agarose gels show oligonucleotides produced by the invention subjected to various concentrations of DNase I, wherein: (A) shows the reaction products of an oligonucleotide containing only conventional nucleotides (natural ODN); (B) shows the reaction products of an oligonucleotide containing 2′-Fluoro-2′-deoxyuridine-5′-triphosphate functionalized nucleotides (2′F-dUTP); and (C) shows the reaction products of an oligonucleotide containing 2′-Deoxythymidine-5′-O-(1-Thiotriphosphate) (S-ODN).

[0197] FIG. 6 shows a negative image of a photograph of a denaturing PAGE gel visualized using UV light following SybrGold staining. The PAGE gel shows functionalized single stranded oligonucleotide products of the invention comprising 5-Vinyl-2′-deoxyuridine-5′-triphosphate (5-Vinyl-dUTP) produced using various relative amounts of 5-Vinyl-dUTP nucleotides, i.e. 25%, 50%, 75% and 100%.

[0198] FIG. 7 shows a negative image of a photograph of a denaturing PAGE gel visualized using UV light following SybrGold staining. The PAGE gel shows functionalized single stranded oligonucleotide products of the invention comprising 4-Thiothymidine-5′-Triphosphate (4-Thio-dTTP) produced using various relative amounts of 5-Vinyl-dUTP nucleotides, i.e. 25%, 50%, 75% and 100%.

[0199] FIG. 8 shows annotated versions of the pseudogene sequences that were used in the production of oligonucleotides having sequences corresponding to SEQ ID NOs: 1-13. The sequences recognized by the cleavage and nicking enzymes, the hairpin sequences, and final oligonucleotide sequences are identified.

[0200] FIG. 9 shows the structure of a 2′-Azido-dATP (A) and negative images of photographs of denaturing PAGE gels visualized using UV light following SybrGold staining (B and C). The PAGE gels show functionalized single stranded oligonucleotide products of the invention comprising 2′-Azido-dATP produced using various relative amounts of 2′-Azido-dATP nucleotides, i.e. 25%, 50%, 75% and 100% and phi29 DNA polymerase (B) or Bst DNA polymerase (C).

[0201] FIG. 10 shows the structure of a Biotin-16-Aminoallyl-2′-dUTP (A) and a negative image of a photograph of a denaturing PAGE gel visualized using UV light following SybrGold staining (B). The PAGE gel shows functionalized single stranded oligonucleotide products of the invention comprising Biotin-16-Aminoallyl-2′-dUTP produced using various relative amounts of Biotin-16-AA-dUTP nucleotides, i.e. 25%, 50%, 75% and 100% and phi29 DNA polymerase.

[0202] FIG. 11 shows the structures of a 5′-Bromo-2′-deoxyuridine-5′Triphosphate nucleotide (A) and a 5′-Propynyl-2′-deoxycytidine-5′-Triphosphate nucleotide (B); negative images of photographs of denaturing PAGE gels visualized using UV light following SybrGold staining (C, D, E and F). The PAGE gels show functionalized single stranded oligonucleotide products of the invention comprising 5′-Br-dUTP (C and E) or 5′-Propynyl-dCTP (D and F) produced using various relative amounts of the respective functionalized nucleotides, i.e. 25%, 50%, 75% and 100% and phi29 DNA polymerase or Bst DNA polymerase.

[0203] FIG. 12 shows the structure of a 2′-O-Methyladenosine-5′-Triphosphate nucleotide (A) and a negative image of a photograph of a denaturing PAGE gel visualized using UV light following SybrGold staining (B). The PAGE gel shows functionalized single stranded oligonucleotide products of the invention comprising 2′-OMe-ATP produced using various relative amounts of 2′-OMe-ATP nucleotides, i.e. 25%, 50%, 75% and 100% and phi29 DNA polymerase.

