ADENO-ASSOCIATED VIRUS VECTORS FOR THE DELIVERY OF THERAPEUTICS

20220047618 · 2022-02-17

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided herein are methods for selectively delivering therapeutics to the eye using AAV vectors. For example, the cornea can be specifically targeted using the methods described. Also provided herein are compositions comprising AAV vectors packaged with CRISPR complexes, which can be delivered directly to the eye, for example the cornea, and in particular the cornea endothelium. Diseases and conditions comprising abnormalities or deterioration of tissues in the eye, such as the cornea endothelium (e.g. FECD), can be treated using the methods and compositions described herein.

Claims

1-168. (canceled)

169. A method of expressing a protein in an eye of a subject in need thereof comprising: a) providing one or more adeno-associated (AAV) vectors comprising a nucleotide sequence that encodes said protein; and b) administering the AAV vector to the eye.

170. The method of claim 169, wherein said protein is preferentially expressed in the cornea as compared with other tissues or cells in the eye.

171. The method of claim 169, wherein the AAV vector serotype is selected from the group consisting of AAV5, AAV6, and AAV8.

172. The method of claim 169, wherein the AAV vector serotype is AAV6.

173. The method of claim 169, wherein the protein is selected from the group consisting of: a Cas protein, a transcription factor, a collagen, a nuclease and a fluorescent protein.

174. The method of claim 169, wherein the protein is transcription factor 4 (TCF4).

175. The method of claim 169, wherein the vector is administered to the subject via injection into the eye.

176. The method of claim 175, wherein the vector is administered to the subject via injection to the anterior portion of the eye.

177. The method of claim 175, wherein the vector is administered to the corneal stroma, corneal limbus, onto the epithelial surface of the cornea, or onto the endothelial membrane of the cornea.

178. The method of claim 175, wherein the vector is administered to the subject via intracameral (IC) injection.

179. The method of claim 169, wherein the protein is preferentially expressed in the cornea as compared with other eye tissues or cells after IC injection.

180. The method of claim 169 which is suitable for treating a disease or condition in the eye; wherein the disease or condition in the eye is a disease or condition of the cornea selected from a superficial corneal dystrophy, anterior corneal dystrophy, corneal stromal dystrophy, or posterior corneal dystrophy; and wherein the posterior corneal dystrophy is Fuchs endothelial corneal dystrophy (FECD; both early and late onset), posterior polymorphous corneal dystrophy (PPCD; types 1, 2, and 3), congenital endothelial dystrophy (types 1 and 2), and X-linked endothelial corneal dystrophy.

181. A composition comprising: a) a nucleotide sequence, or portion thereof, of an AAV vector; and b) a nucleic acid editing system comprising at least one nucleotide sequence that is complementary to at least one mutant allele on a target gene associated with diseases or conditions in the cornea; a nucleic acid capable of down-regulating gene expression of at least one mutant allele on a target gene associated with diseases or conditions in the cornea; and/or at least one nucleotide sequence, or portion thereof, that codes for a protein to be expressed in the eye.

182. The composition of claim 181, wherein said protein is preferentially expressed in the cornea as compared with other ocular tissues or cells.

183. The composition of claim 181, wherein the AAV vector serotype is selected from the group consisting of AAV5, AAV6, and AAV8.

184. The composition of claim 181, wherein the AAV vector serotype is AAV6.

185. The composition of claim 181, wherein the target gene is preferentially expressed in the anterior portion of the eye after intracameral (IC) injection.

186. A method for repairing a gene expressed in the cornea in a subject in need thereof, the method comprising: a) providing a delivery system comprising a nucleic acid editing system comprising at least one nucleotide sequence that is complementary to at least one mutant allele on a target gene associated with diseases or conditions in the cornea; and b) administering the delivery system to the cornea of the subject.

187. The method of claim 186, wherein the nucleic acid editing system is a CRISPR-Cas system.

188. The method of claim 186, wherein the target gene is TCF4 or COL8A2.

189. The method of claim 186, wherein the delivery system is administered to the subject via injection into the eye.

190. The method of claim 186, wherein the delivery system is administered to the corneal stroma, corneal limbus, onto the epithelial surface of the cornea, or onto the endothelial membrane of the cornea

191. The method of claim 186, wherein the delivery system is administered to the subject via intracameral injection.

192. A method of treating a disease or condition of the cornea caused by a mutant allele of a gene that comprises trinucleotide repeats (TNRs) and/or a point mutation in a subject in need thereof, said method comprising: a) excising at least a portion of the trinucleotide repeats (TNRs) within the gene, comprising: i) providing an AAV5, AAV6, or AAV8 vector which comprises one or more nucleotide sequences coding for one or more CRISPR guide RNAs targeting a sequence within the TNRs, 5′ of the TNRs, 3′ of the TNRs, or combination thereof; and ii) administering the vector to the cornea; and/or b) correcting the point mutation of the gene or gene product comprising: i) providing an AAV5, AAV6, or AAV8 vector comprising one or more nucleotide sequences coding one or more CRISPR guide RNAs targeting a sequence in the gene associated with a point mutation in the gene product; and ii) administering the vector to the cornea; wherein said one or more nucleotide sequences are preferentially expressed in the cornea.

193. The method of claim 192, wherein the target gene is TCF4 or COL8A2.

194. The method of claim 192, wherein the AAV vector is AAV6.

195. The method of claim 192, wherein the AAV vector comprises a Cas protein.

196. The method of claim 195, wherein the Cas protein is Cas9 nuclease; and wherein the Cas9 nuclease cleaves the TNRs.

197. The method of claim 192, wherein the vector is administered to the subject via injection to the anterior portion of the eye.

198. The method of claim 192, wherein the vector system is administered to the corneal stroma, corneal limbus, onto the epithelial surface of the cornea, or onto the endothelial membrane of the cornea.

199. The method of claim 192, wherein the vector system is administered to the subject via intracameral (IC) injection.

200. The method of claim 192, wherein the one or more nucleotide sequences are preferentially expressed in the corneal endothelial cells as compared with other cells in the eye after IC injection.

201. A method for down-regulating expression of a gene that is expressed in the cornea in a subject in need thereof, the method comprising administering to the subject a delivery system comprising: a) a nucleotide sequence, or portion thereof, of an AAV vector; b) a nucleic acid capable of down-regulating gene expression of at least one mutant allele on a target gene associated with diseases or conditions in the cornea; and c) administering the delivery system to the cornea.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0047] FIG. 1 is an illustration of the layers of the cornea (see https://discoveryeye.org/treatment-corneal-scratches-and-abrasions/).

[0048] FIG. 2 is an illustration of the structure of the mouse eye, and a depiction of intracameral and intravitreal injection into the eye.

[0049] FIG. 3 depicts the in vivo images of a mouse eye after intracameral delivery of AAV5-eGFP. Panels A-D show images from the OD eye (“OD” refers to Oculus Dexter which is latin for the right eye). Panels E-H show images from the OS eye (“OS” refers to Oculus Sinister which is latin for the left eye). Panel A provides a reference for panel B. Panel E provides a reference for panel F. Panels B & F show the image which demonstrates fluorescence in the cornea from the AAV5-eGFP. Panels C & G shows the fundus image and panels D & H show the image which demonstrates no fluorescence in the retina. Two dots of fluorescence are detected in the OS retina shown by arrows in panel H.

[0050] FIG. 4 depicts the immunohistochemistry of the same eyes shown in FIG. 3. AAV5-eGFP was delivered by intracameral injection. The OS eye was separated into a cornea flat mount (panel A, magnified insert shown in panel B) and a retina flat mount (panel C, magnified insert shown in panel D). Staining shows eGFP localized to the cornea endothelium and a few cells staining in the retina. The OD eye was collected whole and processed for cross-sections shown in panel E. Staining shows eGFP localized to the cornea endothelium and not in the retina. Magnified inserts are shown in panels F-G. Panel F shows the cornea endothelium layer. Panel G shows the retina, where the exposure time had to be increased to capture a positive signal not seen in panel E. (green=endogenous eGFP, red=secondary staining using primary antibody to eGFP).

[0051] FIG. 5 depicts the in vivo images of a mouse eye after intracameral delivery of AAV6-eGFP. Panel A provides a reference for panel B. Panel B shows the image which demonstrates fluorescence in the cornea from the AAV6-eGFP. Panel C shows the fundus image and panel D shows the image which demonstrates fluorescence in the retina.

[0052] FIG. 6 depicts the immunohistochemistry of the same mouse eye shown in FIG. 5. Staining demonstrates that AAV6-eGFP is present in the corneal endothelium, stroma, and ciliary body (green=endogenous eGFP, red=secondary staining using primary antibody to eGFP, blue=DAPI stained nuclei). The white rectangle in panel A indicates the zoomed-in area shown in panel B. The left arrow in panel B indicates the positive corneal stroma layer. The right arrow in panel B indicates the positive corneal endothelium layer.

[0053] FIG. 7 depicts the in vivo images of a mouse eye after intracameral delivery of AAV8-eGFP. Panel A provides a reference for panel B. Panel B shows the image which demonstrates fluorescence in the cornea from the AAV8-eGFP. Panel C shows the fundus image and panel D shows the image which demonstrates fluorescence in the retina.

[0054] FIG. 8 depicts the immunohistochemistry of the same mouse eye shown in FIG. 7. Staining demonstrates that AAV8-eGFP is present in the corneal endothelium, stroma, and ciliary body (green=endogenous eGFP, red=secondary staining using primary antibody to eGFP, blue=DAPI stained nuclei). The white rectangle in panel A indicates the zoomed-in area shown in panel B. The left arrow in panel B indicates the positive corneal stroma layer. The right arrow in panel B indicates the positive corneal endothelium layer.

[0055] FIG. 9 depicts the ELISA results of eGFP protein levels from 4 mice (whole eyes) for each of the AAV serotypes, such as AAV5-eGFP, AAV6-eGFP, AAV8-eGFP, delivered by intracameral route. Two mice that received PBS+0.001% pluronic acid were included as controls for each of the AAV serotypes tested. Means with SEM are shown.

[0056] FIG. 10 is a composite figure that depicts the in vivo fluorescence images and immunochemistry results of AAV2-eGFP, AAV5-eGFP, AAV6-eGFP, AAV8-eGFP, and AAV9-eGFP after IC delivery into the mouse eye.

DETAILED DESCRIPTION

[0057] It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only, and are not restrictive of any subject matter claimed.

[0058] Headings are used solely for organizational purposes, and are not intended to limit the invention in any way.

[0059] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the inventions belong. All patents, patent applications, published applications and publications, websites and other published materials referred to throughout the entire disclosure herein, unless noted otherwise, are incorporated by reference in their entirety for any purpose. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods are described.

[0060] Corneal dystrophy is a term for the heterogenous group of non-inflammatory bilateral diseases restricted to the cornea. They are grouped by the anatomical location of the pathology within the cornea. Most do not have any manifestations outside of the cornea and they result with corneal opacities and affect visual acuity (see https://www.cornealdystrophyfoundation.org/what-is-corneal-dystrophy).

[0061] Anterior corneal dystrophies affect the corneal epithelium and its basement membrane and the superficial corneal stroma. Stromal corneal dystrophies affect the corneal stroma. Posterior corneal dystrophies affect Descemet membrane and the corneal endothelium. The most common posterior corneal dystrophy is Fuchs' corneal endothelial dystrophy.

[0062] The cornea has three major regions that are affected by corneal dystrophies: corneal epithelium, stroma and endothelium. AAV5 targets the corneal endothelium after IC delivery and could be utilized to deliver gene therapy for posterior corneal dystrophies. Both AAV6 and AAV8 can target the corneal stroma, endothelium, and ciliary body after IC delivery and could be utilized to deliver gene therapy for corneal stromal dystrophies and posterior corneal dystrophies. As some anterior corneal dystrophies affect both the epithelium and the superficial corneal stroma, AAV6 and AAV8 could deliver gene therapy to the stroma.

[0063] Table D1 shows corneal dystrophies and certain genes associated therewith ((Klintworth, 2009. Corneal dystrophies. Orphanet J. Rare Dis., 4, 7. doi:10.1186/1750-1172-4-7).

TABLE-US-00001 TABLE D1 Summary of the corneal dystrophies: modes of inheritance, gene loci, genes and the categories of the International Committee for the Classification of Corneal Dystrophies (IC3D) categories. Mode of IC3D inher- Gene Cate- itance locus Gene gory* SUPERFICIAL CORNEAL DYSTROPHIES Meesmann dystrophy AD 12q13 KRT3 1 Meesmann dystrophy AD 17q12 KRT12 1 Stocker-Holt dystrophy AD 17q12 KRT12 1 Granular corneal dystrophy AD 5q31 TGFB1 1 type III (Reis-Bücklers dystrophy) Thiel-Behnke dystrophy AD 5q31 TGFB1 1 Thiel-Behnke dystrophy AD 10q23-q24 Unknown 2 Gelatinous droplike corneal AR 1p32 TACSTD 1 dystrophy (familial 2 (MISI) subepithelial corneal amyloidosis) Subepithelial mucinous AD Unknown Unknown 4 corneal dystrophy Lisch epithelial dystrophy XR Xp22.3 Unknown 2 Epithelial recurrent erosion AD Unknown Unknown 3 dystrophy CORNEAL STROMAL DYSTROPHIES Macular corneal dystrophy AR 16q22 CHST6 1 Granular corneal dystrophy AD 5q31 TGFB1 1 type I Granular corneal dystrophy AD 5q31 TGFB1 1 type II (Avellino dystrophy, combined lattice-granular dystrophy) Lattice corneal dystrophy AD 5q31 TGFB1 1 type I and variants Lattice corneal dystrophy AD 9q34 GSN 1 type II Fleck dystrophy AD 2q35 PIP5K3 1 Schnyder corneal dystrophy AD 1p34.1-p35 UBIAD1 1 Posterior amorphous corneal AD Unknown Unknown 3 dystrophy Congenital stromal dystrophy AD 12q13.2 DCN 1 POSTERIOR DYSTROPHIES Fuchs dystrophy (early onset) AD 1p34.3 COL8A 1 Fuchs dystrophy (late onset) AD 13pTel- Unknown 2 13q12.13 Fuchs dystrophy (late onset) AD 18q21.2- Unknown 2 q21.32 Fuchs dystrophy (late onset) ? 20p13-p12 SLC4A11 1 Fuchs dystrophy (late onset) ? 10p11.2 TCF8 1 Posterior polymorphous AD 20p11.2 Unknown 2 dystrophy type 1 Posterior polymorphous AD 1p34.3-02.3 COL8A2# 1 dystrophy type 2 Posterior polymorphous AD 10p11.2 TCF8 1 dystrophy type 3 Congenital endothelial AD 20p11. 2- Unknown 2 dystrophy type 1 q11.2 Congenital endothelial AR 20p13-p12 SLC4A11 1 dystrophy type 2 X-linked endothelial corneal XR Unknown Unknown 2 dystrophy *Category 1: A well-defined corneal dystrophy in which the gene has been mapped and identified and specific mutations are known. Category 2: A well-defined corneal dystrophy that has been mapped to 1 or more specific chromosomal loci, but the gene(s) remains to be identified. Category 3: A well-defined corneal dystrophy in which the disorder has not yet been mapped to a chromosomal locus. Category 4: A suspected new, or previously documented corneal dystrophy, although the evidence for it, being a distinct entity, is not yet convincing.

[0064] Table D2 is from Moore, C. B. T., Christie, K. A., Marshall, J., & Nesbit, M. A. (2018). Personalised genome editing—The future for corneal dystrophies. Prog Retin Eye Res, 65, 147-165. doi:10.1016/j.preteyeres.2018.01.004.

TABLE-US-00002 TABLE D2 List of known corneal dystrophies, including associated inheritance pattern, gene locus and causative genes. Inheritance Genetic Gene Gene(s) IC3D Pattern Locus known Affected Category Epithelial EBMD Minority of 5q13 Some TGFB1 Some C1 and Sub- cases, mostly cases Epithelial sporadic Dystrophies ERED Autosomal Unknown Unknown N/A C3 Dominant SMCD Likely Unknown Unknown Unknown C4 Autosomal Dominant MECD Autosomal 12q13 and Yes KRT3 and C1 Dominant 17q12 KRT12 (Stocker- Holt variant) LECD X-chromosomal Xq22.3 Unknown Unknown C2 dominant GDCD Autosomal 1q32 Yes TACSTD2, C1 Recessive previously M1S1 Epithelial RBCD Autosomal 5q13 Yes TGFB1 C1 Stromal Dominant Dystrophies TBCD Autosomal 5q13 Yes TGFB1 C1 Dominant LCD1 Autosomal 5q13 Yes TGFB1 C1 Dominant GCD1 Autosomal 5q13 Yes TGFB1 C1 Dominant GCD2 Autosomal 5q13 Unknown TGFB1 C1 Dominant Stromal MCD Autosomal 16q22 Yes CHST6 C1 Dystrophies Recessive SCD Autosomal 1q36 Yes UBIAD1 C1 Dominant CSCD Autosomal 12q21.33 Yes DCN C1 Dominant FCD Autosomal 2q34 Yes PIKFYVE, C1 Dominant previously PIP5K3 PACD Autosomal 12q21.33 Yes KERA, C1 Dominant LUM, DCN, EPYC CCDF Unknown Unknown Unknown Unknown C4 PDCD Reported AD, X-linked Unknown STS C4 similar deposits ichthyosis = seen with X- Xp22.31 linked ichthyosis Descemet's FECD Unknown, Early onset = Some Unknown, C2 = Membrane reported 1q34.3-p32 cases TCF4, identified and autosomal (FECD1) SLC4A11, genetic loci, Endothelial dominant Late onset = Unknown, C3 = Dystrophies 13pt34-q12.3 ZEB1, without (FECD2), Unknown, known 18q21.2- AGBL1 inheritance q21.3 (FECD3), 20p13-q12 (FECD4), 5q33.1-q35.2 (FECD 5), 10p11.2 (FECD 6), 9p24.1-p22.1 (FECD 7), 15q25 (FECD 8) PPCD Autosomal PPCD 1 = Unknown Unknown C2 Dominant 20p11.2- Yes COL8A2 C1 q11.2 Yes ZEB 1 C1 PPCD 2 = 1p34.3-p32.3 PPCD 3 = 10p11.2 CHED Autosomal 20p13 Yes SLC4A11 C1 (some recessive cases C3) XECD X-chromosomal Xq25 Unknown Unknown C2 dominant Total: 22 Known = 17 Known = 18 Known = 12 Partially known = 4 Unknown = 5

[0065] Delivering AAVs directly to the eye, for example by intracameral injection, can result in a viral targeting tropism to the cornea. Delivering AAV5 via intracameral injection results in a viral targeting tropism to the cornea endothelium, and not to other ocular structures. This targeted tropism could deliver the therapeutic to the affected structure, while sparing other ocular structures, decreasing the risk of off-target effects. Intracameral delivery of AAV6 or AAV8 also demonstrates targeting to the corneal endothelium. However, both AAV6 and AAV8 also display tropism to other corneal and anterior structures, as well as the retina, when delivering a gene using the ubiquitous CAG promoter.

[0066] AAV is a small virus consisting of two open reading frames, Rep and Cap, flanked by two 145 base inverted terminal repeats (ITRs). When used for gene therapy, the Rep and Cap open reading frames are removed, and the desired gene, together with a promoter to drive transcription of the desired gene, is inserted between the ITRs.

[0067] CRISPR nucleotides (e.g. gRNA and/or nucleotides coding for Cas proteins) can be packaged between the ITRs, creating a viral vector for targeted delivery of therapeutics. In some embodiments, the CRISPR nucleotide gRNA is packaged with a Cas protein (e.g. Cas9 nuclease) to form a ribonucleoprotein (RNP) complex. However, the AAVs can also be packaged with nucleotides encoding other proteins. AAVs are preferred viral vectors because they can infect both dividing and non-dividing cells, and are associated with a lack of pathogenicity.

[0068] AAV vectors can thus be used to preferentially target certain layers of the cornea. AAV5, for example, specifically targets cornea endothelium. The specificity of AAV vectors reduces the risk for off-target effects of therapeutics that are delivered via the AAV vectors.

[0069] In certain embodiments, the AAV vectors can comprise one or more nucleotide sequences that are complementary to at least one target sequence on a target gene.

[0070] In some embodiments, the AAV vectors can comprise one or more nucleotide acid editing systems. Nucleotide editing systems include, but are not limited to a CRISPR system, an siRNA, an shRNA, an miRNA, an antisense RNA, or an antagomir RNA.

[0071] In certain embodiments, AAV vectors can be used for targeted gene editing or therapy in the eye, preferably the cornea or other affected anterior structures, by delivering one or more nucleotide editing systems directly to the eye.

[0072] In certain embodiments, the AAV vectors can be used for targeted gene therapy in the cornea, by delivering CRISPR complexes targeting genes involved in corneal dystrophies, such as Fuchs endothelial corneal dystrophy (FECD). FECD is associated with trinucleotide repeat (TNR) expansions in the transcription factor 4 (TCF4) gene. Most of the genetic predisposition for FECD is associated with a TNR in the third intron of the TCF4 gene. FECD is a condition that affects the cornea of the eye, in particular the endothelium. Corneal dystrophies are also associated with mutations in the COL8A gene. Mutations of the COL8A gene lead to a Gln455Lys, Gln455Val, or Leu450Trp mutation in the gene product.

[0073] By delivering CRISPR complexes (gRNA plus a Cas protein, or a nucleotide encoding a Cas protein) to the cornea endothelium, the TNRs, or a portion thereof, can be excised from the TCF4 gene in the corneal endothelium, without affecting the TCF4 gene in other parts of the eye.

[0074] In certain embodiments, CRISPR complexes are packaged into one or more AAV vectors. The CRISPR complexes may target either the TNRs of the TCF4 gene, or the mutant alleles of the COL8A2 gene.

[0075] In certain embodiments, the AAV vectors may be delivered by themselves. In other embodiments, the AAV vectors may be enclosed in a lipid nanoparticle, liposome, non-lipid nanoparticle, or viral capsid for delivery.

Definitions

[0076] In this application, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the singular forms “a,” “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0077] In this application, the use of “or” means “and/or” unless stated otherwise.

[0078] As used herein, the terms “comprises” and/or “comprising” specify the presence of the stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof. Furthermore, to the extent that the terms “includes,” “having,” “has,” “with,” “composed,” “comprised” or variants thereof are used in either the detailed description or the claims, such terms are intended to be inclusive in a manner similar to the term “comprising.”

[0079] As used herein, ranges and amounts can be expressed as “about” a particular value or range. “About” is intended to also include the exact amount. Hence “about 5 percent” means “about 5 percent” and also “5 percent.” “About” means within typical experimental error for the application or purpose intended.

[0080] As used herein, “treatment” refers to any delivery, administration, or application of a therapeutic for a disease or condition. Treatment may include curing the disease, inhibiting the disease, slowing or stopping the development of the disease, ameliorating one or more symptoms of the disease, or preventing the recurrence of one or more symptoms of the disease.

[0081] As used herein, “FECD” refers to Fuchs endothelial corneal dystrophy. FECD includes patients who have the condition, as well as individuals who do not have symptoms, but have a genetic disposition to FECD.

[0082] As used herein, “AAV” refers to an adeno-associated virus. AAV is a non-enveloped virus that is icosahedral, is about 20 to 24 nm long with a density of about 1.40-1.41 g/cc, and contains a single stranded linear genomic DNA molecule approximately 4.7 kb in length. The single stranded AAV genomic DNA can be either a plus strand, or a minus strand. In certain embodiments, the term “AAV” or “AAV vector” refers to an AAV that has been modified so that a therapeutic, such as for example, a CRISPR complex, replaces the Rep and Cap open reading frames between the inverted terminal repeats (ITRs) of the AAV genome.

[0083] As used herein, “AAV serotype” means a sub-division of AAV that is identifiable by serologic or DNA sequencing methods and can be distinguished by its antigenic character.

[0084] As used herein, a “vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Vectors include, but are not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. The term “vector” includes an autonomously replicating plasmid or a virus. “Vector” may also include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds liposomes, lipid nanoparticles, non-lipid nanoparticles, and the like. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus (AAV) vectors, retroviral vectors, lentiviral vectors, and the like. Preferably, the vector is an AAV vector.

[0085] As used herein, “RNA” refers to a molecule comprising one or more ribonucleotide residues. A “ribonucleotide” is a nucleotide with a hydroxyl group at the 2′ position of the beta-D-ribofuranose moiety. The term “RNA” includes double-stranded RNA, single-stranded RNA, isolated RNA (e.g. partially purified RNA), essentially pure RNA, synthetic RNA, and recombinantly produced RNA. The term “RNA” also refers to modified RNA that differs from naturally-occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides.

[0086] As used herein “inhibitory RNA” means a nucleic acid molecule that contains a sequence that is complementary to a target nucleic acid that mediates a decrease in the level or activity of the target nucleic acid. Inhibitory RNA includes, but is not limited to, interfering RNA (iRNA), short hairpin RNA (shRNA), small interfering RNA (siRNA), ribozymes, antagomirs, and antisense oligonucleotides.

[0087] As used herein, “shRNA” refers to an RNA molecule comprising an antisense region, a loop portion, and a sense region, wherein the sense region has complementary nucleotides that base pair with the antisense region to form a duplex stem. Following post-transcriptional processing, the shRNA is converted to siRNA by a cleavage mediated by the enzyme Dicer, which is a member of the RNase III family.

