SELECTIVE GLUCOCORTICOID RECEPTOR MODIFIERS FOR TREATING IMPAIRED SKIN WOUND HEALING

Abstract

The present invention relates to a Selective Glucocorticoid Receptor Modulator (SEGRM), or a pharmaceutically acceptable salt thereof, for use in the treatment of impaired skin wound healing in a subject, an in vitro method for identifying a subject suffering from impaired skin wound healing to be responsive to the treatment with a Selective Glucocorticoid Receptor Modulator (SEGRM), or a pharmaceutically acceptable salt thereof, and kits and kits-of-part related thereto.

Claims

1. A method of treating impaired skin wound healing in a subject, the method comprising administering to a subject in need thereof an effective amount of a Selective Glucocorticoid Receptor Modulator (SEGRM), or a pharmaceutically acceptable salt thereof, thereby treating impaired skin wound healing in the subject.

2. The method of claim 1, wherein the SEGRM, or the pharmaceutically acceptable salt thereof, is a non-steroidal Selective Glucocorticoid Receptor Modulator (SEGRM), and wherein the SEGRM specifically binds to a Glucocorticoid Receptor (GC) with an affinity (KD) of less than 100 nM, and/or wherein the competition factor for the SEGRM i) is lower than 20 for Glucocorticoid Receptor (GC), and ii) is at least 5 for progesterone receptor (PR), androgen receptor (AR) and mineralocorticoid receptor (MR), wherein the competition factor is defined as IC.sub.50 value of the SEGRM/IC.sub.50 of a reference compound, and wherein the reference compound for GC is dexamethasone, the reference compound for PR is progesterone, the reference compound for AR is metribolone, and the reference compound for MR is aldosterone, and/or wherein the EC.sub.50 value for transactivation activity of the SEGRM upon binding to a Glucocorticoid Receptor (GC) in a cell is at least 20-fold higher than the EC.sub.50 value for transactivation activity of dexamethasone and/or the IC.sub.50 value for transrepression activity of the SEGRM upon binding to a Glucocorticoid Receptor (GC) in a cell is at most 100-fold higher than the IC.sub.50 value for transrepression activity of dexamethasone.

3. The method of claim 1, wherein the SEGRM or the pharmaceutically acceptable salt thereof specifically binds to a Glucocorticoid Receptor (GC) with an affinity (KD) of less than 100 nM, and/or is a non-steroidal SEGRM, and/or effects translocation of the glucocorticoid receptor from the cytoplasm into the nucleus in primary human fibroblasts in an in vitro culture at a concentration of the SEGRM of 10 nM at 37° C., and/or is a glucocorticoid receptor (GR) agonist.

4. The method of claim 1, wherein the skin wound is selected from a wound of a diabetic patient, a skin wound which is infected by at least one microorganism, an ischemic wound, a wound in a patient suffering from deficient blood supply or venous stasis, an ulcer, such a diabetic ulcer, venous ulcer, arterial ulcer, such as ulcus cruris arteriosum, mixed ulcer, or pressure ulcer, a neuropathic wound, ulcus cruris, surgical wound, burn, dehiscence, neoplastic ulcer, a bullous skin disease, such as epidermolysis bullosa, and rare ulcer.

5. The method of claim 1, wherein the subject suffers from at least one co-morbidity associated with impaired skin wound healing or from diabetes, and/or wherein the subject is treated with at least one immunosuppressive drug.

6. The method of claim 1, wherein the subject suffers from diabetes and/or has at least one diabetic ulcer, and/or wherein the subject (i) has undergone transplantation of a graft, and/or (ii) obtains immunosuppressive therapy, and optionally suffers from diabetes.

7. The method of claim 1, wherein the subject is identified as being responsive to the treatment of impaired skin wound healing by i) measuring the proliferation of fibroblast cells, and optionally the amount of at least one IL-1 cytokine marker in the supernatant of fibroblast cells, in the presence of: (1) a wound exudate sample or wound biofilm sample obtained from the skin wound of said subject, and (2) at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof; and/or ii) measuring the fibroblast-derived matrix formation by fibroblast cells in the presence of: (1) a wound exudate sample or wound biofilm sample obtained from the skin wound of said subject, and (2) at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof.

8. The method of claim 7, further wherein the subject is identified as being responsive to the treatment of impaired skin wound healing with a Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof, when the value of proliferation of fibroblast cells measured in step i) and/or the value of the fibroblast-derived matrix formation by fibroblast cells measured in step ii) is at least 20% above a control value established in the absence of the at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof of (2), and, optionally, when the value for the amount of the at least one IL-1 cytokine marker in the supernatant of fibroblast cells obtained in step i) is below a control value established in the absence of the at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof of (2).

9. The method of claim 7, further wherein step iiia) and/or one, two, three, or four of the following steps iiib) to iiie) are performed: iiia) measuring the proliferation of keratinocyte cells in the presence of: (1) a wound exudate sample, or wound biofilm sample, obtained from the skin wound of said subject, and (2) at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof, iiib) measuring the amount(s) of one or more M1 marker(s) and one or more M2 marker(s) in the supernatant of macrophages incubated with (1) a wound exudate sample or wound biofilm sample obtained from said skin wound, and (2) at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof, wherein the macrophages are in co-culture with fibroblasts, and wherein the one or more M1 markers are selected from CXCL10 and IL-23p19, and the one or more M2 markers are selected from CCL22 and CCL18, iiic) measuring the amount(s) and/or frequency distribution(s) of one or more M1 cell surface marker(s) and one or more M2 cell surface marker(s) on macrophages incubated with (1) a wound exudate sample or wound biofilm sample obtained from said skin wound, and (2) at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof, wherein the macrophages are in co-culture with fibroblasts, and wherein the one or more M1 cell surface markers are selected from CD38, CD64 and CD197, and wherein the one or more M2 cell surface markers are selected from CD200 receptor, CD206 and CD209, iiid) measuring the expression level(s) of one or more M1 marker mRNA(s) and one or more M2 marker mRNA(s) in macrophages incubated with (1) a wound exudate sample or wound biofilm sample obtained from said skin wound, and (2) at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof, wherein the macrophages are in co-culture with fibroblasts, and wherein the one or more M1 marker mRNA(s) are selected from CD38, CD64, CD197, CXCL10 and IL-23p19, and the one or more M2 marker mRNA(s) are selected from CD200 receptor (CD200R), CD206, CD209, CCL22 and CCL18, iiie) measuring the amount(s) of one or more cytokine markers in the supernatant of macrophages incubated (1) with a wound exudate sample or wound biofilm sample obtained from said skin wound, and (2) at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof, wherein the macrophages are in co-culture with fibroblasts, and wherein the one or more cytokine markers are selected from IL-1alpha, IL-1beta and TNF-alpha, and wherein the subject is identified as being responsive to treatment with at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof, when the value of proliferation of fibroblast cells measured in step i) and/or the value of the fibroblast-derived matrix formation by fibroblast cells measured in step ii) and/or the value of the proliferation of keratinocyte cells in step iiia) is at least 20% above a control value established in the absence of the at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof of (2), and, optionally, when the value for the amount of the at least one IL-1 cytokine marker in the supernatant of fibroblast cells obtained in step i) is below a control value established in the absence of the at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof of (2).

