NANOVESICLES DERIVED FROM BACTERIA OF GENUS RHODOCOCCUS, AND USE THEREOF

20220047648 · 2022-02-17

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a method of diagnosing or treating a disease in a subject using the vesicles derived from bacteria of the genus Rhodococcus. The vesicles are significantly decreased in a clinical sample obtained from a patient with lung cancer, pancreatic cancer, bile duct cancer, breast cancer, bladder cancer, lymphoma, diabetes, stroke, myocardial infarction, asthma, COPD, and dementia, compared with a normal individual, and administration of the vesicles to the patient inhibits the secretion of inflammation mediators caused by pathogenic vesicles such as E. coli-derived vesicles, and inhibits cranial nerve cell damage caused by stress hormones, therefore the vesicles are used in a method of diagnosing lung cancer, pancreatic cancer, bile duct cancer, breast cancer, bladder cancer, lymphoma, diabetes, stroke, myocardial infarction, asthma, COPD, and/or dementia, and a method of alleviating or treating a malignant disease, diabetes, stroke, a cardiovascular disease, an inflammatory pulmonary disease, and/or a cranial nerve disease.

Claims

1. A method of diagnosing one or more diseases selected from the group consisting of lung cancer, pancreatic cancer, bile duct cancer, breast cancer, bladder cancer, lymphoma, diabetes, stroke, myocardial infarction, asthma, chronic obstructive pulmonary disease (COPD), and dementia, the method comprising the following steps: (a) extracting DNAs from vesicles isolated from samples of a normal individual and a subject; (b) performing PCR (Polymerase Chain Reaction) on the extracted DNA using a pair of primers prepared based on a gene sequence present in 16S rDNA to obtain each PCR product; and (c) determining a case in which a content of vesicles derived from bacteria of the genus Rhodococcus is lower than that of the normal individual sample, as one or more diseases selected from the group consisting of lung cancer, pancreatic cancer, bile duct cancer, breast cancer, bladder cancer, lymphoma, diabetes, stroke, myocardial infarction, asthma, chronic obstructive pulmonary disease (COPD), and dementia, through quantitative analysis of the PCR product.

2. The method of claim 1, wherein the sample in Step (a) is blood or urine.

3. A method of alleviating or treating one or more diseases selected from the group consisting of a malignant disease, diabetes, stroke, a cardiovascular disease, an inflammatory pulmonary disease, and a cranial nerve disease, the method comprising administering to a subject in need thereof a composition comprising an effective amount of vesicles derived from bacteria of the genus Rhodococcus.

4. The method of claim 3, wherein the malignant disease is one or more selected from the group consisting of lung cancer, pancreatic cancer, bile duct cancer, breast cancer, bladder cancer, and lymphoma.

5. The method of claim 3, wherein the cardiovascular disease is one or more selected from the group consisting of myocardial infarction, hypertension, ischemic heart disease, coronary artery disease, angina, atherosclerosis (arteriosclerosis), and arrhythmia.

6. The method of claim 3, wherein the inflammatory pulmonary disease is one or more selected from the group consisting of asthma, chronic obstructive pulmonary disease (COPD), acute lung injury, empyema, lung abscesses, pneumonia, pulmonary tuberculosis, and bronchitis.

7. The method of claim 3, wherein the cranial nerve disease is one or more selected from the group consisting of depression, obsessive-compulsive disorder, schizophrenia, dementia, Alzheimer's disease, epilepsy, autism, and Parkinson's disease.

8. The method of claim 3, wherein the vesicles have an average diameter of 10 to 200 nm.

9. The method of claim 3, wherein the vesicles are secreted naturally or artificially from bacteria of the genus Rhodococcus.

10. The method of claim 3, wherein the vesicles derived from bacteria of the genus Rhodococcus are secreted from Rhodococcus equi.

11. The method of claim 3, wherein the composition is a pharmaceutical composition, a food composition, or an inhalable composition.

12.-15. (canceled)

16. A cosmetic composition for preventing or alleviating an inflammatory skin disease, comprising vesicles derived from bacteria of the genus Rhodococcus as an active ingredient.

17. The cosmetic composition of claim 16, wherein the inflammatory skin disease is one or more selected from the group consisting of atopic dermatitis, acne, hair loss, and psoriasis.

18.-22. (canceled)

Description

DESCRIPTION OF DRAWINGS

[0041] FIG. 1A is a series of photographs capturing distribution patterns of bacteria and bacteria-derived vesicles (EV) by time after the bacteria and the vesicles derived from bacteria were orally administered to mice, and FIG. 1B is a result of evaluating the in vivo distribution patterns of the bacteria and the vesicles by harvesting blood, kidneys, liver, and various organs at 12 hours after orally administering the bacteria and the vesicles.

[0042] FIGS. 2A and 2B are results obtained by comparing the distribution of vesicles derived from bacteria of the genus Rhodococcus after metagenomic analysis is performed on vesicles derived from bacteria present in a lung cancer patient and a normal individual, in which FIG. 2A is the result using a blood sample, and FIG. 2B is the result using a urine sample.

[0043] FIG. 3 is a result of comparing the distributions of vesicles derived from bacteria of the genus Rhodococcus after metagenomic analysis of bacteria-derived vesicles present in the blood of pancreatic cancer patients and a normal individual.

[0044] FIG. 4 is a result of comparing the distributions of vesicles derived from bacteria of the genus Rhodococcus after metagenomic analysis of bacteria-derived vesicles present in the blood of bile duct cancer patients and a normal individual.

[0045] FIG. 5 is a result of comparing the distributions of vesicles derived from bacteria of the genus Rhodococcus after metagenomic analysis of bacteria-derived vesicles present in the blood of breast cancer patients and a normal individual.

[0046] FIG. 6 is a result of comparing the distributions of vesicles derived from bacteria of the genus Rhodococcus after metagenomic analysis of bacteria-derived vesicles present in the blood of bladder cancer patients and a normal individual.

[0047] FIG. 7 is a result of comparing the distributions of vesicles derived from bacteria of the genus Rhodococcus after metagenomic analysis of bacteria-derived vesicles present in the blood of lymphoma patients and a normal individual.

[0048] FIG. 8 is a result of comparing the distributions of vesicles derived from bacteria of the genus Rhodococcus after metagenomic analysis of bacteria-derived vesicles present in the blood of diabetes patients and a normal individual.

[0049] FIG. 9 is a result of comparing the distributions of vesicles derived from bacteria of the genus Rhodococcus after metagenomic analysis of bacteria-derived vesicles present in the blood of stroke patients and a normal individual.

[0050] FIG. 10 is a result of comparing the distributions of vesicles derived from bacteria of the genus Rhodococcus after metagenomic analysis of bacteria-derived vesicles present in the blood of myocardial infarction patients and a normal individual.

[0051] FIG. 11 is a result of comparing the distributions of vesicles derived from bacteria of the genus Rhodococcus after metagenomic analysis of bacteria-derived vesicles present in the blood of asthma patients and a normal individual.

[0052] FIG. 12 is a result of comparing the distributions of vesicles derived from bacteria of the genus Rhodococcus after metagenomic analysis of bacteria-derived vesicles present in the blood of COPD patients and a normal individual.

[0053] FIG. 13 is a result of comparing the distributions of vesicles derived from bacteria of the genus Rhodococcus after metagenomic analysis of bacteria-derived vesicles present in the blood of dementia patients and a normal individual.

[0054] FIGS. 14A and 14B are results obtained by evaluating the influence on inflammation mediator secretion by E. coli vesicles by pretreating vesicles derived from Rhodococcus bacteria before treatment of E. coli vesicles (E. coli EV), which are pathogenic vesicles, to evaluate anti-inflammatory and immunoregulatory effects of Rhodococcus equi-derived vesicles, in which FIG. 14A is the result of comparing the degree of IL-6 secretion, and FIG. 14B is result of comparing the degree of TNF-α secretion.

[0055] FIG. 15 shows the result of evaluating the influence on brain-derived neurotrophic factor (BDNF) expression by nerve cells by simultaneously treating nerve cells, which have been treated with an adrenocortical hormone (GC), which is a stress hormone, with Rhodococcus equi-derived vesicles to evaluate a nerve cell protective effect of the Rhodococcus equi-derived vesicles (EV: Rhodococcus equi extracellular vesicle).

[Best Modes]

[0056] The present invention relates to vesicles derived from bacteria of the genus Rhodococcus and a use thereof.

[0057] The inventors confirmed that a content of vesicles derived from bacteria of the genus Rhodococcus are significantly reduced in samples of patients with lung cancer, pancreatic cancer, bile duct cancer, breast cancer, bladder cancer, lymphoma, diabetes, stroke, myocardial infarction, asthma, COPD, and dementia, compared with a normal individual, through metagenomic analysis. In addition, when macrophages were treated with vesicles isolated from Rhodococcus equi belonging to the genus Rhodococcus, it was confirmed that the secretion of IL-6 and TNF-alpha, which are inflammation mediators, caused by pathogenic vesicles was remarkably inhibited, and the BDNF expression of nerve cells, which is inhibited by a stress hormone, was significantly recovered by the vesicles, and based on this, the present invention was completed.

[0058] Thus, the present invention provides a method of providing information for diagnosing lung cancer, pancreatic cancer, bile duct cancer, breast cancer, bladder cancer, lymphoma, diabetes, stroke, myocardial infarction, asthma, COPD, or dementia, the method comprising the following steps:

[0059] (a) extracting DNAs from vesicles isolated from samples of a normal individual and a subject;

[0060] (b) performing PCR on the extracted DNA using a pair of primers prepared based on a gene sequence present in 16S rDNA to obtain each PCR product; and

[0061] (c) classifying a case in which a content of vesicles derived from bacteria of the genus Rhodococcus is lower than that of the normal individual sample, as lung cancer, pancreatic cancer, bile duct cancer, breast cancer, bladder cancer, lymphoma, diabetes, stroke, myocardial infarction, asthma, COPD, or dementia, through quantitative analysis of the PCR product.

[0062] The term “diagnosis” as used herein refers to determination of a condition of a disease of a patient over all aspects, in a broad sense. The contents of the determination are the disease entity, the etiology, the pathogenesis, the severity, the detailed aspects of a disease, the presence and absence of complications, the prognosis, and the like. The diagnosis in the present invention means determining whether lung cancer, pancreatic cancer, bile duct cancer, breast cancer, bladder cancer, lymphoma, diabetes, stroke, myocardial infarction, asthma, COPD, and/or dementia occur, the level of the disease, and the like.

[0063] The term “nanovesicle” or “vesicle” as used herein refers to a structure consisting of a nano-sized membrane secreted from various bacteria. Vesicles derived from gram-negative bacteria or outer membrane vesicles (OMVs) have endotoxins (lipopolysaccharides), toxic protein, and bacterial DNA and RNA, and vesicles derived from gram-positive bacteria also have peptidoglycan and lipoteichoic acid which are cell wall components of bacteria in addition to proteins and nucleic acids. In the present invention, nanovesicles or vesicles are secreted naturally from bacteria of the genus Rhodococcus or produced artificially, are in the form of a sphere, and have an average diameter of 10 to 200 nm.

[0064] The term “metagenome” as used herein also refers to a microbiome, and refers to a total of genomes including all viruses, bacteria, fungi, and the like in an isolated region such as soil and an animal's intestines, and is typically used as a concept of genomes explaining identification of a large number of microorganisms at one time by using a sequence analyzer in order to analyze uncultivated microorganisms. In particular, the metagenome does not refer to a genome of one species, but refers to a kind of mixed genome as a genome of all species of one environmental unit. The metagenome is, when one species is defined in the development process of omics biology, a term derived from the viewpoint of making a complete species is made by various species interacting with each other as well as one kind of functionally existing species. Technically, the metagenome is an object of a technique to identify all species in one environment and investigate interactions and metabolism by analyzing all DNAs and RNAs regardless of species using a rapid sequence analysis method.

[0065] In the present invention, the sample derived from patients is not limited, but may be blood, urine, stool, saliva or nasal mucosa, and preferably blood or urine.

[0066] In the present invention, the primer pair in Step (b) may be primers of SEQ ID Nos. 1 and 2, but is not limited thereto.

[0067] Another aspect of the present invention provides a composition for preventing or treating one or more diseases selected from the group consisting of a malignant disease, diabetes, stroke, a cardiovascular disease, an inflammatory pulmonary disease, and a cranial nerve disease, comprising vesicles derived from bacteria of the genus Rhodococcus as an active ingredient.

[0068] The composition includes a pharmaceutical composition and an inhalant composition.

[0069] Further, the present invention provides a method of preventing or treating one or more diseases selected from the group consisting of a malignant disease, diabetes, stroke, a cardiovascular disease, an inflammatory pulmonary disease, and a cranial nerve disease, the method comprising a step of administering a pharmaceutical composition comprising vesicles derived from bacteria of the genus Rhodococcus as an active ingredient to a subject.

[0070] Further, the present invention provides a use of a pharmaceutical composition comprising vesicles derived from bacteria of the genus Rhodococcus as an active ingredient for preventing or treating one or more diseases selected from the group consisting of a malignant disease, diabetes, stroke, a cardiovascular disease, an inflammatory pulmonary disease, and a cranial nerve disease.

[0071] Further, the present invention provides a use of vesicles derived from bacteria of the genus Rhodococcus for producing a drug used in treating one or more diseases selected from the group consisting of a malignant disease, diabetes, stroke, a cardiovascular disease, an inflammatory pulmonary disease, and a cranial nerve disease.

[0072] The term “prevention” as used herein refers to all actions that suppress a malignant disease, diabetes, stroke, a cardiovascular disease, an inflammatory pulmonary disease, a cranial nerve disease, or the like, or delay the onset thereof via administration of the composition according to the present invention.

[0073] The term “treatment” as used herein refers to all actions that alleviate or beneficially change symptoms of a malignant disease, diabetes, stroke, a cardiovascular disease, an inflammatory pulmonary disease, a cranial nerve disease, or the like via administration of composition according to the present invention.

[0074] The term “alleviation” used as used herein refers to all actions that at least reduce a parameter associated with a condition to be treated, for example, the degree of symptoms.

[0075] The term “subject” used herein refers to a target in need of treatment of one or more diseases selected from the group consisting of a malignant disease, diabetes, stroke, a cardiovascular disease, an inflammatory pulmonary disease, and a cranial nerve disease, and more specifically, a mammal such as a human or a non-human primate, a mouse, a dog, a cat, a horse, a cow, and the like.

[0076] The term “administration” used herein means providing a composition of the present invention to a subject by any suitable method.

[0077] The term “malignant disease” used herein refers to all diseases with extremely poor prognosis, such as cancer and sarcomas, and diseases that are difficult to treat and have fast progression, and in the present invention, the malignant disease may be one or more selected from the group consisting of lung cancer, pancreatic cancer, bile duct cancer, breast cancer, bladder cancer and lymphoma, but the present invention is not limited thereto.

[0078] The term “cardiovascular disease” used herein is a generic term for diseases occurring in the heart and the major arteries, and in the present invention, the cardiovascular disease may be one or more selected from the group consisting of myocardial infarction, hypertension, ischemic heart disease, coronary artery disease, angina, atherosclerosis (arteriosclerosis) and arrhythmia, but the present invention is not limited thereto.

[0079] The term “inflammatory pulmonary disease” used herein refers to a disease caused by an inflammatory response associated with the lungs, and in the present invention, the inflammatory pulmonary disease may be one or more selected from the group consisting of asthma, COPD, acute lung injury, empyema, lung abscesses, pneumonia, pulmonary tuberculosis and bronchitis, but the present invention is not limited thereto.

[0080] The term “cranial nerve disease” used herein is a generic term for diseases caused by problems with cranial nerve cells, and in the present invention, the cranial nerve disease may be one or more selected from the group consisting of depression, obsessive-compulsive disorder, schizophrenia, dementia, Alzheimer's disease, epilepsy, autism and Parkinson's disease, but the present invention is not limited thereto.

[0081] The vesicles may be isolated from a culturing solution comprising bacteria of the genus Rhodococcus by using one or more methods selected from the group consisting of centrifugation, ultra-high speed centrifugation, high pressure treatment, extrusion, sonication, cell lysis, homogenization, freezing-thawing, electroporation, mechanical decomposition, chemical treatment, filtration by a filter, gel filtration chromatography, free-flow electrophoresis, and capillary electrophoresis. Further, a process such as washing for removing impurities and concentration of obtained vesicles may be further included.

[0082] The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier is typically used in formulation, and includes saline, sterile water, Ringer's solution, buffered saline, cyclodextrin, a dextrose solution, a maltodextrin solution, glycerol, ethanol, liposomes, and the like, but is not limited thereto, and may further include other typical additives such as an antioxidant and a buffer, if necessary. Further, the composition may be formulated into an injectable formulation, such as an aqueous solution, a suspension, and an emulsion, a pill, a capsule, a granule, or a tablet by additionally adding a diluent, a dispersant, a surfactant, a binder, a lubricant, and the like. With regard to suitable pharmaceutically acceptable carriers and formulations, the composition may be preferably formulated according to each ingredient by using the method disclosed in the Remington's literature. The pharmaceutical composition of the present invention is not particularly limited in formulation, but may be formulated into an injection, an inhalant, an external preparation for skin, an oral ingestion, or the like.

[0083] The pharmaceutical composition of the present invention may be administered orally or parenterally (e.g., intravenously, subcutaneously, intradermally) according to a desired method, and a dose may vary according to the condition and body weight of a patient, the severity of a disease, a drug formulation, an administration route, and duration, but may be suitably selected by those of ordinary skill in the art.

[0084] The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, the pharmaceutically effective amount refers to an amount sufficient to treat diseases at a reasonable benefit/risk ratio applicable to medical treatment, and an effective dosage level may be determined according to factors including types of diseases of patients, the severity of disease, the activity of drugs, sensitivity to drugs, administration time, administration route, excretion rate, treatment period, and simultaneously used drugs, and factors well known in other medical fields. The composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with therapeutic agents in the related art, and may be administered in a single dose or multiple doses. It is important to administer the composition in a minimum amount that can obtain the maximum effect without any side effects, in consideration of all the aforementioned factors, and this may be easily determined by those of ordinary skill in the art.

[0085] Specifically, the effective amount of the pharmaceutical composition according to the present invention may be changed according to a patient's age, sex or body weight, and may be increased or decreased depending on the route of administration, the severity of obesity, sex, a body weight, age or the like.

[0086] Another aspect of the present invention provides a food composition for preventing or alleviating one or more diseases selected from the group consisting of a malignant disease, diabetes, stroke, a cardiovascular disease, an inflammatory pulmonary disease, and a cranial nerve disease, comprising vesicles derived from bacteria of the genus Rhodococcus as an active ingredient.

[0087] The food composition of the present invention includes a health functional food composition. The food composition according to the present invention may be used by adding an active ingredient as is to food or may be used together with other foods or food ingredients, but may be appropriately used according to a typical method. The mixed amount of the active ingredient may be suitably determined depending on the purpose of use thereof (for prevention or alleviation). In general, when a food or beverage is prepared, the composition of the present invention is added in an amount of 15 wt % or less, preferably 10 wt % or less based on the raw materials. However, for long-term intake for the purpose of health and hygiene or for the purpose of health control, the amount may be less than the above-mentioned range.

[0088] Other ingredients are not particularly limited, except that the food composition of the present invention contains the active ingredient as an essential ingredient at the indicated ratio, and the food composition of the present invention may contain various flavorants, natural carbohydrates, and the like, like a typical beverage, as an additional ingredient. Examples of the above-described natural carbohydrate include common sugars such as monosaccharides, for example, glucose, fructose and the like; disaccharides, for example, maltose, sucrose and the like; and polysaccharides, for example, dextrin, cyclodextrin and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the flavorant other than those described above, a natural flavorant (thaumatin, stevia extract, for example, rebaudioside A, glycyrrhizin and the like), and a synthetic flavorant (saccharin, aspartame and the like) may be advantageously used. The proportion of the natural carbohydrate may be appropriately determined by the choice of those of ordinary skill in the art.

[0089] The food composition of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, colorants and fillers (cheese, chocolate, and the like), pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloid thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonating agents used in a carbonated beverage, or the like, in addition to the additives. These ingredients may be used either alone or in combinations thereof. The ratio of these additives may also be appropriately selected by those of ordinary skill in the art.

[0090] The inhalant composition of the present invention may include not only vesicles derived from bacteria of the genus Rhodococcus, but also components conventionally used in inhalant compositions, for example, conventional adjuvants such as an antioxidant, a stabilizer, a solubilizer, a vitamin and a flavoring agent, and a carrier.

[0091] Another aspect of the present invention provides a cosmetic composition for preventing or alleviating an inflammatory skin disease, comprising vesicles derived from bacteria of the genus Rhodococcus as an active ingredient.

[0092] In the present invention, the inflammatory skin disease may be one or more selected from the group consisting of atopic dermatitis, acne, hair loss, and psoriasis, but is not limited thereto.

[0093] The cosmetic composition of the present invention may comprise ingredients conventionally used in a cosmetic composition as well as vesicles derived from bacteria of the genus Rhodococcus, and may comprise, for example, a conventional additive such as an antioxidant, a stabilizer, a solubilizer, a vitamin, a pigment and a flavor, and a carrier.

[0094] In addition, the composition of the present invention may also be used by mixing a conventionally used organic sunscreen as long as it does not impair a skin protection effect by reaction with the vesicles derived from bacteria of the genus Rhodococcus, in addition to the vesicles derived from bacteria of the genus Rhodococcus. The organic sunscreen may be one or more selected from the group consisting of glyceryl PABA, drometrizole trisiloxane, drometrizole, digalloyl trioleate, disodium phenyl dibenzimidazole tetrasulfonate, diethylhexyl butamidotriazone, diethylamino hydroxybenzoyl hexylbenzoate, DEA-methoxycinnamate, a Lawson/dihydroxyacetone mixture, methylenebis-benzotriazolyltetramethylbutylphenol, 4-methylbenzylidene camphor, methyl anthranilate, benzophenone-3(oxybenzone), benzophenone-4, benzophenone-8(dioxyphebenzone), butyl methoxydibenzoylmethane, bisethylhexyloxyphenol methoxyphenyl triazine, cinoxate, ethyl dihydroxypropyl PABA, octocrylene, ethylhexyldimethyl PABA, ethylhexyl methoxycinnamate, ethylhexyl salicylate, ethylhexyl triazone, isoamyl-p-methoxycinnamate, polysilicon-15 (dimethicodiethylbenzal malonate), terephthalylidene dicamphor sulfonic acid and a salt thereof, TEA-salicylate and aminobenzoic acid (PABA).

[0095] Products that can contain the cosmetic composition of the present invention include, for example, cosmetics such as an astringent, a skin toner, a nourishing toner, various types of creams, essences, packs and foundations, cleansers, face washes, soaps, treatments, and tonics. Specific formulations of the cosmetic composition of the present invention include a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizing lotion, a nourishing lotion, a massage cream, a nourishing cream, a moisturizing cream, a hand cream, an essence, a nourishing essence, a pack, a soap, a shampoo, a cleansing foam, a cleansing lotion, a cleansing cream, a body lotion, a body cleanser, an emulsion, a lipstick, a makeup base, a foundation, a pressed powder, a loose powder, and an eyeshadow.

[0096] In one embodiment of the present invention, as a result of orally administering bacteria and bacteria-derived vesicles to mice and observing in vivo absorption, distribution, and excretion patterns of the bacteria and the vesicles, it was confirmed that, while the bacteria were not absorbed via the intestinal mucous membrane, the bacteria-derived vesicles were absorbed within 5 minutes after administration and systemically distributed, and excreted via the kidneys, liver, and the like (see Example 1).

[0097] In another embodiment of the present invention, a bacterial metagenomic analysis was performed by using vesicles isolated from the blood or urine of normal individuals who were matched in age and sex with patients with lung cancer, pancreatic cancer, bile duct cancer, breast cancer, bladder cancer, lymphoma, diabetes, stroke, myocardial infarction, asthma, COPD, and dementia. As a result, it was confirmed that vesicles derived from bacteria of the genus Rhodococcus were significantly decreased in clinical samples of patients with lung cancer, pancreatic cancer, bile duct cancer, breast cancer, bladder cancer, lymphoma, diabetes, stroke, myocardial infarction, asthma, COPD, and dementia as compared to samples of normal individuals (see Examples 3 to 14).

[0098] In still another embodiment of the present invention, it was evaluated whether vesicles secreted from the cultured Rhodococcus equi strain exhibit immunoregulatory and anti-inflammatory effects, and as a result of evaluating the secretion of an inflammation mediator by treating macrophages with various concentrations of the Rhodococcus equi-derived vesicles, and then with E. coli-derived vesicles, which is an inflammatory disease-causing factor, it was confirmed that the secretion of IL-6 and TNF-α caused by E. coli-derived vesicles is efficiently inhibited by the Rhodococcus equi-derived vesicles (see Example 16).

[0099] In still another embodiment of the present invention, the nerve cell protective effect of vesicles derived from a Rhodococcus equi strain was evaluated, and as a result of evaluating brain-derived neurotrophic factor (BDNF) expression by simultaneously treating nerve cells, which have been treated with an adrenocortical hormone, which stresses nerve cells, with Rhodococcus equi-derived vesicles, it was confirmed that the Rhodococcus equi-derived vesicles effectively increase the expression of BDNF, which is a mediator protecting against nerve cell damage (see Example 17).

[0100] Hereinafter, preferred Examples for helping the understanding of the present invention will be suggested. However, the following Examples are provided only to more easily understand the present invention, and the contents of the present invention are not limited by the following Examples.