[0088] As used herein, “siRNA” refers to any small RNA molecule capable of inhibiting or down-regulating gene expression by mediating RNA interference in a sequence specific manner.

[0089] As used herein, “antisense RNA” or “antisense oligonucleotides” are short, synthetic pieces of nucleic acid whose sequence is complementary to the mRNA that codes for a protein. Antisense RNA binds to the mRNA and blocks transcription.

[0090] As used herein, an “antagomir” or “antagomir RNA” refers to small synthetic RNA that are complementary to a specific microRNA (miRNA) target, optionally with either mispairing at the cleavage site or one or more base modifications to inhibit cleavage.

[0091] As used herein, “micro RNA” or “miRNA” refers to a single-stranded RNA molecule of about 21-23 nucleotides in length, which regulates gene expression. miRNA molecules are partially complementary to one or more mRNA, and their main function is to down-regulate gene expression.

[0092] As used herein, “TNRs” refers to trinucleotide repeats (i.e. multiple repetitions of three base pairs). The term “TNR expansion” refers to a higher than normal number of TNRs. For example, about 50 or more TNRs in intron 3 of TCF4 would be considered a TNR expansion.

[0093] As used herein “CRISPR” means a bacterial adaptive immune system known as CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) sequences.

[0094] As used herein, “guide RNA” and “gRNA” are used interchangeably, and refer to RNA sequences that are directed to a target DNA sequence. The gRNA contains a CRISPR RNA (crRNA) and transactivating crRNA (trRNA or tracrRNA). The crRNA and the trRNA may be associated on a single RNA molecule, referred to as a single guide RNA (sgRNA). Alternatively, the crRNA and trRNA may be disassociated on separate RNA molecules, and form a dual guide RNA (dgRNA). In some embodiments, the gRNA is chemically modified, and comprises one or more modified nucleosides or nucleotides. Modification of nucleosides and nucleotides can include one or more of: i) alteration, e.g. replacement, of one or both of the non-linking phosphate oxygens and/or of one or more of the linking phosphate oxygens in the phosphodiester backbone; ii) alteration, e.g. replacement, of a constituent of the ribose sugar, such as, for example, the 2′-hydroxyl on the ribose sugar; iii) complete replacement of the phosphate moiety with “dephospho” linkers; iv) modification or replacement of a naturally occurring nucleobase, including with a non-canonical nucleobase; v) replacement or modification of the ribose-phosphate backbone; vi) modification of the 3′ end or 5′ end of the oligonucleotide, e.g. removal, modification, or replacement of a terminal phosphate group, or conjugation of a moiety, cap, or linker; and vii) modification or replacement of the sugar.

[0095] As used herein, the “guide sequence” refers to an about 20 base-pair sequence within the crRNA or trRNA that is complementary to a target sequence. The guide sequence directs the gRNA to a target sequence for cleavage by a nuclease.

[0096] As used herein, “target sequence” refers to a sequence of nucleic acids, within the genomic DNA of the subject, to which a gRNA directs a nuclease for cleavage of the target sequence. For example, a Cas protein may be directed by a gRNA to a target sequence, where the gRNA hybridizes with the target sequence, and the nuclease cleaves the target sequence. Target sequences include both the positive and negative strands of DNA (i.e. the sequence, and the reverse complement of the sequence). In some embodiments, when the guide sequence is the reverse complement of the target sequence, the guide sequence may be identical to the first 20 nucleotides of the target sequence. As used herein, “target sequence” or “target site” also refers to a genomic nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule may specifically bind under conditions sufficient for binding to occur.

[0097] As used herein, the term “CRISPR complex” refers to a combination of a gRNA and an endonucleotide encoding for a Cas protein (gRNA:Cas endonucleotide), or a combination of a gRNA and a Cas protein (gRNA: Cas protein). As used herein, a “ribonucleoprotein” (RNP) refers to a gRNA:Cas protein complex. The CRISPR complexes of the present invention may be directed to and cleave a target sequence either within the TNRs, or flanking the TNRs (5′ or 3′) of the TCF4 gene. The CRISPR complexes may also be directed to cleave a target sequence in the COL8A gene. As used herein, a “protospacer adjacent motif” or “PAM” refers to a nucleotide sequence that must be adjacent to a target nucleotide sequence. The required PAM depends on the specific CRISPR system used. For example, in the CRISPR/Cas system derived from Streptococcus pyogenes, the target DNA must immediately precede a 5′-NGG PAM (where “N” is any nucleobase followed by two guanine nucleobases) for optimal cutting. Although Streptococcus pyogenes Cas9 also recognizes the 5′-NAG PAM, it appears to cut less efficiently at these PAM sites. Other Cas9 orthologs (e.g. derived from Staphylococcus aureus) require different PAM sequences.

[0098] As used herein, “indels” means insertion/deletion mutations that consist of a number of nucleotides that are either inserted or deleted at the site of double-stranded breaks (DSBs) in the nucleic acid of the DNA.

[0099] As used herein, “excision fragment” or “excision fragments” refers to deletions of a consecutive number of nucleotides (such as TNRs) that may occur when two or more gRNA are used together with a Cas mRNA or Cas protein.

[0100] As used herein, “promoter” means a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate specific transcription of a polynucleotide sequence. Preferred are promoters that are operable for AAV vectors, preferably AAV5, AAV6, and/or AAV8, and tissue specific promoters, preferably specific for the eye, more preferably specific for the cornea, and most preferably specific for the endothelium of the cornea. AAV promoters include, for example, an AAV p5 promoter. Promoters include, but are not limited to, CAG, SYN1, CMV, NSE, CBA, PDGF, SV40, RSV, LTR, SV40, dihydrofolate reductase promoter, beta-actin promoter, PGK, EF1alpha, GRK, MT, MMTV, TY, RU486, RHO, RHOK, CBA, chimeric CMV-CBA, MLP, RSV, ubiquitin promoters, actin promoters, tubulin promoters, immunoglobulin promoters, functional fragments thereof, etc. In AAV packaged with heterologous DNA, a promoter normally associated with heterologous nucleic acid can be used, or a promoter normally associated with the AAV vector, or a promoter not normally associated with either, can be used.

[0101] As used herein, “constitutive promoter” is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell. Examples of constitutive promoters include, but are not limited to, cytomegalovirus immediate early promoter (CMV), simian virus (SV40) promoter, adenovirus major late (MLP) promoter, Rous sarcoma virus (RSV) promoter, elongation factor-alpha (EF1a) promoter, ubiquitin promoters, actin promoters, tubulin promoters, immunoglobulin promoters, functional fragments thereof, or combinations thereof.

[0102] As used herein, “inducible promoter” is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only when an inducer which corresponds to the promoter is present in the cell. Examples of inducible promoters include, but are not limited to, those inducible by heat shock, light, chemicals, peptides, metals, steroids, antibiotics, or alcohol. In some embodiments the promoter may be tissue specific, such as a promoter specific for expression in the cornea, e.g. the corneal edothelium.

[0103] As used herein, a “tissue specific promoter” is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter. Tissue specific promoters include, but are not limited to, CMV, CBA, RHO, and RHOK.

[0104] As used herein, a “promoter/regulatory sequence” means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter/regulatory sequence. This sequence may be the core promoter sequence, or it may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product.

[0105] As used herein, “under transcriptional control” or “operably linked” means that the promoter is in the correct location and orientation in relation to a polynucleotide to control initiation of transcription by RNA polymerase and expression of the polynucleotide. These include promoters, a 3′ UTR, or a 5′ UTR. The promoter may be recognized by RNA polymerase III (Pol III), such as, but limited to, U6 and HI Pol III promoters. The Pol III promoters may be, for example, mouse or human.

[0106] As used herein, “gene editing” or “nucleic acid editing” refers to modification of the nucleic acid sequence of a target gene.

[0107] As used herein, “nucleic acid editing system” or “gene editing system” refers to a method that can be used for performing gene editing or nucleic acid editing. Nucleic acid editing systems and gene editing systems include CRISPR systems, and interfering RNAs.

[0108] As used herein, “delivery system” refers to materials used to deliver nucleic acids to target cells. Such materials may include viral vectors such as AAV vectors and pharmaceutically acceptable ingredients.

[0109] As used herein, “modulation” or “modification” includes decreasing or inhibiting expression or function, of for example, a gene or protein, as well as increasing expression or function, of for example, a gene or protein. As used herein, “modulation” or “modification” also includes complete restoration of gene function, which includes replacing mutated part(s) of a gene or replacing the mutant gene with a wild-type version.

[0110] As used herein, “down-regulating” or “down-regulation” means a reduction in expression or transcription of a target nucleotide sequence. Down-regulation may be partial or temporary reduction in the expression or transcription of a target nucleotide sequence. Down-regulation may be a complete elimination of the expression or transcription of a target nucleotide sequence.

[0111] As used herein, “knockdown” refers to a partial or temporary reduction in expression or transcription of a target nucleotide sequence. This may be accomplished by administering a complementary nucleotide sequence that binds to the target sequence. Knockdown can be elicited by antisense oligonucleotides, siRNA, and the like.

[0112] As used herein, “knockout” refers to complete elimination of the expression or transcription of a target nucleotide sequence. Knockout may be elicited, for example, by use of a CRISPR system to cleave the target nucleotide sequence out of the target gene.

[0113] As used herein, non-homologous end joining (NHEJ) is a DNA repair mechanism which is a re-ligation of break ends after cleavage of a target nucleotide sequence.

[0114] As used herein, “homologous repair/homology directed repair (HR/HDR)” refers to DNA repair which is a process of homologous recombination where a DNA template is used to provide the homology necessary for precise repair of a double-strand break. The repair may consist of insertions of desired sequences, or modification of the target sequence.

[0115] As used herein, “repair template” refers to the DNA template used in HR/HDR.

[0116] As used herein, “subject” means a living organism. Preferably, a subject is a mammal, such as a human, non-human primate, rodent, or companion animal such as a dog, cat, cow, pig, etc.

Modulation of Gene Expression

[0117] Gene expression can be modulated by administering to a subject in need thereof a composition comprising a nucleotide editing system.

[0118] In one embodiment, modulating expression of a target gene comprises administering to the subject a composition, wherein the composition comprises a nucleic acid editing system comprising at least one nucleotide sequence that is complementary to at least one allele on a target gene associated with corneal dystrophies. In certain embodiments, the at least one nucleotide sequence that is complementary to at least one allele on a target gene is selected from an siRNA, an shRNA, an miRNA, an antisense RNA, or an antagomir RNA.

Administration of the Composition

[0119] In certain embodiments, the composition is administered by itself.

[0120] In preferred embodiments, the composition comprises an adeno-associated virus (AAV) vector, or a nucleotide sequence or portion thereof encoding an AAV vector.

AAV

[0121] Adeno-associated virus (AAV) is a small, replication-deficient parvovirus. AAV is about 20-24 nm long, with a density of about 1.40-1.41 g/cc. AAV contains a single-stranded linear genomic DNA molecule approximately 4.7 kb in length. The single-stranded AAV genomic DNA can be either a plus strand, or a minus strand. AAV contains two open reading frames, Rep and Cap, flanked by two 145 base inverted terminal repeats (ITRs). AAVs contain a single intron. Cis-acting sequences directing viral DNA replication (Rep), encapsidation/packaging and host cell chromosome integration are contained within the ITRs. Three AAV promoters, p5, p19, and p40 (named for their relative map locations) drive the expression of the two AAV internal open reading frames encoding rep and cap genes. The p5 and p19 are the rep promoters. When coupled with the differential splicing of the single AAV intron, the two rep promoters result in the production of four rep proteins (rep 78, rep 68, rep 52, and rep 40) from the rep gene. The rep proteins have multiple enzymatic properties that are responsible for replicating the viral genome. The cap gene is expressed from the p40 promoter, and encodes the three capsid proteins VP1, VP2, and VP3. Alternative splicing and non-consensus translational start sites are responsible for the production of the three related capsid proteins. A single polyadenylation site is located at map position 95 of the AAV genome. Muzyczka reviews the life cycle and genetics of AAV (Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992)).

[0122] AAV infection is non-cytopathic in cultured cells. Natural infection of humans and other animals is silent and asymptomatic (does not cause disease). Because AAV infects many mammalian cells, there is the possibility of targeting many different tissues in vivo. In addition to dividing cells, AAV transduces slowly dividing and non-dividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (i.e. extrachromosomal element). The AAV proviral genome is infective as cloned DNA in plasmids, which makes construction of recombinant genomes possible. Moreover, because the signals directing AAV replication, genome encapsidation, and integration are all contained with the ITRs of the AAV genome, some or all of the approximately 4.3 kb of the genome, encoding replication and structural capsid proteins (rep-cap) are contained within the ITRs of the AAV genome, and can be replaced with heterologous DNA, such as a gene cassette containing a promoter, a DNA of interest, and a polyadenylation signal. The rep and cap proteins may be provided in trans.

[0123] Several AAV serotypes have been identified, differing in their tropism (type of cell that they infect). Serotype AAV1 shows tropism to the following tissues: CNS; heart; retinal pigment epithelium (RPE); and skeletal muscle. Serotype AAV2 shows tropism to the following tissues: CNS; kidney; photoreceptor cells; and RPE. Serotype AAV3 shows tropism mainly to the heart and liver. Serotype AAV4 shows tropism to the following tissues: CNS; lung; and RPE. Serotype AAV5 shows tropism to the following tissues: CNS; lung; photoreceptor cells; and RPE. Serotype AAV6 shows tropism to the following tissues: lung; and skeletal muscle. Serotype AAV7 shows tropism to the following tissues: liver; and skeletal muscle. Serotype AAV8 shows tropism to the following tissues: CNS; heart; liver; pancreas; photoreceptor cells; RPE; and skeletal muscle. Serotype AAV9 shows tropism for the following tissues: CNS; heart; liver; lung; and skeletal muscle. The tropism of AAV viruses may be related to the variability of the amino acid sequences of the capsid protein, which may bind to different functional receptors present on different types of cells.

[0124] Depending on the promoter included in the heterologous DNA cassette, it may be possible to target specific tissues in the eye. Modifying the capsid proteins may also enable specific infectivity of certain tissues or cells. In one embodiment, an AAV containing an Anc80 or Anc80L65 capsid protein is used for delivery of therapeutics directly to specific tissues in the eye. In some embodiments, the AAV viral particle comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 (e.g., a wild-type AAV6 capsid, or a variant AAV6 capsid such as ShH10, as described in U.S. PG Pub. 2012/0164106), AAV7, AAV8, AAVrh8, AAVrh8R, AAV9 (e.g., a wild-type AAV9 capsid, or a modified AAV9 capsid as described in U.S. PG Pub. 2013/0323226), AAV10, AAVrh10, AAV11, AAV12, a tyrosine capsid mutant, a heparin binding capsid mutant, an AAV2R471A capsid, an AAVAAV2/2-7m8 capsid, an AAV DJ capsid (e.g., an AAV-DJ/8 capsid, an AAV-DJ/9 capsid, or any other of the capsids described in U.S. PG Pub. 2012/0066783), AAV2 N587A capsid, AAV2 E548A capsid, AAV2 N708A capsid, AAV V708K capsid, goat AAV capsid, AAV1/AAV2 chimeric capsid, bovine AAV capsid, mouse AAV capsid, rAAV2/HBoV1 capsid, or an AAV capsid described in U.S. Pat. No. 8,283,151 or International Publication No. WO/2003/042397. In some embodiments, the AAV viral particle comprises an AAV capsid comprising an amino acid substitution at one or more of positions R484, R487, K527, K532, R585 or R588, numbering based on VP1 of AAV2. In further embodiments, a AAV particle comprises capsid proteins of an AAV serotype from Classes A-F. In some embodiments, the rAAV viral particle comprises an AAV serotype 2 capsid. In further embodiments, the AAV serotype 2 capsid comprises AAV2 capsid protein comprising a R471A amino acid substitution, numbering relative to AAV2 VP1. In some embodiments, the vector comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV serotype inverted terminal repeats (ITRs). In some embodiments, the vector comprises AAV serotype 2 ITRs. In some embodiments, the AAV viral particle comprises one or more ITRs and capsid derived from the same AAV serotype. In other embodiments, the AAV viral particle comprises one or more ITRs derived from a different AAV serotype than the capsid of the rAAV viral particles. In some embodiments, the rAAV viral particle comprises an AAV2 capsid, and wherein the vector comprises AAV2 ITRs. In further embodiments, the AAV2 capsid comprises AAV2 capsid protein comprising a R471A amino acid substitution, numbering relative to AAV2 VP1 (see US Patent Publication 2017/0304465).

[0125] It has recently been shown that including a human rhodopsin kinase (hGRK1) promoter in an AAV5 vector results in rod- and cone-specific expression in the primate retina (Boye, et al., Human Gene Therapy, 23:1101-1115 (October 2012) (DOI: 10.1089/hum.2012.125)).

[0126] It has also recently been shown that AAV virions with altered capsid proteins may impart greater tissue specific infectivity. For example, AAV6 with a variant capsid protein shows increased infectivity of retinal cells, compared to wild-type AAV capsid protein (U.S. Pat. No. 8,663,624). A variant capsid protein comprising a peptide insertion between two adjacent amino acids corresponding to amino acids 570 ad 611 of VP1 of AAV2, or the corresponding position in a capsid protein of another AAV serotype, confers increased infectivity of retinal cells, compared to wild-type AAV (U.S. Pat. No. 9,193,956).

Expression of Protein in a Cornea

[0127] To express specific proteins in a cornea, AAV vectors packaged with either an endonucleotide encoding the desired protein, or AAV vectors packaged with the desired protein may be delivered or administered directly to the eye. Proteins can include, for example, CRISPR associated (Cas) proteins, or marker proteins (e.g. green fluorescent protein (GFP or eGFP).

[0128] In certain embodiments, the AAV vectors may be delivered without being enclosed in any particle or lipid vessels. In other embodiments, the AAV vectors may be enclosed in a lipid nanoparticle, liposome, non-lipid nanoparticle, or viral capsid for delivery.

[0129] In some embodiments, the compositions and/or the AAV vectors can be delivered directly to the eye. The composition and/or AAV vector may be administered to the anterior chamber of the eye, the posterior chamber of the eye, the cornea, or the vitreous chamber of the eye. In preferred embodiments, the AAV vectors are administered directly to the aqueous humor of the anterior chamber, which is in contact with the cornea. More than one AAV vector such as a dual AAV vector system may be used for the purpose of modulating gene expression as defined in the present invention.

[0130] As explained above, there are several AAV serotypes, each exhibiting tropism for certain types of tissue. Although the AAV serotype used is not particularly limited, the AAV5, AAV6, and AAV8 serotypes are preferred AAV vectors for targeting corneal and anterior tissues in the eye.

[0131] To test the viral tropism of different AAV serotypes in the present invention, several serotypes were packaged with a nucleotide sequence encoding green fluorescent protein (GFP or eGFP). These AAV-eGFP complexes were delivered intracamerally into the eye. The fluorescence of the GFP could be measured in vivo, showing the localization of the AAV-GFP. The localization of the GFP could also be assessed by performing immunohistochemistry on sections of the eye. The viral tropism of AAV5, as indicated by immunohistochemical staining, was localized to the corneal endothelium. The viral tropism of AAV6 was localized to the cornea endothelium, stroma and endothelium, and ciliary body, with some targeting to retinal cells. The viral tropism of AAV8 was localized to cornea endothelium and stroma, and ciliary body, with some targeting to retinal cells. The viral tropism of AAV2 and AAV9 was localized to both the posterior and anterior segments of the eye after IC administration, with greater expression in the posterior segment than the anterior segment.

[0132] The results show that AAV5, AAV6, and AAV8 show selective tropism for corneal tissues. When selective targeting to the cornea endothelium is desired, use of AAV5 is preferred. Use of other AAV serotypes (e.g. AAV2), which are less tissue selective, may lead to unwanted off-target effects.

[0133] In certain embodiments, the AAV vectors may be delivered by themselves. In other embodiments, the AAV vectors may be enclosed in a lipid nanoparticle, liposome, non-lipid nanoparticle, or viral capsid for delivery.

[0134] In some embodiments, the AAV vectors can be delivered directly to the eye. The AAV vector may be administered to the anterior chamber of the eye, the posterior chamber of the eye, the cornea, or the vitreous chamber of the eye. In certain embodiments, the AAV vectors can be administered to the corneal stroma, corneal limbus, onto the epithelial surface of the cornea, or onto the endothelial membrane of the cornea. In preferred embodiments, the AAV vectors are administered directly to the aqueous humor of the anterior chamber which is in direct contact with the corneal endothelium.

Gene Targeting Using CRISPR Complexes

[0135] In certain embodiments, a CRISPR complex is used to modify a specific nucleotide sequence of the DNA of a gene. The specific nucleotide sequence of the DNA of the gene is the “target sequence.”

[0136] A CRISPR complex is a combination of a gRNA and an endonucleotide encoding for a Cas protein (gRNA: Cas endonucleotide), or a combination of a gRNA and a Cas protein (gRNA: Cas protein).

[0137] The gRNA comprises RNA sequences that are directed to a target DNA sequence. The gRNA contains a CRISPR RNA (crRNA) and transactivating crRNA (trRNA or tracrRNA). The crRNA and the trRNA may be associated on a single RNA molecule, referred to as a single guide RNA (sgRNA). Alternatively, the crRNA and trRNA may be disassociated on separate RNA molecules, and form a dual guide RNA (dgRNA). The gRNA can be targeted to either the positive or negative strand of the DNA.

[0138] The gRNA guides the Cas component (i.e. endonucleotide encoding a Cas protein, or a Cas protein) to the target sequence. The gRNA is complementary to, and hybridizes with, the target sequence, or the reverse complement of the target sequence. In some embodiments, the gRNA sequence is 100% complementary or identical to the target sequence. Preferably, the degree of complementarity or identity between a guide sequence of a gRNA and its corresponding target sequence is at least about 50% or greater. For example, the degree of complementarity or identity may be about 50%, 55%, 60%, 65%, 70%, 80%, 85%, 90%, 95%, 96%, 97% 98%, 99%, or 100%.

[0139] In some embodiments, the gRNA is chemically modified, and comprises one or more modified nucleosides or nucleotides. Modification of nucleosides and nucleotides can include one or more of: i) alteration, e.g. replacement, of one or both of the non-linking phosphate oxygens and/or of one or more of the linking phosphate oxygens in the phosphodiester backbone (e.g. phosphorothioate or boranosphosphate linkages); ii) alteration, e.g. replacement, of a constituent of the ribose sugar, such as, for example, 2′-O-methyl and/or 2′-fluoro and/or 4-thio modifications; iii) complete replacement of the phosphate moiety with “dephospho” linkers; iv) modification or replacement of a naturally occurring nucleobase, including with a non-canonical nucleobase; v) replacement or modification of the ribose-phosphate backbone; vi) modification of the 3′ end or 5′ end of the oligonucleotide, e.g. removal, modification, or replacement of a terminal phosphate group, or conjugation of a moiety, cap, or linker; vii) modification or replacement of the sugar; and viii) locked or unlocked nucleic acids. Other modifications include pseudouridine, 2-thiouridine, 4-thiouridine, 5-azauridine, 5-hydroxyuridine, 5-aminouridine 5-methyluridine, 2-thiopseudouridine, 4-thiopseudouridine, 5-hydroxypseudouridine, 5-methylpseudouridine, 5-aminopseduridine, pseudoisocytidine 5-methylcytidine N-4-methyctidine, 2-thiocytidine, 5-azacytidine 5-hydroxycytidine, 5-aminocytidine, N-4-methylpseudoisocytidine, 2-thiopseudoisocytidine, 5-hydroxypseudoisocytidine, 5-aminopseudisocytidine, 5-methylpseudoisocytidie, N-6-methyladenosine, 7-deazaadenosine, 6-thioguanosine, 7-deazaguanosine, 8-azaguanosine, 6-thio-7-deazaguanosine, 6-thio-8-azaguanosine, 7-deaza-8-azaguanosine, and 6-thio-7-deaza-8-azaguanosine.

[0140] In some embodiments the Cas component comprises Type-I, Type-II, or Type-III components. In certain embodiments, the Cas component is a nuclease. In some embodiments the Cas nuclease is Cas9 or Cpf1. Preferably the Cas nuclease is Cas9. In some embodiments, the gene-editing molecule is a Cas protein (e.g, Cpf1, CasX, CasY, C2C2, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cu1966, or homologs or modified versions thereof). In some embodiments, the Cas protein is a Cas9 protein (e.g., wild-type Cas9, a Cas9 nickase, a dead Cas9 (dCas9), or a split Cas9). In some embodiments, the Cas9 protein is a Streptococcus pyogenes Cas9 protein or Staphylococcus aureus Cas9 protein.

[0141] Once guided to the target sequence, the Cas nuclease cleaves the target sequence. This leads to double-stranded breaks in the DNA, or single-strand breaks if a nickase enzyme is used. Double-stranded breaks in the DNA can be repaired via non-homologous end joining (NHEJ), which is re-ligation of the break ends. NHEJ can produce indel mutations. Alternatively, the DNA may be repaired via homologous repair (HR) or homology-directed repair (HDR). HR and HDR generate precise, defined modifications at the target locus in the presence of an exogenously introduced repair template. In certain embodiments, the repair template contains a nucleotide sequence encoding a desirable mutation on a target gene, and the nucleotide sequence is inserted at the target locus of the gene.