10. The method of claim 1, wherein the Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof is (i) formulated for systemic, oral, or intravenous administration, or (ii) formulated for local, topical, mucosal, ocular, intradermal, or subcutaneous administration.

11. The method of claim 10, wherein the Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof is formulated for local administration, wherein said pharmaceutical formulation comprises at least one Selective Glucocorticoid Receptor Modulator (SEGRM) and a) oleyl alcohol, b) cetearyl octanoate and c) a vegetable oil.

12. The method of claim 1, wherein the SEGRM, or a pharmaceutically acceptable salt thereof, is selected from: (i) a compound of formula (IIa) or (IIb) below: ##STR00046## in which R.sup.1 and R.sup.2, independently of one another, can be a hydrogen atom, a C.sub.1-3-alkyl group, a halogen atom, a cyano group, a C.sub.1-3-alkoxy group or a hydroxy group, as well as their racemates or separately present stereoisomers and optionally their pharmaceutically acceptable salts or their prodrugs; (ii) the compound (R)-2-(4-((5-(Ethylsulfonyl)-1H-pyrrolo[2,3-c]pyridin-2-yl)methyl)-5,5,5-trifluoro-4-hydroxy-2-methylpentan-2-yl)-5-fluorobenzamide, or a pharmaceutically acceptable salt thereof; (iii) the compound of following formula below: ##STR00047## or a pharmaceutically acceptable salt thereof; (iv) the compound of following formula below: ##STR00048## or a pharmaceutically acceptable salt thereof; (v) a compound of following formula (I) below: ##STR00049## wherein R.sub.1 is selected from the group consisting of 5- and 6-membered heteroaryl, (C.sub.1-C.sub.6)alkyl, (C.sub.3-C.sub.6)cycloalkyl, (4-6)-membered heterocycloalkyl and phenyl, wherein said 5- and 6-membered heteroaryl, (C.sub.1-C.sub.6)alkyl, (C.sub.3-C.sub.6)cycloalkyl, (4-6)-membered heterocycloalkyl and phenyl is optionally substituted with one or more substituents independently selected from (C.sub.1-C.sub.4)alkyl, (C.sub.1-C.sub.4)alkoxy, halogen, hydroxyl and cyano; R.sub.2 is selected from (C.sub.1-C.sub.3)alkyl and halo(C.sub.1-C.sub.3)alkyl; R.sub.3 is selected from phenyl, 5-membered heteroaryl and 6-membered heteroaryl, wherein said phenyl, 5-membered heteroaryl and 6-membered heteroaryl are optionally substituted with one or more substituents independently selected from R.sub.5; R.sub.4 is selected from hydrogen, halogen, (C.sub.1-C.sub.4)alkyl and halo(C.sub.1-C.sub.4)alkyl; R.sub.5 is selected from halogen, cyano, (C.sub.1-C.sub.6)alkyl, (C.sub.3-C.sub.6)cycloalkyl, (C.sub.1-C.sub.6)alkoxy, halo(C.sub.1-C.sub.6)alkyl, halo(C.sub.1-C.sub.6)alkoxy, hydroxy(C.sub.1-C.sub.6)alkyl, phenyl, 5-membered heteroaryl, 6-membered heteroaryl and —S(O).sub.2R.sub.a, wherein R.sub.a represents (C.sub.1-C.sub.4)alkyl; X.sub.1 is selected from CH, C(R.sub.b) and N, wherein R.sub.b represents halogen, (C.sub.1-C.sub.4)alkyl or halo(C.sub.1-C.sub.4)alkyl; X.sub.2 is selected from CH and N; Y is selected from —NH— and —O—; m is 0 or 1; n is 0 or 1; L represents a bond, —O—, —NH— or —N(R.sub.c)—, wherein R.sub.c represents (C.sub.1-C.sub.4)alkyl; or pharmaceutically acceptable salts, hydrates or solvates thereof; and (vi) a compound of following formula (III) below: ##STR00050## wherein R.sup.1 and R.sup.2 independently of one another, mean a hydrogen atom, a hydroxy group, a halogen atom, an optionally substituted (C.sub.1-C-.sub.10)-alkyl group, an optionally substituted (C.sub.1-C-.sub.10)-alkoxy group, a (C.sub.1-C.sub.10)-alkylthio group, a (C.sub.1-C.sub.5)-perfluoroalkyl group, a cyano group, a nitro group, or R.sup.1 and R.sup.2 together mean a group that is selected from the groups —O—(CH.sub.2).sub.p—O—, —O—(CH.sub.2).sub.p—CH.sub.2—, —O—CH═CH—, —(CH.sub.2).sub.p+2—, —NH—(CH.sub.2).sub.p+1, —N(C.sub.1-C.sub.3-alkyl)-(CH.sub.2).sub.p+1, and —NH—N═CH—, whereby p=1 or 2, and the terminal oxygen atoms and/or carbon atoms and/or nitrogen atoms are linked to directly adjacent ring-carbon atoms, or NR.sup.6R.sup.7, whereby R.sup.6 and R.sup.7, independently of one another, mean hydrogen, C.sub.1-C.sub.5-alkyl or (CO)—(C.sub.1-C.sub.5)-alkyl, R.sup.3 means a hydrogen atom, a hydroxy group, a halogen atom, a cyano group, an optionally substituted (C.sub.1-C.sub.10)-alkyl group, a (C.sub.1-C.sub.10)-alkoxy group, a (C.sub.1-C.sub.10)-alkylthio group, or a (C.sub.1-C.sub.5)-perfluoroalkyl group, R.sup.4 means a hydrogen, halogen, hydroxy, (C.sub.1-C.sub.5)-alkyl, (C.sub.1-C.sub.5)alkoxy, (C.sub.1-C.sub.5)-alkylthio, (C.sub.1-C.sub.5)-perfluoroalkyl, cyano, nitro, NR.sup.6R.sup.7, COOR.sup.9, (CO)NR.sup.6R.sup.7 or a (C.sub.1-C.sub.5-alkylene)-O—(CO)—(C.sub.1-C.sub.5)alkyl group, R.sup.5 means a group selected from —(C.sub.1-C.sub.10)alkyl, which may be optionally partially or completely halogenated, —(C.sub.2-C.sub.10)alkenyl, —(C.sub.2-C.sub.10)alkynyl, (C.sub.3-C.sub.7)cycloalkyl-(C.sub.1-C.sub.8)alkyl, (C.sub.3-C.sub.7)cycloalkyl-(C.sub.1-C.sub.8)alkylenyl, (C.sub.3-C.sub.7)cycloalkyl-(C.sub.2-C.sub.8)alkynyl, heterocyclyl-(C.sub.1-C.sub.8)alkyl, heterocyclyl-(C.sub.1-C.sub.8)alkenyl, heterocyclyl-(C.sub.2-C.sub.8)alkynyl, —R.sup.8, R.sup.8—(C.sub.1-C.sub.8)alkyl, R.sup.8—(C.sub.2-C.sub.8)alkenyl, R.sup.8—(C.sub.2-C.sub.8)alkynyl, —S—(C.sub.1-C.sub.10)-alkyl, —SO.sub.2—(C.sub.1-C.sub.10)-alkyl, —S—R.sup.8, —SO.sub.2-R.sup.8, —CN, -Hal, —O—(C.sub.1-C.sub.10)-alkyl, —NR.sup.6R.sup.7 wherein R.sup.6, R.sup.7 have the meaning defined above, —O—R.sup.8, —OH, with the exception of —CH(CH.sub.3).sub.2) or —C(CH.sub.3)═CH.sub.2, R.sup.8 means an aryl group which may optionally be substituted by 1-3 hydroxy, halogen, C.sub.1-C.sub.5-alkyl, C.sub.1-C.sub.5-alkoxy, cyano, CF.sub.3, nitro, COO(C.sub.1-C.sub.5-alkyl) or C(O)OCH.sub.2-phenyl or a heteroaryl group whereby the heteroaryl group may contain 1-3 hetero atoms which may optionally be substituted by 1-3 alkyl groups, hydroxy, halogen, cyano or C.sub.1-C.sub.5-alkoxy groups, and their salts, solvates or salts of solvates.