[0204] FIG. 13 shows the structure of an LNA-adenosine-5′-triphosphate nucleotide (A) and negative images of photographs of denaturing PAGE gels visualized using UV light following SybrGold staining (B and C). The PAGE gels show functionalized single stranded oligonucleotide products of the invention comprising LNA-ATP produced using various relative amounts of LNA-ATP nucleotides, i.e. 25%, 50%, 75% and 100% and phi29 DNA polymerase (B) or Bst DNA polymerase (C).

EXAMPLES

Example 1—Enzymatic Production of Single Stranded Oligonucleotides Comprising Fluorescent Nucleotides

[0205] Single stranded fluorescent oligonucleotides 378 nucleotides in length (SEQ ID NO: 1) were produced enzymatically using phi29 DNA polymerase. This was done via incorporation of two different functionalized dATP nucleobases, one comprising the fluorophore Cy3 (7-Propargylamino-7-deaza-ATP-Cy3) and one comprising the fluorophore ATTO-488 (7-Propargylamino-7-deaza-ATP-ATTO-488).

[0206] A double stranded circular DNA template containing SEQ ID NO: 1 and hairpin cleavage domains was prepared as described in Ducani et al., 2013, Nature Methods, 647-652. The template (1 ng/μL) was nicked with Nb.BsrDI and Nt.BspQI (0.25 U/μL) and a rolling circle amplification reaction (0.1-0.25 ng/μL template DNA, phi29 DNA polymerase 0.25 U/μL, 0.1 μg T4 gene 32) was performed several times with different ratios of natural dATPs and functionalized dATPs in each reaction (i.e. different relative amounts of the functionalized dATP, 2%, 3% or 5%). The resulting RCA products were diluted five times in deionized water and 1× digestion buffer (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate, 100 μg/ml BSA, pH 7.9 at 25° C.) and were then digested with BtsCI restriction enzyme (0.5 U/μL) overnight at 50° C. and the digestion products were run on agarose gels. Imaging was done using the emission wavelengths corresponding to the two fluorophores, and after ethidium bromide staining, by UV visualization.

[0207] The resulting images are shown in FIGS. 1A and B for ATTO-488 and Cy3, respectively. It can be seen that increasing the percentage of dATP-ATTO-488 nucleotides resulted in oligonucleotides with higher fluorescence. However, the total amount of RCA product dropped by approximately 60% when 5% of the dATP nucleotides were dATP-ATTO-488.

[0208] Surprisingly and in contrast to the use of dATP-ATTO-488, the percentage of dATP-Cy3 nucleotides present did not seem to affect the efficiency of phi29 DNA polymerase; single stranded DNA products were visible with 5% of dATP-Cy3 in the RCA mixture (FIG. 1B). Moreover, incorporation of the modified nucleotides did not prevent or reduce the efficiency of the BtsCI restriction enzyme, and consequently the release of the designed hairpins comprising the cleavage domains.

TABLE-US-00001 SEQ ID NO: 1: CCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAG TGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTT ACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGA TCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAG GAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTG AATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGT TATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAAC AAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTG

Example 2—Enzymatic Production of Single Stranded Oligonucleotides Comprising Nucleotides with Internalized Alkyne Groups, i.e. Alkyne Groups in the Nucleobase

[0209] Single stranded oligonucleotides 420 nucleotides in length (SEQ ID NO: 2) comprising nucleotides with alkyne groups were produced enzymatically using phi29 DNA polymerase.

[0210] A double stranded circular DNA template containing SEQ ID NO: 2 and hairpin cleavage domains was prepared as described in Ducani et al., 2013, Nature Methods, 647-652. Nicking of the template RCA reactions were performed using the conditions described in Example 1, but using increasing relative amounts of 5′-Ethynyl-dUTP (5′-EdUTP), i.e. replacing dTTP with 5′-EdUTP such that the relative amount of 5′-EdUTP was 0% (control reaction), 25%, 50%, 75% or 100%. After amplification, the RCA products were digested by the BtsCI restriction enzyme and loaded on to an agarose gel as described in Example 2.

