The present invention provides methods and compositions for treating and/or preventing age related macular degeneration and other conditions involving macular degeneration, ocular neovascularization, or ocular inflammation. In an exemplary embodiment, a method is disclosed that involves administering an expression vector that delivers a secretable and cell penetrating CARD to a subject in need of treatment or prevention of age-related macular degeneration or another condition involving macular degeneration or ocular neovascularization.

Provided is an engineered immune cell. The expressions of at least one MHC related gene and at least one NK activating receptor binding molecule are suppressed or silenced, so as to suppress the killing of the engineered immune cell by NK cells. Also provided are a pharmaceutical composition comprising the engineered immune cell and use of the engineered immune cell in preparation of drugs for treatment of cancer, infection, or autoimmune diseases.

The present disclosure relates, in part, to antibodies, and antigen-binding fragments thereof, that can bind to the antigenic loop region of hepatitis B surface antigen (HBsAg) and, optionally, can neutralize infection hepatitis B virus (HBV), and further optionally, of hepatitis delta virus (HDV). Presently disclosed antibodies and antigen-binding fragments have advantageous production characteristics, such as reduced formation of aggregates and/or improved production titer in transformed host cells, as compared to a reference antibody or antigen-binding fragment. The present disclosure also relates to fusion proteins that comprise an antigen-binding fragment, and to nucleic acids that encode and cells that produce such antibodies, antigen-binding fragments, and fusion proteins. In addition, the present disclosure relates to the use of the antibodies, antigen-binding fragments, fusion proteins, and related polynucleotides, vectors, host cells, and compositions of the present disclosure in the diagnosis, prophylaxis and treatment of hepatitis B and hepatitis D. Also provided are combination therapies comprising (i) an antibody or antigen-binding fragment and (ii) an agent that is an inhibitor of HBV gene expression and/or that reduces HBV antigenic load.

The present disclosure provides compositions and methods for minimally invasive optogenetic stimulation. More particularly, the present disclosure provides compositions and methods for using an ultra-sensitive step-function opsin for minimally invasive optogenetic stimulation.

Provided is a bispecific chimeric antigen receptor targeting CD19 and CD22, which comprises extracellular antigen binding domains of heavy-chain variable regions and light-chain variable regions of anti-CD19 and anti-CD22 antibodies. Further provided is a bispecific CAR-T cell targeting CD19 and CD22.

Described are improved methods for manufacturing and purifying clinical-grade retroviral vectors, such as lentiviral vectors.

Methods of treating an age-related disorder in a subject are provided. Aspects of the methods include administering to the subject a nucleic acid vector including a coding sequence for telomerase reverse transcriptase (TERT) and/or telomerase RNA (TR). Gene therapy methods are also provided. Aspects of the invention further include compositions, e.g., nuclcic acid vectors and kits, etc., that find use in methods of the invention.

The present disclosure provides an automated method of producing genetically modified immune cells, including chimeric antigen receptor T (CAR T) cells, utilizing a fully-enclosed cell engineering system.

The present invention realtes to lentiviral particles which have been pseudotyped with Nipah virus (NiV) fusion (F) and attachment (G) glycoproteins (NiVpp-F/G). Additionally, the present invention relates to truncated NiV-F glyocproteins useful in producing such NiVpp lentiviral particles, as well as to additional variant peptides which enhance activity. Further, the present invention relates to methods of using such lentiviral particles or sequences, for example in the treatetment of cancer or CNS disorders.

Disclosed are guide RNAs (gRNAs) that specifically bind the 5′ LTR human immunodeficiency virus-1 (HIV-1) sequence comprising TTGGATGGTGCTTCAAGTTA (SEQ ID NO: 1). Disclosed are gRNAs that specifically bind the 5′ LTR HIV-1 sequence comprising CTACAAGGGACTTTCCGCTG (SEQ ID NO: 2). Disclosed are gRNAs that specifically bind the 5′ LTR HIV-1 sequence comprising TCTACAAGGGACTTTCCGCT (SEQ ID NO: 3). Disclosed are nucleic acid sequences comprising a nucleic acid sequence encoding one or more gRNAs, wherein said one or more gRNAs hybridize with a target sequence in HIV-1, wherein the target sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. Disclosed are vectors comprising a nucleic acid sequence encoding one or more gRNAs, wherein the one or more gRNA hybridizes with a target sequence in HIV-1, wherein the target sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. Disclosed are methods for inhibiting the function of a target HIV-1 DNA sequence in a cell or removing a target HIV-1 DNA sequence from a cellular genome comprising contacting a cell comprising a cellular genome and harboring a HIV-1 genome comprising a target HIV-1 DNA sequence integrated into the cellular genome with one or more gRNAs, or nucleic acids encoding said one or more gRNAs, and a Clustered Regularly Interspaced Short Palindromic Repeats-Associated (cas) protein, or nucleic acid sequence encoding a cas protein, wherein the one or more gRNAs uniquely hybridizes with the target HIV-1 DNA sequence, wherein the target HIV-1 DNA sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; thereby inhibiting the function or presence of the target HIV-1 DNA sequence.