13. The method of claim 1, wherein the SEGRM is a compound selected from the group consisting of: ##STR00051## (R)-2-(4-((5-(Ethylsulfonyl)-1H-pyrrolo[2,3-c]pyridin-2-yl)methyl)-5,5,5-trifluoro-4-hydroxy-2-methylpentan-2-yl)-5-fluorobenzamide; ##STR00052## [(3S)-1-[(3R)-5-oxotetrahydrofuran-3-carbonyl]-3-piperidyl] 4-[(1R,2S)-1-(4-cyclopropylphenyl)-2-[[(2R)-tetrahydrofuran-2-carbonyl] amino]propoxy]benzoate; 5-{[(1S,2S)-1-(2-chloro-3-fluoro-4-methoxyphenyl)-3,3,3-trifluoro-2-hydroxy-2-(methoxymethyl)propyl]amino}-7-fluoro-1H-quinolin-2-one; 5-{(1S,2S) [1-(2-chloro-3-fluoro-4-methoxyphenyl)-3,3,3-trifluoro-2-hydroxy-2-(hydroxymethyl)propyl]amino}-7-fluoro-1H-quinolin-2-one, and 5-{(1S,2S) [1-(2-chloro-3-fluoro-4-methoxyphenyl)-3,3,3-trifluoro-2-hydroxy-2-(hydroxymethyl)propyl]amino}-7-fluoro-1H-quinolin-2-one, or a pharmaceutically acceptable salt thereof.

14. An in vitro method for identifying a subject suffering from impaired skin wound healing who is responsive to treatment with a Glucocorticoid Receptor Modulator (SEGRM), or a pharmaceutically acceptable salt thereof, the method comprising: i) measuring the proliferation of fibroblast cells, and optionally the amount of at least one IL-1 cytokine marker in the supernatant of fibroblast cells, in the presence of: (1) a wound exudate sample or wound biofilm sample obtained from the skin wound of said subject, and (2) at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or a pharmaceutically acceptable salt thereof; and/or ii) measuring fibroblast-derived matrix formation by fibroblast cells in the presence of: (1) a wound exudate sample or wound biofilm sample obtained from the skin wound of said subject, and (2) at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or a pharmaceutically acceptable salt thereof; wherein the subject is identified as being responsive to the treatment with a Selective Glucocorticoid Receptor Modulator (SEGRM), or a pharmaceutically acceptable salt thereof, when the value of proliferation of fibroblast cells measured in step i) and/or the value of the fibroblast-derived matrix formation by fibroblast cells measured in step ii) is at least 20% above a control value established in the absence of the at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof of (2) and, optionally, when the value for the amount of the at least one IL-1 cytokine marker in the supernatant of fibroblast cells obtained in step i) is below a control value established in the absence of the at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof of (2).

15. The in vitro method of claim 14, further wherein step iiia) and/or one, two, three, or four of the following steps iiib) to iiie) are performed: iiia) measuring the proliferation of keratinocyte cells in the presence of: (1) a wound exudate sample, or wound biofilm sample, obtained from the skin wound of said subject, and (2) at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof; iiib) measuring the amount(s) of one or more M1 marker(s) and one or more M2 marker(s) in the supernatant of macrophages incubated with (1) a wound exudate sample or wound biofilm sample obtained from said skin wound, and (2) at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof, wherein the macrophages are in co-culture with fibroblasts, and wherein the one or more M1 markers are selected from CXCL10 and IL-23p19, and the one or more M2 markers are selected from CCL22 and CCL18; iiic) measuring the amount and/or frequency distribution of one or more M1 cell surface marker and one or more M2 cell surface marker on macrophages incubated with (1) a wound exudate sample or wound biofilm sample obtained from said skin wound, and (2) at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof, wherein the macrophages are in co-culture with fibroblasts, and wherein the one or more M1 cell surface markers are selected from CD38, CD64 and CD197, and wherein the one or more M2 cell surface markers are selected from CD200 receptor, CD206 and CD209; iiid) measuring the expression level(s) of one or more M1 marker mRNA(s) and one or more M2 marker mRNA(s) in macrophages incubated with (1) a wound exudate sample or wound biofilm sample obtained from said skin wound, and (2) at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof, wherein the macrophages are in co-culture with fibroblasts, and wherein the one or more M1 marker mRNA(s) are selected from CD38, CD64, CD197, CXCL10 and IL-23p19, and the one or more M2 marker mRNA(s) are selected from CD200 receptor (CD200R), CD206, CD209, CCL22 and CCL18; iiie) measuring the amount of one or more cytokine markers in the supernatant of macrophages incubated (1) with a wound exudate sample or wound biofilm sample obtained from said skin wound, and (2) at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof, and wherein the subject is identified as being responsive to the treatment with a Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof, when the value of proliferation of fibroblast cells measured in step i) and/or the value of the fibroblast-derived matrix formation by fibroblast cells measured in step ii) and/or the value of the proliferation of keratinocyte cells in step iiia) is at least 20% above a control value established in the absence of the at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof of (2).

16. A kit, comprising: (a) a pharmaceutical composition comprising at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or a pharmaceutically acceptable salt thereof, and (b) one or more of the following: i) fibroblast cells, ii) a support having a plurality of defined areas or cavities, wherein a subset of areas or cavities are (i) coated with adhesion enhancing agent, and/or (ii) are filled with fibroblast-derived matrix (FDM), iii) a matrix promoting supplement.

17. (canceled)

18. The method of claim 9, further wherein the subject is identified as being responsive to treatment with at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof when one or more of the following applies: the ratio of amount(s) of one or more M1 marker(s) to the amount(s) of one or more M2 marker(s) obtained in iiib) is/are below a control value established in the absence of the at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof of (2); the ratio of amount(s) and/or frequency distribution(s) of one or more M1 cell surface marker(s) to the amount(s) and/or frequency distribution(s) of one or more M2 cell surface marker(s) obtained in iiic) is/are below a control value established in the absence of the at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof of (2), in particular wherein the ratio is selected from a CD38/CD209 ratio, a CD197/CD209 ratio and a CD197/CD206 ratio; the ratio of expression level(s) of one or more M1 marker mRNA(s) to the expression level(s) of one or more M2 marker mRNA(s) obtained in iiid) is/are below a control value established in the absence of the at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof of (2); and/or the value obtained in iiie) is below a control value established in the absence of the at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof of (2).

19. The method of claim 15, further wherein the subject is identified as being responsive to treatment with a Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof, when one or more of the following applies: the ratio of amount(s) of one or more M1 marker(s) to the amount(s) of one or more M2 marker(s) obtained in iiib) is/are below a control value established in the absence of the at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof of (2); the ratio of amount(s) and/or frequency distribution(s) of one or more M1 cell surface marker(s) to the amount(s) and/or frequency distribution(s) of one or more M2 cell surface marker(s) obtained in iiic) is/are below a control value established in the absence of the at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof of (2), in particular wherein the ratio is selected from a CD38/CD209 ratio, a CD197/CD209 ratio and a CD197/CD206 ratio; the ratio of expression level(s) of one or more M1 marker mRNA(s) to the expression level(s) of one or more M2 marker mRNA(s) obtained in iiid) is/are below a control value established in the absence of the at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof of (2); and/or the value obtained in iiie) is below a control value established in the absence of the at least one Selective Glucocorticoid Receptor Modulator (SEGRM), or pharmaceutically acceptable salt thereof of (2).

Description

FIGURE LEGENDS

[0863] FIG. 1: shows profiling of the active SEGRM compound BI-653048 in comparison with its inactive analogue BI-3047 in the human dermal fibroblast proliferation assay (2D) with or without wound exudate from patients 1-3 (1A-1C). Fibroblast proliferation in medium in the absence of WE is shown in 1D. Filled circles: graded concentrations of BI-653048; empty triangles: graded concentrations of BI-3047. The active compound reversed inhibition of wound exudate (WE)-induced fibroblast proliferation, while the inactive analogue had no effect.

[0864] FIG. 2: shows the effects of the active SEGRM compound BI-653048 in comparison with its inactive analogue BI-3047 in the presence of WE-1 on fibroblast proliferation (2A) as well as IL-1β secretion into the supernatant (2B). Filled circles: graded concentrations of BI-653048; empty triangles: graded concentrations of BI-3047. The active compound dose-dependently reversed inhibition of wound exudate (WE)-induced fibroblast proliferation and inhibited IL-1β secretion at the same concentrations. The inactive analogue had no effect on proliferation and much less effect on IL-1β secretion.

[0865] FIG. 3: shows the effects of the active SEGRM compound BI-653048 in comparison with its inactive analogue BI-3047 in the presence of WE-2 on the expression of mRNAs for collagens 1 and 3 in the fibroblast proliferation assay. Filled symbols (3A and 3B): 72-hour incubation performed in the presence of WE-2; empty symbols (3C and 3D): 72-hour incubation performed in medium in the absence of WE. Both compounds were used at 1 μM. The active compound enhanced collagen 1- and collagen 3 mRNA expression in the presence of WE, but not in medium.

[0866] FIG. 4: shows the effect of graded concentrations of the SEGRM BI-653048, both in the presence and absence of the glucocorticoid receptor antagonist mifepristone (concentration 1 μM) in 3D fibroblast culture regarding the formation of fibroblast-derived matrix with WE-1. The matrix-promoting effects of BI-653048 can be abrogated by addition of mifepristone, indicating that these effects are mediated by the glucocorticoid receptor.

[0867] FIG. 5: shows the effects of the SEGRM compounds mapracorat and BI-53048 in the presence of WE-4 on fibroblast proliferation. Filled circles: graded concentrations of BI-53048; filled squares: graded concentrations of mapracorat. Both compounds dose-dependently reversed inhibition of wound exudate (WE)-induced fibroblast proliferation, albeit at different concentrations.

[0868] FIG. 6: shows the effects of graded concentrations of mapracorat in the presence of WE-1 on the expression of mRNAs for collagen 1 in the fibroblast proliferation assay. Filled symbols (6A): 72-hour incubation performed in the presence of WE-1; empty symbols (6B): 72-hour incubation performed in medium in the absence of WE. Mapracorat dose-dependently enhanced collagen 1 mRNA expression in the presence of WE, but not in medium.

[0869] FIG. 7: shows the effects of graded concentrations of mapracorat in the presence of WE-1 on the expression of mRNAs for collagen 3 in the fibroblast proliferation assay. Filled symbols (7A): 72-hour incubation performed in the presence of WE-1; empty symbols (7B): 72-hour incubation performed in medium in the absence of WE. Mapracorat at all three concentrations enhanced collagen 3 mRNA expression in the presence of WE, but not in medium.

[0870] FIG. 8: shows the effects of graded concentrations of mapracorat in the presence of WE-1 on the expression of mRNAs for IL-1β in the fibroblast proliferation assay. Filled symbols (8A): 72-hour incubation performed in the presence of WE-1; empty symbols (8B): 72-hour incubation performed in medium in the absence of WE. Mapracorat dose-dependently inhibited IL-1β mRNA expression in the presence of WE. There was no IL-1β induction in medium.

[0871] FIG. 9: shows the effects of the SEGRM compounds ZK216348 and HY14234 in the presence of WE-1 on fibroblast proliferation (9A) as well as IL-1β secretion into the supernatant (9B). Filled circles: graded concentrations of HY14234; filled triangles: graded concentrations of ZK216348. All tested compounds led to a dose-dependent partial reversion of the wound exudate (WE)-induced inhibition of fibroblast proliferation and they inhibited IL-1β secretion at the same concentrations. The efficacy of ZK216348 was not as high as for HY14234.

