A revised technique for preparing human tissues and organs aiming at application to medical use is provided. With this technique, function per cell is greatly improved and great reduction in production cost is realized.

A method of preparing an organ bud, comprising culturing vascular endothelial cells, mesenchymal cells and a tissue or organ cell in vitro in the presence of blood cells. Also provided are an organ bud prepared by the above method and a method of preparing a tissue or an organ using the organ bud. Using the same organ bud, there are provided a method of transplanting an organ bud, a method of regeneration or function recovery of a tissue or an organ, a method of preparing a non-human chimeric animal, and a method of evaluating a drug.

Genetically modified rodents such as mice and rats, and methods and compositions for making and using the same, are provided. The rodents comprise a humanization of at least one endogenous rodent Tmprss gene, such as an endogenous rodent Tmprss2, Tmprss4, or Tmprss11d gene.

A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

The present invention relates inter alia to improvements in the production of chimaeric antibodies in non-human transgenic vertebrates such as mice and rats bearing one or more chimaeric antibody transgenes. In particular, the invention provides for improved non-human vertebrates and cells in which VpreB has been species-matched with the variable region of the chimaeric antibodies. Also, embodiments also provide for species-matching of the entire surrogate light chain for efficient pairing with chimaeric heavy chains during B-cell development in vivo in a non-human transgenic vertebrate setting.

The present invention relates to a method for preparing a canine model of atherosclerosis, in particular, relates to a method for preparing an apolipoprotein E (APOE) gene knock-out disease canine model with the use of gene knock-out technology.

Mice that comprise a replacement of endogenous mouse IL-6 and/or IL-6 receptor genes are described, and methods for making and using the mice. Mice comprising a replacement at an endogenous IL-6R locus of mouse ectodomain-encoding sequence with human ectodomain-encoding sequence is provided. Mice comprising a human IL-6 gene under control of mouse IL-6 regulatory elements is also provided, including mice that have a replacement of mouse IL-6-encoding sequence with human IL-6-encoding sequence at an endogenous mouse IL-6 locus.

Provided herein are compositions, methods, and devices for the treatment and prevention of atrial fibrillation (AF) using gene therapy techniques. In particular, oxidative stress (OS) and parasympathetic nervous system signaling are inhibited to prevent and/or reverse the electrical remodeling that underlies AF.

Genetically modified rodents such as mice and rats, and methods and compositions for making and using the same, are provided. The rodents comprise a humanization of at least one endogenous rodent Tmprss gene, such as an endogenous rodent Tmprss2, Tmprss4, or Tmprss11d gene.

Genetically modified rodents such as mice and rats, and methods and compositions for making and using the same, are provided. The rodents comprise a humanization of at least one endogenous rodent Tmprss gene, such as an endogenous rodent Tmprss2, Tmprss4, or Tmprss11d gene.

A multifunctional dog chain includes at least two ropes, a handle ring and hooks. Rear ends of the at least two ropes are interconnected to form a first connecting portion, the handle ring is in 360 rotary connection with the first connecting portion, front ends of the ropes are separated, the hooks used for connecting with dog collars are arranged on each of said ropes, an adjustable rope clamp is arranged between the ropes and connected to the ropes to separate the ropes into a front part and a rear part, the ropes between the first connecting portion and the adjustable rope clamp form the closed rear part, each of the ropes in the front part is of a separated structure, and the adjustable rope clamp can move back and forth along said ropes. The multifunctional dog chain can prevent accidents out of too long ropes.