[0142] Some of the sequences disclosed herein include the following lists (see WO 2017/185054). SEQ ID NOs: 1-93 are target sequences 5′ of the TNRs in intron 3 of the TCF4 gene. SEQ ID NOs: 94-190 are target sequences 3′ of the TNRs in intron 3 of the TCF4 gene. SEQ ID NOs: 191-1063 are target sequences for the wild type COL8A2 gene. SEQ ID NOs: 1064-1069 are target sequences for the COL8A2 Gln455Lys mutation. SEQ ID NOs: 1070-1075 are target sequences for the COL8A2 Gln455a1 mutation. SEQ ID NOs: 1076-1084 are target sequences for the COL8A2 Leu450Trp mutation.

[0143] Table A shows the sequences for SEQ ID NOs: 1085-1088 (see Exemplary sequences from WO 2017/185054).

[0144] The guide RNA and Cas components (i.e. the CRISPR complexes) are packaged into AAV vectors for delivery to a subject. In certain embodiments, the AAV vectors may be delivered by themselves. In other embodiments, the AAV vectors may be enclosed in a lipid nanoparticle, liposome, non-lipid nanoparticle, or viral capsid for delivery.

[0145] In some embodiments, the AAV vectors can be delivered directly to the eye. The AAV vector may be administered to the anterior chamber of the eye, the posterior chamber of the eye, the cornea, or the vitreous chamber of the eye. In certain embodiments, the AAV vectors can be administered to the corneal stroma, corneal limbus, onto the epithelial surface of the cornea, or onto the endothelial membrane of the cornea. In preferred embodiments, the AAV vectors are administered directly to the aqueous humor of the anterior chamber which is in direct contact with the corneal endothelium.

TCF4 Gene Targeting

[0146] The TCF4 gene is located on chromosome 18. The cytogenic location is 18q21.2 (the long arm of chromosome 18 at position 21.2). The molecular location is on base pairs 55,222,311 to 55,635,993 on chromosome 18 (Homo sapiens Annotation Release 109, GRCh38.p12 (NCBI)).

[0147] The target sequence may be within or flanking the TNRs in the TCF4 gene. A Cas nuclease is guided to the target sequence. In some embodiments, the Cas nuclease may be guided to a target sequence within the TNRs of the TCF4 gene. In other embodiments, the Cas nuclease may be guided to a target sequence flanking the TNR. For example, the Cas nuclease may be directed to a target sequence 5′ of the TNRs. Or the Cas nuclease may be directed to a target sequence 3′ of the TNRs. In some embodiments, the Cas protein may be directed by two or more gRNAs to two target sequences flanking the TNRs. In some embodiments, the Cas nuclease may be directed by two or more gRNAs to two target sequences, wherein one is within the TNRs of the TCF4 gene, and the other flanks the TNRs of the TCF4 gene. Target sequences for the TCF4 gene are chosen from SEQ ID NOs: 1-190. SEQ ID NOs: 1-93 are target sequences 5′ of the TNRs in intron 3 of the TCF4 gene. SEQ ID NOs: 94-190 are target sequences 3′ of the TNRs in intron 3 of the TCF4 gene. Guide sequences for the TCF4 gene are chosen from SEQ ID NOs: 1089-1278. (see Sequence Listing)

[0148] The one or more gRNA comprise a guide sequence that is complementary to a target sequence in the TCF4 gene, or the reverse complement of a target sequence in the TCF4 gene. In some embodiments, the gRNA sequence is 100% complementary or identical to the target sequence. Preferably, the degree of complementarity or identity between a guide sequence of a gRNA and its corresponding target sequence is at least about 50% or greater. For example, the degree of complementarity or identity may be about 50%, 55%, 60%, 65%, 70%, 80%, 85%, 90%, 95%, 96%, 97% 98%, 99%, or 100%.

[0149] In some embodiments, one gRNA is used. In other embodiments, a combination of two or more gRNA are used. In certain embodiments, a gRNA targeting a sequence 5′ of the TNRs is used in combination with a gRNA that targets a sequence 3′ to the TNRs, in order to excise the TNRs of the TCF4 gene. In some embodiments, a gRNA complementary to a target sequence chosen from SEQ ID NOs: 1-93 is used together with a gRNA complementary to a target sequence chosen from SEQ ID NOs: 94-190. Table 1 shows target sequences and corresponding guide sequences (from Ex. 1 of WO 2017/185054). Table 2 shows combinations of guide sequences (From Ex. 1 of WO 2017/185054). (see Exemplary sequences from WO 2017/185054)

[0150] In embodiments wherein the CRISPR complex includes an endonucleotide encoding the protein, the endonucleotide may be operably linked to one or more transcriptional or translational control sequences. In certain embodiments, the endonucleotide is operably linked to one or more promoters. The promoter may be constitutive, inducible, or tissue-specific. Examples of constitutive promoters include, but are not limited to, cytomegalovirus immediate early promoter (CMV), simian virus (SV40) promoter, adenovirus major late (MLP) promoter, Rous sarcoma virus (RSV) promoter, elongation factor-alpha (EF1a) promoter, ubiquitin promoters, actin promoters, tubulin promoters, immunoglobulin promoters, functional fragments thereof, or combinations thereof. Examples of inducible promoters include, but are not limited to, those inducible by heat shock, light, chemicals, peptides, metals, steroids, antibiotics, or alcohol. In some embodiments the promoter may be tissue specific, such as a promoter specific for expression in the cornea, e.g. the corneal edothelium.

[0151] In some embodiments, the nucleotide sequence encoding the gRNA may be operably linked to at least one transcriptional or translational control sequences. These include promoters, a 3′ UTR, or a 5′ UTR. The promoter may be recognized by RNA polymerase III (Pol III), such as, but limited to, U6 and HI Pol III promoters. The Pol III promoters may be, for example, mouse or human.

[0152] In certain embodiments, one or more gRNA are packaged in AAV vectors, in combination with either an endonucleotide sequence encoding a Cas protein, or a Cas protein (e.g. Cas9) (i.e. CRISPR complexes). The AAV serotype used is not particularly limited. Preferably, the AAV vectors are of the AAV5, AAV6, or AAV8 serotype.

[0153] The AAV-CRISPR complexes can be delivered directly into the eye via intracameral or intrastromal injection. In certain embodiments, the AAV vectors may be delivered by themselves. In other embodiments, the AAV vectors may be enclosed in a lipid nanoparticle, liposome, non-lipid nanoparticle, or viral capsid for delivery.

[0154] In some embodiments, the AAV vectors can be delivered directly to the eye. The AAV vector may be administered to the anterior chamber of the eye, the posterior chamber of the eye, the cornea, or to the vitreous chamber of the eye. In certain embodiments, the AAV vectors can be administered to the corneal stroma, corneal limbus, onto the epithelial surface of the cornea, or onto the endothelial membrane of the cornea. In preferred embodiments, the AAV vectors are administered directly to the aqueous humor of the anterior chamber which is in direct contact with the corneal endothelium.

COL8A2 Gene Targeting

[0155] Mutations in the COL8A2 gene, and thus the mutations in the gene products, can also be treated with the methods and compositions described herein. This can be done by developing CRISPR complexes that target specific sequences in the COL8A2 gene that lead to the mutations.

[0156] In some embodiments, a CRISPR complex can be used to excise a target mutant nucleotide sequence on the COL8A2 gene, and excise a nucleotide sequence of the DNA encoding a mutated gene product. The DNA may then be repaired with the process of NHEJ, leading to the generation of indels and the loss of the mutant allele. In other embodiments, use of the CRISPR complexes can be done together with either an exogenous template for HR/HDR, or using the endogenous normal allele as a template for HR/HDR, resulting in correction of the nucleic acid mutation that leads to the amino acid mutation in the alpha 2 subunit of COL8. Mutations that can be corrected include: the Gln455Lys mutation, caused by the c.1364C>A nucleotide change; the Gln455Val mutation caused by the c.1363-1364CA>GT nucleotide changes; or the Leu450Trp mutation caused by the c.1349T>G nucleotide change.

[0157] Target sequences for the COL8A2 gene can be selected using the NCBI Reference Sequence NM_005202.3 of transcript variant 1 of the COL8A2 gene. This sequence does not contain mutations at positions 455 and 450 in the amino acid sequence of the COL8 gene product, and may be considered the “wild type” COL8A2 gene sequence. Target sequences can be selected between Chr1:36097532-36100270 (hg38). Target sequences for the COL8A2 gene are selected from SEQ ID NOs: 191-1063. Target sequences for the wild type COL8A2 gene are shown in Table 3. Guide sequences complementary to these target sequences can be developed to target the COL8A2 gene.

[0158] Target sequences to the mutant alleles can also be developed, based on the differences in the nucleotide sequences for the mutant alleles. Table 4 shows target sequences specific for the Gln155Lys mutation, caused by the c.1364C>A nucleotide change (SEQ ID NOs: 1064-1069). Table 5 shows target sequences specific for the Gln455Val mutation, caused by the c.1363-1364CA>GT nucleotide changes (SEQ ID NOs: 1070-1075). Table 6 shows target sequences specific for Leu450Trp mutation, caused by the c.1349T>G nucleotide change (SEQ ID NOs: 1076-1084). The mutant alleles could be targeted using gRNA comprising guide sequences complementary to the target sequences, or comprising guide sequences complementary to the reverse complement of the target sequences.

[0159] In certain embodiments, one or more gRNA are packaged in AAV vectors, in combination with either an endonucleotide sequence encoding a Cas protein, or a Cas protein (e.g. Cas9) (i.e. CRISPR complexes). The AAV serotype used is not particularly limited. Preferably, the AAV vectors are of the AAV5, AAV6, or AAV8 serotype.

[0160] The AAV-CRISPR complexes can be delivered directly into the eye via intracameral or intrastromal injection. In certain embodiments, the AAV vectors may be delivered by themselves. In other embodiments, the AAV vectors may be enclosed in a lipid nanoparticle, liposome, non-lipid nanoparticle, or viral capsid for delivery.

[0161] In some embodiments, the AAV vectors can be delivered directly to the eye. The AAV vector may be administered to the anterior chamber of the eye, the posterior chamber of the eye, or the cornea. In certain embodiments, the AAV vectors can be administered to the corneal stroma, corneal limbus, onto the epithelial surface of the cornea, or onto the endothelial membrane of the cornea. In preferred embodiments, the AAV vectors are administered directly to the aqueous humor of the anterior chamber which is in direct contact with the corneal endothelium.

Exemplary Embodiments

[0162] In certain embodiments, the mutant allele is encoded by a target sequence on the target gene.

[0163] In some embodiments, at least one nucleotide sequence that is complementary to at least one mutant allele on a target gene hybridizes to a target sequence on the target gene in a cell in the subject.

[0164] In certain embodiments the target gene is TCF4 or COL8A2.

[0165] In some embodiments, at least one target sequence is selected from the group consisting of SEQ ID NOs: 1-1084.

[0166] In some embodiments, at least one target sequence is specific to the TCF4 gene, and the target sequence is selected from SEQ ID NOs: 1-190.

[0167] In some embodiments, the target sequence is specific to the COL8A2 gene and the target sequence is selected from SEQ ID NOs: 191-1084

[0168] In some embodiments, the nucleic acid editing system is a CRISPR system, an siRNA, an shRNA, an miRNA, an antisense RNA, or an antagomir RNA.

[0169] In some embodiments, the nucleic acid editing system is a CRISPR system.

[0170] In some embodiments, the nucleic acid editing system is a CRISPR-Cas system.

[0171] In some embodiments, the CRISPR-Cas system comprises a nucleotide sequence encoding a CRISPR-associated (Cas) gene and a nucleotide sequence encoding a guide RNA (gRNA).

[0172] In some embodiments, the Cas gene encodes a Cas protein.

[0173] In some embodiments, the Cas protein encoded by the Cas gene is a Cas nuclease.

[0174] In some embodiments, the Cas nuclease is Cas9.

[0175] In some embodiments, the guide RNA comprises a CRISPR RNA (crRNA) and a trans-activating crRNA (tracrRNA or trRNA).

[0176] In some embodiments, the guide RNA is a single guide RNA (sgRNA), and both the crRNA and the tracrRNA are combined on one guide RNA molecule.

[0177] In some embodiments, the guide RNA is a double guide RNA (dgRNA), and the crRNA and the tracrRNA are on separate RNA molecules, used at the same time, but not combined.

[0178] In some embodiments, the CRISPR-Cas system is a CRISPR-Cas9 system.

[0179] In some embodiments, the crRNA and tracrRNA form a complex with the nucleotide sequence encoding Cas9 nuclease.

[0180] In some embodiments, the nucleotide sequence that is complementary to at least one mutant allele is a gRNA.

[0181] In some embodiments, at least one guide RNA comprises a crRNA sequence that is complementary to at least one target sequence selected from SEQ ID NOs: 1-1084.

[0182] In some embodiments, at least one guide RNA comprises a guide sequence selected from the group consisting of SEQ ID NOs: 1089-1278.

[0183] In some embodiments, the delivery system, vector, gene editing system, or composition further comprises a repair template.

[0184] In some embodiments, the repair template is selected from the group consisting of a DNA repair template, an mRNA repair template, an siRNA repair template, an miRNA repair template, and an antisense oligonucleotide repair template.

[0185] In some embodiments, the AAV vector serotype is selected from the group consisting of AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh10.

[0186] In some embodiments, the AAV vector serotype is AAV5, AAV6, or AAV8.

[0187] In some embodiments, the AAV vector serotype is AAV5.

[0188] In some embodiments, the AAV vector serotype is AAV6.

[0189] In some embodiments, the AAV vector serotype is AAV8.

[0190] In some embodiments, the delivery system, vector, nucleotide or gene editing system, or composition further comprises a promoter.

[0191] In some embodiments, the promoter is optimized for use with an AAV5, AAV6 or AAV8 vector.

[0192] In some embodiments, the promoter is tissue specific, and when operably linked with the AAV vector or the nucleotide that is a sequence that is complementary to at least one mutant allele on a target gene is active in the eye.

[0193] In some embodiments, the tissue specific promoter is active in the cornea or other anterior ocular tissues.

[0194] In some embodiments, the tissue specific promoter is active in the endothelium of the cornea.

[0195] In some embodiments, the target gene is preferentially expressed in the anterior portion of the eye. Preferably, the target gene is preferentially expressed in the cornea, and most preferably, preferentially expressed in the endothelium of the cornea.

[0196] In some embodiments, the delivery system, vector, nucleotide or gene editing system, or composition is preferentially expressed in the anterior portion of the eye after IC injection. Preferably, the delivery system, vector, nucleotide or gene editing system, or composition is preferentially expressed in the cornea, and most preferably, preferentially expressed in the endothelium of the cornea, after IC injection.

[0197] In some embodiments, the delivery system, vector, nucleotide or gene editing system, or composition is suitable for treating a disease or condition in the eye.

[0198] In some embodiments, the disease or condition in the eye is a disease or condition of the cornea.

[0199] In some embodiments, the disease or condition of the cornea is a superficial corneal dystrophy, anterior corneal dystrophy, corneal stromal dystrophy, or posterior cornea dystrophy.

[0200] In some embodiments, the disease or condition of the cornea is a posterior corneal dystrophy.

[0201] In some embodiments, the posterior corneal dystrophy is Fuchs endothelial corneal dystrophy (FECD; both early and late onset), posterior polymorphous dystrophy (PPCD; types 1, 2, and 3), congenital endothelial dystrophy (types 1 and 2), and X-linked endothelial corneal dystrophy.

[0202] In some embodiments, the corneal dystrophy is FECD.

EXAMPLES

Example 1. Methods of Preparing and Administering AAV Vectors

AAV Vectors

[0203] Wildtype AAV2 AAV5, AAV6, AAV8, and AAV9 vectors were produced by methods known in the art. Each AAV encoded for eGFP under the ubiquitous CAG promoter. Each AAV was supplied at 1e13vg/mL in a PBS+0.001% pluronic acid formulation.

Intracameral (IC) Injections

[0204] Adult male C57BL/6J mice (10-11 weeks old) were purchased from Jackson Laboratories. All animal procedures and handling were conducted according to the ARVO Statement for the use of Animals and the Regeneron Pharmaceuticals IACUC reviewed protocol. Mice were anesthetized with ketamine/xylazine mixture by intraperitoneal injection. The eyes were rinsed with sterile saline followed by a drop of tropicamide (to dilate the pupil) with a drop of proparacaine (to numb the cornea). Using a Drummond Scientific Nanoject II microinjection device fitted with a pulled glass needle (sandpaper beveled), AAV solution was filled into the needle and used to inject AAV solution into each anterior chamber. The glass needle was injected through the cornea, parallel to the iris, into the aqueous humor of the anterior chamber. A small amount of aqueous humor was allowed to leak out. Bubbles were pushed into cornea followed by 1.5 μL of AAV solution, containing 1.5e10 vg. The needle was held still after the injection for 30 sec and then pulled out in a quick smooth motion. Both OD (right eye) and OS (left eye) of each animal were injected. Control animals received injections of PBS+0.001% pluronic acid instead of AAV solution. Genteal ointment was applied to each eye to prevent corneal drying and abrasion while the mouse was placed on its ventral side (to prevent leakage and pooling) to recover from anesthesia.

Intravitreal Injections

[0205] Adult male C57BL/6J mice (10-11 weeks old) were purchased from Jackson Laboratories. All animal procedures and handling were conducted according to the ARVO Statement for the use of Animals and the Regeneron Pharmaceuticals IACUC reviewed protocol. Mice were anesthetized with ketamine/xylazine mixture by intraperitoneal injection. The eyes were rinsed with sterile saline followed by a drop of tropicamide (to dilate the pupil) with a drop of proparacaine (to numb the cornea). Using a Drummond Scientific Nanoject II microinjection device fitted with a pulled glass needle (sandpaper beveled), AAV solution was filled into the needle and used to inject AAV solution into the vitreous humor of the vitreous chamber. The glass needle was injected through the sclera at the limbus of the eye into the vitreous chamber. 1.5 μL of AAV solution, containing 1.5e10 vg, was injected into the vitreous chamber using the microinjection device. The needle was pulled out in a quick smooth motion. Both OD (right eye) and OS (left eye) of each animal were injected. Control animals received injections of PBS+0.001% pluronic acid instead of AAV solution. Genteal ointment was applied to each eye to prevent corneal drying and abrasion while the mouse was placed on its ventral side (to prevent leakage and pooling) to recover from anesthesia.

Example 2. Assessment of Specificity of Protein Targeting to Different Tissues in the Eye

In Vivo Imaging

[0206] In vivo imaging was performed at baseline prior to injections and at timepoints post injections using the Heidelberg Spectralis HRA+OCT (Heidelberg Engineering, Inc, Germany). Mice were anesthetized and a drop of tropicamide was applied to each eye to dilate the pupil, followed by a drop of proparacaine to numb the cornea. At each time point, infrared images and fluorescence images to detect AAV-eGFP fluorescence were taken of the posterior retinal fundus (+25 diopter small animal imaging lens) and the anterior cornea (anterior segment module). The FA modality on the Heidelberg Spectralis HRA+OCT was used to detect fluorescence of eGFP protein resulting from the AAV-eGFP injections.

Immunohistochemistry

[0207] Mice that received AAV-eGFP injections, such as AAV5-eGFP, AAV6-eGFP, and AAV8-eGFP, by intraocular injection were euthanized for enucleation of their eyes. Control mice that received PBS+0.001% pluronic acid intraocular injections were euthanized for enucleation of their eyes. Each eye was enucleated and fixed in 4% PFA overnight at 4° C. The eyes were washed in PBS followed by incubation in 30% sucrose at 4° C. for a minimum of 3 days. Eyes were then embedded in OCT embedding compound and a subset of the samples were sent for cross-sectioning by Histoserv Inc (Maryland). In order to amplify regions of AAV-eGFP localization, a primary antibody for eGFP was incubated on the slides containing cross-sectioned mouse eye tissues at 4° C. overnight. The secondary antibody was conjugated to Alexa-Fluor 594 (red) to differentiate from the green endogenous eGFP unamplified signal. DAPI (blue) was added to the slides to label nuclei and aid in the identification of cellular types and regions.

[0208] The slides were imaged using the Keyence microscope (Keyence Corporation of America, Ill., USA). Regions of green and/or red fluorescence were assessed for both anatomical ocular regions and cellular localization.

eGFP Protein Measurement

[0209] Four mice (whole eyes) for each of the AAV serotypes, such as AAV5-eGFP, AAV6-eGFP, AAV8-eGFP, delivered by intraocular injections were euthanized for enucleation of their eyes. Two mice that received PBS+0.001% pluronic acid were included as controls for each of the AAV serotypes tested and were euthanized for enucleation of their eyes. Each eye was kept separate and processed as an individual sample. The eyes were immersed in 1× cell extraction buffer PTR (provided in the ELISA kit) and were homogenized using a tissuelyzer with stainless steel beads. The samples were centrifuged and the protein containing lysate was collected. Total protein measurements were measured using the BCA kit (Pierce BCA Protein Assay kit, ThermoFisher). Samples were assayed in triplicates for eGFP protein expression using the GFP SimpleStep ELISA kit (Abcam). eGFP expression per eye was calculated as ng/μg of total protein isolated from the eye.

[0210] Transduction efficiency and tropism varied depending on the AAV serotype used. Using Heidelberg Spectralis in vivo imaging, regions of AAV transduction after IC administration were determined. AAV2, AAV6, AAV8, and AAV9 were found to target both the posterior and anterior segments of the eye after IC administration with AAV2, AAV6, and AAV9 showing the strongest eGFP expression in the anterior segment, whereas AAV5 targets only anterior ocular tissues. The data also indicate that that AAV5, AAV6, and AAV8 have a strong tropism for anterior regions after IC injections. Additionally, IC injections are also capable of delivering AAVs to the posterior tissues, as shown by the strong tropism of AAV2 and AAV9 to the posterior regions after IC injections.

Example 3. Correction of a Gene Mutation in the Endothelial Cells of the Cornea

[0211] Corrections of target gene mutations such as mutations in TCF4 or COL8A2 in the endothelial cells of the cornea are done by administering a composition comprising a nucleic acid editing system comprising a CRISPR/Cas complex.

[0212] The CRISPR/Cas complex comprises a guide sequence that is complementary to a portion of the target gene containing the mutation and is directed to the target DNA sequence, and an endonucleotide encoding for a Cas nuclease.

[0213] The CRISPR/Cas complex is guided to the target sequence, and the Cas nuclease cleaves the target sequence. A gene insertion mutation is corrected by cleaving the target sequence, and repairing the break in the DNA. A gene mutation that is a change in a nucleotide is corrected by cleaving the mutated sequence nucleotide sequence, and repairing the DNA with a repair template comprising the nucleotide sequence of the wild-type gene.

[0214] The CRISPR/Cas complex is preferably packaged in an AAV vector, such as AAV5, AAV6 or AAV8. AAV vectors are produced by methods known in the art. Each AAV encodes for a target sequence under the ubiquitous CAG promoter. Each AAV is supplied at 1e13 g/mL in a PBS+0.001% pluronic acid formulation.

[0215] The AAV vector packaged with the CRISPR/Cas complex is administered directly to the anterior chamber of the eye via intracameral injection. Mice carrying such mutations are anesthetized with ketamine/xylazine mixture by intraperitoneal injection. The eyes are rinsed with sterile saline followed by a drop of tropicamide (to dilate the pupil) with a drop of proparacaine (to numb the cornea). Using a Drummond Scientific Nanoject II microinjection device fitted with a pulled glass needle (sandpaper beveled), AAV solution is filled into the needle and used to inject AAV solution into each anterior chamber. The glass needle is injected through the cornea, parallel to the iris, into the aqueous humor of the anterior chamber. A small amount of aqueous humor is allowed to leak out. Bubbles are pushed into cornea followed by 1.5 μL of AAV solution, containing 1.5e10 vg. The needle is held still after the injection for 30 sec and then pulled out in a quick smooth motion. Both OD (right eye) and OS (left eye) of each animal are injected. Control animals receive injections of PBS+0.001% pluronic acid instead of AAV solution. Genteal ointment is applied to each eye to prevent corneal drying and abrasion while the mouse is placed on its ventral side (to prevent leakage and pooling) to recover from anesthesia.

[0216] Corrections of gene expression is confirmed by dissecting corneas (as well as isolating endothelial cells from said corneas) from the eyes of treated and control mice, and doing DNA and/or RNA nucleic acid sequencing.

Example 4—Downregulation of Gene Expression in the Endothelial Cells of the Cornea

[0217] Gene expression is downregulated by administering a composition comprising at least one inhibitory nucleotide sequence that is complementary to at least one allele on a target gene, selected from an siRNA, an shRNA, an miRNA, an antisense RNA, or an antagomir RNA. The target gene is any cornea mutated gene such as TCF4 or COL8A2. The inhibitory RNA is present in the composition by itself, or as part of a CRISPR/Cas complex.

[0218] The inhibitory RNA is packaged in an AAV vector similarly to Example 3. The inhibitory RNA is preferably packaged in an AAV vector, such as AAV5, AAV6 or AAV8. AAV vectors are produced by methods known in the art. Each AAV encodes for a target sequence under the ubiquitous CAG promoter. Each AAV is supplied at 1e13 g/mL in a PBS+0.001% pluronic acid formulation.