[0872] FIG. 10: shows the effects of the SEGRM compounds ZK216348 and HY14234 in the presence of WE-2 on fibroblast proliferation (10A) as well as IL-1β secretion into the supernatant (10B). Filled circles: graded concentrations of HY14234; filled triangles: graded concentrations of ZK216348. All tested compounds dose-dependently reversed inhibition of wound exudate (WE)-induced fibroblast proliferation, while in the context of WE-2, inhibition of IL-1β secretion was negligible.

[0873] FIG. 11: shows the effects of the SEGRM compounds ZK216348 and HY14234 in the presence of WE-3 on fibroblast proliferation (11A) as well as IL-1β secretion into the supernatant (11B). Filled circles: graded concentrations of HY14234; filled triangles: graded concentrations of ZK216348. All tested compounds dose-dependently reversed inhibition of wound exudate (WE)-induced fibroblast proliferation and inhibited IL-1β secretion at the same concentrations. The efficacy of ZK216348 was not as high as for HY14234.

[0874] FIG. 12: shows the effect of a plurality of SEGRM in 3D fibroblast culture with WE from patient #92. AZD7594 was the most active of the SEGRM tested in 3D culture, followed by mapracorat and BI653048. This is in line with their potencies for glucocorticoid receptor activation (EC.sub.50 values of 0.9 nM, 1.9 nM and 55 nM, respectively). The inactive compound BI3047 did not induce matrix formation. Filled diamonds: AZD7594; filled circles: mapracorat; filled squares: HY14234; filled triangles: BI653048; open triangles: BI3047; x: ZK216348.

[0875] FIG. 13: shows the effect of mapracorat in a pig model of delayed wound healing. Wounds were induced for 5 days on the back of pigs using human chronic wound exudates WE-01 and WE-02 or normal human serum in the presence of the TLR7/8 agonist R848 as inducer of inflammation (FIGS. 13A-C) or human serum alone as a control (FIG. 13D). Compound treatment started on day 6 and continued until day 10. Total wound score (wound appearance, size, content, pus, crust, erythema, erythema width, swelling, necrosis) was determined daily until day 12.

[0876] Mapracorat (MAPRA) at 10 mM and 1 mM reduced the wound score from days 6 to 12 with WE-01 (FIG. 13A), WE-02 (FIG. 13B) and R848 (FIG. 13C) as inducers of delayed wound healing. Mapracorat did not have any negative effect on the healing of control wounds in the presence of human serum (FIG. 13D).

[0877] While the general effect of mapracorat was similar in both pigs, the extent of wound score reduction differed, depending on the individual pig and the stimulus (WE and/or R848) used. Pig #2 responded better than pig #1, and the ameliorating effect of mapracorat was better for WE-02 then WE-01. In one preferred embodiment, a personalized medicine approach for individual patients may be performed, by performing methods described herein, including pretesting of the exudates of the patients against specific drugs, as described above.

[0878] FIG. 14: shows the translocation of the glucocorticoid receptor from the cytoplasm (C) of fibroblasts into the nucleus (N) as a measure of activity. The cells were incubated with graded compound concentrations and intracellular glucocorticoid receptor localization was determined by indirect immunofluorescence, using an antibody directed against the receptor. Both mapracorat and the active BI653048 show nuclear translocation at low concentrations (1-10 nM), while BI3047, the inactive stereoisomer of BI653048, is inactive up to 100 nM. Clobetasol as a positive control shows nuclear staining as well.

[0879] FIG. 15: the table shows the effects of 1 μM mapracorat on fibroblast proliferation in the presence of a high number of different wound exudates from chronic, non-healing skin wound of human patients. The level of proliferation in the presence of the respective WE was set to 100%, and formed the basis for the calculation of the effect of mapracorat. All values >120% (mean of WE control+2 SD) are considered growth promoting. In one preferred embodiment of the present invention, patients are preselected using methods of the present invention who are most likely to respond effectively to therapy in a personalized way, as described above.

[0880] FIG. 16: shows the inhibition of LPS-induced IL-8 secretion in U937 cells (A) and of spontaneous IL-8 secretion in human monocytes (B) in response to the active SEGRM mapracorat (filled circles), HY14234 (filled triangles) and BI653048 (filled squares), the inactive compound BI3047 (open squares) and, as a comparator, the glucocorticoid dexamethasone (filled diamonds). The active SEGRM inhibited both LPS-induced and spontaneous IL-8 secretion in U937 and primary human monocytes, respectively, while the inactive stereoisomer showed even induced IL-8 secretion at the highest concentrations. The comparator corticosteroid, dexamethasone, inhibited IL-8 in a similar fashion as the SEGRM, thus confirming the anti-inflammatory properties of these compounds.

EXAMPLES

Example 1: Assays Used in the Invention

Abbreviations

Abbreviation Description

[0881] DMSO Dimethylsulfoxide

[0882] FACS Fluorescence activated cell sorting

[0883] FCS Fetal calf serum

[0884] FDM Fibroblast-derived matrices

[0885] HaCaT Human keratinocyte cell line

[0886] HESS Hank's balanced salt solution

[0887] HDF Human dermal fibroblasts

[0888] HGF Hepatocyte growth factor

[0889] M-CSF Macrophage colony stimulating factor

[0890] PBS Phosphate buffered saline

[0891] RPM I Roswell Park Memorial Institute medium

[0892] SRB Sulforhodamine B

[0893] TGFbeta Transforming growth factor beta (TGF-β)

[0894] WE Wound exudate

[0895] The assays described in Examples 1.1 and 1.2 represent predictive models for skin wound healing. Most of the non-healing wound exudates (WE) obtained from a variety of patients inhibit proliferation of primary human fibroblasts (HDF) in the assay as described in Example 1.1 and also inhibit the formation of fibroblast-derived matrices (FDM) in 3D, as described in Example 1.2.

Example 1.1: Fibroblast Proliferation Assay: Measuring the Proliferation of Fibroblast Cells and the Secretion of IL-1β in the Presence of a Wound Exudate Sample Obtained from a Skin Wound, in Particular Chronic Human Skin Wounds

[0896] Primary human dermal fibroblasts (HDF) were purchased from CELLnTEC, Bern. They were routinely grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% FCS, 2 mM glutamine, and 100 U/ml penicillin/100 μg/ml streptomycin. Media, antibiotics, and glutamine were bought from Lonza. The cells were used at passage 5-15. Cells were trypsinized and seeded at 2500 cells/well in 30 μl into the inner wells of 384-well plates in the absence or presence of graded compound concentrations with or without different dilutions of sterile-filtered WE in medium. For control samples, 30 μl medium was added instead of specific stimuli. The outer wells were loaded with sterile water. The cells were incubated for 72 hours at 37° C.

[0897] At the end of the incubation period, supernatants were removed for the determination of IL-1β, and the cells were fixed with 4% paraformaldehyde (Morphisto) for 15 minutes at room temperature and washed 3 times with PBS. A control plate was fixed after the overnight adherence of the cells (day 1) to determine the starting cell number.

