A recombinant adeno-associated virus (rAAV) comprising an AAV capsid and a vector genome comprising a frataxin gene is provided. Also provided is a composition containing an effective amount of rAAV to ameliorate symptoms of Freidreich’s ataxia, including, e.g., reduction in progression towards neurocognitive decline and/or cardiomyopathy.

A nucleic acid molecule comprising a variant inc coding strand is disclosed as a regulator of plasmid copy number. Also disclosed is a replicon comprising the nucleic acid molecule, a promoter, and an origin of replication. Also disclosed is a vector comprising the replicon. Also disclosed is a recombinant microorganism comprising the vector.

Provided herein, in some embodiments, are nucleic acid constructs encoding RNA molecules comprising one or more introns that can be regulated (e.g., autoregulated), and that are useful for delivery in a recombinant viral vector. Aspects of the application provide compositions and methods for delivering regulated (e.g., auto-regulated) gem expression constructs to a subject.

Compositions and regimens useful in treating type I citrullenemia are provided. The compositions include recombinant adeno-associated virus (rAAV) with a transthyretin enhancer and promoter driving expression of a human Argininosuccinate Synthase 1 (ASS1).

Provided herein are compositions that include a single nucleic acid vector or two different nucleic acid vectors, and the use of these compositions to treat hearing loss in a subject.

A vector system for expressing a transgene in a cell, the vector system comprising a first vector and a second vector, wherein: (a) the first vector comprises in a 5′ to 3′ direction: a promoter; an intron; a 5′ end portion of the transgene coding sequence (CDS); a splice donor sequence; and a first recombinogenic region; (b) the second vector comprises in a 5′ to 3′ direction: a second recombinogenic region; a splice acceptor sequence; and a 3′ end portion of the transgene CDS; wherein the 5′ end portion and the 3′ end portion together constitute the transgene CDS, and wherein the intron is not capable of homologous recombination with the splice donor sequence to excise the 5′ end portion of the transgene CDS.

The present invention relates to the field of recombinant viral vectors suitable for the delivery of therapeutic genes in vivo. Described is an adeno-associated virus (AAV) vector comprising (i) a human growth hormone intron 3 (hGHi3) sequence (ii) a synapsin promoter sequence and/or (iii) a progranulin 3′ untranslated region (UTR) sequence, operably coupled to a polynucleotide sequence encoding a polypeptide of interest. Specific use of such a vector lies in the enhanced expression of a polypeptide of interest, such as progranulin (PGRN), to treat subjects who have a genetic mutation or intrinsic polypeptide level that is below a physiologically normal level.

The present invention relates to a DNA construct encoding one or more human IGF-1 isoforms that can be used for treatment of neuropathy. Further provided herein are a pharmaceutical composition including the DNA construct as an active ingredient and a method of administering the DNA construct for treatment of neuropathy. The present invention provides a safe and effective way of treating neuropathic patients.

Described herein are compositions comprising AAV vectors comprising a sequence encoding mucolipin 1, and methods of use thereof for gene therapy of Mucolipidosis IV (MLIV).

Herein is reported a nucleic acid comprising in 5′ to 3′ direction i) a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon, ii) a second nucleic acid fragment operably linked to said first nucleic acid fragment which is beginning with the 5′ splice donor site of an immunoglobulin heavy chain CH3 or CH4 domain and which is terminated by the 3′ splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1 and which comprises in frame translational stop codon and a polyadenylation signal, and iii) a third nucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane domain, wherein the second nucleic acid fragment has at its 3′ terminus the nucleotide sequence CTACCACCCCCTTCCTGTCCAG (SEQ ID NO: 29) or TGACCACGCCAATCGTGTCCAG (SEQ ID NO: 14) or CTACCACGCCAATCGTGTCCAG (SEQ ID NO: 31).