TRAIL CELL-PENETRATING PEPTIDE-LIKE MUTANT MUR5, PREPARATION METHOD AND APPLICATION THEREOF
20170247427 · 2017-08-31
Inventors
- Shouchun Chen (Chengdu, Sichuan, CN)
- Juan Yan (Chengdu, Sichuan, CN)
- Qi Xu (Chengdu, Sichuan, CN)
- Xianzhou Huang (Chengdu, Sichuan, CN)
- Lijia Wei (Chengdu, Sichuan, CN)
- Haiyang Hu (Chengdu, Sichuan, CN)
Cpc classification
C12N15/74
CHEMISTRY; METALLURGY
C07K14/70578
CHEMISTRY; METALLURGY
C12P21/02
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C07K14/705
CHEMISTRY; METALLURGY
C12N15/74
CHEMISTRY; METALLURGY
Abstract
A TRAIL cell-penetrating peptide (CPPs)-like mutant MuR5 and a preparation method and the application thereof. The amino acid sequence of said mutant is SEQ ID NO: 2. The TRAIL CPPs-like mutant selectively transforms the amino acid coding sequence of No. 114-118 of the outer fragment of the TRAIL wild-type protein cell membrane from VRERG to RRRRR, i.e., mutates valine into arginine on the 114.sup.th coding sequence, glutamic acid into arginine on the 116.sup.th coding sequence and glycine into arginine on the 118.sup.th coding sequence, turning the coding sequence of N-terminal of the mutant protein into that of five arginines and making it a protein containing CPPs-like structure. Having a superior therapeutic effect on different types of tumor, the TRAIL CPPs-like mutant is a new generation of high-efficient drug for inducing tumor apoptosis of much potential.
Claims
1. A TRAIL CPPs-like mutant, wherein, the amino acid sequence of the mutant is SEQ ID NO: 2.
2. The TRAIL CPPs-like mutant according to claim 1, wherein, the TRAIL CPPs-like mutant selectively transforms the amino acid coding sequence of No. 114-118 of the outer fragment of TRAIL wild-type protein cell membrane from VRERG to RRRRR, i.e., mutates valine into arginine on the 114.sup.th coding sequence, glutamic acid into arginine on the 116.sup.th coding sequence and glycine into arginine on the 118.sup.th coding sequence, turning the coding sequence of N-terminal of the mutant protein into that of five arginines and making it a protein containing CPPs-like structure.
3. The TRAIL CPPs-like mutant according to claim 1, wherein, the cDNA sequence of the mutant is coded as SEQ ID NO: 1.
4. The TRAIL CPPs-like mutant according to claim 3, wherein, a kit for amplifying the mutant comprises the following primers: TABLE-US-00010 Upstream primer MuR5-TR-NdeI: GGTCATATGCGTCGTCGTCGTCGTCCGCAGCGTGTGGCTGCTCAC Downstream primer TR-Eco-R: GTTGAATTCT TATTAACCAA CAAGGAAAGC ACCGAAGAAA G.
5. A preparation method of the TRAIL CPPs-like mutant, comprising the following steps: (1) amplificating and cloning cDNA fragment; wherein, the cDNA sequence is SEQ ID NO: 1; (2) constructing and identifying expression vector; (3) fusion expressing the recombinant TRAIL protein; (4) purifying the TRAIL protein; (5) identifying the TRAIL protein.
6. The preparation method of the TRAIL CPPs-like mutant according to claim 5, wherein, the constructing and identifying expression vector in Step (2) comprises the following steps: (a) excising the sequence of fusion tag in the prokaryotic expression vector; (b) cloning the optimized coded TRAIL CPPs-like mutant protein with the cDNA sequence as SEQ ID NO: 1 onto the prokaryotic expression vector to obtain a high-efficient soluble non-fusion expression.
7. The preparation method of the TRAIL CPPs-like mutant according to claim 5, wherein, the prokaryotic expression vector in Step (b) is pET 32a.
8. The preparation method of the TRAIL CPPs-like mutant according to claim 5, wherein, during fusion expressing the recombinant TRAIL protein in Step (3), the inducing temperature is 18-24° C.
9. The preparation method of the TRAIL CPPs-like mutant according to claim 5, wherein, purifying the TRAIL protein in Step (4) comprises the following steps: taking cation exchange resin SP Sepharose Fast Flow as the primary purification to capture the target protein from the supernatant after bacteria breaking; taking gel chromatography resin Sephadex G-25 medium as the secondary moderate purification to further improve the protein purity and remove the endotoxin; and taking anion exchange resin Q Sepharose Fast Flow as the final polishing purification.