[0898] Total cellular protein was determined as a measure of cell number by staining the fixed cells with sulforhodamine B (SRB, Sigma). A 0.4% SRB solution in 1% acetic acid was added to the wells for 30 minutes. The wells were then washed with 1% acetic acid until the wash solution remained colorless. After drying, the dye was eluted with 10 mM Tris.HCl, pH8.5, and absorbance was measured either at 550 or 492 nm for lower and higher cell densities, respectively. The average absorbance of the sample representing the day 1 starting cell number was subtracted from the absorbance values of the WE-treated cells.

[0899] IL-1β levels were determined with a commercial ELISA kit. The amount of IL-1β contained in the wound exudate added to the cells was subtracted from the total IL-β in the supernatants in order to determine the cytokine secreted by the cells.

[0900] All experiments were carried out in triplicate for each sample and concentration, and means±standard deviation (SD) were used for the evaluation of the experiment. Results are expressed as percentage of control values for unstimulated cells.

[0901] The table in FIG. 15 shows the effects of 1 μM mapracorat on fibroblast proliferation in the presence of a high number of different wound exudates from chronic, non-healing skin wound of human patients. The level of proliferation in the presence of the respective WE was set to 100%, and formed the basis for the calculation of the effect of mapracorat. All values >120% (mean of WE control+2 SD) are considered growth promoting.

[0902] Further results are shown in Table 1 below:

TABLE-US-00005 TABLE 1 WE AZD1594 WE-04 100 1139  WE-05 100 203 WE-37 100 171 WE-03 100 161 WE-02 100 196 WE-77 100 128

[0903] The table shows the effects of 1 μM AZD7594 on fibroblast proliferation in the presence of a plurality of different wound exudates. The level of proliferation in the presence of the respective WE was set to 100%, and formed the basis for the calculation of the effect of AZD7594, which are given in % proliferation of respective WE controls. All values >120% (mean of WE control+2 SD) are considered growth promoting. The efficacy of AZD7594 was comparable to the effect of mapracorat (cf. FIG. 15).

Example 1.2: Measuring the Fibroblast-Derived Matrix Formation (FDM) by Fibroblast Cells: Measuring the Fibroblast-Derived Matrix Formation by Fibroblast Cells in the Presence of a Wound Exudate Sample Obtained from a Skin Wound, in Particular Chronic Human Skin Wound

[0904] Human dermal fibroblast (HDF) cells were seeded at 1250 cells/well on day −3 into 384-well tissue culture plates, which had been pre-coated for 1 hour at 37° C. with 0.2% gelatin solution (Sigma). When the cells reached confluence (=day 0), a matrix promoting supplement (vitamin C: 2-phospho-L-ascorbic acid trisodium salt, 100 μg/ml; Sigma) was added together with test samples containing TGF-β1 or graded concentrations of compounds −/+WE as described for the HDF proliferation assay. After 4 days, medium was replaced by fresh vitamin C- and stimulus- as well as compound-containing medium, maintaining the conditions initiated on day 0. TGF-β1 was included as a positive control to promote FDM formation. After a total incubation time of 7 to 8 days, FDM production was measured in fixed cultures via SRB staining and evaluated as described above. In some cases, the experiment was stopped and evaluated already on day 4.

[0905] Experimental results are for example shown in FIG. 12. FIG. 12 shows the effect of a plurality of SEGRM in 3D fibroblast culture with WE from patient #92. AZD7594 was the most active of the SEGRM tested in 3D culture, followed by mapracorat and BI653048. This is in line with their potencies for glucocorticoid receptor activation (EC50 values of 0.9 nM, 1.9 nM and 55 nM, respectively). The inactive BI3047, which is not a SEGRM, did not induce matrix formation.

Example 1.3: Keratinocyte Proliferation Assay: Measuring the Proliferation of Keratinocyte Cells in the Presence of a Wound Exudate Sample Obtained from a Skin Wound, in Particular Chronic Human Skin Wound

[0906] The HaCaT keratinocyte cell line was routinely cultured in DMEM containing 10% FCS, 2 mM glutamine, and 100 U/ml penicillin/100 μg/ml streptomycin. The proliferation assay was carried out as described for HDF cells. Primary human keratinocytes were grown in KBM medium (Lonza) containing 0.06 mM calcium and supplemented with growth factors (Lonza) on plastic coated with rat tail collagen (40 μg/ml; Gibco) or gelatin (0.2%; Sigma). No antibiotics were used. The proliferation assay was carried out as described for HDF cells.

Example 1.4: Primary Human Macrophage Stimulation Assay: Measuring Cytokine Production

[0907] Primary human macrophages were differentiated from monocytes, which had been isolated from peripheral blood mononuclear cells (PBMC). PBMC were isolated from buffy coats obtained from the Red Cross, Vienna, using LymphoPrep (Technoclone). 30 ml of buffy concentrate was diluted 1:2 with PBS, gently underlayered with 15 ml Lymphoprep in a 50 ml Falcon tube and centrifuged for 25 minutes at 1800 rpm at 21° C. The interphase was carefully transferred to a new Falcon tube and filled up to 50 ml with ice cold PBS. After another centrifugation step (10 minutes, 1200 rpm, 4° C.), the cell pellet was washed 3 times with PBS, resuspended in RPMI medium containing 20% FCS and 10% DMSO and frozen in liquid nitrogen. Monocytes were generated from frozen aliquots using positive selection with the CD14 Beads-Kit (Miltenyi) on an autoMACS-Sorter (Miltenyi) according to the manufacturer's instructions.

[0908] For culture and differentiation into macrophages, monocytes were seeded at 3-5×10.sup.6 monocytes/well in 6-well-plates (Nunc) and incubated with 20 ng/ml M-CSF (R&D Systems) in RPMI supplemented with 10% FCS, 2 mM glutamine, and 100 U/ml penicillin/100 μg/ml streptomycin in a total volume of 5 ml per well After 2 days, 2 ml of the supernatant were removed and replaced by 2.5 ml/well of fresh medium containing 20 ng/ml M-CSF. On the third day, microscopic examination revealed differentiation into adherent, frequently elongated cells.

[0909] The macrophages were harvested and re-seeded in 200 μl or 50 μl serum-free medium on 96-well or 384-well plates, respectively, combining cells with graded concentrations of test compounds in the absence or presence of various dilutions of sterile-filtered WE.

[0910] A combination of 100 ng/ml LPS (Sigma) and 50 ng/ml IFN-γ (PeproTech) served as positive control for the induction of cytokine secretion. For negative control samples, medium was added instead of specific stimuli.

[0911] After 24 hours, the supernatants were transferred to fresh plates and frozen at −20° C. for future cytokine analysis (IL-1α, IL-1β, TNF-α). The cytokine concentrations of the input WE were subtracted from the supernatant levels in order to calculate WE-induced cytokine stimulation.