[0219] Similarly to Example 3, the AAV vector packaged with the inhibitory RNA is administered directly to the anterior chamber of the eye via intracameral injection. Mice are anesthetized with ketamine/xylazine mixture by intraperitoneal injection. The eyes are rinsed with sterile saline followed by a drop of tropicamide (to dilate the pupil) with a drop of proparacaine (to numb the cornea). Using a Drummond Scientific Nanoject II microinjection device fitted with a pulled glass needle (sandpaper beveled), AAV solution is filled into the needle and used to inject AAV solution into each anterior chamber. The glass needle is injected through the cornea, parallel to the iris, into the aqueous humor of the anterior chamber. A small amount of aqueous humor is allowed to leak out. Bubbles are pushed into the cornea followed by 1.5 μL of AAV solution, containing 1.5e10 vg. The needle is held still after the injection for 30 sec and then pulled out in a quick smooth motion. Both OD (right eye) and OS (left eye) of each animal are injected. Control animals receive injections of PBS+0.001% pluronic acid instead of AAV solution. Genteal ointment is applied to each eye to prevent corneal drying and abrasion while the mouse is placed on its ventral side (to prevent leakage and pooling) to recover from anesthesia.

[0220] Downregulation of gene expression is confirmed by dissecting corneas from the eyes of treated and control mice, and measuring the amount of the protein encoded by the gene in the samples via Western blot. Successful downregulation of gene expression results in reduced levels of the encoded protein in corneal tissue from treated mice versus control mice.

[0221] The present invention has been described in detail, including the preferred embodiments thereof. However, it will be appreciated that those skilled in the art, upon consideration of the present disclosure, may make modifications and/or improvements on this invention that fall within the scope and spirit of the invention.

Exemplary Sequences from WO 2017/185054.

TABLE-US-00003 TABLE A SEQ ID NOs: 1085-1088 SEQ Sequence Description ID NO. GTTTGTGTGA TTTTGCTAAA ATGCATCACC AACAGCGAAT TCF4 intron 3 1085 GGCTGCCTTA GGGACGGACA AAGAGCTGAG TGATTTACTG sequence with GATTTCAGTG CGgtaagaaa gaacggtgga aactaacaac flanking axons, agctgtgaaa aaaacaaaac aaaaacccaa acacttcagc tagaaaccag taggaatcta reverse strand aaggacagta ataattttta attggctgaa tccttggtaa atatgaaggt ctattgaca (GRCh37/hg19). agtttttaac tataattttg tggtgtgatg gaagattcag gctttttttt ttttttgagt tttattactg While gccttcaatt ccctacccac tgattacccc aaataatgga atctcacccc commonly agtggaaagc aaaaatagac acccctaaaa ctaaaccacc cctaaaactt ggccatgtct referred to as gaacactgag actactaata ctttgcacac tactcttcgt tttatttatt gtttttggaa intron 3, many atggaaaata gaaaatagga gacccagttg tctctttaaa gttttaagct aatgatgctt tggattggta alternatively ggacctgttc cttacatctt acctcctagt tacatctttt cctaggattc spliced isoforms ttaaaactag tatggatatg ctgagcatac attctttaga accttttgga ctgttttggt aaatttcgta of the gene gtcgtaggat cagcacaaag cggaacttga cacacttgtg gagattacg exist, such that gctgtacttg gtccttctcc atcccttgac ttccttttcc taaaccaagt cccagacatg tcaggagaat this intron may gaattcattt ttaatgccag atgagtttgg tgtaagatgc atttgtaaag not fall between caaaataaaa agaatecaca aaacacacaa ataaaatcca aaccgccttc caagtggggc the 3.sup.rd and 4.sup.th tctttcatgc tgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctg exons of every ctgctgctgctgctgctgctgctcctcctc ctcctcctcc ttctcctcct cctcctcctc ttctagacct transcript. tcttttggag aaatggcttt cggaagtttt gccaggaaac gtagccctag Bold font gcaggcagct ttgcagcccc ctttctgctt gttgcacttt ctccattcgt tcctttgctt tttgcaggct indicates ctg ctgactcagg gaaggtgtgc attatccact agatacgtcg aagaagaggg (TNRsrepeats ). aaaccaatta gggtcgaaat aaatgctgga gagagaggga gtgaaagaga gagtgagagt This region is gagagagaga gagagtcttg cttcaaattg ctctcctgtt agagacgaaa tgagaattta variable in gtgcaggtgg cacttttatt tttatttggg ttcacatatg acaggcaaat cctatacgag atggaaatgg size. acattgccac gtttatggcc aaggttttca atataaaaca aaacaacttt Capital letters tttcttctcc ttggtgaaac tagtgttttt ctagagaggc tgctggcctc caacctgaat cttgataaca indicate ttatggggac tgtgtttgtt ccaaatgtag cagtagtact gcttggccat sequences of ctaatgaacc tgaggaaaaa gaaagaacag agtaataatg ggggctgggg tgggatctgt adjacent 5′ and aatgttgttt ctcttttagt tttaagttgg atggtgatgt attttactaa ataaaccctt 3′ axons. agcataaact ctaagctgtt tggtaacagt atgaaagatc tttgaggagc tctgaaggca caagtgtctt cttttcaact gtaatatttc tttgtttctt ttagATGTTT TCACCTCCTG TGAGCAGTGG GAAAAATGGA CCAACTTCTT TGGCAAGTGG ACATTTTACT GGCTCAA mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAG sgRNA 1086 AmGmCmUmAmGmAmAmUmAmGmCAAGUUAAA modified AUAAGGCUAGUCCGUUA UCAmAmCmUm UmGmAm sequence AmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmC “N” may be any mGmGmUmGmCm U*mU*mU*mU natural or non-natural nucleotide * = PS linkgage; “m” = 2′-O-Me nucleotide. NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAUGCUGUUUUUG crRNA 1087 sequence “N” may be any natural or non-natural nucleotide. AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA trRNA sequence 1088 CUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU

TABLE-US-00004 TABLE 1 TCF4 target sequences and corresponding guide sequences SEQ Distance SEQ ID Target sequence Chromosomal to start ID Guide NO (including PAM) location Strand Orientation TNR NO sequence 1 TTGGCAAGTGGAC Chr18:55585285- - 5′ of TNRs -871 1089 UUGGCAAGUG ATTTTACTGG 55585307 of TCF4 GACAUUUUAC 2 TGTCCACTTGCCA Chr18:55585294- + 5′ of TNRs -862 1090 UGUCCACUUG AAGAAGTTGG 55585316 of TCF4 CCAAAGAAGU 3 GGACCAACTT Chr18:55585297- - 5′ of TNRs -859 1091 GGACCAACUU CTTTGGCAAGTGG 55585319 of TCF4 CUUUGGCAAG 4 GAAAAATGGA Chr18:55585304- - 5′ of TNRs -852 1092 GAAAAAUGGA CCAACTTCTTTGG 55585326 of TCF4 CCAACUUCUU 5 CCATTTTTCC Chr18:55585318 + 5′ of TNRs -838 1093 CCAUUUUUCC CACTGCTCACAGG 55585340 of TCF4 CACUGCUCAC 6 CCTGTGAGCA Chr18:55585318- - 5′ of TNRs -838 1094 CCUGUGAGCA GTGGGAAAAATGG 55585340 of TCF4 GUGGGAAAAA 7 TTTTTCCCAC Chr18:55585321- + 5′ of TNRs -835 1095 UUUUUCCCAC TGCTCACAGGAGG 55585343 of TCF4 UGCUCACAGG 8 TTTCACCTCC Chr18:55585326- - 5′ of TNRs -830 1096 UUUCACCUCC TGTGAGCAGTGGG 55585348 of TCF4 UGUGAGCAGU 9 TTTTCACCTC Chr18:55585327- - 5′ of TNRs -829 1097 UUUUCACCUC CTGTGAGCAGTGG 55585349 of TCF4 CUGUGAGCAG 10 AGATCTTTGA Chr18:55585399- - 5′ of TNRs -757 1098 AGAUCUUUGA GGAGCTCTGAAGG 55585421 of TCF4 GGAGCUCUGA 11 AACAGTATCA Chr18:55585410- - 5′ of TNRs -746 1099 AACAGUAUGA AAGATCTTTGAGG 55585432 of TCF4 AAGAUCUUUG 12 AGCATAAACT Chr18:55585434- - 5′ of TNRs -722 1100 AGCAUAAACU CTAAGCTGTTTGG 55585456 of TCF4 CUAAGCUGUU 13 ACAGCTTAGA Chr18:55585438- + 5′ of TNRs -718 1101 ACAGCUUAGA GTTTATGCTAAGG 55585460 of TCF4 GUUUAUGCUA 14 CAGCTTAGAG Chr18:55585439- + 5′ of TNRs -717 1102 CAGCUUAGAG TTTATGCTAAGGG 55585461 of TCF4 UUUAUGCUAA 15 TCTTTTAGTT Chr18:55585483- - 5′ of TNRs -673 1103 UCUUUUAGUU TTAAGTTGGATGG 55585505 of TCF4 UUAAGUUGGA 16 TTTCTCTTTT Chr18:55585487- - 5′ of TNRs -669 1104 UUUCUCUUUU AGTTTTAAGTTGG 555585509 of TCF4 AGUUUUAAGU 17 GTGATAATGG Chr18:55585523- - 5′ of TNRs -633 1105 GUGAUAAUGG GGGCTGGGGTGGG 55585545 of TCF4 GGGCUGGGGU 18 AGTGATAATG Chr18:55585524- - 5′ of TNRs -632 1106 AGUGAUAAUG GGGGCTGGGGTGG 55585546 of TCF4 GGGGCUGGGG 19 CAGAGTGATA Chr18:55585527- - 5′ of TNRs -629 1107 CAGAGUGAUA ATGGGGGCTGGGG 55585549 of TCF4 AUGGGGGCUG 20 ACAGAGTGAT Chr18:55585528- - 5′ of TNRs -628 1108 ACAGAGUGAU AATGGGGGCTGGG 55855550 of TCF4 AAUGGGGGCU 21 AACAGAGTGA Chr18:5585529- - 5′ of TNRs -627 1109 AACAGAGUGA TAATGGGGGCTGG 5585551 of TCF4 UAAUGGGGGC 22 AAAGAACAGA Chr18:55585533- - 5′ of TNRs -623 1110 AAAGAACAGA GTGATAATGGGGG 55585555 of TCF4 GUGAUAAUGG 23 GAAAGAACAG Chr18:55585534- - 5′ of TNRs -622 1111 GAAAGAACAG AGTGATAATGGGG 55585556 of TCF4 AGUGAUAAUG 24 AGAAAGAACA Chr18:55585535- - 5′ of TNRs -621 1112 AGAAAGAACA GAGTGATAATGGG 55585557 of TCF4 GAGUGAUAAU 25 AAGAAAGAAC Chr18:55585536- - 5′ of TNRs -620 1113 AAGAAAGAAC AGAGTGATAATGG 55585558 of TCF4 AGAGUGAUAA 26 TCTGTTCTTT Chr18:5585546- + 5′ of TNRs -610 1114 UCUGUUCUUU CTTTTTCCTCAGG 5585568 of TCF4 CUUUUUCCUC 27 TTTTCCTCAG Chr18:55585558- + 5′ of TNRs -598 1115 UUUUCCUCAG GTTCATTAGATGG 55585580 of TCF4 GUUCAUUAGA 28 TTGGCCATCT Chr18:55585562- - 5′ of TNRs -594 1116 UUGGCCAUCU AATGAACCTGAGG 55585584 of TCF4 AAUGAACCUG 29 AATGTAGCAG Chr18:55585581- - 5′ of TNRs -575 1117 AAUGUAGCAG TAGTACTGCTTGG 55585603 of TCF4 UAGUACUGCU 30 AGCAGTACTA Chr18:55585584- + 5′ of TNRs -572 1118 AGCAGUACUA CTGCTACATTTGG 55585606 of TCF4 CUGCUACAUU 31 TGAATCTTGA Chr18:55585619- - 5′ of TNRs -537 1119 UGAAUCUUGA TAACATTATGGGG 55585641 of TCF4 UAACAUUAUG 32 CTGAATCTTG Chr18:55585620- - 5′ of TNRs -536 1120 CUGAAUCUUG ATAACATTATGGG 55585642 of TCF4 AUAACAUUAU 33 CCATAATGTT Chr18:55585621- + 5′ of TNRs -535 1121 CCAUAAUGUU ATCAAGATTCAGG 55585643 of TCF4 AUCAAGAUUC 34 CCTGAATCTT Chr18:55585621- - 5′ of TNRs -535 1122 CCUGAAUCUU GATAACATTATGG 55585643 of TCF4 GAUAACAUUA 35 AATGTTATCA Chr18:55585625- + 5′ of TNRs -531 1123 AAUGUUAUCA AGATTCAGGTTGG 55585647 of TCF4 AGAUUCAGGU 36 GTTATCAAGA Chr18:55585628- + 5′ of TNRs -528 1124 GUUAUCAAGA TTCAGGTTGGAGG 55585650 of TCF4 UUCAGGUUGG 37 TGTTTTTCTA Chr18:55585651- - 5′ of TNRs -505 1125 UGUUUUUCUA GAGAGGCTGCTGG 55585673 of TCF4 GAGAGGCUGC 38 AAACTAGTGT Chr18:55585658- - 5′ of TNRs -498 1126 AAACUAGUGU TTTTCTAGAGAGG 55585680 of TCF4 UUUUCUAGAG 39 GAAAAACACT Chr18:55585666- + 5′ of TNRs -490 1127 GAAAAACACU AGTTTCACCAAGG 55585688 of TCF4 AGUUUCACCA 40 AACAACTTTT Chr18:55585683- - 5′ of TNRs -473 1128 AACAACUUUU TTCTTCTCCTTGG 55585705 of TCF4 UUCUUCUCCU 41 TTGTTTTATA Chr18:55585706- + 5′ of TNRs -450 1129 UUGUUUUAUA TTGAAAACCTTGG 55585728 of TCF4 UUGAAAACCU 42 GAAAACCTTG Chr18:55585718- + 5′ of TNRs -438 1130 GAAAACCUUG GCCATAAACGTGG 55585740 of TCF4 GCCAUAAACG 43 CATTGCCACG Chr18:55585723- - 5′ of TNRs -433 1131 CAUUGCCACG TTTATGGCCAAGG 55585745 of TCF4 UUUAUGGCCA 44 AATGGACATT Chr18:55585729- - 5′ of TNRs -427 1132 AAUGGACAUU GCCACGTTTATGG 55585751 of TCF4 GCCACGUUUA 45 TGTCCATTTC Chr18:55585744- + 5′ of TNRs -412 1133 UGUCCAUUUC CATCTCGTATAGG 55585766 of TCF4 CAUCUCGUAU 46 AATCCTATAC Chr18:55585747- - 5′ of TNRs -409 1134 AAUCCUAUAC GAGATGGAAATGG 55585769 of TCF4 GAGAUGGAAA 47 CAGGCAAATC Chr18:55585753- - 5′ of TNRs -403 1135 CAGGCAAAUC CTATACGAGATGG 55585775 of TCF4 CUAUACGAGA 48 TATTTGGGTT Chr18:55585772- - 5′ of TNRs -384 1136 UAUUUGGGUU CACATATGACAGG 55585794 of TCF4 CACAUAUGAC 49 TGGCACTTTT Chr18:55585787- - 5′ of TNRs -369 1137 UGGCACUUUU ATTTTTATTTGGG 55585809 of TCF4 AUUUUUAUUU 50 GTGGCACTTT Chr18:55585788- - 5′ of TNRs -368 1138 GUGGCACUUU TATTTTTATTTGG 55585810 of TCF4 UAUUUUUAUU 51 AAATGAGAAT Chr18:55585807- - 5′ of TNRs -349 1139 AAAUGAGAAU TTAGTGCAGGTGG 55585829 of TCF4 UUAGUGCAGG 52 ACGAAATGAG Chr18:55585810- - 5′ of TNRs -346 1140 ACGAAAUGAG AATTTAGTGCAGG 55585832 of TCF4 AAUUUAGUGC 53 ATTCTCATTT Chr18:55585820- + 5′ of TNRs -336 1141 AUUCUCAUUU CGTCTCTAACAGG 55585842 of TCF4 CGUCUCUAAC 54 AAATAAATGC Chr18:55585898- - 5′ of TNRs -258 1142 AAAUAAAUGC TGGAGAGAGAGGG 55585920 of TCF4 UGGAGAGAGA 55 GAAATAAATG Chr18:55585899- - 5′ of TNRs -257 1143 GAAAUAAAUG CTGGAGAGAGAGG 55585921 of TCF4 CUGGAGAGAG 56 ATTAGGGTCG Chr18:55585908- - 5′ of TNRs -248 1144 AUUAGGGUCG AAATAAATGCTGG 55585930 of TCF4 AAAUAAAUGC 57 GCATTTATTT Chr18:55585911- + 5′ of TNRs -245 1145 GCAUUUAUUU CGACCCTAATTGG 55585933 of TCF4 CGACCCUAAU 58 AAGAAGAGGG Chr18:55585924- - 5′ of TNRs -232 1146 AAGAAGAGGG AAACCAATTAGGG 55585946 of TCF4 AAACCAAUUA 59 GAAGAAGAGG Chr18:5585925- - 5′ of TNRs -231 1147 GAAGAAGAGG GAAACCAATTAGG 5585947 of TCF4 GAAACCAAUU 60 ACTAGATACG Chr18:55585937- - 5′ of TNRs -219 1148 ACUAGAUACG TCGAAGAAGAGGG 55585959 of TCF4 UCGAAGAAGA 61 CACTAGATAC Chr18:55585938- - 5′ of TNRs -218 1149 CACUAGAUAC GTCGAAGAAGAGG 55585960 of TCF4 GUCGAAGAAG 62 CTCTTCTTCG Chr18:5585939- + 5′ of TNRs -217 1150 CUCUUCUUCG ACGTATCTAGTGG 5585961 of TCF4 ACGUAUCUAG 63 TGCAGGCTCT Chr18:55585972- - 5′ of TNRs -184 1151 UGCAGGCUCU GACTCAGGGAAGG 55585994 of TCF4 GACUCAGGGA 64 TTTTTGCAGG Chr18:55585976- - 5′ of TNRs -180 1152 UUUUUGCAGG CTCTGACTCAGGG 55585998 of TCF4 CUCUGACUCA 65 CTTTTTGCAG Chr18:55585977- - 5′ of TNRs -179 1153 CUUUUUGCAG GCTCTGACTCAGG 55585999 of TCF4 GCUCUGACUC 66 TCAGAGCCTG Chr18:55585983- + 5′ of TNRs -173 1154 UCAGAGCCUG CAAAAAGCAAAGG 55586005 of TCF4 CAAAAAGCAA 67 TTCGTTCCTT Chr18:55585989- - 5′ of TNRs -167 1155 UUCGUUCCUU TGCTTTTTGCAGG 55586011 of TCF4 UGCUUUUUGC 68 GCAAAAAGCA Chr18:55585992- + 5′ of TNRs -164 1156 GCAAAAAGCA AAGGAACGAATGG 55586014 of TCF4 AAGGAACGAA 69 AGAAAGTGCA Chr18:55586015- + 5′ of TNRs -171 1157 AGAAAGUGCA ACAAGCAGAAAGG 55586037 of TCF4 ACAAGCAGAA 70 GAAAGTGCAA Chr18:55586016- + 5′ of TNRs -140 11158 GAAAGUGCAA CAAGCAGAAAGGG 55586038 of TCF4 CAAGCAGAAA 71 AAAGTGCAAC Chr18:55586017- + 5′ of TNRs -139 1159 AAAGUGCAAC AAGCAGAAAGGGG 55586039 of TCF4 AAGCAGAAAG 72 AAGTGCACA Chr18:55586018- + 5′ of TNRs -138 1160 AAGUGCAACA AGCAGAAAGGGGG 55586040 of TCF4 AGCAGAAAGG 73 GGCTGCAAAG Chr18:55586039- + 5′ of TNRs -117 1161 GGCUGCAAAG CTGCCTGCCTAGG 55586061 of TCF4 CUGCCUGCCU 74 GCTGCAAAGC Chr18:55586040- + 5′ of TNRs -116 1162 UGCCUGCCUA TGCCTGCCTAGGG 55586062 of TCF4 CAGGAAACGU 75 CAGGAAACGT Chr18:55586052- - 5′ of TNRs -104 1163 AGCCCUAGGC TGCCCTAGGCAGG 55586074 of TCF4 CUGCCUAGGG 76 CTGCCTAGGG Chr18:55586053- + 5′ of TNRs -103 1164 CUACGUUUCC CTACGTTTCCTGG 55586075 of TCF4 UUGCCAGGAA 77 TTGCCAGGAA Chr18:55586056- - 5′ of TNRs -100 1165 ACGUAGCCCU ACGTAGCCCTAGG 55586078 of TCF4 UGGCUUUCGG 78 TGGCTTTCGG Chr18:55586071- - 5′ of TNRs  -85 1166 AAGUUUUGCC AAGTTTTGCCAGG 55586093 of TCF4 UCUUUUGGAG 79 TCTTTTGGAG Chr18:55586084- - 5′ of TNRs  -72 1167 AAAUGGCUUU AAATGGCTTTCGG 55586106 of TCF4 AAAGCCAUUU 80 AAAGCCATTT Chr18:55586087- + 5′ of TNRs  -69 1168 CUCCAAAAGA CTCCAAAAGAAGG 55586109 of TCF4 UAGACCUUCU 81 TAGACCTTCT Chr18:55586091- - 5′ of TNRs  -65 1169 UAGACCUUCU TTTGGAGAAATGG 55586113 of TCF4 UUUGGAGAAA 82 TCCAAAAGAA Chr18:55586098- + 5′ of TNRs  -58 1170 UCCAAAAGAA GGTCTAGAAGAGG 55586120 of TCF4 GGUCUAGAAG 83 TCCTCTTCTA Chr18:55586099- - 5′ of TNRs  -57 1171 UCCUCUUCUA GACCTTCTTTTGG 55586121 of TCF4 GACCUUCUUU 84 AAAAGAAGGT Chr18:55586101- + 5′ of TNRs  -55 1172 AAAAGAAGGU CTAGAAGAGGAGG 55586123 of TCF4 CUAGAAGAGG 85 AGAAGGTCTA Chr18:55586104- + 5′ of TNRs  -52 1173 AGAAGGUCUA GAAGAGGAGGAGG 55586126 of TCF4 GAAGAGGAGG 86 AGGTCTAGAA Chr18:55586107- + 5′ of TNRs  -49 1174 AGGUCUAGAA GAGGAGGAGGAGG 55586129 of TCF4 GAGGAGGAGG 87 TCTAGAAGAG Chr18:55586110- + 5′ of TNRs  -46 1175 UCUAGAAGAG GAGGAGGAGGAGG 55586132 of TCF4 GAGGAGGAGG 88 AGAGGAGGAG Chr18:55586116- + 5′ of TNRs  -40 1176 AGAGGAGGAG GAGGAGGAGAAGG 55586138 of TCF4 GAGGAGGAGA 89 GGAGGAGGAG Chr18:55586119- + 5′ of TNRs  -37 1177 GGAGGAGGAG GAGGAGAAGGAGG 55586141 of TCF4 GAGGAGAAGG 90 GGAGGAGGAG Chr18:55586122- + 5′ of TNRs  -34 1178 GGAGGAGGAG GAGAAGGAGGAGG 55586144 of TCF4 GAGAAGGAGG 91 GGAGGAGGAG Chr18:55586125- + 5′ of TNRs  -31 1179 GGAGGAGGAG AAGGAGGAGGAGG 55586147 of TCF4 AAGGAGGAGG 92 GGAGGAGAAG Chr18:55586128- + 5′ of TNRs  -28 1180 GGAGGAGAAG GAGGAGGAGGAGG 55586150 of TCF4 GAGGAGGAGG 93 GGAGAAGGAG Chr18:55586131- + 5′ of TNRs  -25 1181 GGAGAAGGAG GAGGAGGAGGAGG 55586153 of TCF4 GAGGAGGAGG 94 CAGCATGAAA Chr18:55586225- + 3′ of TNRs   69 1182 CAGCAUGAAA GAGCCCCACTTGG 55586247 of TCF4 GAGCCCCACU 95 ATGAAAGAGC Chr18:55586229- + 3′ of TNRs   73 1183 AUGAAAGAGC CCCACTTGGAAGG 55586251 of TCF4 CCCACUUGGA 96 AAAGAGCCCC Chr18:55586232- + 3′ of TNRs   76 1184 AAAGAGCCCC ACTTGGAAGGCGG 55586254 of TCF4 ACUUGGAAGG 97 GCCCCACTTG Chr18:55586237- + 3′ of TNRs   81 1185 GCCCCACUUG GAAGGCGGTTTGG 55586259 of TCF4 GAAGGCGGUU 98 TCCAAACCGC Chr18:55586238- - 3′ of TNRs   82 1186 UCCAAACCGC CTTCCAAGTG 55586260 of TCF4 CUUCCAAGUG GGG 99 ATCCAAACCG Chr18:55586239- - 3′ of TNRs   83 1187 AUCCAAACCG CCTTCCAAGTGGG 55586261 of TCF4 CCUUCCAAGU 100 AATCCAAACC Chr18:55586240- - 3′ of TNRs   84 1188 AAUCCAAACC GCCTTCCAAGTGG 55586262 of TCF4 GCCUUCCAAG 101 GATTTTATTT Chr18:55586259- + 3′ of TNRs  103 1189 GAUUUUAUUU GTGTGTTTTGTGG 55586281 of TCF4 GUGUGUUUUG 102 CATCTTACAC Chr18:55586308- + 3′ of TNRs  152 1190 CAUCUUACAC CAAACTCATCTGG 55586330 of TCF4 CAAACUCAUC 103 TTTTTAATGC Chr18:55586317- - 3′ of TNRs  161 1191 UUUUUAAUGC CAGATGAGTTTGG 55586339 of TCF4 CAGAUGAGUU 104 ATTCATTCTC Chr18:55586343- + 3′ of TNRs  187 1192 AUUCAUUCUC CTGACATGTCTGG 55586365 of TCF4 CUGACAUGUC 105 TTCATTCTCC Chr18:55586344- + 3′ of TNRs  188 1193 UUCAUUCUCC TGACATGTCTGGG 55586366 of TCF4 UGACAUGUCU 106 CTCCTGACAT Chr18:55586350- + 3′ of TNRs  194 1194 CUCCUGACAU GTCTGGGACTTGG 55586372 of TCF4 GUCUGGGACU 107 AACCAAGTCC Chr18:55586352- - 3′ of TNRs  196 1195 AACCAAGUCC CAGACATGTCAGG 55586374 of TCF4 CAGACAUGUC 108 ACATGTCTGG Chr18:55586356- + 3′ of TNRs  200 1196 ACAUGUCUGG GACTTGGTTTAGG 55586378 of TCF4 GACUUGGUUU 109 CTGGGACTTG Chr18:55586362- + 3′ of TNRs  206 1197 CUGGGACUUG GTTTAGGAAAAGG 55586384 of TCF4 GUUUAGGAAA 110 GGTTTAGGAA Chr18:55586371- + 3′ of TNRs  215 1198 GGUUUAGGAA AAGGAAGCAAAGG 55586393 of TCF4 AAGGAAGCAA 111 GTTTAGGAAA Chr18:55586372- + 3′ of TNRs  216 1199 GUUUAGGAAA AGGAAGCAAAGGG 55586394 of TCF4 AGGAAGCAAA 112 AGGAAAAGGA Chr18:55586376- + 3′ of TNRs  220 1200 AGGAAAAGGA AGCAAAGGGATGG 55586398 of TCF4 AGCAAAGGGA 113 AGGAAGCAAA Chr18:55586382- + 3′ of TNRs  226 1201 AGGAAGCAAA GGGATGGAGAAGG 55586404 of TCF4 GGGAUGGAGA 114 TGGAGTTTTA Chr18:55586406- - 3′ of TNRs  250 1202 UGGAGUUUUA CGGCTGTACTTGG 55586428 of TCF4 CGGCUGUACU 115 GACACACTTG Chr18:55586416- - 3′ of TNRs  260 1203 GACACACUUG TGGAGTTTTACGG 55586438 of TCF4 UGGAGUUUUA 116 AGCGGAACTT Chr18:55586426- - 3′ of TNRs  270 1204 AGCGGAACUU GACACACTTGTGG 55586448 of TCF4 GACACACUUG 117 GTCGTAGGAT Chr18:55586444- - 3′ of TNRs  288 1205 GUCGUAGGAU CAGCACAAAGCGG 55586466 of TCF4 CAGCACAAAG 118 TTGGTAAATT Chr18:55586459- - 3′ of TNRs  303 1206 UUGGUAAAUU TCGTAGTCGTAGG 55586481 of TCF4 UCGUAGUCGU 119 ATTTACCAAA Chr18:55586473- + 3′ of TNRs  317 1207 AUUUACCAAA ACAGTCCAAAAGG 55586495 of TCF4 ACAGUCCAAA 120 TAGAACCTTT Chr18:55586478- - 3′ of TNRs  322 1208 UAGAACCUUU TGGACTGTTTTGG 55586500 of TCF4 UGGACUGUUU 121 ATACATTCTT Chr18:55586488- - 3′ of TNRs  332 1209 AUACAUUCUU TAGAACCTTTTGG 55586510 of TCF4 UAGAACCUUU 122 TAGGATTCTT Chr18:55586522- - 3′ of TNRs  366 1210 UAGGAUUCUU AAAACTAGTATGG 55586544 of TCF4 AAAACUAGUA 123 ATACTAGTTT Chr18:55586524- + 3′ of TNRs  368 1211 AUACUAGUUU TAAGAATCCTAGG 55586546 of TCF4 UAAGAAUCCU 124 TCCTAGGAAA Chr18:55586540- + 3′ of TNRs  384 1212 UCCUAGGAAA AGATGTAACTAGG 55586562 of TCF4 AGAUGUAACU 125 TCCTAGTTAC Chr18:55586541- - 3′ of TNRs  385 1213 UCCUAGUUAC ATCTTTTCCTAGG 55586563 of TCF4 AUCUUUUCCU 126 TAGGAAAAGA Chr18:55586543- + 3′ of TNRs  387 1214 UAGGAAAAGA TGTAACTAGGAGG 55586565 of TCF4 UGUAACUAGG 127 TAACTAGGAG Chr18:55586555- + 3′ of TNRs  399 1215 UAACUAGGAG GTAAGATGTAAGG 55586577 of TCF4 GUAAGAUGUA 128 GGAGGTAAGA Chr18:55586561- + 3′ of TNRs  405 1216 GGAGGUAAGA TGTAAGGAACAGG 55586583 of TCF4 UGUAAGGAAC 129 TAATGATGCT Chr18:55586585- - 3′ of TNRs  429 1217 UAAUGAUGCU TTGGATTGGTAGG 55586607 of TCF4 UUGGAUUGGU 130 AAGCTAATGA Chr18:55586589- - 3′ of TNRs  433 1218 AAGCUAAUGA TGCTTTGGATTGG 55586611 of TCF4 UGCUUUGGAU 131 GTTTTAAGCT Chr18:55586594- - 3′ of TNRs  438 1219 GUUUUAAGCU AATGATGCTTTGG 55586616 of TCF4 AAUGAUGCUU 132 TAAAACTTTA Chr18:55586611- + 3′ of TNRs  455 1220 UAAAACUUUA AAGAGACAACTGG 55586633 of TCF4 AAGAGACAAC 133 AAAACTTTAA Chr18:55586612- + 3′ of TNRs  456 1221 AAAACUUUAA AGAGACAACTGGG 55586634 of TCF4 AGAGACAACU 134 GGAAATGGAA Chr18:55586638- - 3′ of TNRs  482 1222 GGAAAUGGAA AATAGAAAATAGG 55586660 of TCF4 AAUAGAAAAU 135 TTATTTATTG Chr18:55586653- - 3′ of TNRs  497 1223 UUAUUUAUUG TTTTTGGAAATGG 55586675 of TCF4 UUUUUGGAAA 136 TTCGTTTTAT Chr18:55586659- - 3′ of TNRs  503 1224 UUCGUUUUAU TTATTGTTTTTGG 55586681 of TCF4 UUAUUGUUUU 137 GTAGTCTCAG Chr18:55586702- + 3′ of TNRs  546 1225 GUAGUCUCAG TGTTCAGACATGG 55586724 of TCF4 UGUUCAGACA 138 TTCAGACATG Chr18:55586714- + 3′ of TNRs  558 1226 UUCAGACAUG GCCAAGTTTTAGG 55586736 of TCF4 GCCAAGUUUU 139 TCAGACATGG Chr18:55586715- + 3′ of TNRs  559 1227 UCAGACAUGG CCAAGTTTTAGGG 55586737 of TCF4 CCAAGUUUUA 140 CAGACATGGC Chr18:55586716- + 3′ of TNRs  560 1228 CAGACAUGGC CAAGTTTTAGGGG 55586738 of TCF4 CAAGUUUUAG 141 ACATGGCCAA Chr18:55586719- + 3′ of TNRs  563 1229 ACAUGGCCAA GTTTTAGGGGTGG 55586741 of TCF4 GUUUUAGGGG 142 ACTAAACCAC Chr18:55586725- - 3′ of TNRs  569 1230 ACUAAACCAC CCCTAAAACTTGG 55586747 of TCF4 CCCUAAAACU 143 TTTAGGGGTG Chr18:55586731- + 3′ of TNRs  575 1231 UUUAGGGGUG GTTTAGTTTTAGG 55586753 of TCF4 GUUUAGUUUU 144 TTAGGGGTGG Chr18:55586732- + 3′ of TNRs  576 1232 UUAGGGGUGG TTTAGTTTTAGGG 55586754 of TCF4 UUUAGUUUUA 145 TAGGGGTGGT Chr18:55586733- + 3′ of TNRs  577 1233 UAGGGGUGGU TTAGTTTTAGGGG 55586755 of TCF4 UUAGUUUUAG 146 TGTCTATTTT Chr18:55586756- + 3′ of TNRs  600 1234 UGUCUAUUUU TGCTTTCCACTGG 55586778 of TCF4 UGCUUUCCAC 147 GTCTATTTTT Chr18:55586757- + 3′ of TNRs  601 1235 GUCUAUUUUU GCTTTCCACTGGG 55586779 of TCF4 GCUUUCCACU 148 TCTATTTTTG Chr18:55586758- + 3′ of TNRs  602 1236 UCUAUUUUUG CTTTCCACTGGGG 55586780 of TCF4 CUUUCCACUG 149 ATAATGGAAT Chr18:55586772- - 3′ of TNRs  616 1237 AUAAUGGAAU CTCACCCCAGTGG 55586794 of TCF4 CUCACCCCAG 150 TGGGGTGAGA Chr18:55586776- + 3′ of TNRs  620 1238 UGGGGUGAGA TTCCATTATTTGG 55586798 of TCF4 UUCCAUUAUU 151 GGGGTGAGAT Chr18:55586777- + 3′ of TNRs  621 1239 GGGGUGAGAU TCCATTATTTGGG 55586799 of TCF4 UCCAUUAUUU 152 GGGTGAGATT Chr18:55586778- + 3′ of TNRs  622 1240 GGGUGAGAUU CCATTATTTGGGG 55586800 of TCF4 CCAUUAUUUG 153 CCATTATTTG Chr18:55586788- + 3′ of TNRs  632 1241 CCAUUAUUUG GGGTAATCAGTGG 55586810 of TCF4 GGGUAAUCAG 154 CCACTGATTA Chr18:55586788- - 3′ of TNRs  632 1242 CCACUGAUUA CCCCAAATAATGG 55586810 of TCF4 CCCCAAAUAA 155 CATTATTTGG Chr18:55586789- + 3′ of TNRs  633 1243 CAUUAUUUGG GGTAATCAGTGGG 55586811 of TCF4 GGUAAUCAGU 156 ATTTGGGGTA Chr18:55586793- + 3′ of TNRs  637 1244 AUUUGGGGUA ATCAGTGGGTAGG 55586815 of TCF4 AUCAGUGGGU 157 TTTGGGGTAA Chr18:55586794- + 3′ of TNRs  638 1245 UUUGGGGUAA TCAGTGGGTAGGG 55586816 of TCF4 UCAGUGGGUA 158 ATCAGTGGGT Chr18:55586803- + 3′ of TNRs  647 1246 AUCAGUGGGU AGGGAATTGAAGG 55586825 of TCF4 AGGGAAUUGA 159 TTTTTTTTGA Chr18:55586826- - 3′ of TNRs  670 1247 UUUUUUUUGA GTTTTATTACTGG 55586848 of TCF4 GUUUUAUUAC 160 TGTGGTGTGA Chr18:55586856- - 3′ of TNRs  700 1248 UGUGGUGUGA TGGAAGATTCAGG 55586878 of TCF4 UGGAAGAUUC 161 ACTATAATTT Chr18:55586866- - 3′ of TNRs  710 1249 ACUAUAAUUU TGTGGTGTGATGG 55586888 of TCF4 UGUGGUGUGA 162 AGTTTTTAAC Chr18:55586874- - 3′ of TNRs  718 1250 AGUUUUUAAC TATAATTTTGTGG 55586896 of TCF4 UAUAAUUUUG 163 AAAGACCTTC Chr18:55586903- + 3′ of TNRs  747 1251 AAAGACCUUC ATATTTACCAAGG 55586925 of TCF4 AUAUUUACCA 164 TGAATCCTTG Chr18:55586908- - 3′ of TNRs  752 1252 UGAAUCCUUG GTAAATATGAAGG 55586930 of TCF4 GUAAAUAUGA 165 TTTTTAATTG Chr18:55586920- - 3′ of TNRs  764 1253 UUUUUAAUUG GCTGAATCCTTGG 55586942 of TCF4 GCUGAAUCCU 166 GGACAGTAAT Chr18:55586932- - 3′ of TNRs  776 1254 GGACAGUAAU AATTTTTAATTGG 55586954 of TCF4 AAUUUUUAAU 167 ACTGTCCTTT Chr18:55586948- + 3′ of TNRs  792 1255 ACUGUCCUUU AGATTCCTACTGG 55586970 of TCF4 AGAUUCCUAC 168 AGAAACCAGT Chr18:55586953- - 3′ of TNRs  797 1256 AGAAACCAGU AGGAATCTAAAGG 55586975 of TCF4 AGGAAUCUAA 169 CACTTCAGCT Chr18:55586963- - 3′ of TNRs  807 1257 CACUUCAGCU AGAAACCAGTAGG 55586985 of TCF4 AGAAACCAGU 170 TGGTTTCTAG Chr18:55586968- + 3′ of TNRs  812 1258 UGGUUUCUAG CTGAAGTGTTTGG 55586990 of TCF4 CUGAAGUGUU 171 GGTTTCTAGC Chr18:55586969- + 3′ of TNRs  813 1259 GGUUUCUAGC TGAAGTGTTTGGG 55586991 of TCF4 UGAAGUGUUU 172 AGTGCGGTAA Chr18:55587028- - 3′ of TNRs  872 1260 AGUGCGGUAA GAAAGAACGGTGG 55587050 of TCF4 GAAAGAACGG 173 TTCAGTGCGG Chr18:55587031- - 3′ of TNRs  875 1261 UUCAGUGCGG TAAGAAAGAACGG 55587053 of TCF4 UAAGAAAGAA 174 TGATTTACTG Chr18:55587044- - 3′ of TNRs  888 1262 UGAUUUACUG GATTTCAGTGCGG 55587066 of TCF4 GAUUUCAGUG 175 CAAAGAGCTG Chr18:55587056- - 3′ of TNRs  900 1263 CAAAGAGCUG AGTGATTTACTGG 55587078 of TCF4 AGUGAUUUAC 176 CAGCTCTTTG Chr18:55587069- + 3′ of TNRs  913 1264 CAGCUCUUUG TCCGTCCCTAAGG 55587091 of TCF4 UCCGUCCCUA 177 GCGAATGGCT Chr18:55587080- - 3′ of TNRs  924 1265 GCGAAUGGCU GCCTTAGGGACGG 55587102 of TCF4 GCCUUAGGGA 178 AACAGCGAAT Chr18:55587084- - 3′ of TNRs  928 1266 AACAGCGAAU GGCTGCCTTAGGG 55587106 of TCF4 GGCUGCCUUA 179 CAACAGCGAA Chr18:55587085- - 3′ of TNRs  929 1267 CAACAGCGAA TGGCTGCCTTAGG 55587107 of TCF4 UGGCUGCCUU 180 CTAAGGCAGC Chr18:55587086- + 3′ of TNRs  930 1268 CUAAGGCAGC CATTCGCTGTTGG 55587108 of TCF4 CAUUCGCUGU 181 AATGCATCAC Chr18:55587095- - 3′ of TNRs  939 1269 AAUGCAUCAC CAACAGCGAATGG 55587117 of TCF4 CAACAGCGAA 182 ATCACACAAA Chr18:55587126- + 3′ of TNRs  970 1270 AUCACACAAA CCTAGAAACATGG 55587148 of TCF4 CCUAGAAACA 183 GCGGTTATTT Chr18:55587136- - 3′ of TNRs  980 1271 GCGGUUAUUU CCATGTTTCTAGG 55587158 of TCF4 CCAUGUUUCU 184 GGGACTGGAT Chr18:55587155- - 3′ of TNRs  999 1272 GGGACUGGAU TTTCTGATTGCGG 55587177 of TCF4 UUUCUGAUUG 185 GAAAATCCAG Chr18:55587164- + 3′ of TNRs 1008 1273 GAAAAUCCAG TCCCAATCCTTGG 55587186 of TCF4 UCCCAAUCCU 186 TTTTCTCCAA Chr18:55587170- - 3′ of TNRs 1014 1274 UUUUCUCCAA GGATTGGGACTGG 55587192 of TCF4 GGAUUGGGAC 187 TTGTGTTTTC Chr18:55587175- - 3′ of TNRs 1019 1275 UUGUGUUUUC TCCAAGGATTGGG 55587197 of TCF4 UCCAAGGAUU 188 ATTGTGTTTT Chr18:55587176- - 3′ of TNRs 1020 1276 AUUGUGUUUU CTCCAAGGATTGG 55587198 of TCF4 CUCCAAGGAU 189 ATCCTTGGAG Chr18:55587179- + 3′ of TNRs 1023 1277 AUCCUUGGAG AAAACACAATCGG 55587201 of TCF4 AAAACACAAU 190 ATCCGATTGT Chr18:55587181- - 3′ of TNRs 1025 1278 AUCCGAUUGU GTTTTCTCCAAGG 55587203 of TCF4 GUUUUCUCCA

