VIRUS-BASED REPLICON FOR PLANT GENOME EDITING WITHOUT INSERTING REPLICON INTO PLANT GENOME AND USES THEREOF
20220049263 · 2022-02-17
Inventors
- Jae Yean Kim (Gyeongsangnam-do, KR)
- Tien Van Vu (Gyeongsangnam-do, KR)
- Jihae Kim (Gyeongsangnam-do, KR)
- Se Jeong Jeong (Gyeongsangnam-do, KR)
- Hyun Jeong Kim (Gyeongsangnam-do, KR)
- Seo-Jin PARK (Gyeongsangnam-do, KR)
- Mil Thi Tran (Gyeongsangnam-do, KR)
- Velu Sivankalyani (Gyeongsangnam-do, KR)
- Yeon Woo Sung (Gyeongsangnam-do, KR)
- Thi Hai Duong DOAN (Gyeongsangnam-do, KR)
- Dibyajyoti PRAMANIK (Gyeongsangnam-do, KR)
- Mahadev Rahul SHELAKE (Gyeongsangnam-do, KR)
- Geon Hui SON (Gyeongsangnam-do, KR)
Cpc classification
C12N2750/12043
CHEMISTRY; METALLURGY
International classification
Abstract
A recombinant vector according to an embodiment is for genome editing without inserting a replicon into the plant genome in a T.sub.0 generation plant. The recombinant vector includes a geminivirus-based replicon between the sequence of LB (left border) and sequence of RB (right border) of Ti plasmid. A method of genome editing without inserting a replicon into the plant genome in a T.sub.0 generation plant according to an embodiment includes transforming a plant cell by inserting a foreign gene to the aforementioned recombinant vector.
Claims
1. A recombinant vector for genome editing without inserting a replicon into plant genome in a T.sub.0 generation plant, the recombinant vector including a geminivirus-based replicon between the sequence of LB (left border) and sequence of RB (right border) of Ti plasmid.
2. The recombinant vector according to claim 1, wherein the geminivirus is BeYDV (Bean Yellow Dwarf Virus) or MSV (Maize Streak Virus).
3. The recombinant vector according to claim 1, wherein the replicon has LIR (long intergenic region); promoter; Rep/RepA protein-coding sequence; terminator; SIR (short intergenic region); MCS (multiple cloning site) to which a foreign gene to be expressed can be inserted; SIR; and LIR that are sequentially connected.
4. The recombinant vector according to claim 3, wherein the MCS consists of the restriction enzyme BsmBI, AarI, or BpiI.
5. The recombinant vector according to claim 3, wherein the replicon consists of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
6. A method of genome editing without inserting a replicon into the plant genome in a T.sub.0 generation plant, the method comprising transforming a plant cell by inserting a foreign gene to the recombinant vector of claim 1.
7. A composition for genome editing without inserting a replicon into the plant genome in a T.sub.0 generation plant, the composition comprising the recombinant vector of any one of claim 1 as an effective component.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
DETAILED DESCRIPTION
[0017] To achieve the purpose described above, the present invention provides a recombinant vector for genome editing without inserting a replicon into the plant genome in a T.sub.0 generation plant, said recombinant vector including a geminivirus-based replicon between the sequence of LB (left border) and sequence of RB (right border) of Ti plasmid.
[0018] As described herein, the term “recombinant” indicates that, in a cell, an exogenous nucleotide is replicated or expressed, or a peptide, an exogenous peptide, or a protein encoded by an exogenous nucleotide is expressed. A recombinant cell can express a gene or a gene fragment, which is not found in the natural-state cell, in the form of a sense or antisense. In addition, the recombinant cell can express a gene that is found in the natural state, but the gene has been modified and re-introduced into the cell by an artificial means.
[0019] As described herein, the “vector” is used for indicating a means for delivering DNA fragment(s) or genetic molecules to cells. Vector allows independent replication of DNA and it can be re-produced in host cells. The term “delivery vehicle” is used interchangeably with “vector”. The term “expression vector” means a recombinant vector that contains a target coding sequence and a suitable gene sequence essentially required for expressing an operably-linked coding sequence in a specific host organism. The recombinant vector indicates a bacteria plasmid, a phage, a yeast plasmid, a plant cell virus, a mammalian cell virus, or other vector. In general, as long as it can be replicated and stabilized in a host, any plasmid or vector can be used.
[0020] With regard to the recombinant vector according to one embodiment of the present invention, the geminivirus can be BeYDV (Bean Yellow Dwarf Virus) or MSV (Maize Streak Virus), but it is not limited thereto. BeYDV is used for producing a replicon for a dicot plant and MSV is used for producing a replicon for a monocot plant.