Example 1.5

[0912] Human monocyte-dermal fibroblast co-cultures as in vitro models that reflect macrophage behavior in human skin: measuring (a) the amount(s) of one or more M1 marker(s) and one or more M2 marker(s) in the supernatant of macrophages incubated with a wound exudate sample obtained from a skin wound, wherein the macrophages are in co-culture with fibroblasts, and (b) measuring the amount(s) and/or frequency distribution(s) of one or more M1 cell surface marker(s) and one or more M2 cell surface marker(s) on macrophages incubated with a wound exudate sample obtained from a skin wound, wherein the macrophages are in co-culture with fibroblasts, (c) measuring the expression level(s) of one or more M1 marker mRNA(s) and one or more M2 marker mRNA(s) in macrophages incubated with a wound exudate sample obtained from a skin wound, wherein the macrophages are in co-culture with fibroblasts and (d) the amount(s) of one or more cytokine markers selected from IL-1alpha, IL-1beta and TNF-alpha in the supernatant of macrophages incubated with a wound exudate sample obtained from a skin wound, wherein the macrophages are in co-culture with fibroblasts

[0913] CD14.sup.+ monocytes, isolated from PBMC of healthy donors by magnetic bead separation were incubated either alone or in the presence of primary human dermal fibroblasts (CellNTec) or fibroblast-derived matrices (FDM). FDM had been generated from primary human dermal fibroblasts by a 3-week incubation with the growth supplements vitamin C or insulin and EGF (vitamin C: 2-phospho-L-ascorbic acid trisodium salt, 100 μg/ml; human EGF, 5 ng/ml; human insulin, 5 μg/ml). Alternatively, fibroblast monolayer cultures can be used as well. After 4 days to a week to allow for macrophage differentiation in the presence or absence of M-CSF (25 ng/ml), the cultures were stimulated overnight with graded concentrations of test compounds in the absence or presence of various dilutions of sterile-filtered WE. IFN-γ (50 ng/ml), LPS (100 ng/ml) and IL-4 (25 ng/ml) or combinations thereof served as controls for M1 and M2 macrophage induction. For negative control samples, medium was added instead of specific stimuli. WE with and without compounds were added to the culture medium for overnight stimulation at dilutions ranging from 1:25 to 1:100.

[0914] Supernatants were harvested and frozen for cytokine determination by ELISA, and cells were harvested and subjected to FACS analysis, gating on the monocyte population. Geometric means or mean fluorescence intensities (MFI) were used to quantify surface marker expression.

[0915] There are 2 possibilities for evaluation: a) the % of cells positive for a given marker within a population, which is the most commonly used readout in FACS analysis, or b) the quantity of cell surface expression (as surrogate for the number of labelled molecules on the cell surface per individual cell), as measured by the mean fluorescence intensity.

[0916] Specific mRNA levels are determined as ratios compared to a housekeeping gene; the values obtained are “expression relative to housekeeping gene”.

[0917] The following readouts were used:

[0918] FACS: CD38, CD64 and CD197 for M1 macrophages, CD200 receptor (CD200R), CD206 and CD209 for M2 macrophages, CD163 as a marker of macrophage differentiation. Ratios of M1/M2 cell surface marker expression were calculated.

[0919] ELISA: CXCL10 and IL-23p19 for M1 macrophages and CCL22 and CCL18 as M2 macrophage markers, IL-1alpha, IL-1beta and TNF-alpha as pro-inflammatory markers indicative of an M1 phenotype.

[0920] mRNA: CD38, CD64 CD38, CD64 and CD197 for M1 macrophages, CD200 receptor (CD200R), CD206 and CD209 for M2 macrophages, CD163 as a marker of macrophage differentiation.

Example 1.6: Determination of CCL18

[0921] CCL18 in WE and in macrophage supernatants was determined in F96 Maxisorp Nunc Immune plates (Nunc, #439454) using the hCCL18/PARC DuoSet ELISA Kit from R&D Systems (#DY394) according to the manufacturer's instructions. Enzyme reaction and measurement were performed as described for IL-1α.

Example 1.7: Analysis of Macrophage Surface Markers by Flow Cytometry

[0922] Cells were harvested and resuspended in FACS buffer (PBS containing 2% FCS). Unspecific antibody binding was prevented by incubation with human Trustain FCR blocking solution (Biolegend, #422302) on ice for 10 minutes. The following fluorochrome-conjugated antibodies from eBioscience (now ThermoFisher Scientific) were used to detect specific surface markers by staining on ice for 30 minutes: CD38-PerCPeFluor710 (#46-0388-42), CD197-APC (#17-1979-42), CD206-AF488 (#53-2069-42), CD209-PerCP Cy5.5 (#45-2099-42). Co-staining with CD45 eFluor (#506 69-0459-42) was used to distinguish macrophages from primary human fibroblasts when analyzed from co-cultures. After washing cells with FACS buffer, they were fixed with 1% paraformaldehyde in PBS and stored at 4° C. in the dark until data were acquired on a Gallios flow cytometer from Beckman Coulter and analyzed with the Kaluza analysis software 1.3.

Example 1.8: Analysis of mRNA Expression in Fibroblast Cultures

[0923] Cells were seeded into 24-well plates and incubated with compounds in the presence or absence of wound exudates for 72 hours. Total RNA was isolated using the RNeasy Mini Kit (QIAGEN #74106) according to the manufacturer's protocol. RNA integrity and concentration for each sample was confirmed and measured with the Qubit fluorometer. Each RNA sample was then diluted to 2 ng/μl in nuclease-free doubly distilled water.

[0924] 20 ng of total RNA were reverse-transcribed into cDNA and immediately subjected to PCR amplification using the SuperScript III Platinum One-Step Quantitative RT-PCR System with ROX (Invitrogen #11745). qRT-PCR amplifications were performed in 20 μl reactions containing 9 μl 2× Reaction Mix with ROX, 0.4 μl SuperScript III RT/Platinum Taq Mix and 1 μl primer (final: 900 nM, Taqman Gene Expression Assay, Applied Biosystems)

[0925] The program included 30 minutes of reverse transcription at 48° C., an initial denaturation for 5 minutes at 95° C. followed by 40 cycles of denaturation at 95° C. for 15 seconds and annealing at 60° C. for 60 seconds. Reactions were set up in 96-well format PCR plates (Peqlab #732-2879) and carried out in a Mx3005P Real-Time PCR Detection System (Stratagene).

