Patent classifications
A01K2217/20
TARGETED DELIVERY OF GLYCINE RECEPTORS TO EXCITABLE CELLS
The invention provides a method of modulating electrophysiological activity of an excitable cell. The method involves causing exogenous expression of a glycine receptor (GlyR) protein in an excitable cell of a subject. Thereafter, the excitable cell is exposed to an allosteric modulator of the GlyR protein. Modulation of the exogenous GlyR protein (an ion channel) in response to the allosteric modulator modulates the electrophysiological activity of the excitable cell. The method can be used to control pain in a subject. The invention further provides a replication-defective HSV vector comprising an expression cassette encoding a GlyR protein, stocks and pharmaceutical compositions containing such vectors, and a transgenic animal.
Genetically modified rat models for severe combined immunodeficiency (SCID)
This invention relates to the engineering of animal cells, preferably mammalian, more preferably rat, that are deficient due to the disruption of tumor suppressor gene(s) or gene product(s). In another aspect, the invention relates to genetically modified rats, as well as the descendants and ancestors of such animals, which are animal models of human cancer and methods of their use.
Transgenic mouse capable of spatial and temporal control of expression and site-specific modification of target protein, production method and uses thereof
The present invention relates to a mouse (Mus musculus) in which expression and site-specific modification of a target protein is temporally and spatially controlled, and a method for producing the same and the use thereof, and more particularly to a transgenic mouse in which expression of a target protein having a modification attached to a specific position is temporally and spatially controlled as a result of incorporation of an unnatural amino acid. In the mouse according to the present invention, in which site-specific modification of a target protein is temporally and spatially controllable, expression of the target protein having the site-specific modification attached thereto is controllable depending on the timing and/or position of introduction of an unnatural amino acid. Thus, the mouse according to the present invention is useful for studies on the in vivo functions of cellular proteins, various human diseases including cancers and neurodegenerative disorders, new drug discovery, and the like.
Inflammation reporter system
The present invention provides a method for detection of an inflammatory reaction, which comprises using a transformant or transgenic non-human animal transfected with a vector comprising a promoter for a gene encoding an inflammatory cytokine, a gene encoding a reporter protein, a gene encoding the inflammatory cytokine, and a gene encoding a proteolytic signal sequence to thereby detect an inflammatory reaction induced upon inflammatory stimulation in the transformant or in the transgenic non-human animal.
Targeted delivery of glycine receptors to excitable cells
The invention provides a method of modulating electrophysiological activity of an excitable cell. The method involves causing exogenous expression of a glycine receptor (GlyR) protein in an excitable cell of a subject. Thereafter, the excitable cell is exposed to an allosteric modulator of the GlyR protein. Modulation of the exogenous GlyR protein (an ion channel) in response to the allosteric modulator modulates the electrophy-stological activity of the excitable cell. The method can be used to control pain in a subject. The invention further provides a replication-defective HSV vector comprising an expression cassette encoding a GlyR protein, stocks and pharmaceutical compositions containing such vectors, and a transgenic animal.
DNA SEQUENCE THAT INCREASES ODORANT RECEPTOR REPRESENTATION IN THE OLFACTORY SYSTEM
A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.
Humanized IL-4 and IL-4Rα animals
Non-human animals comprising a human or humanized IL-4 and/or IL-4R nucleic acid sequence are provided. Non-human animals that comprise a replacement of the endogenous IL-4 gene and/or IL-4R gene with a human IL-4 gene and/or IL-4R gene in whole or in part, and methods for making and using the non-human animals, are described. Non-human animals comprising a human or humanized IL-4 gene under control of non-human IL-4 regulatory elements is also provided, including non-human animals that have a replacement of non-human IL-4-encoding sequence with human IL-4-encoding sequence at an endogenous non-human IL-4 locus. Non-human animals comprising a human or humanized IL-4R, gene under control of non-human IL-4R regulatory elements is also provided, including non-human animals that have a replacement of non-human IL-4R-encoding sequence with human or humanized IL-4R-encoding sequence at an endogenous non-human CIL-4R locus. Non-human animals comprising human or humanized IL-4 gene and/or IL-4R, sequences, wherein the non-human animals are rodents, e.g., mice or rats, are provided.
HUMANIZED IL-4 AND IL-4Ra ANIMALS
Non-human animals comprising a human or humanized IL-4 and/or IL-4R nucleic acid sequence are provided. Non-human animals that comprise a replacement of the endogenous IL-4 gene and/or IL-4R gene with a human IL-4 gene and/or IL-4R gene in whole or in part, and methods for making and using the non-human animals, are described. Non-human animals comprising a human or humanized IL-4 gene under control of non-human IL-4 regulatory elements is also provided, including non-human animals that have a replacement of non-human IL-4-encoding sequence with human IL-4-encoding sequence at an endogenous non-human IL-4 locus. Non-human animals comprising a human or humanized IL-4R gene under control of non-human IL-4R regulatory elements is also provided, including non-human animals that have a replacement of non-human IL-4R-encoding sequence with human or humanized IL-4R-encoding sequence at an endogenous non-human C IL-4R locus. Non-human animals comprising human or humanized IL-4 gene and/or IL-4R sequences, wherein the non-human animals are rodents, e.g., mice or rats, are provided.
MULTIFUNCTIONAL ALLELES
Nucleic acid constructs and methods for rendering modifications to a genome are provided, wherein the modifications comprise null alleles, conditional alleles and null alleles comprising COINs. Multifunctional alleles (MFA) are provided, as well as methods for making them, which afford the ability in a single targeting to introduce an allele that can be used to generate a null allele, a conditional allele, or an allele that is a null allele and that further includes a COIN. MFAs comprise pairs of cognate recombinase recognition sites, an actuating sequence and/or a drug selection cassette, and a nucleotide sequence of interest, and a COIN, wherein upon action of a recombinase a conditional allele with a COIN is formed. In a further embodiment, action of a second recombinase forms an allele that contains only a COIN in sense orientation. In a further embodiment, action by a third recombinase forms an allele that contains only the actuating sequence in sense orientation.
LATE-ONSET ALZHEIMER'S DISEASE ANIMAL MODEL AND USES THEREOF
An animal model (e.g., mouse) and method of use, and cell culture assay method, for characterizing or screening a test compound for its effect on late onset Alzheimer's disease (LOAD). The test compound may be used as a therapeutic agent for treatment of Alzheimer's disease (AD). The AD animal model may be haploinsufficient for Shugoshin 1 (Sgo1) gene, or may comprise a genetic modification enabling modulation of Sgo1 expression in the brain of the animal when exposed to an Sgo1 expression-modulating compound, such as tamoxifen. After the test compound is administered to the animal model, the presence or amount of an AD biomarker is assessed or measured.