[0021] With regard to the recombinant vector of the present invention, the replicon may have LIR (long intergenic region); promoter; Rep/RepA protein-coding sequence; terminator; SIR (short intergenic region); MCS (multiple cloning site) to which a foreign gene to be expressed can be inserted; SIR; and LIR that are sequentially connected, but it is not limited thereto.
[0022] In virus, LIR can play a role of replication origin and promoter and SIR can play a role of terminator.
[0023] In general, the smaller the replicon size is, the higher the copy number is obtained, and since a higher probability of homologous recombination is obtained as the copy number of a template increases, the constitution of the replicon can be controlled by considering various factors.
[0024] With regard to the recombinant vector according to one embodiment of the present invention, the replicon can be a replicon consisting of the nucleotide sequence of BeYDV-based SEQ ID NO: 1 or a replicon consisting of the nucleotide sequence of MSV-based SEQ ID NO: 2, but it is not limited thereto.
[0025] As described herein, the term “replicon” means a replication unit capable of having voluntary control, and the replication unit is a continuous DNA molecule in which the replication is initiated at specific site within a molecule and terminated after sequential progress. All of the plasmid, viral DNA, and bacterial chromosome are a single replication unit.
[0026] It was shown by Baltes et.al. (2014, Plant Cell 26 (1):151-163) that, according to amplification of a HR (homologous recombination) template by using ZFN (Zinc Finger Nuclease) and geminivirus-based virus replicon, the HR efficiency can be remarkably improved in a tobacco plant. The geminivirus replicon containing ZFN and HR template was added in T-DNA and, after the introduction to a tobacco plant mediated by Agrobacterium and rolling-circle replication, a replicon in circular form is produced and, according to induction of DSB in defective GUS target gene by expressing ZFN, HR is induced to occur by the HR template added in the replicon.
[0027] With regard to the replicon of the present invention, the aforementioned MCS may be composed of a restriction enzyme such as BsmBI, AarI or BpiI, but it is not limited thereto. The restriction enzyme such as BsmBI, AarI or BpiI is a Type IIs restriction enzyme for Golden gate cloning.
[0028] The genome editing based on the use of a virus-based replicon may allow genome editing based on the mechanism of homologous recombination.
[0029] In the aforementioned MCS according to the present invention, a template DNA sequence for genome editing can be cloned. Alternatively, a template DNA sequence for genome editing; a sequence encoding one or more nucleic acid hydrolases selected from a group consisting of Cas9 (CRISPR associated protein 9), Cpf(CRISPR from Prevotella and Francisella 1), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease), and their functional homologs; and a guide RNA for inducing the nucleic acid hydrolase to a target genome site desired for editing, or the like can be cloned in the MCS, but it is not limited thereto.
[0030] As a result of comparing the efficiency of homologous recombination depending on a difference between Cas9 and Cpf1, the inventors of the present invention found that Cpf1 has higher efficiency of homologous recombination events than Cas9.
[0031] The present invention further provides a method of genome editing without inserting a replicon into the plant genome in a T.sub.0 generation plant in which the method includes transforming a plant cell by inserting a foreign gene to the recombinant vector of the present invention.
[0032] The recombinant vector of the present invention is the same as described above. As the replicon is removed from T.sub.0 event cells in which genome editing has occurred, it is found that effective genome editing can be achieved even in crops propagated by vegetative reproduction instead of sexual reproduction.
[0033] The replicon according to one embodiment of the present invention can be a replicon consisting of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, but it is not limited thereto.
[0034] The present invention still further provides a composition for genome editing without inserting a replicon into the plant genome in a T.sub.0 generation plant in which the composition comprises the recombinant vector of the present invention as an effective component. As the composition of the present invention comprises, as an effective component, a recombinant vector including virus-based replicon, which allows an editing event of a target gene without having the replicon itself inserted to the plant genome, only the editing of the desired gene can be achieved without having insertion of the replicon to genome in T.sub.0 generation plant.
[0035] Hereinbelow, the present invention is explained in detail in view of the Examples. However, it is evident that the following Examples are given only for exemplification of the present invention and by no means the present invention is limited to the following Examples.
Materials and Methods
1. Experimental Materials
[0036] Materials used in the present invention are described in the following Table 1.