10. The application of the TRAIL CPPs-like mutant according to claim 1 in preparation of antineoplastic drugs.
11. The application of the TRAIL CPPs-like mutant according to claim 2 in preparation of antineoplastic drugs.
12. The application of the TRAIL CPPs-like mutant according to claim 3 in preparation of antineoplastic drugs.
13. The application of the TRAIL CPPs-like mutant according to claim 4 in preparation of antineoplastic drugs.
14. The application of the TRAIL CPPs-like mutant according to claim 5 in preparation of antineoplastic drugs.
15. The application of the TRAIL CPPs-like mutant according to claim 6 in preparation of antineoplastic drugs.
16. The application of the TRAIL CPPs-like mutant according to claim 7 in preparation of antineoplastic drugs.
17. The application of the TRAIL CPPs-like mutant according to claim 8 in preparation of antineoplastic drugs.
18. The application of the TRAIL CPPs-like mutant according to claim 9 in preparation of antineoplastic drugs.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0039] In order to illustrate the technical schemes in the embodiments of the Invention or in prior art more clearly, the drawings required in description of the embodiments or prior art will be introduced briefly as follows. Obviously, the drawings described below are just a part of the embodiments of the Invention. A person skilled in the art is able to obtain other drawings according to these drawings without any creative work.
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0047] A clear and full description of the technical schemes of the embodiments of the Invention will be given as follows. Obviously, the described embodiments are just a part rather than the whole of the embodiments of the Invention. Based on the embodiments of the Invention, any other embodiments obtained by a person skilled in the art without any creative work will fall within the protection scope of the Invention.
[0048] Design Thought of Apo2L/TRAIL CPPs-Like Mutant
[0049] The final effective core part of apoptosis protein is within the cell membrane, and the cell membrane is a biological barrier for therapeutic bioactive substance being transferred into cell. The bioactive molecule cannot enter the cell membrane freely due to the hydrophilia of apoptosis protein, thus the function and practical application will be limited. As a kind of positively charged cationic short peptide containing 20-30 amino acids with the function of cell membrane penetration, CPPs is a new technology for drug transportation and delivery that has been developed in recent decades. It is also called protein transduction domain (PTD).
[0050] In 1988, Green and Frankel have firstly verified that the trans-activating protein TAT of human immunodeficiency virus (HIV-1) can be transferred into cytoplasm and cell nucleus cross the membrane. One of the TAT polypeptide (GRKKRRQRRRGY) containing rich arginine has the function of cell-penetrating transduction protein, and can mediate various multi-source substances as gene, protein, polypeptide and chemosynthetic nano-particles into cell membrane and even cell nucleus. Later, drosophila-homeosis transcription factor ANTP, herpes simplex virus type I (HSV-1), transcription factor VP22, Transpotan and polyarginine sequences were found one after another having the function of cell membrane penetration. At present, hundreds of peptide fragments were found having the function of cell membrane penetration.
[0051] The CPPs can be divided into different types according to different standard. At an early stage, CPPs, according to the structural features, have been simply divided into two types as (1) the CPP containing abundant cation with no typic structure, such as TAT and penetratin; (2) amphiphilic α helical peptide from protein signal sequence. According to the sources, CPPs have been divided into two types as natural presence and artificially synthesized and further been divided into three types as (1) CPPs from protein, such as penetratin, TAT and pVEC. They normally have a smallest valid fragment to transport protein, i.e., protein transduction part and membrane ectopic sequence. (2) Model CPPs, such as MAP and Arg (7), which are artificially synthesized for forming a definite amphiphilic α helical peptide or simulating a known CPP structure. The polyarginine and polylysine synthesized according to the CPP structure have a stronger ability of cell membrane penetration than the transduction activity of TAT protein. (3) Artificially designed and synthesized CPPs, such as PEP-1, MPG and Transportan, which are mostly chimeric polypeptides, containing 1 hydrophobic part and 1 hydrophilic part. For example, PEP-1 (KETWW ETWWT EWSQP KKKRK V) contains a fragment full of hydrophobicity tryptophan sequence (KETWW ETWWT EW), a spacer region (SQP) and a region full of hydrophilic lysine sequence (KKKRKV). Such peptide fragment has more advantages. With no need of covalent linkage with target macromolecular, PEP-1 can directly mix with the target macromolecular and then import the protein of native conformation into cells efficiently.
