This invention relates to inhibition of the complement signaling using an anti-C5 antibody. Specifically, the invention relates to methods of treating a complement-mediated disease or complement-mediated disorder in an individual by contacting the individual with an anti-C5 antibody.

This invention relates to inhibition of the complement signaling using an anti-C5 antibody. Specifically, the invention relates to methods of treating a complement-mediated disease or complement-mediated disorder in an individual by contacting the individual with an anti-C5 antibody.

The present invention relates to a CD24 protein for treating immune-related adverse events (irAEs) associated with cancer immunotherapy. Provided herein is a method of treating, mitigating, minimizing, or preventing immunerelated adverse events (irAEs) associated with a cancer immunotherapy by administering a CD24 protein to a subject in need thereof. The irAE may be diarrhea or another gastrointestinal disorder, pure red cell aplasia, microcytic anemia, lupus, autoimmune nephritism, autoimmune hepatitis, pneumonitis, myocarditis, pericarditis, endocrinopathy, Addison's disease, hypogonadism, Sjogren's syndrome, or type I diabetes. The CCD24 protein may comprise a mature human CD24 or a variant thereof.

Described herein are hybrid antibodies targeted for use in the treatment of cancer. The antibodies have binding capabilities for Fcε receptors and the neonatal Fc receptor, which may be achieved e.g. by replacing sequences or amino acids in IgE constant domain with corresponding sequences and amino acids derived from IgG.

Herein is reported a nucleic acid comprising in 5′ to 3′ direction i) a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon, ii) a second nucleic acid fragment operably linked to said first nucleic acid fragment which is beginning with the 5′ splice donor site of an immunoglobulin heavy chain CH3 or CH4 domain and which is terminated by the 3′ splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1 and which comprises in frame translational stop codon and a polyadenylation signal, and iii) a third nucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane domain, wherein the second nucleic acid fragment has at its 3′ terminus the nucleotide sequence CTACCACCCCCTTCCTGTCCAG (SEQ ID NO: 29) or TGACCACGCCAATCGTGTCCAG (SEQ ID NO: 14) or CTACCACGCCAATCGTGTCCAG (SEQ ID NO: 31).

Described herein are hybrid antibodies targeted for use in the treatment of cancer. The antibodies have binding capabilities for Fcε receptors and Fcγ receptors, which may be achieved e.g. by grafting heavy chain constant domain sequences (e.g. CH2 and CH3 domains) derived from IgG to IgE.

The invention provides novel heterodimeric proteins including heterodimeric antibodies.

The invention relates to anti-PSMA antibodies comprising a heavy chain constant region comprising one or more amino acid substitutions compared to a wild-type IgG, wherein the one or more amino acid substitutions reduce the affinity of the antibody for the neonatal Fc receptor (FcRn), thereby reducing the serum half-life of the modified antibody compared to a wild-type antibody of class IgG. The one or more amino acid modification having the effect of reducing FcRn binding is selected from positions His310, His433, His435, His436, Ile253. Antibodies of the present invention are particularly suited for use in radioimmunotherapy.

Described herein are polypeptides and antibodies comprising a variant Fc region. The variant Fc region provides for stabilized Fc-Fc interactions when the polypeptide(s), antibody or antibodies are bound to its target, antigen or antigens on the surface of a cell, while at the same time also having decreased complement-dependent cytotoxicity (CDC) and may also have decreased activation of other effector functions resulting from one or more amino acid modifications in the Fc region.

This disclosure provides a method of preventing, alleviating or treating a condition (i.e., neutropenia) in a subject in need thereof, the condition characterized by compromised white blood cell production in the subject. The method includes administering to the subject a therapeutically effective amount of a protein complex on the same day as a chemotherapy regimen, wherein the protein complex is a modified human granulocyte-colony stimulating factor (hG-CSF) covalently linked to an immunoglobulin Fc region via a non-peptidyl polymer. The non-peptidyl polymer is site-specifically linked to an N-terminus of the immunoglobulin Fc region, and the modified hG-CSF comprises substitutions in at least one of Cys17 and Pro65.