EXAMPLES

Example 1. Analysis of In Vivo Absorption, Distribution, and Excretion Patterns of Intestinal Bacteria and Vesicles Derived from Bacteria

[0101] In order to evaluate whether bacteria and bacteria-derived vesicles were systemically absorbed through the mucous, an experiment was performed with the following method. First, a dose of 50 μg of each of fluorescence-labeled intestinal bacteria and the intestinal bacteria-derived vesicles was administered to the stomach of a mouse, and fluorescence was measured after 0 minute, 5 minutes, 3 hours, 6 hours, and 12 hours. As a result of observing the entire image of the mouse, as illustrated in FIG. 1A, the bacteria were not systemically absorbed, but the vesicles derived from bacteria were systemically absorbed 5 minutes after administration, and fluorescence was strongly observed in the bladder 3 hours after administration, so that it could be seen that the vesicles were excreted to the urinary tract. Further, it could be seen that the vesicles were present in the body until 12 hours after administration (see FIG. 1A).

[0102] In addition, in order to evaluate the pattern in which the intestinal bacteria and the vesicles derived from the intestinal bacteria infiltrated into various organs after they were systemically absorbed, 50 μg of bacteria and vesicles derived from bacteria labeled with fluorescence were administered in the same manner as described above, and then the urine, heart, lungs, liver, kidneys, spleen, fat, and muscle were collected 12 hours after administration. As a result of observing fluorescence in the collected tissues, as illustrated in FIG. 1B, it could be seen that the vesicles derived from bacteria were distributed in the urine, heart, lungs, liver, spleen, fat, muscle, and kidneys but the bacteria were not absorbed (see FIG. 1B).

Example 2. Metagenomic Analysis of Vesicles Derived from Bacteria in Clinical Sample

[0103] After blood or urine was first put into a 10-ml tube and suspended matter was allowed to settle by a centrifuge (3,500×g, 10 min, 4° C.), only the supernatant was transferred to a new 10-ml tube. After bacteria and impurities were removed by using a 0.22-μm filter, they were transferred to a Centriprep tube (centrifugal filters 50 kD) and centrifuged at 1,500×g and 4° C. for 15 minutes, materials smaller than 50 kD were discarded, and the residue was concentrated to 10 ml. After bacteria and impurities were removed once again by using a 0.22-μm filter, the supernatant was discarded by using a ultra-high speed centrifugation at 150,000×g and 4° C. for 3 hours with a Type 90Ti rotor, and an aggregated pellet was dissolved in physiological saline (PBS).

[0104] Internal DNA was extracted out of the lipid by boiling 100 μl of the vesicles isolated by the above method at 100° C., and then cooled on ice for 5 minutes. And then, in order to remove the remaining suspended matter, the DNA was centrifuged at 10,000×g and 4° C. for 30 minutes, and only the supernatant was collected. And, the amount of DNA was quantified by using Nanodrop.

[0105] Thereafter, in order to confirm whether the DNA derived from bacteria was present in the extracted DNA, PCR was performed with 16s rDNA primers shown in the following Table 1 and it was confirmed that genes derived from bacteria were present in the extracted genes.

TABLE-US-00001 TABLE 1 SEQ ID primer Sequence No. 16S 16S_V3_ 5′- 1 rDNA F TCGTCGGCAGCGTCAGATGTGTATAAGA GACAGCCTACGGGNGGCWGCAG-3′ 16S_V4_ 5′- 2 R GTCTCGTGGGCTCGGAGATGTGTATAAG AGACAGGACTACHVGGGTATCTAATCC

[0106] The DNA extracted by the above method was amplified using the 16S rDNA primers, and then sequencing was performed (Illumina MiSeq sequencer), the results were output as a standard flowgram format (SFF) file, the SFF file was converted into a sequence file (.fasta) and a nucleotide quality score file using GS FLX software (v2.9), and then the reliability estimation for the reads was confirmed, and a portion in which the window (20 bps) average base call accuracy was less than 99% (Phred score<20) was removed. For the OTU (operational taxonomy unit) analysis, clustering was performed according to sequence similarity by using UCLUST and USEARCH, the genus, family, order, class, and phylum were clustered based on 94%, 90%, 85%, 80%, and 75% sequence similarity, respectively, classification was performed at the phylum, class, order, family, and genus levels of each OUT, and bacteria having a sequence similarity of 97% or more at the genus level were profiled by using the 16S RNA sequence database (108,453 sequences) of BLASTN and GreenGenes (QIIME).

Example 3. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood and Urine of Patient with Lung Cancer

[0107] After a metagenomic analysis was performed using the method of Example 2 on the blood from 126 patients with lung cancer, and 198 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Rhodococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Rhodococcus were significantly decreased in the blood from the patients with lung cancer as compared to the blood from the normal individuals (see Table 2 and FIG. 2A).

TABLE-US-00002 TABLE 2 Blood Control Lung cancer t-test Taxon Mean SD Mean SD p-value Ratio Rhodococcus 0.0081 0.0364 0.0027 0.0102 0.02 0.33

[0108] After a metagenomic analysis was performed using the method of Example 2 on the urine from 66 patients with lung cancer, and 78 normal individuals who were matched in age and sex by extracting genes from vesicles present in the urine, the distribution of vesicles derived from bacteria of the genus Rhodococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Rhodococcus were significantly decreased in the urine from the patients with lung cancer as compared to the urine from the normal individuals (see Table 3 and FIG. 2B).

TABLE-US-00003 TABLE 3 Urine Control Lung cancer t-test Taxon Mean SD Mean SD p-value Ratio Rhodococcus 0.0041 0.0105 0.0007 0.0027 0.008 0.17

Example 4. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Pancreatic Cancer

[0109] After a metagenomic analysis was performed using the method of Example 2 on the blood from 176 patients with pancreatic cancer, and 271 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Rhodococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Rhodococcus were significantly decreased in the blood from the patients with pancreatic cancer as compared to the blood from the normal individuals (see Table 4 and FIG. 3).

