The present invention relates to nanoparticles complexed with biomacromolecule agents configured for treating, preventing or ameliorating various types of disorders, and methods of synthesizing the same. In particular, the present invention is directed to compositions comprising nanoparticles (e.g., synthetic high density lipoprotein (sHDL)) carrying biomacromolecule agents (e.g., nucleic acid, peptides, glycolipids, etc.), methods for synthesizing such nanoparticles, as well as systems and methods utilizing such nanoparticles (e.g., in diagnostic and/or therapeutic settings).

The present invention provides a cyanine modified telodendrimer, nanoparticles thereof, and methods of using the nanoparticles to treat various diseases such as cancer.

Methods and compositions are provided for extending the half-life of a therapeutic agent. A modified therapeutic agent (mTA) comprises a therapeutic agent, a staple, and a half-life extending molecule. The mTAs disclosed herein may be used to treat a disease or a condition in a subject in need thereof.

Described herein are processable compositions comprising at least one moiety that is processable in its free form. Also described herein are compositions and methods for the treatment of ocular diseases or disorders including glaucoma, blepharitis, ocular inflammation, diabetic macular edema, posterior inflammation, anterior inflammation, macular degeneration (e.g., wet macular degeneration (AMD) or dry AMD), post-cataract surgery, and retinal vein occlusion. Said compositions and methods comprise steroids and prostaglandins which demonstrate anti-inflammatory activity, intraocular pressure (IOP) lowering, and/or other desirable activities. Injection of said compositions in the eye provides therapeutic benefit to patients suffering from ocular disorders.

The present invention relates to oligomeric compounds and conjugates thereof that target Proprotein Convertase Subtilisin/Kexin type 9 (PCSK9) PCSK9 mRNA in a cell, leading to reduced expression of PCSK9. Reduction of PCSK9 expression is beneficial for a range of medical disorders, such as hypercholesterolemia and related disorders.

The present disclosure provides duplexes comprising a first oligomeric compound and a second oligomeric compound wherein the second oligomeric compound comprises a conjugate group. In certain embodiments, the duplex modulates the amount or activity of a target nucleic acid in extra hepatic tissues and/or extra hepatic cells. In certain embodiments, the duplex modulates the amount or activity of a target nucleic acid in hepatic tissues and/or hepatic cells.

The invention relates to pharmaceutical compositions, and more specifically to pharmaceutical compositions comprising at least one fatty acid-bile acid conjugate and at least one thyroid hormone receptor agonist or thyroid hormone mimetic or pharmaceutically acceptable salts thereof, and use of such compositions in methods of treating, stabilizing or lessening the severity or progression of a liver disease including fibrosis, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), and comorbidity ties associated with a liver disease.

The present description relates to a conjugated compound an antibody covalently linked to enhancer moiety composed by a nuclear localization sequence (NLS), covalently linked to a sterol variant, such as cholic acid (ChAc) or a variant thereof. The enhancer moiety as encompassed herein is able to induce endosome escape of the compound-conjugates by direct membrane destabilization or indirectly by ROS and ceramide production which destabilize endosome-lysosome membrane. The conjugated compound can further comprise payload.

This disclosure relates to a therapeutic combination of drugs for the treatment or management of a neurodegenerative disease, the combination comprising: a first conjugate comprising an RNA silencing agent and a first targeting agent that targets the first conjugate to the central nervous system, and a second conjugate comprising an antagonist of the RNA silencing agent and a second targeting agent that targets the second conjugate to a off-target tissue.

A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO:4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO:5). The passenger RNA strand includes a 2′-O-methylation modification to increase stability. Cholesterol is conjugated to the 3′-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule.