DICARBOXYLIC ACID SYNTHESIS-RELATED ENZYME, AND METHOD FOR PRODUCING DICARBOXYLIC ACID USING SAME

20220049231 · 2022-02-17

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention elates to a dicarboxylic acid synthesis-related enzyme, a gene coding for same, and a method for producing dicarboxylic acid using same. The gene or enzyme encoded by the gene of the present invention can be used in bio-enzymatic production, instead of the existing chemical production, of dicarboxylic acid, and is thus expected to have high industrial utility.

Claims

1. A protein involved in the biosynthesis of a dicarboxylic acid (DCA) comprising one or more selected from a lipase (LIP1), cytochrome P450 52B1 (CYP52B1), an NADPH-cytochrome P450 reductase (NCP1), a long-chain alcohol oxidase (FAO1), and an aldehyde dehydrogenase (ALD1).

2. The protein of claim 1, wherein the proteins are derived from a Candida tropicalis strain.

3. The protein of claim 1, wherein the dicarboxylic acid is a C6-C20 dicarboxylic acid.

4. The protein of claim 1, wherein the lipase (LIP1) is expressed by a gene set forth in SEQ ID NO: 1; the cytochrome P450 52B1 (CYP52B1) is expressed by a gene set forth in SEQ ID NO: 2; the NADPH-cytochrome P450 reductase (NCP1) is expressed by a gene set forth in SEQ ID NO: 3; the long-chain alcohol oxidase (FAO1) is expressed by a gene set forth in SEQ ID NO: 4; and the aldehyde dehydrogenase (ALD1) is expressed by a gene set forth in SEQ ID NO: 5.

5. A composition for biosynthesis of a dicarboxylic acid comprising a recombinant vector comprising one or more genes selected from the group consisting of a gene set forth in SEQ ID NO: 1; a gene set forth in SEQ ID NO: 2; a gene set forth in SEQ ID NO: 3; a gene set forth in SEQ ID NO: 4; and a gene set forth in SEQ ID NO: 5.

6. A microorganism having an ability to produce a dicarboxylic acid (DCA), wherein the microorganism is transformed with the composition defined in claim 5.

7. The microorganism of claim 6, wherein the microorganism is a Candida tropicalis strain whose β-oxidation pathway is blocked.

8. A method for producing a dicarboxylic acid (DCA), the method comprising: incubating the protein defined in claim 1 with a substrate.

9. The method of claim 8, wherein the substrate is a fatty acid methyl ester (FAME).

10. The method of claim 9, wherein the fatty acid methyl ester substrate comprises one or more selected from C.sub.6-C.sub.20 fatty acid methyl esters.

11. The method of claim 8, which comprises: (1) enzymatically reacting the lipase (LIP1) with a C.sub.6-C.sub.20 fatty acid methyl ester; (2) reacting the product of the step (1) with the cytochrome P450 52B1 (CYP52B1) and the NADPH-cytochrome P450 reductase (NCP1); (3) enzymatically reacting the product of the step (2) with the long-chain alcohol oxidase (FAO1); and (4) enzymatically reacting the product of the step (3) with the aldehyde dehydrogenase (ALD1).

12. A method for producing a dicarboxylic acid (DCA), the method comprising: incubating the microorganism defined in claim 6 with substrate in a medium.

13. The method of claim 12, wherein the microorganism is a Candida tropicalis strain whose β-oxidation pathway is blocked.

14. The method of claim 12, wherein the substrate is a fatty acid methyl ester (FAME).

15. The method of claim 14, wherein the fatty acid methyl ester comprises one or more selected from C.sub.6-C.sub.20 fatty acid methyl esters.

Description

DESCRIPTION OF DRAWINGS

[0034] FIG. 1 is a schematic diagram showing a biosynthesis pathway for sebacic acid, which is one of the dicarboxylic acids, and genes associated with the biosynthesis pathway.

[0035] FIG. 2 shows the results of GC/MS analysis of in vitro reaction products of a Lip1p enzyme.

[0036] FIG. 3 shows the results of GC/MS analysis of in vitro reaction products of Cyp52B1p and Ncp1p enzymes.

[0037] FIG. 4 shows the results of GC/MS analysis of in vitro reaction products of Fao1p and Ald1p enzymes.

BEST MODE

[0038] Hereinafter, the constitution and the effects of the present invention will be described in further detail with reference to embodiments thereof. However, it should be understood that the embodiments described herein are merely provided for exemplary illustration of the present invention, and are not intended to limit the scope of the present invention.

[Example 1] Development of DAME-Tolerant Strain Using Evolutionary Engineering Method

[0039] To develop a strain having tolerance to DAME, which is a substrate having cytotoxicity, a C. tropicalis MYA_3404 strain was incubated in a YNB medium (10 g/L of a yeast extract and 20 g/L of peptone) to which DAME was added at a concentration of 10 g/L. In this case, it was confirmed that the concentration of DAME in the medium was maintained to be approximately 0.45 g/L (maximal solubility) due to the low solubility of the DAME substrate (confirmed through the results of internal experiments). The growth curve of the inoculated strain was determined by measuring an absorbance value at a wavelength of 600 nm.

[0040] The absorbance of the medium in which the strain was inoculated was observed in real time, and the strain was then sub-cultured in a fresh medium until the growth of the strain reached a mid-exponential phase. A specific growth rate of the strain was calculated from the measured absorbance value, and strains having phases where a specific growth rate was greatly changed were determined to be E1 (170 generation time), E2 (470 generation time), E3 (650 generation time), E4 (700 generation time), and E5 (720 generation time), respectively. Also, the E5 strain obtained by the method as described above was sub-cultured in a YNB medium (10 g/L of a yeast extract and 20 g/L of peptone) supplemented with 20 g/L of glucose as a non-toxic carbon source, and then re-incubated in a DAME substrate to screen a strain whose tolerance to DAME was maintained even after replacing the carbon source, which was named “ES5.”

[Example 2] Transcriptome Analysis of DAME-Tolerant Mutant Strain (ES5)

[0041] To check a change of a transcriptome in media with and without DAME, the transcriptomes of the ES5 strain grown in a medium supplemented with DAME and the ES5 strain grown in a DAME-free medium were analyzed.

[0042] The ES5 strains were incubated in a DAME-free YNB medium and a YNB medium supplemented with 10 g/L of DAME at 30° C. for 24 hours. The incubated cells were collected, and washed with water. Thereafter, the collected cells were used as a sample for whole RNA extraction. The RNA extraction was performed using an RNeasy Mini Kit (Qiagen, Hilden, Germany), and the concentration and purity of the extracted RNA were measured using NanoDrop (Thermo Scientific, Wilmington, Del., USA) and Agilent Bioanalyzer 2100 (Santa Clara, Ca, USA), respectively.

[0043] The transcriptome of the mutant ES5 strain was analyzed, and compared with that of the parent strain. As a result, it was confirmed that a total of 453 genes were upregulated in the ES5 strain, compared to the parent strain, and 147 genes were downregulated in the ES5 strain, compared to the parent strain. The details of the number and clusters of the genes are specified in Table 1. The five genes (LIP1, CYP52B1, NCP1, FAO1, and ALD1), which were expected to be associated with the metabolism of sebacic acid, which was one of the dicarboxylic acids, among the 453 genes confirmed to be upregulated through the transcriptome analysis, were selected (FIG. 1).

TABLE-US-00001 TABLE 1 Results of comparison/analysis of transcriptomes of parent strain and DAME-tolerant mutant strain (ESS) No of No of Upregulated Downregulated No Pathway Genes Genes 1 Alanine, aspartate, and glutamate 12 metabolisms 2 alpha-Linolenic acid metabolisms 9 3 Arginine and proline metabolisms 12 4 Arginine biosynthesis 9 5 Ascorbate and aldarate metabolisms 6 6 Beta-Alanine metabolism 15 6 7 Biosynthesis of antibiotics 51 8 Biosynthesis of unsaturated fatty 12 acids 9 Biotin metabolism 6 10 Butanoate metabolism 9 6 11 Cell cycle - yeast 12 12 Cysteine and methionine 12 metabolisms 13 DNA replication 15 14 Fatty acid degradation 6 15 Fatty acid metabolism 18 6 16 Galactose metabolism 6 17 Glycerolipid metabolism 12 18 Histidine metabolism 12 19 Homologous recombination 9 20 Lysine biosynthesis 9 21 Lysine degradation 12 22 Meiosis - yeast 15 23 Metabolic pathways 120 27 24 Mismatch repair 6 25 Monobactam biosynthesis 6 26 Nucleotide excision repair 6 27 Pantothenate and CoA biosynthesis 12 28 Pentose and glucuronate 6 interconversions 29 Peroxisome 27 6 30 Pyruvate metabolism 18 31 Starch and sucrose metabolisms 9 32 Steroid biosynthesis 9 33 Tryptophan metabolism 9 34 Ubiquinone and other terpenoid- 9 quinone biosynthesis 35 Valine, leucine and isoleucine 12 biosynthesis 36 Valine, leucine and isoleucine 15 6 degradation Total 453 147

[Example 3] Attainment of SA Biosynthesis Pathway-Related Genes Using Cloning Technique

