The present invention relates in part to nucleic acids encoding proteins, nucleic acids containing non-canonical nucleotides, therapeutics comprising nucleic acids, methods, kits, and devices for inducing cells to express proteins, methods, kits, and devices for transfecting, gene editing, and reprogramming cells, and cells, organisms, and therapeutics produced using these methods, kits, and devices. Methods for inducing cells to express proteins and for reprogramming and gene-editing cells using RNA are disclosed. Methods for producing cells from patient samples, cells produced using these methods, and therapeutics comprising cells produced using these methods are also disclosed.

The present invention discloses formulation of a serum-free medium used for human pluripotent stem cells, which comprises the following raw materials: inorganic salt components, organic components, amino acids and amino acid salts, energy substances and metabolic intermediates, vitamins and antioxidants, proteins and polypeptides, trace elements and chromogenic substances; while the culture process comprises the following steps: selecting a basic formulation, performing combination screening, identifying and evaluating results, and testing a new formulation of culture; and proportioning according to the following methods: adding aforesaid raw materials into 950 ml of water for injection, stirring gently until dissolved, and finally adding 2.438 g of sodium bicarbonate, and stirring gently until dissolved, and then adding 1 liter of water for injection, adjusting the pH to the desired value with 1 mol/L sodium hydroxide solution or 1 mol/L hydrochloric acid solution, finally filtering sterilized with 0.1 μm diameter filter under positive pressure, and storing the medium solution in dark place at 2° C.-8° C., the invention solves the problem of high cost of domestic import of serum-free formulation.

Disclosed herein are methods and materials for transdifferentiating mesenchymal stem cells into neural progenitor cells.

Methods of generating definitive hematopoietic cells from source cells including at least one of: differentiating iPS cells, cells directly reprogrammed to pre-cursors of hematopoietic cells, cells directly reprogrammed to definitive hematopoietic cells, and adult or neonatal hematopoietic cells from bone marrow, cord blood, placenta, or mobilized peripheral blood, the method including using a metabolic regulator to activate a tricarboxylic acid cycle of the source cells. Other methods relate to generating primitive hematopoietic cells from source cells including at least one of: differentiating iPS cells, cells directly reprogrammed to pre-cursors of hematopoietic cells, cells directly reprogrammed to definitive hematopoietic cells, and adult or neonatal hematopoietic cells from bone marrow, cord blood, placenta, or mobilized peripheral blood, the method including using a metabolic regulator to inhibit a tricarboxylic acid cycle of the source cells. Some aspects relate to a metabolic regulator for activation of a tricarboxylic acid cycle of source cells for the production of definitive or primitive hematopoietic cells.

Disclosed are methods for preparing retinal pigment epithelium (RPE) cells from pluripotent stem cells (PSCs). More particularly, it represents an automated method that combines in a sequential manner three differentiating agents to direct the differentiation of human PSCs into RPE cells.

The current teachings are directed to virus free cells lines derived from virus-contaminated starting material, such as an organism or a cell line. Methods for obtaining virus free cell lines obtained from virus-contaminated starting material are also provided. Exemplary virus free cell lines include: cell lines derived from a Spodoptera frugiperda cell line contaminated with Sf-rhabdovirus, wherein the cell lines lack Sf-rhabdovirus; and cell lines derived from a Trichoplusia ni cell line contaminated with an alphanodavirus, wherein the cell line lacks an alphanodavirus.

The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.

The present invention provides a chromosome-stabilizing agent for stem cells containing a β-nicotinamide mononucleotide or a pharmaceutically acceptable salt thereof, or a solvate thereof, as an active ingredient. The present invention also provides a culture method for stem cells, including culturing stem cells in a culture medium containing a β-nicotinamide mononucleotide or a pharmaceutically acceptable salt thereof, or a solvate thereof.

The present disclosure provides methods and compositions for generating populations of auxotrophic cells and populations of differentiated cells and selecting populations of transfected cells using split auxotrophy.

The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.