A01K2217/20

DNA sequence that increases odorant receptor representation in the olfactory system

A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

Humanized IL-4 and IL-4Rα animals

Non-human animals comprising a human or humanized IL-4 and/or IL-4R nucleic acid sequence are provided. Non-human animals that comprise a replacement of the endogenous IL-4 gene and/or IL-4R gene with a human IL-4 gene and/or IL-4R gene in whole or in part, and methods for making and using the non-human animals, are described. Non-human animals comprising a human or humanized IL-4 gene under control of non-human IL-4 regulatory elements is also provided, including non-human animals that have a replacement of non-human IL-4-encoding sequence with human IL-4-encoding sequence at an endogenous non-human IL-4 locus. Non-human animals comprising a human or humanized IL-4R gene under control of non-human IL-4R regulatory elements is also provided, including non-human animals that have a replacement of non-human IL-4R-encoding sequence with human or humanized IL-4R-encoding sequence at an endogenous non-human C IL-4R locus. Non-human animals comprising human or humanized IL-4 gene and/or IL-4R sequences, wherein the non-human animals are rodents, e.g., mice or rats, are provided.

Humanized IL-4 and IL-4R? animals

Non-human animals comprising a human or humanized IL-4 and/or IL-4R? nucleic acid sequence are provided. Non-human animals that comprise a replacement of the endogenous IL-4 gene and/or IL-4R? gene with a human IL-4 gene and/or IL-4R? gene in whole or in part, and methods for making and using the non-human animals, are described. Non-human animals comprising a human or humanized IL-4 gene under control of non-human IL-4 regulatory elements is also provided, including non-human animals that have a replacement of non-human IL-4-encoding sequence with human IL-4-encoding sequence at an endogenous non-human IL-4 locus. Non-human animals comprising a human or humanized IL-4R? gene under control of non-human IL-4R? regulatory elements is also provided, including non-human animals that have a replacement of non-human IL-4R?-encoding sequence with human or humanized IL-4R?-encoding sequence at an endogenous non-human C IL-4R? locus. Non-human animals comprising human or humanized IL-4 gene and/or IL-4R? sequences, wherein the non-human animals are rodents, e.g., mice or rats, are provided.

Multifunctional alleles

Nucleic acid constructs and methods for rendering modifications to a genome are provided, wherein the modifications comprise null alleles, conditional alleles and null alleles comprising COINs. Multifunctional alleles (MFA) are provided, as well as methods for making them, which afford the ability in a single targeting to introduce an allele that can be used to generate a null allele, a conditional allele, or an allele that is a null allele and that further includes a COIN. MFAs comprise pairs of cognate recombinase recognition sites, an actuating sequence and/or a drug selection cassette, and a nucleotide sequence of interest, and a COIN, wherein upon action of a recombinase a conditional allele with a COIN is formed. In a further embodiment, action of a second recombinase forms an allele that contains only a COIN in sense orientation. In a further embodiment, action by a third recombinase forms an allele that contains only the actuating sequence in sense orientation.

GENETICALLY MODIFIED RAT MODELS FOR SEVERE COMBINED IMMUNODEFICIENCY (SCID)
20240156069 · 2024-05-16 ·

This invention relates to the engineering of animal cells, preferably mammalian, more preferably rat, that are deficient due to the disruption of tumor suppressor gene(s) or gene product(s). In another aspect, the invention relates to genetically modified rats, as well as the descendants and ancestors of such animals, which are animal models of human cancer and methods of their use.

Late-onset Alzheimer's disease animal model and uses thereof

An animal model (e.g., mouse) and method of use, and cell culture assay method, for characterizing or screening a test compound for its effect on late onset Alzheimer's disease (LOAD). The test compound may be used as a therapeutic agent for treatment of Alzheimer's disease (AD). The AD animal model may be haploinsufficient for Shugoshin 1 (Sgo1) gene, or may comprise a genetic modification enabling modulation of Sgo1 expression in the brain of the animal when exposed to an Sgo1 expression-modulating compound, such as tamoxifen. After the test compound is administered to the animal model, the presence or amount of an AD biomarker is assessed or measured.

GENERATION OF GENETICALLY ENGINEERED ANIMALS BY CRISPR/CAS9 GENOME EDITING IN SPERMATOGONIAL STEM CELLS

The present disclosure provides methods and compositions for the production of genetically engineered animals, such as mice, by genomic editing of the spermatogonial stem cells, such as by using the CRISPR/Cas9 gene editing system. Also provided are methods of studying gene function and creating disease models.

DNA sequence that increases odorant receptor representation in the olfactory system
12063914 · 2024-08-20 · ·

A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

DNA SEQUENCE THAT INCREASES ODORANT RECEPTOR REPRESENTATION IN THE OLFACTORY SYSTEM
20180317465 · 2018-11-08 ·

A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

EXPRESSION SYSTEMS
20180312870 · 2018-11-01 ·

A gene expression system is provided. The system comprises at least one coding sequence to be expressed in an organism, and at least one promoter operably linked thereto. It further comprises at least one splice control sequence which, in cooperation with a spliceosome, mediates alternative splicing of RNA transcripts of the coding sequence. The mediation of alternative splicing is in a sex-specific, stage-specific, germline-specific and tissue-specific manner.