[0044] Based on the results of transcriptome analysis in Example 2, the five genes (LIP1, CYP52B1, NCP1, FAO1, and ALD1) expected to be associated with the sebacic acid biosynthesis pathway were selected, and LIP1 (Uniprot. ID: C5MD87), CYP52B1 (Uniprot. ID: C5MAM3), NCP1 (Uniprot. ID: C5M346), NADPH-cytochrome P450 reductase, FAO1 (Uniprot. ID: Q6QIR6), and ALD1 (Uniprot. ID: C5MEH8) genes were obtained by cloning in order to check the activities of the enzymes (a lipase, cytochrome P450 52B1, a long-chain alcohol oxidase, and an aldehyde dehydrogenase) derived from the five genes. The CYP450 gene is known to have two subunits, CYP1 and NCP1.

[0045] The C. tropicalis MYA_3404 strain was incubated at 30° C. for 48 hours in a YPD medium (10 g/L of a yeast extract, 20 g/L of peptone, and 20 g/L of glucose), and template DNA used for cloning was then extracted using a yeast DNA isolation kit (Epicentre, Madison, Wis., USA). A candidate gene was amplified using a Q5 High-Fidelity Master mix (BioLabs, Ipswich, Mass., USA), and the primers used to amplify the candidate gene are as listed in Table 2 (primers 1 to 10; SEQ ID NOs: 6 to 15). Thereafter, PCR was performed in all the experiments for genetic recombination using the same enzymes. A base sequence of a gene encoding a histidine residue was added to enhance the affinity of a HisTrap column. The remaining PCR products other than the CYP450 gene, and a pAUR123 vector was doubly digested with XhoI and XbaI restriction enzymes, and the final DNA fragments were ligated into the same restriction enzyme sites using a T4 DNA ligase (New England Biolabs). As two subunits encoding the CYP450 gene, CYP52B1 (Uniprot. ID: C5MAM3) and NCP1 (Uniprot. ID: C5M346) genes were separately digested with SmaI/SalI, SalI/XhoI, and then sequentially ligated. Thereafter, all four ligated plasmids (Plasmids 1 to 4) were independently transformed into E. coli DH5a (Novagen, Cambridge, Mass., USA). To overexpress the proteins encoded by the genes obtained by the above-described process, the four extracted plasmids (Plasmids 1 to 4) were re-transformed into a C. tropicalis strain. The transformation into yeast was performed according to a LiAc/SS carrier DNA/PEG method using a yeast transformation kit (MP Biomedicals, Solon, Ohio, USA). The proteins were spontaneously expressed without any separate inducer by an auto-induction system of the pAUR123 vector serving as the vector used for gene introduction.

TABLE-US-00002 TABLE 2 List of Primeres used to clone SA biosynthesis-related genes custom-character Primers 5′-3′ sequence Seabcic acid pathway related genes 6 LIP1_F AAACTCGAGATGAGATTTCTTGTATTCATTACAAT TATTACATGGTTGAAAAC (Xhol) 7 LIP1_R AAATCTAGAGTGGTGGTGGTGGTGGTGGACAAGAT AGGTACTATTCTTCACAGTGAAGCTT (Xbal) 8 CYP1_F AAACCCGGGATGATCGAACAAGTTGTTGAATACTG GTACGTG (Xmal) 9 CYP1_R AAAGTGACGTGGTGGTGGTGGTGGTGATCGATCTT GACAATAGTTCCGTCTTGTAAAGACA (Sall) 10 NCP1_F AAAGTCGACATGGCATTAGATAAGTTAGATTTATA TGTTATTATAACATTGGTG (Sall) 11 NCP2_R AAACTCGAGGTGGTGGTGGTGGTGGTGCCAGACAT CTTCTTGGTATCTATTTTGAACTTTCC (Xhol) 12 FAO1_F AAACTCGAGATGGCTCCATTTTTGCCCGACCAGGT (Xhol) 13 FAO1_R AAATCTAGAGTGGTGGTGGTGGTGGTGCAACTTGG CCTTGGTCTTCAAGGAGTCT (Xbal) 14 ALD1_F AAACTCGAGATGACACCACCTTCTAAAATTGAGGA CAGTTCA (Xhol) 15 ALD1_R AAATCTAGAGTGGTGGTGGTGGTGGTGTTGTTTAT TGGTTATGAATTCAGCAAGTAAACTAAAGACAC (Xbal)