TABLE-US-00005 TABLE 2 Combinations of TCF4 guide sequences SEQ ID NOs (5′ SEQ ID NOs (3′ Target Sequence) Target Sequence) 83 109 85 109 86 112 85 125 86 109 85 107 83 125 86 125 86 107 64 106 85 114 86 114 83 114 53 114 83 112 74 114 85 108 83 107 85 115 58 109 86 108 83 96 74 109 77 115 53 96 83 108 74 125 85 94 86 96 53 107 83 94 71 115 77 96 58 112 77 109 85 95 53 94 77 95 86 115 85 96 58 94 58 115 71 96 58 107 83 95 58 96 77 94 56 94 77 108 77 112 86 94 77 107 86 95 56 96 54 94 71 94 77 114 71 114 56 95 58 95 53 112 71 109 74 112 54 96 58 114 74 108 53 108 74 107 74 94 71 107 71 95 71 112 74 96 74 95 74 115 54 95 53 95 77 125 54 112 56 114 73 101 54 109 54 114 54 107 54 108 54 115 56 109 56 107 56 108 56 112 56 115 56 125 53 125

TABLE-US-00006 TABLE 3 Target sequences for wild-type COL8A2 gene SEQ ID Chromosomal No location Strand Target sequence 191 Chr1:36097532- + GGGGAGGAGGCEAGGGCAGCAGG 36097554 192 Chr1:36097545- + GGGCAGCAGGACCCCCCCCGCGG 36097567 193 Chr1:36097546- + GGCAGCAGGACCCCCCCCGCGGG 36097568 194 Chr1:36097554- + GACCCCCCCCGCGGGTTATGTGG 36097576 195 Chr1:36097555- + ACCCCCCCCGCGGGTTATGTGGG 36097577 196 Chr1:36097556- + CCCCCCCCGCGGGTTATGTGGGG 36097578 197 Chr1:36097556- - CCCCACATAACCCGCGGGGGGGG 36097578 198 Chr1:36097557- - GCCCCACATAACCCGCGGGGGGG 36097579 199 Chr1:36097558- - TGCCCCACATAACCCGCGGGGGG 36097580 200 Chr1:36097559- - CTGCCCCACATAACCCGCGGGGG 36097581 201 Chr1:36097560- - TCTGCCCCACATAACCCGCGGGG 36097582 202 Chr1:36097561- - CTCTGCCCCACATAACCCGCGGG 36097583 203 Chr1:36097562- - GCTCTGCCCCACATAACCCGCGG 36097584 204 Chr1:36097578- + GCAGAGCAAGAATCCTGAAAAGG 36097600 205 Chr1:36097581- + GAGCAAGAATCCTGAAAAGGAGG 36097603 206 Chr1:36097586- + AGAATCCTGAAAAGGAGGAGTGG 36097608 207 Chr1:36097591- - TACATCCACTCCTCCTTTTCAGG 36097613 208 Chr1:36097599- + GGAGGAGTGGATGTACTCCGTGG 36097621 209 Chr1:36097607- + GGATGTACTCCGTGGAGTAGAGG 36097629 210 Chr1:36097614- + CTCCGTGGAGTAGAGGCCGTTGG 36097636 211 Chr1:36097616- - GGCCAACGGCCTCTACTCCACGG 36097638 212 Chr1:36097619- + TGGAGTAGAGGCCGTTGGCCTGG 36097641 213 Chr1:36097627- + AGGCCGTTGGCCTGGTCCGACGG 36097649 214 Chr1:36097630- - ATGCCGTCGGACCAGGCCAACGG 36097652 215 Chr1:36097637- - GGTGCAGATGCCGTCGGACCAGG 36097659 216 Chr1:36097643- - GGTCTGGGTGCAGATGCCGTCGG 36097665 217 Chr1:36097646- + ACGGCATCTGCACCCAGACCTGG 36097668 218 Chr1:36097653- + CTGCACCCAGACCTGGTCGTTGG 36097675 219 Chr1:36097654- + TGCACCCAGACCTGGTCGTTGGG 36097676 220 Chr1:36097658- - GCGGCCCAACGACCAGGTCTGGG 36097680 221 Chr1:36097659- - TGCGGCCCAACGACCAGGTCTGG 36097681 222 Chr1:36097664- + CCTGGTCGTTGGGCCGCAGCTGG 36097686 223 Chr1:36097664- - CCAGCTGCGGCCCAACGACCAGG 36097686 224 Chr1:36097671- + GTTGGGCCGCAGCTGGAGCACGG 36097693 225 Chr1:36097677- - GTGGGGCCGTGCTCCAGCTGCGG 36097699 226 Chr1:36097688- + GCACGGCCCCACCAGATGCCTGG 36097710 227 Chr1:36097694- + CCCCACCAGATGCCTGGTCCAGG 36097716 228 Chr1:36097694- - CCTGGACCAGGCATCTGGTGGGG 36097716 229 Chr1:36097695- - ACCTGGACCAGGCATCTGGTGGG 36097717 230 Chr1:36097696- - TACCTGGACCAGGCATCTGGTGG 36097718 231 Chr1:36097699- - GGCTACCTGGACCAGGCATCTGG 36097721 232 Chr1:36097706- - CAAGAAGGGCTACCTGGACCAGG 36097728 233 Chr1:36097712- - TGAGTACAAGAAGGGCTACCTGG 36097734 234 Chr1:36097719- + GCCCTTCTTGTACTCATCGTAGG 36097741 235 Chr1:36097720- - ACCTACGATGAGTACAAGAAGGG 36097742 236 Chr1:36097721- - TACCTACGATGAGTACAAGAAGG 36097743 237 Chr1:36097725- + CTTGTACTCATCGTAGGTATAGG 36097747 238 Chr1:36097728- + GTACTCATCGTAGGTATAGGTGG 36097750 239 Chr1:36097732- + TCATCGTAGGTATAGGTGGCCGG 36097754 240 Chr1:36097751- + CCGGCACGTTGTTCTTGTACAGG 36097773 241 Chr1:36097751- - CCTGTACAAGAACAACGTGCCGG 36097773 242 Chr1:36097752- + CGGCACGTTGTTCTTGTACAGGG 36097774 243 Chr1:36097767- + GTACAGGGCCACCCACACGTTGG 36097789 244 Chr1:36097775- - CAAGGGCACCAACGTGTGGGTGG 36097797 245 Chr1:36097778- - CGTCAAGGGCACCAACGTGTGGG 36097800 246 Chr1:36097779- - ACGTCAAGGGCACCAACGTGTGG 36097801 247 Chr1:36097787- + TGGTGCCCTTGACGTGCACATGG 36097809 248 Chr1:36097792- - GCTTACCATGTGCACGTCAAGGG 36097814 249 Chr1:36097793- - TGCTTACCATGTGCACGTCAAGG 36097815 250 Chr1:36097816- + AAGTAGTAGACGCCGCCCACAGG 36097838 251 Chr1:36097817- + AGTAGTAGACGCCGCCCACAGGG 36097839 252 Chr1:36097821- + GTAGACGCCGCCCACAGGGCAGG 36097843 253 Chr1:36097828- - ATCTTCACCTGCCCTGTGGGCGG 36097850 254 Chr1:36097831- - GGCATCTTCACCTGCCCTGTGGG 36097853 255 Chr1:36097832- - TGGCATCTTCACCTGCCCTGTGG 36097854 256 Chr1:36097836- + AGGGCAGGTGAAGATGCCAGTGG 36097858 257 Chr1:36097840- + CAGGTGAAGATGCCAGTGGCTGG 36097862 258 Chr1:36097841- + AGGTGAAGATGCCAGTGGCTGGG 36097863 259 Chr1:36097852- - AGCGGCTACAACCCAGCCACTGG 36097874 260 Chr1:36097856- + TGGCTGGGTTGTAGCCGCTGTGG 36097878 261 Chr1:36097870- - ACTCTCTACAATGGCCACAGCGG 36097892 262 Chr1:36097874- + TGTGGCCATTGTAGAGAGTCCGG 36097896 263 Chr1:36097879- - TTTGACCGGACTCTCTACAATGG 36097901 264 Chr1:36097887- + GAGAGTCCGGTCAAATTTCACGG 36097909 265 Chr1:36097888- + AGAGTCCGGTCAAATTTCACGGG 36097910 266 Chr1:36097893- - GCATGCCCGTGAAATTTGACCGG 36097915 267 Chr1:36097899- + AAATTTCACGGGCATGCCCGAGG 36097921 268 Chr1:36097902- + TTTCACGGGCATGCCCGAGGCGG 36097924 269 Chr1:36097903- + TTCACGGGCATGCCCGAGGCGGG 36097925 270 Chr1:36097904- + TCACGGGCATGCCCGAGGCGGGG 36097926 271 Chr1:36097908- + GGGCATGCCCGAGGCGGGGAAGG 36097930 272 Chr1:36097909- + GGCATGCCCGAGGCGGGGAAGGG 36097931 273 Chr1:36097914- + GCCCGAGGCGGGGAAGGGCGAGG 36097936 274 Chr1:36097915- - ACCTCGCCCTTCCCCGCCTCGGG 36097937 275 Chr1:36097916- - CACCTCGCCCTTCCCCGCCTCGG 36097938 276 Chr1:36097932- + CGAGGTGAGCACCGCAGTGAAGG 36097954 277 Chr1:36097936- + GTGAGCACCGCAGTGAAGGCCGG 36097958 278 Chr1:36097941- + CACCGCAGTGAAGGCCGGTGTGG 36097963 279 Chr1:36097943- - TGCCACACCGGCCTTCACTGCGG 36097965 280 Chr1:36097946- + CAGTGAAGGCCGGTGTGGCATGG 36097968 281 Chr1:36097947- + AGTGAAGGCCGGTGTGGCATGGG 36097969 282 Chr1:36097955- - GCTGTCTGCCCATGCCACACCGG 36097977 283 Chr1:36097975- + AGCTCGCCCAGCCCAAACTGTGG 36097997 284 Chr1:36097981- - GGCAAGCCACAGTTTGGGCTGGG 36098003 285 Chr1:36097982- - GGGCAAGCCACAGTTTGGGCTGG 36098004 286 Chr1:36097986- - AGGGGGGCAAGCCACAGTTTGGG 36098008 287 Chr1:36097987- - AAGGGGGGCAAGCCACAGTTTGG 36098009 288 Chr1:36097998- + CTTGCCCCCCTTGCCCAGCACGG 36098020 289 Chr1:36098002- - GGTGCCGTGCTGGGCAAGGGGGG 36098024 290 Chr1:36098003- - GGGTGCCGTGCTGGGCAAGGGGG 36098025 291 Chr1:36098004- - AGGGTGCCGTGCTGGGCAAGGGG 36098026 292 Chr1:36098005- - GAGGGTGCCGTGCTGGGCAAGGG 36098027 293 Chr1:36098006- - GGAGGGTGCCGTGCTGGGCAAGG 36098028 294 Chr1:36098011- - GGTGTGGAGGGTGCCGTGCTGGG 36098033 295 Chr1:36098012- - CGGTGTGGAGGGTGCCGTGCTGG 36098034 296 Chr1:36098019- + GGCACCCTCCACACCGCCGTTGG 36098041 297 Chr1:36098020- + GCACCCTCCACACCGCCGTTGGG 36098042 298 Chr1:36098023- - CTGCCCAACGGCGGTGTGGAGGG 36098045 299 Chr1:36098024- + CCTCCACACCGCCGTTGGGCAGG 36098046 300 Chr1:36098024- - CCTGCCCAACGGCGGTGTGGAGG 36098046 301 Chr1:36098027- - GCACCTGCCCAACGGCGGTGTGG 36098049 302 Chr1:36098032- - GGCTTGCACCTGCCCAACGGCGG 36098054 303 Chr1:36098035- - GCAGGCTTGCACCTGCCCAACGG 36098057 304 Chr1:36098053- - TTCGATGAGACTGGCATCGCAGG 36098075 305 Chr1:36098055- + TGCGATGCCAGTCTCATCGAAGG 36098077 306 Chr1:36098062- + CCAGTCTCATCGAAGGCCCCAGG 36098084 307 Chr1:36098062- - CCTGGGGCCTTCGATGAGACTGG 36098084 308 Chr1:36098063- + CAGTCTCATCGAAGGCCCCAGGG 36098085 309 Chr1:36098064- + AGTCTCATCGAAGGCCCCAGGGG 36098086 310 Chr1:36098071- + TCGAAGGCCCCAGGGGCACCAGG 36098093 311 Chr1:36098072- + CGAAGGCCCCAGGGGCACCAGGG 36098094 312 Chr1:36098073- + GAAGGCCCCAGGGGCACCAGGGG 36098095 313 Chr1:36098074- + AAGGCCCCAGGGGCACCAGGGGG 36098096 314 Chr1:36098078- - GGGACCCCCTGGTGCCCCTGGGG 36098100 315 Chr1:36098079- - CGGGACCCCCTGGTGCCCCTGGG 36098101 316 Chr1:36098080- + CCAGGGGCACCAGGGGGTCCCGG 36098102 317 Chr1:36098080- - CCGGGACCCCCTGGTGCCCCTGG 36098102 318 Chr1:36098081- + CAGGGGCACCAGGGGGTCCCGGG 36098103 319 Chr1:36098082- + AGGGGCACCAGGGGGTCCCGGGG 36098104 320 Chr1:36098083- + GGGGCACCAGGGGGTCCCGGGGG 36098105 321 Chr1:36098088- + ACCAGGGGGTCCCGGGGGCCCGG 36098110 322 Chr1:36098089- + CCAGGGGGTCCCGGGGGCCCGGG 36098111 323 Chr1:36098089- - CCCGGGCCCCCGGGACCCCCTGG 36098111 324 Chr1:36098092- + GGGGGTCCCGGGGGCCCGGGAGG 36098114 325 Chr1:36098098- + CCCGGGGGCCCGGGAGGCCCCGG 36098120 326 Chr1:36098098- - CCGGGGCCTCCCGGGCCCCCGGG 36098120 327 Chr1:36098099- - TCCGGGGCCTCCCGGGCCCCCGG 36098121 328 Chr1:36098101- + GGGGGCCCGGGAGGCCCCGGAGG 36098123 329 Chr1:36098102- + GGGGCCCGGGAGGCCCCGGAGGG 36098124 330 Chr1:36098106- - CGGGCCCTCCGGGGCCTCCCGGG 36098128 331 Chr1:36098107- - ACGGGCCCTCCGGGGCCTCCCGG 36098129 332 Chr1:36098115- - CTGGAATCACGGGCCCTCCGGGG 36098137 333 Chr1:36098116- + CCCGGAGGGCCCGTGATTCCAGG 36098138 334 Chr1:36098116- - CCTGGAATCACGGGCCCTCCGGG 36098138 335 Chr1:36098117- + CCGGAGGGCCCGTGATTCCAGGG 36098139 336 Chr1:36098117- - CCCTGGAATCACGGGCCCTCCGG 36098139 337 Chr1:36098118- + CGGAGGGCCCGTGATTCCAGGGG 36098140 338 Chr1:36098125- + CCCGTGATTCCAGGGGAGCCAGG 36098147 339 Chr1:36098125- - CCTGGCTCCCCTGGAATCACGGG 36098147 340 Chr1:36098126- + CCGTGATTCCAGGGGAGCCAGGG 36098148 341 Chr1:36098126- - CCCTGGCTCCCCTGGAATCACGG 36098148 342 Chr1:36098134- + CCAGGGGAGCCAGGGACCCCTGG 36098156 343 Chr1:36098134- - CCAGGGGTCCCTGGCTCCCCTGG 36098156 344 Chr1:36098135- + CAGGGGAGCCAGGGACCCCTGGG 36098157 345 Chr1:36098136- + AGGGGAGCCAGGGACCCCTGGGG 36098158 346 Chr1:36098137- + GGGGAGCCAGGGACCCCTGGGGG 36098159 347 Chr1:36098143- - ACGGGGCCCCCAGGGGTCCCTGG 36098165 348 Chr1:36098145- + AGGGACCCCTGGGGGCCCCGTGG 36098167 349 Chr1:36098146- + GGGACCCCTGGGGGCCCCGTGGG 36098168 350 Chr1:36098150- - TGGGCCCACGGGGCCCCCAGGGG 36098172 351 Chr1:36098151- - CTGGGCCCACGGGGCCCCCAGGG 36098173 352 Chr1:36098152- - GCTGGGCCCACGGGGCCCCCAGG 36098174 353 Chr1:36098160- - CTGGCACGGCTGGGCCCACGGGG 36098182 354 Chr1:36098161- + CCCGTGGGCCCAGCCGTGCCAGG 36098183 355 Chr1:36098161- - CCTGGCACGGCTGGGCCCACGGG 36098183 356 Chr1:36098162- - ACCTGGCACGGCTGGGCCCACGG 36098184 357 Chr1:36098169- - CAGGGGAACCTGGCACGGCTGGG 36098191 358 Chr1:36098170- - GCAGGGGAACCTGGCACGGCTGG 36098192 359 Chr1:36098174- - GAGAGCAGGGGAACCTGGCACGG 36098196 360 Chr1:36098179- - GAGGGGAGAGCAGGGGAACCTGG 36098201 361 Chr1:36098185- + TCCCCTGCTCTCCCCTCTCCAGG 36098207 362 Chr1:36098186- + CCCCTGCTCTCCCCTCTCCAGGG 36098208 363 Chr1:36098186- - CCCTGGAGAGGGGAGAGCAGGGG 36098208 364 Chr1:36098187- + CCCTGCTCTCCCCTCTCCAGGGG 36098209 365 Chr1:36098187- - CCCCTGGAGAGGGGAGAGCAGGG 36098209 366 Chr1:36098188- + CCTGCTCTCCCCTCTCCAGGGGG 36098210 367 Chr1:36098188- - CCCCCTGGAGAGGGGAGAGCAGG 36098210 368 Chr1:36098194- + CTCCCCTCTCCAGGGGGCCCTGG 36098216 369 Chr1:36098196- - TGCCAGGGCCCCCTGGAGAGGGG 36098218 370 Chr1:36098197- - CTGCCAGGGCCCCCTGGAGAGGG 36098219 371 Chr1:36098198- + CCTCTCCAGGGGGCCCTGGCAGG 36098220 372 Chr1:36098198- - CCTGCCAGGGCCCCCTGGAGAGG 36098220 373 Chr1:36098203- + CCAGGGGGCCCTGGCAGGCCTGG 36098225 374 Chr1:36098203- - CCAGGCCTGCCAGGGCCCCCTGG 36098225 375 Chr1:36098211- - AGGGGGAACCAGGCCTGCCAGGG 36098233 376 Chr1:36098212- - AAGGGGGAACCAGGCCTGCCAGG 36098234 377 Chr1:36098216- + GCAGGCCTGGTTCCCCCTTCAGG 36098238 378 Chr1:36098221- + CCTGGTTCCCCCTTCAGGCCCGG 36098243 379 Chr1:36098221- - CCGGGCCTGAAGGGGGAACCAGG 36098243 380 Chr1:36098225- + GTTCCCCCTTCAGGCCCGGCAGG 36098247 381 Chr1:36098228- - AGGCCTGCCGGGCCTGAAGGGGG 36098250 382 Chr1:36098229- - AAGGCCTGCCGGGCCTGAAGGGG 36098251 383 Chr1:36098230- - CAAGGCCTGCCGGGCCTGAAGGG 36098252 384 Chr1:36098231- + CCTTCAGGCCCGGCAGGCCTTGG 36098253 385 Chr1:36098231- - CCAAGGCCTGCCGGGCCTGAAGG 36098253 386 Chr1:36098232- + CTTCAGGCCCGGCAGGCCTTGGG 36098254 387 Chr1:36098233- + TTCAGGCCCGGCAGGCCTTGGGG 36098255 388 Chr1:36098239- - ATTGGGCCCCAAGGCCTGCCGGG 36098261 389 Chr1:36098240- - TATTGGGCCCCAAGGCCTGCCGG 36098262 390 Chr1:36098242- + GGCAGGCCTTGGGGCCCAATAGG 36098264 391 Chr1:36098243- + GCAGGCCTTGGGGCCCAATAGGG 36098265 392 Chr1:36098248- - GCTGGCCCTATTGGGCCCCAAGG 36098270 393 Chr1:36098251- + TGGGGCCCAATAGGGCCAGCTGG 36098273 394 Chr1:36098256- - AGGGTCCAGCTGGCCCTATTGGG 36098278 395 Chr1:36098257- - CAGGGTCCAGCTGGCCCTATTGG 36098279 396 Chr1:36098258- + CAATAGGGCCAGCTGGACCCTGG 36098280 397 Chr1:36098266- + CCAGCTGGACCCTGGAGTCCTGG 36098288 398 Chr1:36098266- - CCAGGACTCCAGGGTCCAGCTGG 36098288 399 Chr1:36098267- + CAGCTGGACCCTGGAGTCCTGGG 36098289 400 Chr1:36098275- - TCAGGAATCCCAGGACTCCAGGG 36098297 401 Chr1:36098276- - CTCAGGAATCCCAGGACTCCAGG 36098298 402 Chr1:36098277- + CTGGAGTCCTGGGATTCCTGAGG 36098299 403 Chr1:36098278- + TGGAGTCCTGGGATTCCTGAGGG 36098300 404 Chr1:36098284- - AGGGGTCCCTCAGGAATCCCAGG 36098306 405 Chr1:36098288- + GGATTCCTGAGGGACCCCTCAGG 36098310 406 Chr1:36098293- + CCTGAGGGACCCCTCAGGCCAGG 36098315 407 Chr1:36098293- - CCTGGCCTGAGGGGTCCCTCAGG 36098315 408 Chr1:36098302- + CCCCTCAGGCCAGGCTGCCCAGG 36098324 409 Chr1:36098302- - CCTGGGCAGCCTGGCCTGAGGGG 36098324 410 Chr1:36098303- + CCCTCAGGCCAGGCTGCCCAGGG 36098325 411 Chr1:36098303- - CCCTGGGCAGCCTGGCCTGAGGG 36098325 412 Chr1:36098304- - TCCCTGGGCAGCCTGGCCTGAGG 36098326 413 Chr1:36098311- - TTGGGGCTCCCTGGGCAGCCTGG 36098333 414 Chr1:36098319- - AAGGTGACTTGGGGCTCCCTGGG 36098341 415 Chr1:36098320- - AAAGGTGACTTGGGGCTCCCTGG 36098342 416 Chr1:36098328- - TGGGGCAGAAAGGTGACTTGGGG 36098350 417 Chr1:36098329- - CTGGGGCAGAAAGGTGACTTGGG 36098351 418 Chr1:36098330- + CCAAGTCACCTTTCTGCCCCAGG 36098352 419 Chr1:36098330- - CCTGGGGCAGAAAGGTGACTTGG 36098352 420 Chr1:36098331- + CAAGTCACCTTTCTGCCCCAGGG 36098353 421 Chr1:36098338- - GCAGGAGCCCTGGGGCAGAAAGG 36098360 422 Chr1:36098346- - CAGGGGTGGCAGGAGCCCTGGGG 36098368 423 Chr1:36098347- + CCCAGGGCTCCTGCCACCCCTGG 36098369 424 Chr1:36098347- - CCAGGGGTGGCAGGAGCCCTGGG 36098369 425 Chr1:36098348- - ACCAGGGGTGGCAGGAGCCCTGG 6098370 426 Chr1:36098356- + CCTGCCACCCCTGGTCCTCCAGG 36098378 427 Chr1:36098356- - CCTGGAGGACCAGGGGTGGCAGG 36098378 428 Chr1:36098357- + CTGCCACCCCTGGTCCTCCAGGG 36098379 429 Chr1:36098360- - TCGCCCTGGAGGACCAGGGGTGG 36098382 430 Chr1:36098363- - GGGTCGCCCTGGAGGACCAGGGG 36098385 431 Chr1:36098364- - CGGGTCGCCCTGGAGGACCAGGG 36098386 432 Chr1:36098365- - ACGGGTCGCCCTGGAGGACCAGG 36098387 433 Chr1:36098371- - GGTTTCACGGGTCGCCCTGGAGG 36098393 434 Chr1:36098374- + CCAGGGCGACCCGTGAAACCCGG 36098396 435 Chr1:36098374- - CCGGGTTTCACGGGTCGCCCTGG 36098396 436 Chr1:36098383- - AAGGGTGAGCCGGGTTTCACGGG 36098405 437 Chr1:36098384- - CAAGGGTGAGCCGGGTTTCACGG 36098406 438 Chr1:36098385- + CGTGAAACCCGGCTCACCCTTGG 36098407 439 Chr1:36098386- + GTGAAACCCGGCTCACCCTTGGG 36098408 440 Chr1:36098392- - ACTGGGCCCAAGGGTGAGCCGGG 36098414 441 Chr1:36098393- - AACTGGGCCCAAGGGTGAGCCGG 36098415 442 Chr1:36098395- + GGCTCACCCTTGGGCCCAGTTGG 36098417 443 Chr1:36098401- + CCCTTGGGCCCAGTTGGTCCAGG 36098423 444 Chr1:36098401- - CCTGGACCAACTGGGCCCAAGGG 36098423 445 Chr1:36098402- + CCTTGGGCCCAGTTGGTCCAGGG 36098424 446 Chr1:36098402- - CCCTGGACCAACTGGGCCCAAGG 36098424 447 Chr1:36098403- + CTTGGGCCCAGTTGGTCCAGGGG 36098425 448 Chr1:36098404- + TTGGGCCCAGTTGGTCCAGGGGG 36098426 449 Chr1:36098409- - ATGGACCCCCTGGACCAACTGGG 36098431 450 Chr1:36098410- - CATGGACCCCCTGGACCAACTGG 36098432 451 Chr1:36098411- + CAGTTGGTCCAGGGGGTCCATGG 36098433 452 Chr1:36098412- + AGTTGGTCCAGGGGGTCCATGGG 36098434 453 Chr1:36098419- + CCAGGGGGTCCATGGGCCCCAGG 36098441 454 Chr1:36098419- - CCTGGGGCCCATGGACCCCCTGG 36098441 455 Chr1:36098428- - AGGGGACTTCCTGGGGCCCATGG 36098450 456 Chr1:36098435- - AGGTGAGAGGGGACTTCCTGGGG 36098457 457 Chr1:36098436- - CAGGTGAGAGGGGACTTCCTGGG 36098458 458 Chr1:36098437- + CCAGGAAGTCCCCTCTCACCTGG 36098459 459 Chr1:36098437- - CCAGGTGAGAGGGGACTTCCTGG 36098459 460 Chr1:36098438- + CAGGAAGTCCCCTCTCACCTGGG 36098460 461 Chr1:36098446- + CCCCTCTCACCTGGGACCCCTGG 36098468 462 Chr1:36098446- - CCAGGGGTCCCAGGTGAGAGGGG 36098468 463 Chr1:36098447- - ACCAGGGGTCCCAGGTGAGAGGG 36098469 464 Chr1:36098448- - AACCAGGGGTCCCAGGTGAGAGG 36098470 465 Chr1:36098455- - GCTGGGAAACCAGGGGTCCCAGG 36098477 466 Chr1:36098459- + GGACCCCTGGTTTCCCAGCCAGG 36098481 467 Chr1:36098462- - TGGCCTGGCTGGGAAACCAGGGG 36098484 468 Chr1:36098463- - GTGGCCTGGCTGGGAAACCAGGG 36098485 469 Chr1:36098464- - AGTGGCCTGGCTGGGAAACCAGG 36098486 470 Chr1:36098467- + GGTTTCCCAGCCAGGCCACTAGG 36098489 471 Chr1:36098472- - AGGGGCCTAGTGGCCTGGCTGGG 36098494 472 Chr1:36098473- - CAGGGGCCTAGTGGCCTGGCTGG 36098495 473 Chr1:36098474- + CAGCCAGGCCACTAGGCCCCTGG 36098496 474 Chr1:36098477- - TGACCAGGGGCCTAGTGGCCTGG 36098499 475 Chr1:36098482- - CGAGGTGACCAGGGGCCTAGTGG 36098504 476 Chr1:36098490- - CTGGCATTCGAGGTGACCAGGGG 36098512 477 Chr1:36098491- + CCCTGGTCACCTCGAATGCCAGG 36098513 478 Chr1:36098491- - CCTGGCATTCGAGGTGACCAGGG 36098513 479 Chr1:36098492- - GCCTGGCATTCGAGGTGACCAGG 36098514 480 Chr1:36098500- + CCTCGAATGCCAGGCACTCCTGG 36098522 481 Chr1:36098500- - CCAGGAGTGCCTGGCATTCGAGG 36098522 482 Chr1:36098501- + CTCGAATGCCAGGCACTCCTGGG 36098523 483 Chr1:36098502- + TCGAATGCCAGGCACTCCTGGGG 36098524 484 Chr1:36098503- + CGAATGCCAGGCACTCCTGGGGG 36098525 485 Chr1:36098509- - GGAGGACCCCCAGGAGTGCCTGG 36098531 486 Chr1:36098512- + GGCACTCCTGGGGGTCCTCCAGG 36098534 487 Chr1:36098518- - GCAGGGCCTGGAGGACCCCCAGG 36098540 488 Chr1:36098527- - AAGGGTGAGGCAGGGCCTGGAGG 36098549 489 Chr1:36098530- + CCAGGCCCTGCCTCACCCTTAGG 36098552 490 Chr1:36098530- - CCTAAGGGTGAGGCAGGGCCTGG 36098552 491 Chr1:36098535- - CTGGGCCTAAGGGTGAGGCAGGG 36098557 492 Chr1:36098536- + CCTGCCTCACCCTTAGGCCCAGG 36098558 493 Chr1:36098536- - CCTGGGCCTAAGGGTGAGGCAGG 36098558 494 Chr1:36098537- + CTGCCTCACCCTTAGGCCCAGGG 36098559 495 Chr1:36098538- + TGCCTCACCCTTAGGCCCAGGGG 36098560 496 Chr1:36098539- + GCCTCACCCTTAGGCCCAGGGGG 36098561 497 Chr1:36098540- - GCCCCCTGGGCCTAAGGGTGAGG 36098562 498 Chr1:36098545- - CGTGGGCCCCCTGGGCCTAAGGG 36098567 499 Chr1:36098546- - ACGTGGGCCCCCTGGGCCTAAGG 36098568 500 Chr1:36098553- - CTGGCAGACGTGGGCCCCCTGGG 36098575 501 Chr1:36098554- + CCAGGGGGCCCACGTCTGCCAGG 36098576 502 Chr1:36098554- - CCTGGCAGACGTGGGCCCCCTGG 36098576 503 Chr1:36098562- - CAGGGCTTCCTGGCAGACGTGGG 36098584 504 Chr1:36098563- - GCAGGGCTTCCTGGCAGACGTGG 36098585 505 Chr1:36098572- + CCAGGAAGCCCTGCAGACCCAGG 36098594 506 Chr1:36098572- - CCTGGGTCTGCAGGGCTTCCTGG 36098594 507 Chr1:36098580- - CTGGACTTCCTGGGTCTGCAGGG 36098602 508 Chr1:36098581- + CCTGCAGACCCAGGAAGTCCAGG 36098603 509 Chr1:36098581- - CCTGGACTTCCTGGGTCTGCAGG 36098603 510 Chr1:36098582- + CTGCAGACCCAGGAAGTCCAGGG 36098604 511 Chr1:36098583- + TGCAGACCCAGGAAGTCCAGGGG 36098605 512 Chr1:36098584- + GCAGACCCAGGAAGTCCAGGGGG 36098606 513 Chr1:36098589- - GGGGTCCCCCTGGACTTCCTGGG 36098611 514 Chr1:36098590- - GGGGGTCCCCCTGGACTTCCTGG 36098612 515 Chr1:36098599- - CAGGGTCTTGGGGGTCCCCCTGG 36098621 516 Chr1:36098602- + GGGGGACCCCCAAGACCCTGTGG 36098624 517 Chr1:36098603- + GGGGACCCCCAAGACCCTGTGGG 36098625 518 Chr1:36098608- - CAGGGCCCACAGGGTCTTGGGGG 36098630 519 Chr1:36098609- - GCAGGGCCCACAGGGTCTTGGGG 36098631 520 Chr1:36098610- - AGCAGGGCCCACAGGGTCTTGGG 36098632 521 Chr1:36098611- - GAGCAGGGCCCACAGGGTCTTGG 36098633 522 Chr1:36098617- + CCCTGTGGGCCCTGCTCCCCTGG 36098639 523 Chr1:36098617- - CCAGGGGAGCAGGGCCCACAGGG 36098639 524 Chr1:36098618- - GCCAGGGGAGCAGGGCCCACAGG 36098640 525 Chr1:36098626- - GATGGGGAGCCAGGGGAGCAGGG 36098648 526 Chr1:36098627- - GGATGGGGAGCCAGGGGAGCAGG 36098649 527 Chr1:36098633- - AGGGGAGGATGGGGAGCCAGGGG 36098655 528 Chr1:36098634- - CAGGGGAGGATGGGGAGCCAGGG 36098656 529 Chr1:36098635- + CCTGGCTCCCCATCCTCCCCTGG 36098657 530 Chr1:36098635- - CCAGGGGAGGATGGGGAGCCAGG 36098657 531 Chr1:36098642- - GGGTGAGCCAGGGGAGGATGGGG 36098664 532 Chr1:36098643- - GGGGTGAGCCAGGGGAGGATGGG 36098665 533 Chr1:36098644- - AGGGGTGAGCCAGGGGAGGATGG 36098666 534 Chr1:36098648- - GGACAGGGGTGAGCCAGGGGAGG 36098670 535 Chr1:36098651- - GGGGGACAGGGGTGAGCCAGGGG 36098673 536 Chr1:36098652- - TGGGGGACAGGGGTGAGCCAGGG 36098674 537 Chr1:36098653- - TTGGGGGACAGGGGTGAGCCAGG 36098675 538 Chr1:36098662- + CCCCTGTCCCCCAAGAGTCCTGG 36098684 539 Chr1:36098662- - CCAGGACTCTTGGGGGACAGGGG 36098684 540 Chr1:36098663- + CCCTGTCCCCCAAGAGTCCTGGG 36098685 541 Chr1:36098663- - CCCAGGACTCTTGGGGGACAGGG 36098685 542 Chr1:36098664- - TCCCAGGACTCTTGGGGGACAGG 36098686 543 Chr1:36098669- - TGGGGTCCCAGGACTCTTGGGGG 36098691 544 Chr1:36098670- - CTGGGGTCCCAGGACTCTTGGGG 36098692 545 Chr1:36098671- - GCTGGGGTCCCAGGACTCTGGG 36098693 546 Chr1:36098672- - AGCTGGGGTCCCAGGACTCTTGG 36098694 547 Chr1:36098674- + AAGAGTCCTGGGACCCCAGCTGG 36098696 548 Chr1:36098675- + AGAGTCCTGGGACCCCAGCTGGG 36098697 549 Chr1:36098680- - AGGGGCCCAGCTGGGGTCCCAGG 36098702 550 Chr1:36098687- - GGGGGACAGGGGCCCAGCTGGGG 36098709 551 Chr1:36098688- - AGGGGGACAGGGGCCCAGCTGGG 36098710 552 Chr1:36098689- - AAGGGGGACAGGGGCCCAGCTGG 36098711 553 Chr1:36098691- + AGCTGGGCCCCTGTCCCCCTTGG 36098713 554 Chr1:36098692- + GCTGGGCCCCTGTCCCCCTTGGG 36098714 555 Chr1:36098693- + CTGGGCCCCTGTCCCCCTTGGGG 36098715 556 Chr1:36098698- + CCCCTGTCCCCCTTGGGGCCTGG 36098720 557 Chr1:36098698- - CCAGGCCCCAAGGGGGACAGGGG 36098720 558 Chr1:36098699- - GCCAGGCCCCAAGGGGGACAGGG 36098721 559 Chr1:36098700- - TGCCAGGCCCCAAGGGGGACAGG 36098722 560 Chr1:36098705- - AGGACTGCCAGGCCCCAAGGGGG 36098727 561 Chr1:36098706- - CAGGACTGCCAGGCCCCAAGGGG 36098728 562 Chr1:36098707- + CCCTTGGGGCCTGGCAGTCCTGG 36098729 563 Chr1:36098707- - CCAGGACTGCCAGGCCCCAAGGG 36098729 564 Chr1:36098708- - GCCAGGACTGCCAGGCCCCAAGG 36098730 565 Chr1:36098716- - TATGGGATGCCAGGACTGCCAGG 36098738 566 Chr1:36098724- + TCCTGGCATCCCATAGCCAGTGG 36098746 567 Chr1:36098725- + CCTGGCATCCCATAGCCAGTGGG 36098747 568 Chr1:36098725- - CCCACTGGCTATGGGATGCCAGG 36098747 569 Chr1:36098726- + CTGGCATCCCATAGCCAGTGGGG 36098748 570 Chr1:36098733- - TGATAGGCCCCACTGGCTATGGG 36098755 571 Chr1:36098734- - CTGATAGGCCCCACTGGCTATGG 36098756 572 Chr1:36098740- + CCAGTGGGGCCTATCAGCCCAGG 36098762 573 Chr1:36098740- - CCTGGGCTGATAGGCCCCACTGG 36098762 574 Chr1:36098741- + CAGTGGGGCCTATCAGCCCAGGG 36098763 575 Chr1:36098742- + AGTGGGGCCTATCAGCCCAGGGG 36098764 576 Chr1:36098743- + GTGGGGCCTATCAGCCCAGGGGG 36098765 577 Chr1:36098744- + TGGGGCCTATCAGCCCAGGGGGG 36098766 578 Chr1:36098749- - CGGGGCCCCCCTGGGCTGATAGG 36098771 579 Chr1:36098750- + CTATCAGCCCAGGGGGGCCCCGG 36098772 580 Chr1:36098751- + TATCAGCCCAGGGGGGCCCCGGG 36098773 581 Chr1:36098757- - CAGGGACCCGGGGCCCCCCTGGG 36098779 582 Chr1:36098758- + CCAGGGGGGCCCCGGGTCCCTGG 36098780 583 Chr1:36098758- - CCAGGGACCCGGGGCCCCCCTGG 36098780 584 Chr1:36098767- - AAAGGGGAGCCAGGGACCCGGGG 36098789 585 Chr1:36098768- - CAAAGGGGAGCCAGGGACCCGGG 36098790 586 Chr1:36098769- + CCGGGTCCCTGGCTCCCCTTTGG 36098791 587 Chr1:36098769- - CCAAAGGGGAGCCAGGGACCCGG 36098791 588 Chr1:36098775- - CAGGGGCCAAAGGGGAGCCAGGG 36098797 589 Chr1:36098776- - TCAGGGGCCAAAGGGGAGCCAGG 36098798 590 Chr1:36098779- + GGCTCCCCTTTGGCCCCTGATGG 36098801 591 Chr1:36098780- + GCTCCCCTTTGGCCCCTGATGGG 36098802 592 Chr1:36098783- - GGGCCCATCAGGGGCCAAAGGGG 36098805 593 Chr1:36098784- - AGGGCCCATCAGGGGCCAAAGGG 36098806 594 Chr1:36098785- - CAGGGCCCATCAGGGGCCAAAGG 36098807 595 Chr1:36098788- + TTGGCCCCTGATGGGCCCTGTGG 36098810 596 Chr1:36098792- - AGGACCACAGGGCCCATCAGGGG 36098814 597 Chr1:36098793- - CAGGACCACAGGGCCCATCAGGG 36098815 598 Chr1:36098794- + CCTGATGGGCCCTGTGGTCCTGG 36098816 599 Chr1:36098794- - CCAGGACCACAGGGCCCATCAGG 36098816 600 Chr1:36098803- - GCAGGGTTGCCAGGACCACAGGG 36098825 601 Chr1:36098804- - AGCAGGGTTGCCAGGACCACAGG 36098826 602 Chr1:36098812- + CCTGGCAACCCTGCTGCCCCTGG 36098834 603 Chr1:36098812- - CCAGGGGCAGCAGGGTTGCCAGG 36098834 604 Chr1:36098813- + CTGGCAACCCTGCTGCCCCTGGG 36098835 605 Chr1:36098820- - TGGGAGTCCCAGGGGCAGCAGGG 36098842 606 Chr1:36098821- - GTGGGAGTCCCAGGGGCAGCAGG 36098843 607 Chr1:36098828- - AGACGGTGTGGGAGTCCCAGGGG 36098850 608 Chr1:36098829- - TAGACGGTGTGGGAGTCCCAGGG 36098851 609 Chr1:36098830- - GTAGACGGTGTGGGAGTCCCAGG 36098852 610 Chr1:36098836- + ACTCCCACACCGTCTACTCCAGG 36098858 611 Chr1:36098839- + CCCACACCGTCTACTCCAGGAGG 36098861 612 Chr1:36098839- - CCTCCTGGAGTAGACGGTGTGGG 36098861 613 Chr1:36098840- - ACCTCCTGGAGTAGACGGTGTGG 36098862 614 Chr1:36098845- - AAAGGACCTCCTGGAGTAGACGG 36098867 615 Chr1:36098848- + TCTACTCCAGGAGGTCCTTTTGG 36098870 616 Chr1:36098849- + CTACTCCAGGAGGTCCTTTTGGG 36098871 617 Chr1:36098854- - GTGGGCCCAAAAGGACCTCCTGG 36098876 618 Chr1:36098863- + CCTTTTGGGCCCACAGCTCCTGG 36098885 619 Chr1:36098863- - CCAGGAGCTGTGGGCCCAAAAGG 36098885 620 Chr1:36098872- - AGGGGGGAGCCAGGAGCTGTGGG 36098894 621 Chr1:36098873- - CAGGGGGGAGCCAGGAGCTGTGG 36098895 622 Chr1:36098874- + CACAGCTCCTGGCTCCCCCCTGG 36098896 623 Chr1:36098875- + ACAGCTCCTGGCTCCCCCCTGGG 36098897 624 Chr1:36098876- + CAGCTCCTGGCTCCCCCCTGGGG 36098898 625 Chr1:36098881- + CCTGGCTCCCCCCTGGGGCCTGG 36098903 626 Chr1:36098881- - CCAGGCCCCAGGGGGGAGCCAGG 36098903 627 Chr1:36098888- - TGGAGTTCCAGGCCCCAGGGGGG 36098910 628 Chr1:36098889- - CTGGAGTTCCAGGCCCCAGGGGG 36098911 629 Chr1:36098890- + CCCCTGGGGCCTGGAACTCCAGG 36098912 630 Chr1:36098890- - CCTGGAGTTCCAGGCCCCAGGGG 36098912 631 Chr1:36098891- - TCCTGGAGTTCCAGGCCCCAGGG 36098913 632 Chr1:36098892- - CTCCTGGAGTTCCAGGCCCCAGG 36098914 633 Chr1:36098893- + CTGGGGCCTGGAACTCCAGGAGG 36098915 634 Chr1:36098899- - TCTGGGCCTCCTGGAGTTCCAGG 36098921 635 Chr1:36098908- - AAGGGTGAGTCTGGGCCTCCTGG 36098930 636 Chr1:36098916- - CAGGAGACAAGGGTGAGTCTGGG 36098938 637 Chr1:36098917- + CCAGACTCACCCTTGTCTCCTGG 36098939 638 Chr1:36098917- - CCAGGAGACAAGGGTGAGTCTGG 36098939 639 Chr1:36098918- + CAGACTCACCCTTGTCTCCTGGG 36098940 640 Chr1:36098919- + AGACTCACCCTTGTCTCCTGGGG 36098941 641 Chr1:36098926- + CCCTTGTCTCCTGGGGCCCCAGG 36098948 642 Chr1:36098926- - CCTGGGGCCCCAGGAGACAAGGG 36098948 643 Chr1:36098927- - TCCTGGGGCCCCAGGAGACAAGG 36098949 644 Chr1:36098935- - GATGGGCTTCCTGGGGCCCCAGG 36098957 645 Chr1:36098942- - TGGTTTGGATGGGCTTCCTGGGG 36098964 646 Chr1:36098943- - CTGGTTTGGATGGGCTTCCTGGG 36098965 647 Chr1:36098944- + CCAGGAAGCCCATCCAAACCAGG 36098966 648 Chr1:36098944- - CCTGGTTTGGATGGGCTTCCTGG 36098966 649 Chr1:36098952- - TAGGCAAACCTGGTTTGGATGGG 36098974 650 Chr1:36098953- - TTAGGCAAACCTGGTTTGGATGG 36098975 651 Chr1:36098957- - TGGCTTAGGCAAACCTGGTTTGG 36098979 652 Chr1:36098962- + CCAGGTTTGCCTAAGCCAGCTGG 36098984 653 Chr1:36098962- - CCAGCTGGCTTAGGCAAACCTGG 36098984 654 Chr1:36098968- + TTGCCTAAGCCAGCTGGACCAGG 36098990 655 Chr1:36098969- + TGCCTAAGCCAGCTGGACCAGGG 36098991 656 Chr1:36098971- - CTCCCTGGTCCAGCTGGCTTAGG 36098993 657 Chr1:36098972- + CTAAGCCAGCTGGACCAGGGAGG 36098994 658 Chr1:36098976- + GCCAGCTGGACCAGGGAGGCCGG 36098998 659 Chr1:36098977- + CCAGCTGGACCAGGGAGGCCGGG 36098999 660 Chr1:36098977- - CCCGGCCTCCCTGGTCCAGCTGG 36098999 661 Chr1:36098978- + CAGCTGGACCAGGGAGGCCGGGG 36099000 662 Chr1:36098979- + AGCTGGACCAGGGAGGCCGGGGG 36099001 663 Chr1:36098980- + GCTGGACCAGGGAGGCCGGGGGG 36099002 664 Chr1:36098981- + CTGGACCAGGGAGGCCGGGGGGG 36099003 665 Chr1:36098985- + ACCAGGGAGGCCGGGGGGGCCGG 36099007 666 Chr1:36098986- + CCAGGGAGGCCGGGGGGGCCGGG 36099008 667 Chr1:36098986- - CCCGGCCCCCCCGGCCTCCCTGG 36099008 668 Chr1:36098987- + CAGGGAGGCCGGGGGGGCCGGGG 36099009 669 Chr1:36098988- + AGGGAGGCCGGGGGGGCCGGGGG 36099010 670 Chr1:36098995- - GGGGGTGCCCCCGGCCCCCCCGG 36099017 671 Chr1:36099004- + CCGGGGGCACCCCCCTGCCCTGG 36099026 672 Chr1:36099004- - CCAGGGCAGGGGGGTGCCCCCGG 36099026 673 Chr1:36099005- + CGGGGGCACCCCCCTGCCCTGGG 36099027 674 Chr1:36099006- + GGGGGCACCCCCCTGCCCTGGGG 36099028 675 Chr1:36099013- + CCCCCCTGCCCTGGGGCCCCAGG 36099035 676 Chr1:36099013- - CCTGGGGCCCCAGGGCAGGGGGG 36099035 677 Chr1:36099014- - GCCTGGGGCCCCAGGGCAGGGGG 36099036 678 Chr1:36099015- - TGCCTGGGGCCCCAGGGCAGGGG 36099037 679 Chr1:36099016- - CTGCCTGGGGCCCCAGGGCAGGG 36099038 680 Chr1:36099017- - GCTGCCTGGGGCCCCAGGGCAGG 36099039 681 Chr1:36099021- + CCCTGGGGCCCCAGGCAGCCCGG 36099043 682 Chr1:36099021- - CCGGGCTGCCTGGGGCCCCAGGG 36099043 683 Chr1:36099022- + CCTGGGGCCCCAGGCAGCCCGGG 36099044 684 Chr1:36099022- - CCCGGGCTGCCTGGGGCCCCAGG 36099044 685 Chr1:36099026- + GGGCCCCAGGCAGCCCGGGCTGG 36099048 686 Chr1:36099029- - GGGCCAGCCCGGGCTGCCTGGGG 36099051 687 Chr1:36099030- - TGGGCCAGCCCGGGCTGCCTGGG 36099052 688 Chr1:36099031- - GTGGGCCAGCCCGGGCTGCCTGG 36099053 689 Chr1:36099039- - ATAATGGAGTGGGCCAGCCCGGG 36099061 690 Chr1:36099040- - GATAATGGAGTGGGCCAGCCCGG 36099062 691 Chr1:36099049- - CTCAAGGGGGATAATGGAGTGGG 36099071 692 Chr1:36099050- + CCACTCCATTATCCCCCTTGAGG 36099072 693 Chr1:36099050- - CCTCAAGGGGGATAATGGAGTGG 36099072 694 Chr1:36099055- - CGAGGCCTCAAGGGGGATAATGG 36099077 695 Chr1:36099062- - AGGTGATCGAGGCCTCAAGGGGG 36099084 696 Chr1:36099063- - CAGGTGATCGAGGCCTCAAGGGG 36099085 697 Chr1:36099064- + CCCTTGAGGCCTCGATCACCTGG 36099086 698 Chr1:36099064- - CCAGGTGATCGAGGCCTCAAGGG 36099086 699 Chr1:36099065- + CCTTGAGGCCTCGATCACCTGGG 36099087 700 Chr1:36099065- - CCCAGGTGATCGAGGCCTCAAGG 36099087 701 Chr1:36099066- + CTTGAGGCCTCGATCACCTGGGG 36099088 702 Chr1:36099067- + TTGAGGCCTCGATCACCTGGGGG 36099089 703 Chr1:36099073- + CCTCGATCACCTGGGGGCCCAGG 36099095 704 Chr1:36099073- - CCTGGGCCCCCAGGTGATCGAGG 36099095 705 Chr1:36099082- - CAGGGGGAGCCTGGGCCCCCAGG 36099104 706 Chr1:36099083- + CTGGGGGCCCAGGCTCCCCCTGG 36099105 707 Chr1:36099084- + TGGGGGCCCAGGCTCCCCCTGGG 36099106 708 Chr1:36099085- + GGGGGCCCAGGCTCCCCCTGGGG 36099107 709 Chr1:36099090- - CAGGGCCCCAGGGGGAGCCTGGG 36099112 710 Chr1:36099091- + CCAGGCTCCCCCTGGGGCCCTGG 36099113 711 Chr1:36099091- - CCAGGGCCCCAGGGGGAGCCTGG 36099113 712 Chr1:36099098- - GGGGGAACCAGGGCCCCAGGGGG 36099120 713 Chr1:36099099- - AGGGGGAACCAGGGCCCCAGGGG 36099121 714 Chr1:36099100- - CAGGGGGAACCAGGGCCCCAGGG 36099122 715 Chr1:36099101- + CCTGGGGCCCTGGTTCCCCCTGG 36099123 716 Chr1:36099101- - CCAGGGGGAACCAGGGCCCCAGG 36099123 717 Chr1:36099108- - CAGGATTCCAGGGGGAACCAGGG 36099130 718 Chr1:36099109- + CCTGGTTCCCCCTGGAATCCTGG 36099131 719 Chr1:36099109- - CCAGGATTCCAGGGGGAACCAGG 36099131 720 Chr1:36099110- + CTGGTTCCCCCTGGAATCCTGGG 36099132 721 Chr1:36099111- + TGGTTCCCCCTGGAATCCTGGGG 36099133 722 Chr1:36099112- + GGTTCCCCCTGGAATCCTGGGG 36099134 723 Chr1:36099116- - AGGGCCCCCAGGATTCCAGGGGG 36099138 724 Chr1:36099117- - CAGGGCCCCCAGGATTCCAGGGG 36099139 725 Chr1:36099118- + CCCTGGAATCCTGGGGGCCCTG 36099140 726 Chr1:36099118- - CCAGGGCCCCCAGGATTCCAGG 36099140 727 Chr1:36099119- - GCCAGGGCCCCCAGGATTCCAG 36099141 728 Chr1:36099127- - CAAGGGGTGCCAGGGCCCCCAGG 36099149 729 Chr1:36099128- + CTGGGGGCCCTGGCACCCCTTGG 36099150 730 Chr1:36099129- + TGGGGGCCCTGGCACCCCTTGGG 36099151 731 Chr1:36099135- - CAGGTGCCCAAGGGGTGCCAGGG 36099157 732 Chr1:36099136- + CCTGGCACCCCTTGGGCACCTGG 36099158 733 Chr1:36099136- - CCAGGTGCCCAAGGGGTGCCAGG 36099158 734 Chr1:36099143- - TGGAAAACCAGGTGCCCAAGGGG 36099165 735 Chr1:36099144- - CTGGAAAACCAGGTGCCCAAGGG 36099166 736 Chr1:36099145- + CCTTGGGCACCTGGTTTTCCAGG 36099167 737 Chr1:36099145- - CCTGGAAAACCAGGTGCCCAAG 36099167 738 Chr1:36099146- + CTTGGGCACCTGGTTTTCCAGGG 36099168 739 Chr1:36099154- - ATTACTATCCCTGGAAAACCAGG 36099176 740 Chr1:36099162- + TCCAGGGATAGTAATGCCTGAG 36099184 741 Chr1:36099163- + CCAGGGATAGTAATGCCTGAGGG 36099185 742 Chr1:36099163- - CCCTCAGGCATTACTATCCCTGG 36099185 743 Chr1:36099164- + CAGGGATAGTAATGCCTGAGGGG 36099186 744 Chr1:36099169- + ATAGTAATGCCTGAGGGGCCCGG 36099191 745 Chr1:36099170- + TAGTAATGCCTGAGGGGCCCGGG 36099192 746 Chr1:36099173- + TAATGCCTGAGGGGCCCGGGAGG 36099195 747 Chr1:36099178- + CCTGAGGGGCCCGGGAGGCCAGG 36099200 748 Chr1:36099178- - CCTGGCCTCCCGGGCCCCTCAGG 36099200 749 Chr1:36099179- + CTGAGGGGCCCGGGAGGCCAGGG 36099201 750 Chr1:36099180- + TGAGGGGCCCGGGAGGCCAGGGG 36099202 751 Chr1:36099181- + GAGGGGCCCGGGAGGCCAGGGGG 36099203 752 Chr1:36099187- + CCCGGGAGGCCAGGGGGTCCTGG 36099209 753 Chr1:36099187- - CCAGGACCCCCTGGCCTCCCGGG 36099209 754 Chr1:36099188- + CCGGGAGGCCAGGGGGTCCTGGG 36099210 755 Chr1:36099188- - CCCAGGACCCCCTGGCCTCCCGG 36099210 756 Chr1:36099189- + CGGGAGGCCAGGGGGTCCTGGGG 36099211 757 Chr1:36099190- + GGGAGGCCAGGGGGTCCTGGGGG 36099212 758 Chr1:36099196- - CGGGGACCCCCAGGACCCCCTG 36099218 759 Chr1:36099197- + CAGGGGGTCCTGGGGGTCCCCGG 36099219 760 Chr1:36099200- + GGGGTCCTGGGGGTCCCCGGAGG 36099222 761 Chr1:36099205- - CAGGGCCTCCGGGGACCCCCAGG 36099227 762 Chr1:36099206- + CTGGGGGTCCCCGGAGGCCCTGG 36099228 763 Chr1:36099214- - CGAGGGGACCAGGGCCTCCGGGG 36099236 764 Chr1:36099215- - ACGAGGGGACCAGGGCCTCCGGG 36099237 765 Chr1:36099216- - TACGAGGGGACCAGGGCCTCCGG 36099238 766 Chr1:36099223- + CCCTGGTCCCCTCGTATTCCTGG 36099245 767 Chr1:36099223- - CCAGGAATACGAGGGGACCAGGG 36099245 768 Chr1:36099224- - GCCAGGAATACGAGGGGACCAGG 36099246 769 Chr1:36099230- - GGGGGAGCCAGGAATACGAGGGG 36099252 770 Chr1:36099231- - GGGGGGAGCCAGGAATACGAGGG 36099253 771 Chr1:36099232- - CGGGGGGAGCCAGGAATACGAGG 36099254 772 Chr1:36099241- + CCTGGCTCCCCCCGAAGCCCCGG 36099263 773 Chr1:36099241- - CCGGGGCTTCGGGGGGAGCCAGG 36099263 774 Chr1:36099248- - AGGGCAGCCGGGGCTTCGGGGGG 36099270 775 Chr1:36099249- - CAGGGCAGCCGGGGCTTCGGGGG 36099271 776 Chr1:36099250- + CCCCGAAGCCCCGGCTGCCCTGG 36099272 777 Chr1:36099250- - CCAGGGCAGCCGGGGCTTCGGGG 36099272 778 Chr1:36099251- - ACCAGGGCAGCCGGGGCTTCGGG 36099273 779 Chr1:36099252- - CACCAGGGCAGCCGGGGCTTCGG 36099274 780 Chr1:36099253- + CGAAGCCCCGGCTGCCCTGGTGG 36099275 781 Chr1:36099258- - TCGGGCCACCAGGGCAGCCGGGG 36099280 782 Chr1:36099259- - GTCGGGCCACCAGGGCAGCCGGG 36099281 783 Chr1:36099260- - GGTCGGGCCACCAGGGCAGCCGG 36099282 784 Chr1:36099267- - CTGGCAAGGTCGGGCCACCAGGG 36099289 785 Chr1:36099268- + CCTGGTGGCCCGACCTTGCCAGG 36099290 786 Chr1:36099268- - CCTGGCAAGGTCGGGCCACCAGG 36099290 787 Chr1:36099269- + CTGGTGGCCCGACCTTGCCAGGG 36099291 788 Chr1:36099276- - CAGGGCTCCCTGGCAAGGTCGGG 36099298 789 Chr1:36099277- + CCGACCTTGCCAGGGAGCCCTGG 36099299 790 Chr1:36099277- - CCAGGGCTCCCTGGCAAGGTCGG 36099299 791 Chr1:36099278- + CGACCTTGCCAGGGAGCCCTGGG 36099300 792 Chr1:36099279- + GACCTTGCCAGGGAGCCCTGGGG 36099301 793 Chr1:36099280- + ACCTGCCAGGGAGCCCTGGGGG 36099302 794 Chr1:36099281- - TCCCCCAGGGCTCCCTGGCAAGG 36099303 795 Chr1:36099286- - GCTGGTCCCCCAGGGCTCCCTGG 36099308 796 Chr1:36099294- - TGGGCAAGGCTGGTCCCCCAGGG 36099316 797 Chr1:36099295- - ATGGGCAAGGCTGGTCCCCCAGG 36099317 798 Chr1:36099299- + GGGGACCAGCCTTGCCCATCCGG 36099321 799 Chr1:36099300- + GGGACCAGCCTTGCCCATCCGGG 36099322 800 Chr1:36099304- - TTCTCCCGGATGGGCAAGGCTGG 36099326 801 Chr1:36099308- - TGGCTTCTCCCGGATGGGCAAGG 36099330 802 Chr1:36099310- + TTGCCCATCCGGGAGAAGCCAGG 36099332 803 Chr1:36099311- + TGCCCATCCGGGAGAAGCCAGGG 36099333 804 Chr1:36099312- + GCCCATCCGGGAGAAGCCAGGGG 36099334 805 Chr1:36099313- + CCCATCCGGGAGAAGCCAGGGGG 36099335 806 Chr1:36099313- - CCCCCTGGCTTCTCCCGGATGGG 36099335 807 Chr1:36099314- - GCCCCCTGGCTTCTCCCGGATGG 36099336 808 Chr1:36099318- - CTGGGCCCCCTGGCTTCTCCCGG 36099340 809 Chr1:36099322- + GAGAAGCCAGGGGGCCCAGCAGG 36099344 810 Chr1:36099323- + AGAAGCCAGGGGGCCCAGCAGGG 36099345 811 Chr1:36099328- + CCAGGGGGCCCAGCAGGGCCAGG 36099350 812 Chr1:36099328- - CCTGGCCCTGCTGGGCCCCCTGG 36099350 813 Chr1:36099336- - ATGGGCAGCCTGGCCCTGCTGGG 36099358 814 Chr1:36099337- - CATGGGCAGCCTGGCCCTGCTGG 36099359 815 Chr1:36099338- + CAGCAGGGCCAGGCTGCCCATGG 36099360 816 Chr1:36099346- + CCAGGCTGCCCATGGAGTCCTGG 36099368 817 Chr1:36099346- - CCAGGACTCCATGGGCAGCCTGG 36099368 818 Chr1:36099354- - TGGGAAAGCCAGGACTCCATGGG 36099376 819 Chr1:36099355- - ATGGGAAAGCCAGGACTCCATGG 36099377 820 Chr1:36099361- + AGTCCTGGCTTTCCCATGCCTGG 36099383 821 Chr1:36099364- - AAACCAGGCATGGGAAAGCCAGG 36099386 822 Chr1:36099370- + TTTCCCATGCCTGGTTTTCCTGG 36099392 823 Chr1:36099371- + TTCCCATGCCTGGTTTTCCTGGG 36099393 824 Chr1:36099373- - TTCCCAGGAAAACCAGGCATGGG 36099395 825 Chr1:36099374- - CTTCCCAGGAAAACCAGGCATGG 36099396 826 Chr1:36099379- + CCTGGTTTTCCTGGGAAGCCAGG 36099401 827 Chr1:36099379- - CCTGGCTTCCCAGGAAAACCAGG 36099401 828 Chr1:36099380- + CTGGTTTTCCTGGGAAGCCAGGG 36099402 829 Chr1:36099381- + TGGTTTTCCTGGGAAGCCAGGGG 36099403 830 Chr1:36099382- + GGTTTTCCTGGGAAGCCAGGGGG 36099404 831 Chr1:36099383- + GTTTTCCTGGGAAGCCAGGGGGG 36099405 832 Chr1:36099388- + CCTGGGAAGCCAGGGGGGCCAGG 36099410 833 Chr1:36099388- - CCTGGCCCCCCTGGCTTCCCAGG 36099410 834 Chr1:36099389- + CTGGGAAGCCAGGGGGGCCAGGG 36099411 835 Chr1:36099390- + TGGGAAGCCAGGGGGGCCAGGGG 36099412 836 Chr1:36099391- + GGGAAGCCAGGGGGGCCAGGGGG 36099413 837 Chr1:36099397- - CGGGGTCCCCCTGGCCCCCCTGG 36099419 838 Chr1:36099400- + GGGGGGCCAGGGGGACCCCGAGG 36099422 839 Chr1:36099405- + GCCAGGGGGACCCCGAGGCCCGG 36099427 840 Chr1:36099406- + CCAGGGGGACCCCGAGGCCCGGG 36099428 841 Chr1:36099406- - CCCGGGCCTCGGGGTCCCCCTGG 36099428 842 Chr1:36099415- + CCCCGAGGCCCGGGCTTCCCAGG 36099437 843 Chr1:36099415- - CCTGGGAAGCCCGGGCCTCGGGG 36099437 844 Chr1:36099416- + CCCGAGGCCCGGGCTTCCCAGGG 36099438 845 Chr1:36099416- - CCCTGGGAAGCCCGGGCCTCGGG 36099438 846 Chr1:36099417- + CCGAGGCCCGGGCTTCCCAGGGG 36099439 847 Chr1:36099417- - CCCCTGGGAAGCCCGGGCCTCGG 36099439 848 Chr1:36099418- + CGAGGCCCGGGCTTCCCAGGGGG 36099440 849 Chr1:36099419- + GAGGCCCGGGCTTCCCAGGGGGG 36099441 850 Chr1:36099423- + CCCGGGCTTCCCAGGGGGGCCGG 36099445 851 Chr1:36099423- - CCGGCCCCCCTGGGAAGCCCGGG 36099445 852 Chr1:36099424- + CCGGGCTTCCCAGGGGGGCCGGG 36099446 853 Chr1:36099424- - CCCGGCCCCCCTGGGAAGCCCGG 36099446 854 Chr1:36099432- - AGGGAGAGCCCGGCCCCCCTGGG 36099454 855 Chr1:36099433- - AAGGGAGAGCCCGGCCCCCCTGG 36099455 856 Chr1:36099437- + GGGGGCCGGGCTCTCCCTTCAGG 36099459 857 Chr1:36099442- - ATGGACCTGAAGGGAGAGCCCGG 36099464 858 Chr1:36099445- + GGCTCTCCCTTCAGGTCCATCGG 36099467 859 Chr1:36099451- - CTGCTGCCGATGGACCTGAAGGG 36099473 860 Chr1:36099452- - GCTGCTGCCGATGGACCTGAAGG 36099474 861 Chr1:36099454- + TTCAGGTCCATCGGCAGCAGCGG 36099476 862 Chr1:36099460- + TCCATCGGCAGCAGCGGTAGAGG 36099482 863 Chr1:36099461- - GCCTCTACCGCTGCTGCCGATGG 36099483 864 Chr1:36099485- + TTTCTGAGAAAGAAAGAGAAAGG 36099507 865 Chr1:36099486- + TTCTGAGAAAGAAAGAGAAAGGG 36099508 866 Chr1:36099487- + TCTGAGAAAGAAAGAGAAAGGGG 36099509 867 Chr1:36099495- + AGAAAGAGAAAGGGGCAGTCAGG 36099517 868 Chr1:36099496- + GAAAGAGAAAGGGGCAGTCAGGG 36099518 869 Chr1:36099497- + AAAGAGAAAGGGGCAGTCAGGGG 36099519 870 Chr1:36099509- + GCAGTCAGGGGCCTGAACTGTGG 36099531 871 Chr1:36099510- + CAGTCAGGGGCCTGAACTGTGGG 36099532 872 Chr1:36099511- + AGTCAGGGGCCTGAACTGTGGGG 36099533 873 Chr1:36099516- + GGGGCCTGAACTGTGGGGACAGG 36099538 874 Chr1:36099517- + GGGCCTGAACTGTGGGGACAGGG 36099539 875 Chr1:36099518- + GGCCTGAACTGTGGGGACAGGGG 36099540 876 Chr1:36099520- - GTCCCCTGTCCCCACAGTTCAGG 36099542 877 Chr1:36099542- - AATGGGGGAATGGGTAGATGGGG 36099564 878 Chr1:36099543- - GAATGGGGGAATGGGTAGATGGG 36099565 879 Chr1:36099544- - GGAATGGGGGAATGGGTAGATGG 36099566 880 Chr1:36099551- - TCATACTGGAATGGGGGAATGGG 36099573 881 Chr1:36099552- - CTCATACTGGAATGGGGGAATGG 36099574 882 Chr1:36099553- + CATTCCCCCATTCCAGTATGAGG 36099575 883 Chr1:36099557 - TGTACCTCATACTGGAATGGGGG 36099579 884 Chr1:36099558- - GTGTACCTCATACTGGAATGGGG 36099580 885 Chr1:36099559- - CGTGTACCTCATACTGGAATGGG 36099581 886 Chr1:36099560- + CCATTCCAGTATGAGGTACACGG 36099582 887 Chr1:36099560- - CCGTGTACCTCATACTGGAATGG 36099582 888 Chr1:36099561- + CATTCCAGTATGAGGTACACGGG 36099583 889 Chr1:36099565- - CTCTCCCGTGTACCTCATACTGG 36099587 890 Chr1:36099566- + CAGTATGAGGTACACGGGAGAGG 36099588 891 Chr1:36099574- + GGTACACGGGAGAGGAAGAATGG 36099596 892 Chr1:36099575- + GTACACGGGAGAGGAAGAATGGG 36099597 893 Chr1:36099576- + TACACGGGAGAGGAAGAATGGGG 36099598 894 Chr1:36099598- + GCTGCCCCTTCCTGCTCTCATGG 36099620 895 Chr1:36099602- - TCTTCCATGAGAGCAGGAAGGGG 36099624 896 Chr1:36099603- - ATCTTCCATGAGAGCAGGAAGGG 36099625 897 Chr1:36099604- - CATCTTCCATGAGAGCAGGAAGG 36099626 898 Chr1:36099605- + CTTCCTGCTCTCATGGAAGATGG 36099627 899 Chr1:36099606- + TTCCTGCTCTCATGGAAGATGGG 36099628 900 Chr1:36099607- + TCCTGCTCTCATGGAAGATGGGG 36099629 901 Chr1:36099608- - ACCCCATCTTCCATGAGAGCAGG 36099630 902 Chr1:36099612- + CTCTCATGGAAGATGGGGTTTGG 36099634 903 Chr1:36099613- + TCTCATGGAAGATGGGGTTTGGG 36099635 904 Chr1:36099614- + CTCATGGAAGATGGGGTTTGGGG 36099636 905 Chr1:36099615- + TCATGGAAGATGGGGTTTGGGGG 36099637 906 Chr1:36099618- + TGGAAGATGGGGTTTGGGGGTGG 36099640 907 Chr1:36099624- + ATGGGGTTTGGGGGTGGCCCAGG 36099646 908 Chr1:36099625- + TGGGGTTTGGGGGTGGCCCAGGG 36099647 909 Chr1:36099626- + GGGGTTTGGGGGTGGCCCAGGGG 36099648 910 Chr1:36099635- + GGGTGGCCCAGGGGACATCTTGG 36099657 911 Chr1:36099636- + GGTGGCCCAGGGGACATCTTGGG 36099658 912 Chr1:36099637- + GTGGCCCAGGGGACATCTTGGGG 36099659 913 Chr1:36099638- + TGGCCCAGGGGACATCTTGGGGG 36099660 914 Chr1:36099641- - TTGCCCCCAAGATGTCCCCTGGG 36099663 915 Chr1:36099642- - GTTGCCCCCAAGATGTCCCCTGG 36099664 916 Chr1:36099645- + GGGGACATCTTGGGGGCAACAGG 36099667 917 Chr1:36099646- + GGGACATCTTGGGGGCAACAGGG 36099668 918 Chr1:36099660- + GCAACAGGGTGTCCTCCTTAAGG 36099682 919 Chr1:36099661- + CAACAGGGTGTCCTCCTTAAGGG 36099683 920 Chr1:36099672- - GGTGTTAGGAGCCCTTAAGGAGG 36099694 921 Chr1:36099675- - TTGGGTGTTAGGAGCCCTTAAGG 36099697 922 Chr1:36099685- + TCCTAACACCCAACCTACCTAGG 36099707 923 Chr1:36099686- - GCCTAGGTAGGTTGGGTGTTAGG 36099708 924 Chr1:36099689- + AACACCCAACCTACCTAGGCTGG 36099711 925 Chr1:36099690- + ACACCCAACCTACCTAGGCTGGG 36099712 926 Chr1:36099693- - AGGCCCAGCCTAGGTAGGTTGGG 36099715 927 Chr1:36099694- - GAGGCCCAGCCTAGGTAGGTTGG 36099716 928 Chr1:36099698- - GGAGGAGGCCCAGCCTAGGTAGG 36099720 929 Chr1:36099702- - TCATGGAGGAGGCCCAGCCTAGG 36099724 930 Chr1:36099708- + CTGGGCCTCCTCCATGAGCCTGG 36099730 931 Chr1:36099713- - ATCAGCCAGGCTCATGGAGGAGG 36099735 932 Chr1:36099716- - AGAATCAGCCAGGCTCATGGAGG 36099738 933 Chr1:36099719- - GTGAGAATCAGCCAGGCTCATGG 36099741 934 Chr1:36099726- - ATGAGAGGTGAGAATCAGCCAGG 36099748 935 Chr1:36099741- - TCAGGTCATGCAGGGATGAGAGG 36099763 936 Chr1:36099744- + CTCATCCCTGCATGACCTGAAGG 36099766 937 Chr1:36099747- + ATCCCTGCATGACCTGAAGGTGG 36099769 938 Chr1:36099749- - CTCCACCTTCAGGTCATGCAGGG 36099771 939 Chr1:36099750- - ACTCCACCTTCAGGTCATGCAGG 36099772 940 Chr1:36099752- + TGCATGACCTGAAGGTGGAGTGG 36099774 941 Chr1:36099759- - CTGGTGGCCACTCCACCTTCAGG 36099781 942 Chr1:36099760- + CTGAAGGTGGAGTGGCCACCAGG 36099782 943 Chr1:36099763- + AAGGTGGAGTGGCCACCAGGTGG 36099785 944 Chr1:36099775- - GGGCTGCTGGTGCCACCTGGTGG 36099797 945 Chr1:36099778- - GGTGGGCTGCTGGTGCCACCTGG 36099800 946 Chr1:36099788- - CGGGCTCTAAGGTGGGCTGCTGG 36099810 947 Chr1:36099791- + GCAGCCCACCTTAGAGCCCGTGG 36099813 948 Chr1:36099792- + CAGCCCACCTTAGAGCCCGTGGG 36099814 949 Chr1:36099795- - GCTCCCACGGGCTCTAAGGTGGG 36099817 950 Chr1:36099796- - TGCTCCCACGGGCTCTAAGGTGG 36099818 951 Chr1:36099799- - CTCTGCTCCCACGGGCTCTAAGG 36099821 952 Chr1:36099807- - AGGTGGGGCTCTGCTCCCACGGG 36099829 953 Chr1:36099808- - GAGGTGGGGCTCTGCTCCCACGG 36099830 954 Chr1:36099822- - AACTGGGAAGTTGGGAGGTGGGG 36099844 955 Chr1:36099823- - GAACTGGGAAGTTGGGAGGTGGG 36099845 956 Chr1:36099824- - TGAACTGGGAAGTTGGGAGGTGG 36099846 957 Chr1:36099827- - AGATGAACTGGGAAGTTGGGAGG 36099849 958 Chr1:36099830- - GGGAGATGAACTGGGAAGTTGGG 36099852 959 Chr1:36099831- - GGGGAGATGAACTGGGAAGTTGG 36099853 960 Chr1:36099836- + TTCCCAGTTCATCTCCCCCTTGG 36099858 961 Chr1:36099838- - TTCCAAGGGGGAGATGAACTGGG 36099860 962 Chr1:36099839- - CTTCCAAGGGGGAGATGAACTGG 36099861 963 Chr1:36099850- - GCACAGGTGGTCTTCCAAGGGGG 36099872 964 Chr1:36099851- - GGCACAGGTGGTCTTCCAAGGGG 36099873 965 Chr1:36099852- - TGGCACAGGTGGTCTTCCAAGGG 36099874 966 Chr1:36099853- - CTGGCACAGGTGGTCTTCCAAGG 36099875 967 Chr1:36099863- - GTGCAGTTAGCTGGCACAGGTGG 36099885 968 Chr1:36099866- - ACGGTGCAGTTAGCTGGCACAGG 36099888 969 Chr1:36099872- - CTGGAAACGGTGCAGTTAGCTGG 36099894 970 Chr1:36099873- + CAGCTAACTGCACCGTTTCCAGG 36099895 971 Chr1:36099881- + TGCACCGTTTCCAGGCCCTCTGG 36099903 972 Chr1:36099882- + GCACCGTTTCCAGGCCCTCTGGG 36099904 973 Chr1:36099883- + CACCGTTTCCAGGCCCTCTGGGG 36099905 974 Chr1:36099885- - TACCCCAGAGGGCCTGGAAACGG 36099907 975 Chr1:36099890- + TCCAGGCCCTCTGGGGTATTAGG 36099912 976 Chr1:36099891- - TCCTAATACCCCAGAGGGCCTGG 36099913 977 Chr1:36099896- - GTTTTTCCTAATACCCCAGAGGG 36099918 978 Chr1:36099897- - TGTTTTTCCTAATACCCCAGAGG 36099919 979 Chr1:36099904- + GGTATTAGGAAAAACACTGAAGG 36099926 980 Chr1:36099908- + TTAGGAAAAACACTGAAGGTAGG 36099930 981 Chr1:36099916- + AACACTGAAGGTAGGAAAATTGG 36099938 982 Chr1:36099919- + ACTGAAGGTAGGAAAATTGGTGG 36099941 983 Chr1:36099920- + CTGAAGGTAGGAAAATTGGTGGG 36099942 984 Chr1:36099921- + TGAAGGTAGGAAAATTGGTGGGG 36099943 985 Chr1:36099928- + AGGAAAATTGGTGGGGAATGAGG 36099950 986 Chr1:36099936- + TGGTGGGGAATGAGGAGCTGTGG 36099958 987 Chr1:36099939- + TGGGGAATGAGGAGCTGTGGAGG 36099961 988 Chr1:36099940- + GGGGAATGAGGAGCTGTGGAGGG 36099962 989 Chr1:36099949- + GGAGCTGTGGAGGGCGCCTGAGG 36099971 990 Chr1:36099958- + GAGGGCGCCTGAGGATCTGATGG 36099980 991 Chr1:36099965- - CTGAGAGCCATCAGATCCTCAGG 36099987 992 Chr1:36099966- + CTGAGGATCTGATGGCTCTCAGG 36099988 993 Chr1:36099967- + TGAGGATCTGATGGCTCTCAGGG 36099989 994 Chr1:36099970- + GGATCTGATGGCTCTCAGGGAGG 36099992 995 Chr1:36099974- + CTGATGGCTCTCAGGGAGGCAGG 36099996 996 Chr1:36099975- + TGATGGCTCTCAGGGAGGCAGGG 36099997 997 Chr1:36099976- + GATGGCTCTCAGGGAGGCAGGGG 36099998 998 Chr1:36099982- + TCTCAGGGAGGCAGGGGATTTGG 36100004 999 Chr1:36099983- + CTCAGGGAGGCAGGGGATTTGGG 36100005 1000 Chr1:36099984- + TCAGGGAGGCAGGGGATTTGGGG 36100006 1001 Chr1:36099985- + CAGGGAGGCAGGGGATTTGGGGG 36100007 1002 Chr1:36099989- + GAGGCAGGGGATTTGGGGGCTGG 36100011 1003 Chr1:36099990- + AGGCAGGGGATTTGGGGGCTGGG 36100012 1004 Chr1:36100002- + TGGGGGCTGGGAGCGATTTGAGG 36100024 1005 Chr1:36100010- + GGGAGCGATTTGAGGCACTGTGG 36100032 1006 Chr1:36100011- + GGAGCGATTTGAGGCACTGTGGG 36100033 1007 Chr1:36100012- + GAGCGATTTGAGGCACTGTGGGG 36100034 1008 Chr1:36100017- + ATTTGAGGCACTGTGGGGTGAGG 36100039 1009 Chr1:36100020- + TGAGGCACTGTGGGGTGAGGAGG 36100042 1010 Chr1:36100032- + GGGTGAGGAGGCTCTCACCCAGG 36100054 1011 Chr1:36100038- + GGAGGCTCTCACCCAGGTACTGG 36100060 1012 Chr1:36100049- - GAGGGCAAAGGCCAGTACCTGGG 36100071 1013 Chr1:36100050- - TGAGGGCAAAGGCCAGTACCTGG 36100072 1014 Chr1:36100053- + GGTACTGGCCTTTGCCCTCACGG 36100075 1015 Chr1:36100057- + CTGGCCTTTGCCCTCACGGAAGG 36100079 1016 Chr1:36100058- + TGGCCTTTGCCCTCACGGAAGGG 36100080 1017 Chr1:36100061- + CCTTTGCCCTCACGGAAGGGCGG 36100083 1018 Chr1:36100061- - CCGCCCTTCCGTGAGGGCAAAGG 36100083 1019 Chr1:36100067- - GTGGGACCGCCCTTCCGTGAGGG 36100089 1020 Chr1:36100068- - TGTGGGACCGCCCTTCCGTGAGG 36100090 1021 Chr1:36100070- + TCACGGAAGGGCGGTCCCACAGG 36100092 1022 Chr1:36100084- + TCCCACAGGTCCTTTCTGCATGG 36100106 1023 Chr1:36100085- + CCCACAGGTCCTTTCTGCATGGG 36100107 1024 Chr1:36100085- - CCCATGCAGAAAGGACCTGTGGG 36100107 1025 Chr1:36100086- - GCCCATGCAGAAAGGACCTGTGG 36100108 1026 Chr1:36100089- + CAGGTCCTTTCTGCATGGGCTGG 36100111 1027 Chr1:36100094- - TACATCCAGCCCATGCAGAAAGG 36100116 1028 Chr1:36100103- + ATGGGCTGGATGTACTTCACTGG 6100125 1029 Chr1:36100104- + TGGGCTGGATGTACTTCACTGGG 36100126 1030 Chr1:36100105- + GGGCTGGATGTACTTCACTGGGG 36100127 1031 Chr1:36100126- + GGCATAGCCCGCCGCCCCACCGG 36100148 1032 Chr1:36100133- - GGCGGGGCCGGTGGGGCGGCGGG 36100155 1033 Chr1:36100134- - TGGCGGGGCCGGTGGGGCGGCGG 36100156 1034 Chr1:36100137- - TGGTGGCGGGGCCGGTGGGGCGG 36100159 1035 Chr1:36100140- - CTCTGGTGGCGGGGCCGGTGGGG 36100162 1036 Chr1:36100141- + CCCACCGGCCCCGCCACCAGAGG 36100163 1037 Chr1:36100141- - CCTCTGGTGGCGGGGCCGGTGGG 36100163 1038 Chr1:36100142- - TCCTCTGGTGGCGGGGCCGGTGG 36100164 1039 Chr1:36100145- - GCGTCCTCTGGTGGCGGGGCCGG 36100167 1040 Chr1:36100149- - GCGGGCGTCCTCTGGTGGCGGGG 36100171