[0926] TaqMan Gene Expression Assays (Applied Biosystems) were used, which include preoptimized probe and primer sets specific for the genes being validated. The sequences and ID numbers are listed below:

TABLE-US-00006 EF1a AAGTGCTAACATGCCTTGGTTCAAG Hs00265885_g1 Collagen 1a AAGACGAAGACATCCCACCAATCAC Hs00164004_m1 Collagen 3a GAACTCAAGAGTGGAGAATACTGGG Hs00943809_m1 IL1β CAGATGAAGTGCTCCTTCCAGGACC Hs01555410_m1

[0927] The house keeping gene elongation factor 1a (EF1a) was used as a reference gene. Normalized expression was calculated using the comparative Ct (or ΔCt) method, and fold changes were derived from the 2-ΔΔCt values for each gene. Graphs were prepared using relative Ct values that were calculated by subtracting the EF1a Ct values from the corresponding Ct values for the gene being measured.

Example 1.9: Delayed Wound Healing in a Pig Model

[0928] The animal experiments were approved by governmental authorities. Two young farm pigs (10-12 kg) were anesthetized and full-thickness excisional wounds were developed using a 6 mm biopsy punch. During the first 5 days after wounding, the wounds were stimulated with a) 0.05% R848 (resiquimod) and 50 μl human wound exudate, b) 0.05% R848 and human serum or c) human serum alone. R848 was applied in the mornings and exudate and serum 6 hours later, in 50 μl of solutions gelified by the addition of 2% HPMC.

[0929] On days 6-10, wounds were treated once daily with mapracorat or vehicle (50% PG/47.5% H.sub.2O/0.5% Tween 80/2% HPMC). The wounds were clinically scored daily. The total wound score (maximum score=21) consisted of wound appearance (dry vs. moist), size, wound content, pus, crust, erythema intensity, erythema width, swelling and necrosis. Reported values are individual values for each of the 2 pigs.

Example 1.10: Translocation of the Glucocorticoid Receptor from the Cytoplasm into the Nucleus in Primary Human Fibroblasts

[0930] Primary human fibroblasts were seeded into 384-well plates, as described in Example 1.1., using 2500 cells/well in a total volume of 50 μl. After adherence for 24 hours, the cells were serum-starved overnight and then incubated for 45 minutes at 37° C. with graded concentrations of SEGRMs or corticosteroids as positive controls. The cells were then fixed with 4% paraformaldehyde for 10 minutes at room temperature, followed by permeabilization with 0.5% Triton X100 in PBS in 1% BSA, for 10 minutes at room temperature. They were stained with a mouse-anti-glucocorticoid receptor monoclonal antibody (CellSignaling #47411) or mouse IgG1-kappa isotype control (e-Bioscience #14-4714) and developed with Alexa Fluor donkey-anti-mouse IgG (Molecular Probes #A21202). Cells were examined in on Olympus CKX53 fluorescence microscope and evaluated based on the localization of the glucocorticoid receptor: predominantly nuclear (N), nuclear+cytoplasmic (N/C) or predominantly cytoplasmic (C).

[0931] The results are shown in Table 2 below:

TABLE-US-00007 TABLE 2 100 nM 10 nm 1 nM 0.1 nM AZD7594 N N N N/C CORT108297 N N N/C C HY14234 N N N N/C Mapracorat N N N N/C ZK216348 N N N N/C BI353048 N N N C BI3047 C/N C C C

[0932] The table shows the translocation of the glucocorticoid receptor from the cytoplasm (C) of fibroblasts into the nucleus (N) as a measure of activity. The cells were incubated with graded compound concentrations and intracellular glucocorticoid receptor localization was determined by indirect immunofluorescence, using an antibody directed against the receptor. The localization of the glucocorticoid receptor at compound concentrations ranging from 0.1 to 100 nM is indicated by N (nucleus), N/C (nucleus>cytoplasm), C/N (cytoplasm>nucleus) and C (cytoplasm).

Example 1.11: Primary Human Monocyte Cytokine Secretion Assay

[0933] Primary human monocytes were prepared from peripheral blood mononuclear cells (PBMC). PBMC were isolated from buffy coats obtained from the Red Cross, Vienna, using LymphoPrep (Technoclone). 30 ml of buffy concentrate was diluted 1:2 with PBS, gently underlayered with 15 ml Lymphoprep in a 50 ml Falcon tube and centrifuged for 25 minutes at 1800 rpm at 21° C. The interphase was carefully transferred to a new Falcon tube and filled up to 50 ml with ice cold PBS. After another centrifugation step (10 minutes, 1200 rpm, 4° C.), the cell pellet was washed 3 times with PBS, resuspended in RPMI medium containing 20% FCS and 10% DMSO and frozen in liquid nitrogen. Monocytes were generated from frozen aliquots using positive selection with the CD14 Beads-Kit (Miltenyi) on an autoMACS-Sorter (Miltenyi) according to the manufacturer's instructions.

[0934] Cells were seeded at 8×10.sup.5/ml in 50 μl/well of a 384-well plate and combined cells with graded concentrations of test compounds. After 16 hours, the supernatants were transferred to fresh plates and frozen at −20° C. for IL-8 analysis, using a commercial ELISA kit.

Example 1.12: U937 Cell Stimulation Assay

[0935] The human monocytic cell line 0937 (ATCC CRL 1593) was routinely grown in RPMI 1640 supplemented by 10% FCS and 2 mM glutamine, and 100 U/ml penicillin/100 μg/ml streptomycin. Cells were seeded at 4×10.sup.5/ml in 50 μl/well of a 384-well plate and combined cells with graded concentrations of test compounds and LPS at 100 ng/ml. After 16 hours, the supernatants were transferred to fresh plates and frozen at −20° C. for IL-8 analysis, using a commercial ELISA kit.

Wound Exudates

[0936] Wound exudates (WE) from venous, arterial, pressure and diabetic ulcers as well as surgical wounds were harvested either in gel-free containers after negative pressure therapy or by swabbing with Nylon-flocked swabs (Copan #502CS01). Informed patient consent had been obtained according to the Declaration of Helsinki.

Test Compounds

[0937] Low molecular weight compounds (see list in Table 3) were dissolved in DMSO (Bioreagent for cell culture, Sigma) at 10 mM or 100 mM and diluted at least 1:1000 in medium for cellular assays (final DMSO concentration ≤0.1%). Compounds were typically tested in logarithmic (1:10) or half-logarithmic (1:3.33) dilution series, starting at 10 μM or 100 μM as the highest compound concentration.

[0938] Cells were incubated with compounds for 72 hours in proliferation assays and up to 8 days for FDM assay (refreshed after 4 days). When compounds were tested for their effect on WE stimulation, the incubation of cells with compounds was started and ended simultaneously with WE-incubation.

TABLE-US-00008 TABLE 3 List of low molecular weight compounds for cellular assays Compound Source Dexamethasone 21- Sigma-Aldrich acetate BI-653048 Boehringer Ingelheim BI-3047 Boehringer Ingelhelm Mifepristone MedChem Express Prednisolone Sigma-Aldrich Mapracorat MedChem Express ZK216348 Axon Medchem HY14234 MedChem Express AZD7594 MedChem Express