The present disclosure relates to tunable biocircuit systems for the development of controlled and/or regulated therapeutic systems. In particular, regulatable biocircuits containing destabilizing domains (DD) derived from mutant human cGMP-specific phosphodiesterase type 5 (PDE5) are disclosed. Especially, the present disclosure provides an effector module. Such effector module may include (a) a stimulus response element (SRE), wherein the SRE is a DD, said DD comprising at least one mutation relative to cGMP-specific 3′,5′-cyclic phosphodiesterase (hPDE5; SEQ ID NO: 1) and (b) at least one payload, which is attached, appended or associated with said SRE. The SRE may be responsive to one or more stimuli.

The present disclosure provides compositions and methods related to transcription factor systems. Such systems provide for modular and tunable protein expression driven by regulated transcriptional activity.

The present disclosure provides methods of treating a subject having a liver disease or type 2 diabetes, and methods of identifying subjects having an increased risk of developing a liver disease or type 2 diabetes.

A nucleic acid complex having a novel structure, which may introduce a bioactive nucleic acid into cells, a composition for treating or diagnosing disease including the same, and a method of regulating target gene expression using the same, are described. The nucleic acid complex may include a bioactive nucleic acid, which includes a material for facilitating endosomal escape, and a carrier peptide nucleic acid, complementarily bound to each other, as useful in a composition for treating or diagnosing disease, or a composition for regulating target gene expression. Such nucleic acid complex may increase the stability of the bioactive nucleic acid, reduce loss of the bioactive nucleic acid, such as precipitation caused by self-aggregation, increase the intracellular delivery efficiency of the bioactive nucleic acid, and easily regulate target gene expression.

The present invention relates to a modified T regulatory cell (Treg) in which the level of microRNA miR-142-5p (CAUAAAGUAGAAAGCACUACU) or a variant thereof is increased or decreased. Therapeutic uses of said modified Tregs are also provided, in particular in the treatment of autoimmune diseases and cancer. Populations of said Tregs and methods of preparing such Tregs are also provided.

Nervous system trauma and neurodegeneration including in optic neuropathies are treated by administration of an effective dose of a PDE4D3 displacing agent to promote neurite extension, neuroprotection and recovery. In some embodiments the neurons are optic neurons, including without limitation retinal ganglion cells (RGCs). A cAMP signaling compartment restricted by mAKAPα-anchored PDE4D3 directly regulates neuronal phenotype, and can be molecularly manipulated with therapeutic effect.

The present disclosure features methods for identifying pateints having a hyperproliferative disease, disorder, or condition responsive to phosphodiesterase 3 (PDE3) and schlafen family member 12 (SLFN12) complex formation. The hyperproliferative disease, disorder, or condition may be cancer in a patient including glioblastoma, melanoma, ovarian cancer, cervical cancer, sarcoma, or hematopoietic cancers, such as acute myeloid leukemia. Those responsive diseases, disorders, or conditions may be identified using the biomarker AIP and/or TRRAP in combination with those biomarkers pertinent to phosphodieseterase 3 and schlafen family member 12 complexes which may be formed by PDE3 modulation with certain active compounds. Expression of combinations of these biomarkers have been shown to correlate with active compound (e.g., PDE3 modulator, PDE3A modulator, PDE3B modulator) sensitivity.

Materials and methods are provided herein for detecting the presence of an autoantibody specific for PDE10A to identify the mammal as having an autoimmune neurological disorder as well as methods and materials for treating an autoimmune neurological disorder. Materials and methods also are provided herein for treating cancer and/or neurological autoimmunity in a mammal using an immune checkpoint inhibitor and detecting the presence of an autoantibody specific for PDE10A to monitor for the development of neurologic complications in the mammal.

Provided are methods of treating epilepsy. The methods include administering to an individual having epilepsy a therapeutically effective amount of a phosphodiesterase 4 (PDE4) inhibitor. Also provided are methods of identifying an anti-epileptic agent. Such methods include contacting a PDE4 polypeptide with a candidate agent in a PDE4 activity assay, where inhibition of activity of the PDE4 polypeptide by the candidate agent identifies the candidate agent as an anti-epileptic agent.

Disclosed are chimeric antigen receptor (CAR) polypeptides comprising a T cell receptor (TCR) antigen binding domain, a transmembrane domain, and an intracellular signaling domain. Disclosed are methods of making a CART cell comprising obtaining a cell from a subject diagnosed with T cell lymphoma; determining the sequence of the TCR on the cell; and transducing a T cell with a vector comprising a nucleic acid sequence that encodes a CAR polypeptide, wherein the CAR polypeptide comprises a TCR antigen binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the TCR antigen binding domain is specific to a subsequence of the sequence of the TCR on the cell identified in the step of determining the sequence of the TCR