[0211] The results in FIG. 2A surprisingly show that even when up 100% of the dTTP nucleotides were replaced with the alkyne functionalized dUTP, the RCA yields dropped only by 15-20%. Thus, FIG. 2A also demonstrates that the RCA product was successfully and efficiently cleaved by BtsCI. The incorporation of the alkyne functionalized dUTP nucleotide was confirmed by the fact that a lower mobility of the functionalized oligonucleotide was observed.

[0212] An additional experiment was performed replacing phi29 DNA polymerase with Bst DNA polymerase. Gel electrophoresis showed no changes in amplification yield up to 50% of functionalized dUTP, with the final product shifted compared the one with 25% of modified dUTP, confirming the incorporation of the modified nucleotide which has higher molecular weight than its corresponding natural nucleotide (dTTP) (FIG. 2B).

TABLE-US-00002 SEQ ID NO: 2: ATTGAAGCATGCGGCGTGCATAATTCTCTTACTGTCATGCCATGCGTAA GATACCACCACACCCGCATTCGCCATTCAGGCGGCCGCCACCGCGGTGG AGCTCCAGCTGCTGTTTCCTGTGTAGAGTTGGTAGCTCTTGATCCGGTC ATATTTGTTCCCTTTAGATCCGCCTCCATCTACAGGGCGCGTCCCCGCG CTTAATGCGCGGCCTAACTACGGCTACACTAGAAGGACTTACCTTCGGA AAAGAAATTGTTATCCGCTCACAAAAGCCAGAGTATTTAAGCTCCCTCG TGCGCTCTCCTGTTCCGGGTTATTGTCTCATCGGCGACCGAGTTGCTCT TGCTTATCAGACCCTGCCGCTTACAAGTGGTCGCCAGTCTATTAACAGC ACTCAATACGGGATAATTTTTCAATATT

Example 3—Click Chemistry Reaction to Conjugate Azide-Fluorophore to Single Stranded Nucleotide Comprising Internalized Alkyne Groups

[0213] The successful incorporation of the functionalized 5-Ethynyl-dUTP nucleotides into the oligonucleotide produced in Example 2 was further demonstrated by performing a click chemistry reaction.

[0214] The functionalized oligonucleotide from the reaction with 75% of the alkyne functionalized dUTP nucleotide was incubated with a Cy3-azide (50 μM). The click chemistry solution also included copper sulfate (50 μM) as a catalyst, sodium ascorbate (50 mM) and THPTA (250 μM). As negative control, an oligonucleotide produced by the same method from the same template but with conventional dNTPs was also incubated with the Cy3-azide. In addition, the functionalized oligonucleotide comprising internalized alkyne groups was also incubated in the absence of the Cy3-azide. The reaction mixtures from the three reactions were run on an agarose gel and imaged (FIG. 3). Fluorescent single stranded oligonucleotides of the expected length were observed only for the reaction comprising the functionalized oligonucleotide and the fluorophore-azide. In addition, no visible DNA degradation due to the presence of the copper sulfate was observed.

Example 4—Enzymatic Production of Single Stranded Oligonucleotides Comprising Endonuclease Resistant Nucleotides

[0215] 2′-Fluoro-2′-deoxyuridine-5′-triphosphate (2′F-dUTP) or 2′-Deoxythymidine-5′-O-(1-Thiotriphosphate) (phosphorothioate dTTP) have both been previously used to modify DNA and RNA oligonucleotides for biomedicine and therapeutics applications, due to their capacity of conferring nuclease stability. These modified nucleotides were incorporated into single stranded DNA oligonucleotides by RCA using the experimental schemes described above. The conventional dTTP nucleotides were replaced by the functionalized nucleotides in increasing percentages from 0 to 100%. The tandem repeat RCA products were then digested by the BtsCI restriction enzyme into discrete 420 base single stranded functionalized oligonucleotides (SEQ ID NO: 2).