TABLE-US-00001 TABLE 1 Experimental materials, reagents, and tools used in the present invention Name Source Plant Tomato variety Cultivar Hongkwang Local company Bacteria Escherichia coli 10-beta NEB, USA Agrobacterium tumefaciens GV3101::pMP90 Kyungsang Univ., South Korea DNA vector pTC147 Addgene, USA pTC217 Addgene, USA pControl 2.6 (8161.1) Vector kept in the lab Golden Gate tool kit Addgene, USA MoClo Tool kit Addgene, USA Reagents dNTPs ThermoFisher Scientific, USA Phusion Taq DNA polymerase ThermoFisher Scientific, USA Pfu DNA polymerase ThermoFisher Scientific, USA T4 DNA ligase NEB, USA Restriction enzymes (BpiI, BsaI and others) NEB, USA T7E1 endonuclease NEB, USA Plant hormones; Acetosyringone; Hydrocarbon; Sigma, USA; β-D Glucuronide (X-Gluc); Chemicals for plant DUCHEFA Biochemie B.V., Netherland tissue culture; MS salts and vitamins; MS salts and B5 vitamins, PhytoAgar, Maltose. Water Treated with Millipore system Kit CloneJET ™ PCR cloning ThermoFisher Scientific, USA Plasmid DNA isolation kit (mini and midi) BIOFACT, South Korea; Qiagen, Germany Total genomic DNA isolation kit (mini preps) Qiagen, Germany
2. Cloning
2.1 DNA Fragment Amplification by Using PCR
[0037] By using Phusion Taq polymerase (high fidelity) according to the manufacturer's protocol, PCR reaction was carried out after mixing a specific primer (final conc. 0.4 μM), dNTPs (final conc. 0.2 mM), and a template (10 to 20 ng of genomic DNA or 0.1 to 0.5 ng of purified DNA/reaction). As for the water used for PCR reaction, water having electric conductivity of less than 2 μS/cm and being free of DNase, RNase, or protease was used. The PCR product was identified by loading onto 0.8% agarose gel. After excising the gel at the part of a band with the expected size, it was purified by using QIAquick Gel Extraction Kit (Qiagen). The concentration of the PCR product was measured by using Nanodrop 2.0 (ThermoFisher Scientific).
2.2 Golden Gate Digestion-Ligation Setup
[0038] Conditions of the enzyme treatment (digestion) and ligation for Golden gate assembly were set as those described in the following Table 2.
TABLE-US-00002 TABLE 2 Conditions of Digestion-Ligation Components Required amount (fmol) 1× 10 × T4 DNA buffer 1.5 Insert 20 x Vector 13 y T4 DNA ligase 0.5 BsaI or BpiI or BsmBI 0.5 H.sub.2O up to 15 Total 15 (μl)
[0039] For a case in which BsaI or BpiI is used, the reaction program for gene amplification is the same as those described in the following Table 3. For a case in which BsmBI is used, the reaction program for gene amplification is the same as those described in the following Table 4.
TABLE-US-00003 TABLE 3 Conditions of amplification reaction (BsaI or BpiI) Temperature Time Repetition Stage (° C.) (minutes) number Remarks 1 37 15 1 Pre-digestion 2 37 2 25-40 Digestion-ligation 16 5 3 37 5 1 Post-digestion 4 50 5 1 Post-digestion 5 80 5 1 Denaturation
TABLE-US-00004 TABLE 4 Conditions of amplification reaction (BsmBI) Temperature Time Repetition Stage (° C.) (minutes) number Remarks 1 42 15 1 Pre-digestion 2 42 2 25-40 Digestion-ligation 16 5 3 42 5 1 Post-digestion 4 50 5 1 Post-digestion 5 80 5 1 Denaturation
2.3 Escherichia coli Transformation
[0040] Escherichia coli 10β strain was transformed with the digestion-ligation mixture. After that, the transformed Escherichia coli and 15 μl of XGAL (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside, 20 mg/ml) were spread on an LB solid medium containing 125 mg/ml carbenicillin or ampicillin. After culture overnight, white positive colonies were identified.
[0041] To determine the construct ratio within the colony, for each construct, white colonies were inoculated to an LB liquid medium containing 50 mg/L streptomycin (for identifying level 0 cloning), an LB liquid medium containing 125 mg/L carbenicillin (for identifying level 1 cloning), or an LB liquid medium containing 50 mg/L kanamycin (for identifying level 2 or 3 cloning) followed by culture. Then, plasmids were isolated and treated with a suitable restriction enzyme. Colonies containing the plasmid, which exhibits the expected cut size, were classified into separate positive clones.
2.4 Sequencing
[0042] Solgent (South Korea) was requested to carry out sequencing of the clones, two positive clones for each construct. Results of the sequencing were analyzed first, and then the cloning was carried out.
