The present invention provides improved and/or shortened methods for expanding TILs and producing therapeutic populations of TILs, including novel methods for expanding TIL populations in a closed system that lead to improved efficacy, improved phenotype, and increased metabolic health of the TILs in a shorter time period, while allowing for reduced microbial contamination as well as decreased costs. Such TILs find use in therapeutic treatment regimens.

Disclosed are improved methods for manufacturing large-scale populations of robust, highly pure, and functional T regulatory cells (Tregs). Also disclosed are expanded Treg populations, cryopreserved Treg populations and methods and uses of these cells in compositions formulated for treating one or more mammalian diseases, including, for example, treatment, prophylaxis, and/or amelioration of one or more symptoms of a human neurodegenerative disorder. In particular, the compositions and methods provided herein find clinical use in the treatment and amelioration of one or more symptoms of amyotrophic lateral sclerosis (ALS), Alzheimer's disease, and other neurological diseases and disorders.

Provided are a novel compound having CDK8 and/or CDK19 inhibitory activity, and a production method for Tregs. The treatment of T cells with a CDK8 and/or CDK19 inhibitor induces Foxp3 in the T cells. Foxp3.sup.+ T cells can be induced by treating Foxp3.sup.− T cells with the CDK8 and/or CDK19 inhibitor in vitro. Thus, Tregs can be induced.

Provided herein are methods and compositions related to a method of stimulating the immune system in a subject in need thereof by administering an agent that increases the level or activity of indoleamine 2,3-dioxygenase (IDO1) and/or aryl hydrocarbon receptor (Ahr).

Methods for production of platelets from pluripotent stem cells, such as human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs) are provided. These methods may be performed without forming embryoid bodies or clusters of pluripotent stem cells, and may be performed without the use of stromal inducer cells. Additionally, the yield and/or purity can be greater than has been reported for prior methods of producing platelets from pluripotent stem cells. Also provided are compositions and pharmaceutical preparations comprising platelets, preferably produced from pluripotent stem cells.

The present invention relates to methods for expanding TILs from tumor tissue using a long first expansion process and a shorter second expansion process. A method for expanding TIL includes obtaining a first population of TILs from a tumor resected from a subject, performing a first expansion for a period of about 21 day to about 35 days by culturing the first population of TILs in a cell culture medium comprising 4-1BB agonist, IL-2, and OKT-3 to produce a second population of TILs, and performing a second expansion for a period of about 7 days to about 10 days by supplementing the cell culture medium of the second population of TILs with antigen presenting cells (APCs) and additional 4-1BB agonist, IL-2, and OKT-3, and culturing to produce a third population of TILs, wherein the third population of TILs is a therapeutic population of TILs.

The present disclosure provides methods for re-stimulating TIL populations that lead to improved phenotype and increased metabolic health of the TILs and provides methods of assaying for TIL populations to determine suitability for more efficacious infusion after re-stimulation.

The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.

The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method.

Provided are a novel compound having CDK8 and/or CDK19 inhibitory activity, and a production method for Tregs. The treatment of T cells with a CDK8 and/or CDK19 inhibitor induces Foxp3 in the T cells. Foxp3.sup.+ T cells can be induced by treating Foxp3.sup.− T cells with the CDK8 and/or CDK19 inhibitor in vitro. Thus, Tregs can be induced.