[0216] In the experiment performed with the 2′F-dUTP functionalized nucleotides, similar RCA yields were visible from 0% up to 75% of the functionalized nucleotide, with a drastic drop in yield observed with 100% of the functionalized nucleotide (FIG. 4A).

[0217] In the phosphorothioate dTTP experiment, the RCA yield decreased gradually as the amount of the functionalized nucleotide was increased, up to approximately a 65% drop with 75% of the functionalized nucleotide, relative to the yield with only conventional nucleotides (FIG. 4B).

[0218] However, overexposure of the agarose gels showed how functionalized single stranded oligonucleotides were produced even with 100% of functionalized nucleobases—see the panels on the right of FIGS. 4A and B.

[0219] Other phosphorothioate dNTPs (indicated as Alpha S dNTPs) were tested in additional experiments, either added one by one or in combination (FIG. 4C). Even in the last case, in which 75% of all the conventional nucleotides were replaced with their corresponding Alpha S functionalized nucleotides, RCA products were synthesized and enzymatically cleaved to yield oligonucleotides visible on the agarose gel.

[0220] The endonuclease resistance of the functionalized oligonucleotides relative to control oligonucleotides produced with only conventional nucleotides was investigated. A control 420-nt long oligonucleotide produced with only conventional nucleotides, the 2′-F-dUTP functionalized oligonucleotides and phosphorothioate dTTP functionalized oligonucleotides (both produced using a relative amount of 75% of the functionalized nucleotide), were incubated with increasing concentrations of DNAse I (FIGS. 5A-C). The control oligonucleotide was completely digested with 18 mU/ml of DNAse I, but both the enzymatically produced 2′-F-dUTP and phosphorothioate dTTP functionalized DNA oligonucleotides were still visible on agarose gels after incubation with the same concentration of endonuclease.

Example 5—Enzymatic Production of Single Stranded Oligonucleotides Comprising Nucleotides with Vinyl Groups

[0221] Single stranded DNA oligonucleotides with lengths from 76-81 bases (SEQ ID NOs: 3-13), functionalized with the thymidine analogue 5-Vinyl-2′-deoxyuridine-5′-triphosphate (5-Vinyl-dUTP) were produced enzymatically via an RCA reaction according to the experimental schemes described above. All of the oligonucleotides were encoded on a single pseudogene (SEQ ID NO: 16). The incorporation of such a functionalized nucleotide in single stranded oligonucleotides enables copper-free click chemistry reactions to be used to conjugate tetrazine-like molecules to the oligonucleotide. This alkene-tetrazine reaction can be completely orthogonal to the alkyne-azide click chemistry reaction previously performed.

[0222] Increasing the amount of the functionalized nucleotide in the RCA reaction mixture, relative to the conventional nucleotide dTTP, led to the successful incorporation of the 5-Vinyl-dUTP into the single stranded RCA product and the successful digestion of the hairpin structures. However, the activity levels of both the phi29 DNA polymerase and the type II endonuclease used to cleave the RCA product were lower than in the absence of the functionalized nucleotide, which consequently led to higher molecular weight bands with undigested hairpin structures when the functionalized nucleotides fully replaced the conventional dTTP nucleotides (FIG. 6).

