A method of generating an RNA molecule having a silencing activity in a cell is provided, comprising: (a) identifying nucleic acid sequences encoding RNA molecules exhibiting predetermined sequence homology range, not including complete identity, with respect to nucleic acid sequences encoding RNA molecules engaged with RISC, (b) determining transcription of nucleic acid sequences encoding RNA molecules so as to select transcribable nucleic acid sequences encoding RNA molecules; (c) determining processability into small RNAs of transcripts of transcribable nucleic acid sequences encoding RNA molecules exhibiting predetermined sequence homology range so as to select transcribable nucleic acid sequences encoding aberrantly processed RNA molecules exhibiting predetermined sequence homology range; (d) modifying a nucleic acid sequence of aberrantly processed, transcribable nucleic acid sequences so as to impart processability into small RNAs that are engaged with RISC and are complementary to a first target RNA or to a target RNA of interest.

Biomarkers and uses thereof in monitoring, assessing, and/or treatment of viral infections, or inflammatory diseases, disorders, or conditions, or cancer.

The present invention relates generally to immunization and immunotherapy for the treatment or prevention of HIV. In particular, the methods include in vivo and/or ex vivo enrichment of HIV-specific CD4+ T cells.

There is provided a protein-RNA complex where here the protein is selected from one of Cpf1 and CAS13 and where the protein is Cpf1 and the RNA is an RNA guide strand which comprises a sequence that is one of SEQ ID NO 1 to 40 less the 5′ TTTN motif of said SEQ ID NO 1-40, or the protein is CAS13 and the polynucleotide is an RNA guide strand that comprises a sequence that is complimentary to one of SEQ ID NO 41 to 80.

Provided herein are, inter alia, oligonucleotides, kits, and methods useful for increasing lentiviral titers.

Provided are compositions and methods for prophylaxis or therapy for human immunodeficiency virus (HIV) infection. The compositions and methods involve use of RNAi agents targeted to an anti-apoptotic long non-coding RNA (lncRNA) that is IncRNA SAF (FAS-AS1) or HOXA-AS2. The RNAi agents preferentially induce apoptosis of HIV infected macrophages. RNAi agents, and macrophages containing the RNAi agents, are also provided.

Provided herein are, inter alia, oligonucleotides, kits, and methods useful for increasing lentiviral titers.

The invention relates to a non-coding sequence of deoxyribonucleic acids comprising at least one sequence motif N.sup.1N.sup.2CGN.sup.3N.sup.4, wherein N is a nucleotide comprising A, C, T, or G, and C is deoxycytidine, G is deoxyguanosine, A is deoxyadenosine and T is deoxythymidine for the treatment of viral infections. In particular, the non-coding sequence of deoxyribonucleic acids is used in combination with antiretroviral therapy and/or histone de-acetylase inhibitors.

Disclosed are guide RNAs (gRNAs) that specifically bind the 5′ LTR human immunodeficiency virus-1 (HIV-1) sequence comprising TTGGATGGTGCTTCAAGTTA (SEQ ID NO: 1). Disclosed are gRNAs that specifically bind the 5′ LTR HIV-1 sequence comprising CTACAAGGGACTTTCCGCTG (SEQ ID NO: 2). Disclosed are gRNAs that specifically bind the 5′ LTR HIV-1 sequence comprising TCTACAAGGGACTTTCCGCT (SEQ ID NO: 3). Disclosed are nucleic acid sequences comprising a nucleic acid sequence encoding one or more gRNAs, wherein said one or more gRNAs hybridize with a target sequence in HIV-1, wherein the target sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. Disclosed are vectors comprising a nucleic acid sequence encoding one or more gRNAs, wherein the one or more gRNA hybridizes with a target sequence in HIV-1, wherein the target sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. Disclosed are methods for inhibiting the function of a target HIV-1 DNA sequence in a cell or removing a target HIV-1 DNA sequence from a cellular genome comprising contacting a cell comprising a cellular genome and harboring a HIV-1 genome comprising a target HIV-1 DNA sequence integrated into the cellular genome with one or more gRNAs, or nucleic acids encoding said one or more gRNAs, and a Clustered Regularly Interspaced Short Palindromic Repeats-Associated (cas) protein, or nucleic acid sequence encoding a cas protein, wherein the one or more gRNAs uniquely hybridizes with the target HIV-1 DNA sequence, wherein the target HIV-1 DNA sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3; thereby inhibiting the function or presence of the target HIV-1 DNA sequence.

Compositions which specifically target Human T cell leukemia virus (HTLV) coding sequences and other essential protein sequences, induce mutations and/or deletions in the viral DNA, rendering the virus unable to undergo replication and less likely to infect other cells, thus halting the viral life cycle and viral propagation and halting cellular transformation induced by the virus.