3. Construction of BeYDV (Bean Yellow Mosaic Virus)-Based Replicon Receptor Vector
[0043] To construct level 2 vector containing BeYDV replicon with Rep/RepA, which has been adjusted for expression, within LIR-SIR-LIR (i.e., for using the vector as Golden gate level 2 receptor), BpiI cloning site (TGCC..GGGA) was inserted between LIR-SIR and LIR. LIR-SIR and LIR were used after they have been cloned from pLSLR vector.
[0044] For the cloning reaction of pLSL, which is a vector containing LIR-SIR-LIR with BpiI cloning site between SIR-LIR, the following DNA fragment was sequentially assembled by using BpiI to generate a sticky end followed by ligation using T4 DNA ligase:
[0045] a) PCR product: BpiI (TGCC)-LIR-SIR- (TGCC) BsaI. (GCAA)BpiI
[0046] b) PCR product: BpiI (GCAA).BsaI (GGGA)-LIR-BpiI (ACTA)
[0047] c) pICH41744 end linker vector: BpiI (ACTA)-L3E- (GGGA)BpiI
[0048] d) Level 2 acceptor: pAGM4673 or pAGM4723 (TGCC..GGGA).
[0049] After that, for cloning pLSL.MCS1 containing MCS (multicloning site) between LIR-SIR, the following DNA fragment was ligated by integration at MCS1 site of pLSL vector:
[0050] a) pLSL cleaved by AscI and BstXI.
[0051] b) MCS1 (MCSf1 and MCSr1 were mixed and annealed).
[0052] After that, to construct a vector (pLSL.Ly) having lycopene-expressing cassette as a cloning marker introduced to pLSL.MCS1, the following DNA fragment was ligated:
[0053] a) pLSL.MCS1 cleaved by BpiI.
[0054] b) pAGM4723 cleaved by BpiI and separated lycopene fragment.
[0055] After that, for cloning pLSL.R.Ly vector in which Rep/RepA coding sequence has been cloned under the control of LIR, the following DNA fragment was ligated inside the replicon:
[0056] a) pLSL.Ly cleaved by BsaI.
[0057] b) Rep/RepA PCR product produced by RRA-F4/RRA-R4 primer.
[0058] A construct containing crRNA, 35S-Cpf1, donor template, or the like in which genes relating to the production of lycopene (i.e., Ly) are removed from the pLSL.R.Ly vector (
4. Tomato Transformation
[0059] Cotyledon explant originating from tomato (Hongkwang variety) cultivated under in vitro conditions was transformed by using Agrobacterium containing the construct of the present invention. Briefly, sterilized seeds of Hongkwang variety were cultured for 7 days under light/dark cycle of 16 hour-light/8 hour-dark, 25±2° C. conditions in 1/2x MSO medium (2.2 g MS salts+B5, 20 g sucrose, 0.5 g MES (pH=5.7), 7.5 g agar for 1 L). Thereafter, seedlings were collected and cotyledon leaves were cut to a size of 0.2 to 0.3 cm. Each fragment (i.e., explant) was then subjected to a pre-treatment by applying it for 1 hour to a flat plate medium containing PREMC media (2.2 g MS salts+B5, 30 g maltose, 0.1 g Ascorbic acid, 1.952 g MES, 0.2 mg IAA (pH=5.5), 7.5 g agar for 1 L; after sterilizing the mixture, it was added with 1.0 mg Zeatin trans-isomer, 1 ml Putrescine (1 mM), and 100 μM acetosyringone (AS)). Tiny holes were created on the pre-treated explant by poking, and, according to a reaction for 20 minutes at room temperature with Agrobacterium tumefaciens GV3101::pMP90 strain comprising the construct of the present invention, the transformation was carried out. Agrobacterium GV3101::pMP90 strain used for the transformation was subjected to overnight primary culture under stirring at 30° C. in an LB medium containing appropriate antibiotics. Then, from the culture broth which has an OD.sub.600 value of 0.6 to 0.8 or so, cells were collected by centrifuge. Cell pellets were suspended in an ABM-MS liquid medium containing 200 μM AS, and then used for the transformation of tomato explant.
[0060] The tomato explant transformed with the Agrobacterium was transferred to a co-culture medium (ABM-MS medium, 8 g/L agar, 200 μM AS) and cultured for 2 days at 25° C. After transfer to a non-selective medium (NSEL) followed by culture for 5 days, the explant was transferred again to a selective medium (SEL5) followed by culture. The subculture of the explant transformed in selective medium was carried out with an interval of 10 days to have the optimum regeneration efficiency. Once the new shoot has sufficient length (1.5 to 3.0 cm), it was transferred to a medium for rooting to induce growth to a complete plant. The complete plant grown in the medium for rooting was then transferred to a vermiculite pot and solidified before it is transferred again to the soil in greenhouse which is under the light/dark cycle of 16 hour-light/8 hour-dark, 26±2° C. temperature.
