C12N2320/51

Angiotensinogen (AGT) iRNA compositions and methods of use thereof

The present invention relates to RNAi agents, e.g., double-stranded RNAi agents, targeting the angiotensinogen (AGT) gene, and methods of using such RNAi agents to inhibit expression of AGT and methods of treating subjects having an AGT-associated disorder, e.g., hypertension.

Modified double-stranded RNA agents

One aspect of the present invention relates to double-stranded RNA (dsRNA) agent capable of inhibiting the expression of a target gene. The sense strand of the dsRNA agent comprises at least one thermally destabilizing nucleotide, and at least one said thermally destabilizing nucleotide occurring at a site opposite to the seed region (positions 2-8) of the antisense strand; and the antisense strand of the dsRNA agent comprises at least two modified nucleotides that provide the nucleotide a steric bulk that is less than or equal to the steric bulk of a 2′-OMe modification, wherein said modified nucleotides are separated by 11 nucleotides in length. Other aspects of the invention relates to pharmaceutical compositions comprising these dsRNA agents suitable for therapeutic use, and methods of inhibiting the expression of a target gene by administering these dsRNA agents, e.g., for the treatment of various disease conditions.

CRISPR-based compositions and methods of use

This invention pertains to modified compositions for use in CRISPR systems, and their methods of use. In particular, length-modified and chemically-modified forms of crRNA and tracrRNA are described for use as a reconstituted guide RNA for interaction with Cas9 of CRISPR systems. The resultant length-modified and chemically-modified forms of crRNA and tracrRNA are economical to produce and can be tailored to have unique properties relevant to their biochemical and biological activity in the context of the CRISPR Cas9 endonuclease system.

PRODUCTS AND COMPOSITIONS

The present invention relates to products and compositions and their uses. In particular the invention relates to nucleic acid products that interfere with target gene expression or inhibit target gene expression and therapeutic uses of such products.

COMPOSITIONS AND METHODS FOR DETECTING AND TREATING INSULIN RESISTANCE
20220282251 · 2022-09-08 ·

A miR-1983 inhibitor comprising an anti-miR-1983 oligonucleotide that is complementary to at least part of CTCACCTGGAGCATGTTTTCT (SEQ ID NO: 1), the part comprising at least nucleotides 2 to 8 of CTCACCTGGAGCATGTTTTCT (SEQ ID NO: 1).

Polynucleotides containing a morpholino linker

The disclosure provides polynucleotides encoding a polypeptide including a morpholino linker. In some embodiments, the polynucleotides of the invention have increased stability compared to wild-type polynucleotides.

COMPOSITIONS AND METHODS FOR INHIBITING PCSK9

Provided herein, inter alia, are dsRNA compositions targeting PCSK9, methods of inhibiting PCSK9 gene expression, and methods of treating one or more diseases associated with PCSK9 gene expression.

Modulation of frataxin expression

Certain embodiments are directed to methods and compounds for increasing FXN. Such methods and compounds are useful for increasing expression of FXN in cells and animals.

Modified RNAi agents

One aspect of the present invention relates to double-stranded RNAi (dsRNA) duplex agent capable of inhibiting the expression of a target gene. The dsRNA duplex comprises one or more motifs of three identical modifications on three consecutive nucleotides in one or both strand, particularly at or near the cleavage site of the strand. Other aspects of the invention relates to pharmaceutical compositions comprising these dsRNA agents suitable for therapeutic use, and methods of inhibiting the expression of a target gene by administering these dsRNA agents, e.g., for the treatment of various disease conditions.

COMPLEMENT COMPONENT iRNA COMPOSITIONS AND METHODS OF USE THEREOF
20220213486 · 2022-07-07 ·

The invention relates to iRNA, e.g., double-stranded ribonucleic acid (dsRNA), compositions targeting the complement factor B (CFB) gene, the complement component C3 gene, and the complement component C9 gene and methods of using such iRNA, e.g., dsRNA, compositions to inhibit expression of CFB, C9 and/or C3 and to treat subjects having a complement component-associated disease, e.g., paroxysmal nocturnal hemoglobinuria and atypical hemolytic uremic syndrome.