TABLE-US-00003 SEQ ID NO Sequence  3 GAACCGTCCCAAGCGTTGCGCCACATCTGCTGGAAGGTGGAC AGTGAGAGGACACCTACGAATCGCAACGGGTATCCT  4 GAACCGTCCCAAGCGTTGCGCCTGGGTACATGGTGGTACCAC CAGACAGGACACCTACGAATCGCAACGGGTATCCT  5 GAACCGTCCCAAGCGTTGCGGAGAGCATAGCCCTCGTAGATG GGCAAGGACACCTACGAATCGCAACGGGTATCCT  6 GAACCGTCCCAAGCGTTGCGGTCCCAGTTGGTAACAATGCCA TGTTCAATGAGGACACCTACGAATCGCAACGGGTATCCT  7 GAACCGTCCCAAGCGTTGCGCGGACTCATCGTACTCCTGCTT GCTGAGGACACCTACGAATCGCAACGGGTATCCT  8 GAACCGTCCCAAGCGTTGCGTTCTCTTTGATGTCACGCACGAT TTCCCAGGACACCTACGAATCGCAACGGGTATCCT  9 GAACCGTCCCAAGCGTTGCGCTCGGTCAGGATCTTCATGAGG TAGTCTGTAGGACACCTACGAATCGCAACGGGTATCCT 10 GAACCGTCCCAAGCGTTGCGTTTCACGGTTGGCCTTAGGGTT CAGGGGAGGACACCTACGAATCGCAACGGGTATCCT 11 GAACCGTCCCAAGCGTTGCGGTACTTCAGGGTCAGGATACCT CTCTTGAGGACACCTACGAATCGCAACGGGTATCCT 12 GAACCGTCCCAAGCGTTGCGCTGCTCGAAGTCTAGAGCAACA TAGCACAAGGACACCTACGAATCGCAACGGGTATCCT 13 GAACCGTCCCAAGCGTTGCGCCTCGTCACCCACATAGGAGTC CTTCAGGACACCTACGAATCGCAACGGGTATCCT

Example 6—Enzymatic Production of Single Stranded Oligonucleotides Comprising Thiolated Nucleotides

[0223] Single stranded DNA oligonucleotides functionalized with a thiolated dTTP (4-Thiothymidine-5′-Triphosphate) were produced enzymatically via an RCA reaction using the reaction scheme and the templates described above (SEQ ID NOs: 3-13). All of the oligonucleotides were encoded on a single pseudogene (SEQ ID NO: 16)

[0224] The incorporation of the thiolated nucleotide into the single stranded oligonucleotide by phi29 DNA polymerase incorporation was very successful in amounts of the functionalized nucleotide up to 75% replacement of the corresponding conventional nucleotide (dTTP) (FIG. 7), i.e. a relative amount of 75% of the functionalized nucleotide.

[0225] The RCA products were digested by type II restriction enzymes as described above, however, a complete digestion of the functionalized RCA products required an enzyme concentration 10 times higher than the concentration used on RCA products comprising only conventional nucleotides. When the conventional dTTP nucleotide was completely replaced with the functionalized thiolated nucleotide, no single stranded oligonucleotides were observed following treatment with the type II restriction enzymes, though there only very faint accumulation of undigested RCA products was observed in the well, suggesting that the activity of the polymerase was also affected.

Example 7—Enzymatic Production of Single Stranded Oligonucleotides Comprising Azide Nucleotides

[0226] Single stranded oligonucleotides 420 nucleotides in length (SEQ ID NO: 2) comprising increasing percentages of functionalized 2′-Azido-dATP nucleotides (FIG. 9A), which replace the corresponding conventional dATP nucleotides, were produced enzymatically using phi29 DNA polymerase (FIG. 9B) and Bst DNA polymerase (FIG. 9C).

[0227] The high density azido groups in the newly synthesized DNA strands enables the post-synthesis functionalization with alkyne molecules, either by a Cu(I)-catalyzed Huisgen cycloaddition (“click” chemistry), or by a strain-promoted [3+2] cycloaddition of azides and cycloalkynes, e.g. cyclooctyne or cyclononyne.

[0228] Two different polymerases with strand displacement activity were used in the amplification step: phi29 DNA polymerase or Bst DNA polymerase. Both polymerases were able to incorporate the functionalized nucleotide into the amplification products, which were then digested and run on an agarose gel.

[0229] DNA products produced with phi29 DNA polymerases were visible in the gel up to 75% of the modified nucleotides (FIG. 9B) while Bst DNA polymerases products were visible up to 100% (FIG. 9C), although Bst amplification buffer salts led to smear effect (even in the lane corresponding to 0% of 2′-Azido dATP). The functionalized nucleotides were incorporated successfully and did not significantly affect the formation of hairpin structures, which enable the cleavage of the amplification product.

Example 8—Enzymatic Production of Single Stranded Oligonucleotides Comprising Biotinylated Nucleotides

[0230] Single stranded oligonucleotides 420 nucleotides in length (SEQ ID NO: 2) comprising increasing percentages (25%-100%) of functionalized Biotin-16-Aminoallyl-2′-dUTP (FIG. 10A), which replace the corresponding conventional nucleotide dTTP, were produced enzymatically using phi29 DNA polymerase (FIG. 10B).

[0231] The incorporation of the biotinylated nucleotides only slightly affected the DNA amplification reaction and, surprisingly, despite the potential for steric hindrance due to the large size of the functionalized nucleotide, did not interfere with the formation of the hairpin structures, which enable the cleavage of the RCA products. The incorporation of multiple internal biotins into a functionalized polynucleotide enables the conjugation with streptavidin functionalized molecules.

Example 9—Enzymatic Production of Single Stranded Oligonucleotides Comprising 5-Modified Pyrimidines: 5-Bromo-2′-deoxyuridine-5′-Triphosphate and 5-Propynyl-2′-deoxycytidine-5′-Triphosphate

[0232] Single stranded oligonucleotides 420 nucleotides in length (SEQ ID NO: 2) comprising increasing percentages (25%-100%) of unnatural 5-modified pyrimidines: 5-Bromo-2′-deoxyuridine-5′-Triphosphate (FIG. 11A) and 5-Propynyl-2′-deoxycytidine-5′-Triphosphate (FIG. 11B), which replace the corresponding conventional nucleotides dTTP and dCTP, respectively, were produced enzymatically using phi29 DNA polymerase (FIGS. 11C and 11D) and Bst DNA polymerase (FIGS. 11E and 11F). Surprisingly, both functionalized nucleotides were successfully incorporated into the newly synthesized DNA sequence without affecting the formation of the hairpin structures in the RCA product, thus allowing the cleavage reaction to occur.

Example 10—Enzymatic Production of Single Stranded Oligonucleotides Comprising 2′-O-Methyl-ATP

[0233] Single stranded oligonucleotides 420 nucleotides in length (SEQ ID NO: 2) comprising increasing percentages (25%-100%) of 2′-O-Methyl-ATP (FIG. 12A), which replace the corresponding conventional nucleotide dATP, were produced enzymatically using phi29 DNA polymerase (FIG. 12B). Even with 100% of the functionalized nucleotide present, the amplification product was still visible. This result was contrary to previous studies which showed that no known natural polymerases are capable of efficiently accepting these modified substrates (Romesberg, JACS 2004, 10.1021/ja038525p).

[0234] In addition, no higher molecular weight undigested DNA bands were visible in the gel, showing that the presence of the functionalized nucleotides did not affect the formation of the hairpin structure and its digestion by the restriction enzyme. This was a surprising result in view of the nuclease resistance which is conferred to DNA molecules by O-methyl groups.

Example 11 Enzymatic Production of Single Stranded Oligonucleotides Comprising LNA-adenosine-5′-triphosphate

[0235] Single stranded oligonucleotides 420 nucleotides in length (SEQ ID NO: 2) comprising increasing percentages (25%-100%) of LNA-adenosine-5′-triphosphate (FIG. 13A), which replace the corresponding conventional nucleotide dATP, were produced enzymatically using phi29 DNA polymerase (FIG. 13B) and Bst DNA polymerase (FIG. 13C).

[0236] Although LNA monomers structurally mimic RNA, even with 100% of the functionalized nucleotide the efficiency of the polymerases, both phi29 DNA polymerase and Bst DNA polymerases, was not significantly affected. Moreover, the functionalized nucleotide did not interfere with the formation of the hairpin structures which enable digestion of the amplification products.