TABLE-US-00003 TABLE 3 Name  text missing or illegible when filed Descriptiontext missing or illegible when filed pET21a text missing or illegible when filed Escherichia coli expression vector, Amp.sup.R text missing or illegible when filed pAUR123 text missing or illegible when filed Low copy number yeast expression vector, AurA.sup.R for yeast, and Amp.sup.R for E. coli text missing or illegible when filed pRS420 text missing or illegible when filed High copy number yeast expression vector, G418R for yeast, and Amp.sup.R for E. coli text missing or illegible when filed plasmid 1 text missing or illegible when filed pAUR123::LIP1 text missing or illegible when filed plasmid 2 text missing or illegible when filed pAUR123::CYP52B1::NCP1 text missing or illegible when filed plasmid 3 text missing or illegible when filed pAUR123:FAO1 text missing or illegible when filed plasmid 4 text missing or illegible when filed pAUR123:ALD1 text missing or illegible when filed text missing or illegible when filed indicates data missing or illegible when filed

[Example 4] Overexpression and Purification of Sebacic Acid Biosynthesis Pathway-Related Enzymes

[0046] To overexpress the sebacic acid biosynthesis-related enzymes in the recombinant strain obtained in Example 3, the recombinant strain was incubated at 30° C. for 24 hours in a YPD medium (10 g/L of a yeast extract, 20 g/L of peptone, and 20 g/L of glucose) supplemented with 0.2 mg/L of Aureobasidin A. To isolate the expressed proteins, the cells were disrupted with ultrasonic waves, and centrifuged. Then, the supernatant was purified using a HisTrap column (GE Healthcare, Piscataway, USA). The purified proteins were concentrated using an Amicon Ultra Centrifugal filter (Millipore, Billerica, Mass., USA). The molecular weights of the expressed enzymes were confirmed to be 50.6 kDa (for Lip1p), 59.3 kDa (for Cyp1) and 76.7 kDa (for Ncp1) (Cyp450p), 77.8 kDa (for Fao1p), and 61.3 kDa (for Ald1p), as measured by SDS-PAGE. The concentrations of the proteins were measured using a bicinchoninic acid (BCA) protein assay kit (Pierce, Rockford, Ill., USA).

[Example 5] Confirmation of In Vitro Activities of Sebacic Acid Biosynthesis Pathway-Related Enzymes

[0047] To check the activities of the Lip1p, Cyp52B1p, Ncp1, Fao1p, and Ald1p obtained in Example 4, an in vitro enzyme assay was performed using a standard material corresponding to each of the substrates.

[0048] To check the activity of Lip1p, 50 μL of a 100 mM DAME substrate, 250 μL of an enzyme (enzyme concentration: 5 mg/mL), and 200 μL of 20 mM Tris-HCl were reacted, that is, a total of 500 μL of the reaction sample was reacted at 30° C. for an hour. DAME and the inactivated Lip1p enzyme were reacted, and the resulting reaction product was used as the control. As shown in FIG. 2 below, the GC/MS results showed that a peak of DAME decreased while a new peak was generated in the reaction product obtained by reacting the Lip1p enzyme with the substrate. Then, the mass spectrum of this peak was compared with that of the standard material. As a result, it was confirmed that the newly generated peak corresponded to DA.

[0049] To check the activities of Cyp52B1p and Ncp1p using the same method as described above, 50 μL of a 100 mM DA substrate, 100 μL of an enzyme (enzyme concentration: 2.99 mg/ml), and 50 μL of 20 mM Tris-HCl were reacted, that is, a total of 200 μL of the reaction sample was reacted at 30° C. for an hour. DA and the inactivated Cyp52B1p and Ncp1p enzymes were reacted, and the resulting reaction product was used as the control. As shown in FIG. 3 below, the GC/MS results showed that a peak of DA decreased while a new peak was generated in the reaction product obtained by reacting the Cyp52B1p and Ncp1p enzymes with the substrate. Then, the mass spectrum of this peak was confirmed. As a result, it was confirmed that the newly generated peak corresponded to 10-hydroxydecanoic acid (FIG. 3).

[0050] Because the standard material (10-oxodecanoic acid) expected to be the reaction product was not purchased, the activity of the Fao1p enzyme was determined as follows. That is, 10 μL of 100 mM 10-HAD as the substrate, 100 μL of Fao1p (enzyme concentration: 2 0.7 mg/ml), and 100 μL of Ald1p (enzyme concentration: 2.0 mg/ml) as the last biosynthesis-related enzyme were sequentially reacted, and the reaction product was then analyzed. As a result, it was confirmed that SA was produced (FIG. 4).

[0051] From the above-described results, the activities of the enzymes associated with the biosynthesis of sebacic acid, which is one of the dicarboxylic acids, were determined, and a novel biosynthesis pathway for dicarboxylic acid could be predicted based on these results.