TABLE-US-00005 TABLE 5 Composition of medium used for culturing tomato explant AMB (for 1 L) MS (for 1 L) ABM-MS NSEL (for 1 L) SEL5 (for 1 L) K.sub.2HPO.sub.4: 2.212 g MS salts + B5 Mix ABM and MS salts + B5 MS salts + B5 KH.sub.2PO.sub.4: 1.130 g vitamins: 2.2 g MS as 1:1 ratio. vitamins: 4.4 g vitamins: 4.4 g NH.sub.4NO.sub.3: 1.496 g Sucrose: 5 g For semisolid MES: 0.976 g MES: 0.976 g KCl: 0.149 g pH = 5.5 ABM-MS, add Maltose: 30 g Maltose: 30 g MgSO.sub.4: 0.308 g 8 g/L of agar. IAA: 0.2 mg IAA: 0.5 mg CaCl.sub.2: 0.015 g Autoclave then pH = 5.7 pH = 5.7 FeSO.sub.4: 0.003 g add: Agar: 8 g Agar: 8 g Glucose: 20 g Zeatin trans- Autoclave then Autoclave then add: MES: 3.904 g isomer: 1.0 mg/L add: Zeatin trans-isomer: pH = 5.5 IAA: 0.2 mg/L Zeatin trans- 2.0 mg putrescine isomer: 2.0 mg Kanamycin: 80 mg (1 mM): 1 ml Timentin: 300 Timentin: 300 mg AS (200 μM) mg Putrescine (1 mM): Putrescine l ml (1 mM): 1 ml
5. Analysis of T.SUB.0 .Tomato Transformant
[0061] Leaves of the tomato transformant were collected and, by using DNeasy Plant mini kit (Qiagen) according to the manufacturer's protocol, total genomic DNA was extracted. The occurrence of the homologous recombination event in T.sub.0 plant was determined by PCR analysis using the extracted gDNA as a template and the primers that are specific to the left or right junction of the replicon. By determining the existence of a circular DNA, the presence or absence of the replicon inside T.sub.0 event plant was examined. The Actin gene was employed as an internal reference gene. To determine the sequence which has been exchanged via the homologous recombination with replicon junction, the sequence of the PCR product was analyzed by Sanger method.
TABLE-US-00006 [TABLE 6] Information of primers used for PCR analysis for determining an occurrence of homologous recombination by replicon and the presence or absence of replicon product Target Primer Sequence (5′.fwdarw.3′) size Left UPANT1-F1 TGCGATGATCTACGGTAACA 1485 bp junction AA (SEQ ID NO: 4) NPTII-R1 GCGTGCAATCCATCTTGTTC (SEQ ID NO: 5) Right ZY010F ACGTAAGGGATGACGCACA 1380 bp junction (SEQ ID NO: 6) TC140R TACCACCGGTCCATTCCCTA (SEQ ID NO: 7) ANT1 TC140F GGAAAATGGCATCTTGTTCC 1056 bp control C (SEQ ID NO: 8) TC140R TACCACCGGTCCATTCCCTA (SEQ ID NO: 7) Replicon GR-F1 TTGAGATGAGCACTTGGGAT 557 bp AG (SEQ ID NO: 9) pCf.ANT1-R4 ACCTCAACGACGCAAGTATT (SEQ ID NO: 10)
Example 1. Determination of the Presence or Absence of Replicon in T.SUB.0 .Tomato Transformant
[0062] As a result of performing transformation of a tomato plant by using the virus-based replicon of the present invention, it was found that, from the all sixteen T.sub.0 tomato plants tested, a PCR amplification product for the right junction was identified, indicating that homologous recombination has occurred in the all sixteen plants. From ten plants, a PCR amplification product for the left junction was also identified, indicating that complete homologous recombination has occurred in those ten plants. Interestingly, a circular DNA was identified only from two plants (i.e., C11 and C117) among the sixteen plants, and thus it was recognized that, in the remaining fourteen plants, the replicon used for transformation is not inserted into the genome of T.sub.0 event plant (
[0063] A sequence listing electronically submitted with the present application on Mar. 9, 2021 as an ASCII text file named 20210309_Q49321GR02_TU_SEQ, created on Mar. 9, 2021 and having a size of 9,000 bytes, is incorporated herein by reference in its entirety.