TABLE-US-00007 TABLE 4 Target sequences for COL8A2 with Gln455Lys mutation SEQ ID Target No Target location strand Target sequence 1064 Chr1:36098302- + CCCCTCAGGCCAGGCTTCCCAGG 36098324 1065 Chr1:36098302- - CCTGGGAAGCCTGGCCTGAGGGG 36098324 1066 Chr1:36098303- + CCCTCAGGCCAGGTTGCCCAGGG 36098325 1067 Chr1:36098303- - CCCTGGGAAGCCTGGCCTGAGGG 36098325 1068 Chr1:36098304- - TCCCTGGGAAGCCTGGCCTGAGG 36098326 1069 Chr1:36098311- - TTGGGGCTCCCTGGGAAGCCTGG 36098333

TABLE-US-00008 TABLE 5 Target sequences for COL8A2 with Gln455Val mutation SEQ ID Target No Target location strand Target sequence 1070 Chr1:36098302- + CCCCTCAGGCCAGGCACCCCAGG 36098324 1071 Chr1:36098302- - CCTGGGGTGCCTGGCCTGAGGGG 36098324 1072 Chr1:36098303- + CCCTCAGGCCAGGCACCCCAGGG 36098325 1073 Chr1:36098303- - CCCTGGGGTGCCTGGCCTGAGGG 36098325 1074 Chr1:36098304- - TCCCTGGGGTGCCTGGCCTGAGG 36098326 1075 Chr1:36098311- - TTGGGGCTCCCTGGGGTGCCTGG 36098333

TABLE-US-00009 TABLE 6 Target sequences for COL8A2 with Leu450Trp mutation SEQ ID Target No Target location strand Target sequence 1076 Chr1:36098311- - TGGGGGCTCCCTGGGCAGCCTGG 36098333 1077 Chr1:36098319- - AAGGTGACTGGGGGCTCCCTGGG 36098341 1078 Chr1:36098320- - AAAGGTGACTGGGGGCTCCCTGG 36098342 1079 Chr1:36098328- - TGGGGCAGAAAGGTGACTGGGGG 36098350 1080 Chr1:36098329- - CTGGGGCAGAAAGGTGACTGGGG 36098351 1081 Chr1:36098330- + CCCAGTCACCTTTCTGCCCCAGG 36098352 1082 Chr1:36098330- - CCTGGGGCAGAAAGGTGACTGGG 36098352 1083 Chr1:36098331- + CCAGTCACCTTTCTGCCCCAGGG 36098353 1084 Chr1:36098331- - CCCTGGGGCAGAAAGGTGACTGG 36098353