TABLE-US-00004 TABLE 4 Blood Control Pancreatic cancer t-test Taxon Mean SD Mean SD p-value Ratio Rhodococcus 0.0078 0.0328 0.0012 0.0059 0.002 0.16

Example 5. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Bile Duct Cancer

[0110] After a metagenomic analysis was performed using the method of Example 2 on the blood from 79 patients with bile duct cancer, and 159 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Rhodococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Rhodococcus were significantly decreased in the blood from the patients with bile duct cancer as compared to the blood from the normal individuals (see Table 5 and FIG. 4).

TABLE-US-00005 TABLE 5 Blood Control Bile duct cancer t-test Taxon Mean SD Mean SD p-value Ratio Rhodococcus 0.0066 0.0321 0.0005 0.0016 0.002 0.07

Example 6. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Breast Cancer

[0111] After a metagenomic analysis was performed using the method of Example 2 on the blood from 107 patients with breast cancer, and 129 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Rhodococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Rhodococcus were significantly decreased in the blood from the patients with breast cancer as compared to the blood from the normal individuals (see Table 6 and FIG. 5).

TABLE-US-00006 TABLE 6 Blood Control Breast cancer t-test Taxon Mean SD Mean SD p-value Ratio Rhodococcus 0.0045 0.0089 0.0016 0.0030 0.0001 0.36

Example 7. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Bladder Cancer

[0112] After a metagenomic analysis was performed using the method of Example 2 on the blood from 91 patients with bladder cancer, and 176 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Rhodococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Rhodococcus were significantly decreased in the blood from the patients with bladder cancer as compared to the blood from the normal individuals (see Table 7 and FIG. 6).

TABLE-US-00007 TABLE 7 Blood Control Bladder cancer t-test Taxon Mean SD Mean SD p-value Ratio Rhodococcus 0.0049 0.0105 0.00019 0.0030 0.0001 0.36

Example 8. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Lymphoma

[0113] After a metagenomic analysis was performed using the method of Example 2 on the blood from 81 patients with lymphoma, and 86 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Rhodococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Rhodococcus were significantly decreased in the blood from the patients with lymphoma as compared to the blood from the normal individuals (see Table 8 and FIG. 7).

TABLE-US-00008 TABLE 8 Blood Control Lymphoma t-test Taxon Mean SD Mean SD p-value Ratio Rhodococcus 0.0061 0.0200 0.0003 0.0011 0.04 0.05

Example 9. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Diabetes

[0114] After a metagenomic analysis was performed using the method of Example 2 on the blood from 114 patients with diabetes, and 132 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Rhodococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Rhodococcus were significantly decreased in the blood from the patients with diabetes as compared to the blood from the normal individuals (see Table 9 and FIG. 8).

TABLE-US-00009 TABLE 9 Blood Control Diabetes t-test Taxon Mean SD Mean SD p-value Ratio Rhodococcus 0.0048 0.0114 0.0004 0.0004 0.00004 0.07

Example 10. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Stroke

[0115] After a metagenomic analysis was performed using the method of Example 2 on the blood from 124 patients with stroke, and 142 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Rhodococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Rhodococcus were significantly decreased in the blood from the patients with stroke as compared to the blood from the normal individuals (see Table 10 and FIG. 9).

TABLE-US-00010 TABLE 10 Blood Control Stroke t-test Taxon Mean SD Mean SD p-value Ratio Rhodococcus 0.0034 0.0119 0.0006 0.0025 0.01 0.19

Example 11. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Myocardial Infarction

[0116] After a metagenomic analysis was performed using the method of Example 2 on the blood from 57 patients with myocardial infarction, and 113 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Rhodococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Rhodococcus were significantly decreased in the blood from the patients with myocardial infarction as compared to the blood from the normal individuals (see Table 11 and FIG. 10).

TABLE-US-00011 TABLE 11 Blood Control Myocardial infarction t-test Taxon Mean SD Mean SD p-value Ratio Rhodococcus 0.0035 0.0108 0.0008 0.0023 0.003 0.22

Example 12. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Asthma

[0117] After a metagenomic analysis was performed using the method of Example 2 on the blood from 135 patients with asthma, and 164 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Rhodococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Rhodococcus were significantly decreased in the blood from the patients with asthma as compared to the blood from the normal individuals (see Table 12 and FIG. 11).

TABLE-US-00012 TABLE 12 Blood Control Asthma t-test Taxon Mean SD Mean SD p-value Ratio Rhodococcus 0.0082 0.0008 0.0008 0.0019 0.00001 0.09

Example 13. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with COPD

[0118] After a metagenomic analysis was performed using the method of Example 2 on the blood from 205 patients with COPD, and 231 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Rhodococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Rhodococcus were significantly decreased in the blood from the patients with COPD as compared to the blood from the normal individuals (see Table 13 and FIG. 12).

TABLE-US-00013 TABLE 13 Blood Control COPD t-test Taxon Mean SD Mean SD p-value Ratio Rhodococcus 0.0082 0.0355 0.0020 0.0028 0.0003 0.25

Example 14. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Dementia

[0119] After a metagenomic analysis was performed using the method of Example 2 on the blood from 72 patients with dementia, and 93 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Rhodococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Rhodococcus were significantly decreased in the blood from the patients with dementia as compared to the blood from the normal individuals (see Table 14 and FIG. 13).

TABLE-US-00014 TABLE 14 Blood Control Dementia t-test Taxon Mean SD Mean SD p-value Ratio Rhodococcus 0.0029 0.0034 0.0006 0.0011 0.00001 0.21

Example 15. Isolation of Vesicles Derived from Rhodococcus equi

[0120] Based on the result of the above examples, the Rhodococcus equi strain belonging to the genus Rhodococcus was cultured and then its vesicles were isolated therefrom. The Rhodococcus equi strain was cultured in a brain heart infusion (BHI) medium in a 37° C. anaerobic chamber to an absorbance (OD600) of 1.0 to 1.5, and then sub-cultured. Afterward, the medium supernatant not containing the strain was collected and centrifuged at 10,000 g and 4° C. for 15 minutes, filtered through a 0.45-μm filter, and the filtered supernatant was concentrated to a 200 mL volume through ultrafiltration using a QuixStand benchtop system (GE Healthcare, UK) with a 100 kDa hollow filter membrane. Afterward, the concentrated supernatant was filtered again through a 0.22-μm filter, the filtered supernatant was ultracentrifuged at 150,000 g and 4° C. for 3 hours, the pellet was suspended with Dulbecco's Phosphate Buffered Saline (DPBS). Subsequently, density-gradient centrifugation was performed using 10%, 40%, and 50% OptiPrep solutions (Axis-Shield PoC AS, Norway), and to prepare a low-density solution, the OptiPrep solution was diluted with HEPES-buffered saline (20 mM HEPES, 150 mM NaCl, pH 7.4). Centrifugation was performed at 200,000 g and 4° C. for 2 hours, and each solution fractionated into the same volume of 1 mL from the upper layer was additionally ultracentrifuged at 150,000 g and 4° C. for 3 hours. Afterward, a protein was quantified using a bicinchoninic acid (BCA) assay, and an experiment was performed on the obtained vesicles.

Example 16. Anti-Inflammatory Effects of Vesicles Derived from Rhodococcus Equi

[0121] To examine the effect of Rhodococcus equi-derived vesicles on the secretion of inflammation mediators in inflammatory cells, Raw 264.7 cells, which is a mouse macrophage cell line, were treated with the Rhodococcus equi-derived vesicles at various concentrations (0.1, 1 and 10 μg/mL), and then treated with E. coli EVs, which are pathogenic vesicles of an inflammatory disease, followed by measuring secretion amounts of the inflammation mediators (IL-6 and TNF-α). More specifically, the Raw 264.7 cells were seeded in a 24-well cell culture plate at 1×10.sup.5 cells/well, and cultured in complete DMEM for 24 hours. Afterward, a culture supernatant was collected in a 1.5 mL tube and centrifuged at 3000 g for 5 minutes, and then the resulting supernatant was stored at 4° C. and subjected to ELISA analysis. As a result, when Rhodococcus equi-derived vesicles were pretreated, it was confirmed that the secretion of the IL-6 and TNF-α by E. coli EVs was significantly suppressed (see FIGS. 14A and 14B). This result shows that inflammatory responses induced by pathogenic vesicles such as E. coli-derived vesicles can be effectively inhibited by the Rhodococcus equi-derived vesicles.

Example 17. Nerve Cell Protective Effect of Rhodococcus equi-Derived Vesicles

[0122] A brain-derived neurotrophic factor (BDNF) is a major mediator protecting nerve cells from nerve cell damage, and its expression is decreased in dementia, depression, Alzheimer's disease, autism, and the like. In this example, to evaluate the therapeutic effect of Rhodococcus equi-derived vesicles against a cranial nerve disease, the nerve cell protective effect was evaluated by treating the nerve cells with a stress hormone. That is, nerve cells (hippocampal neuronal cell line, HT22 cells) were cultured with an adrenocortical hormone (GC: corticosterone 400 ng/ml) or Rhodococcus equi-derived vesicles (EV, 20 μg/mL) for 24 hours in vitro, and the BDNF expression was evaluated by PCR.

[0123] As a result, it was confirmed that the BDNF expression inhibited by adrenocortical hormone treatment is significantly recovered by the treatment of Rhodococcus equi-derived vesicles (see FIG. 15). This means that the Rhodococcus equi-derived vesicles can effectively inhibit a cranial nerve disease caused by a factor causing cranial nerve cell damage such as stress.

[0124] The above-described description of the present invention is provided for illustrative purposes, and those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. Therefore, it should be understood that the above-described Examples are illustrative only in all aspects and are not restrictive.

INDUSTRIAL APPLICABILITY

[0125] Vesicles derived from bacteria of the genus Rhodococcus according to the present invention are expected to be effectively used in a method of diagnosing lung cancer, pancreatic cancer, bile duct cancer, breast cancer, bladder cancer, lymphoma, diabetes, stroke, myocardial infarction, asthma, COPD, or dementia; and a food, inhalant, cosmetic or pharmaceutical composition for preventing, alleviating or treating a malignant disease, diabetes, stroke, a cardiovascular disease, an inflammatory pulmonary disease, or a cranial nerve disease.