[0052] The key structure of the amino acid having a cell-penetrating functional peptide is that the main molecular components are alkaline amino acids such as arginine, lysine and histidine Alkaline amino acid is a key character of the composition of this kind of cell-penetrating protein. Such amino acid is with strong positive charges, which may have interaction with the cell membrane lipid molecules with negative charge and thus mediate the process of membrane penetration, wherein, the arginine residue plays an important role in protein cellular internalization. At present, there are two points of view with regard to the action mechanism of polyarginine transducing protein into cells as: 1. directly transducing protein into cells through ostioles temporally formed by arginine in the cell membrane and lipid bilayers; 2. transducing protein into cells through cell endocytosis mediated in various forms, including macropinocytosis, caveolin-mediated, clathrin-mediated, phagocytosis and endosome-exchange mechanisms. TRAIL induces the aggregation and redistribution of TRAIL induced DRs in micro domain of upper lipid raft of tumor cell membrane, collects Fas-associated death domain (FADD) and Caspase-8 with or without endocytosis of TRAIL-DR4/5 complex for assembling into a death inducing signaling complex (DISC), and enable the cascade process of apoptotic effect by lysing Caspase-8. Most literatures hold that the internalization of TRAIL-DR4/5 complex is necessary for sustaining amplification of apoptotic signal. Traditionally, foreign protein and CPP are fusion expressed. The expressed fusion protein may change the spatial conformation of protein molecule and thus make it lose biological activity. In addition, the fusion protein increases the biological activity of original protein molecule and brings about safety risks.
[0053] Code several amino acids at the N-terminal of amino acid sequence through selective mutation of soluble fragments (114-281aa) of TRAIL protein, make TRAIL form a similar CPPs-like amino acid sequence, i.e., conduct CPPs-like mutation to TRAIL. At present, more than 10 different CPPs-like mutants have been obtained. The Invention breaks through the original design thought of CPP fusion protein, selectively mutates the valine on the 114.sup.th coding sequence, the glutamic acid on the 116.sup.th coding sequence and the glycine on the 118.sup.th coding sequence into arginine at the N-terminal of the amino acid coding sequence of No. 114-281 of the outer fragment of TRAIL wild-type protein cell membrane, turning the amino acid of No. 114-118 into the sequence of five continuous arginines. The endogenous sequence of five continuous arginines changes the amino acid sequence at the N-terminal of the outer fragment of TRAIL to the minimal extent (maintaining the original 115.sup.th and 117.sup.th arginine sequence), maintains the spatial conformation and biological activity of TRAIL protein to the largest extent and structures a sequence of five continuous arginines with the function of membrane penetration. The CPPS-like mutant of the Invention is named as TRAIL-MuR5. CPPs-like mutant is a brand new design thought of a CPP fusion protein.
Embodiment 1
Sequence and Primer Design of TRAIL CPPs-Like Mutant
[0054] The mutant selectively transforms the amino acid coding sequence of No. 114-118 of the outer fragment of TRAIL wild-type protein cell membrane from VRERG to RRRRR at 3 mutational sites, i.e., mutates valine into arginine on the 114.sup.th coding sequence, glutamic acid into arginine on the 116.sup.th coding sequence and glycine into arginine on the 118.sup.th coding sequence, turning the coding sequence of N-terminal of the mutant protein into that of five arginines, and making it a protein containing CPPs-like structure.
[0055] The cDNA of the coded mutant is SEQ ID NO: 1 and the mutant amino acids SEQ ID NO: 2.
[0056] The primers are compounded as follow:
[0057] Upstream primer MuR5-TR-NdeI is shown as SEQ ID NO: 3;
[0058] Downstream primer TR-Eco-R is shown as SEQ ID NO: 4;
Embodiment 2
[0059] PCR Amplifies TRAIL-MuR5 Fragment and Ligates to pET32a; Picking and Identification of Single Colony of Ligation Products
[0060] Taking pMD19/TRAIL plasmid as a template, PCR mutation amplifies TRAIL-MuR5 fragment. Perform double digests with NdeI and EcoRI respectively to TRAIL-MuR5 target fragment and vector pET32a. Ligate the TRAIL-MuR5 fragment to the vector pET32a with Trx fusion tag sequence excised and transform it into Top10 competent cell; pick monoclone for double enzyme digestion identification with XbaI and EcoRI. Refer to Embodiment 1 for the design of primer. The original sequence of pMD19/TRAIL plasmid is derived from NCBI Reference Sequence: NM_003810.3; the vector pET32a is derived from Invitrogen.
Experimental Procedures
[0061] I. PCR Amplifies TRAIL-MuR5 Target Fragment
[0062] 1. Taking pMD19/TRAIL plasmid as a template, MuR5-TR-NdeI/TR-Eco-R primer pair amplifies TRAIL-MuR5 target fragment. Prepare reaction system according to Table 1; the reaction system is of 50 μl.
TABLE-US-00002 TABLE 1 TRAIL-MuR5 PCR reaction system (50 μl) Reagent Reaction system Purified pMD19/TRAIL plasmid 1 μl 10xEx Taq Buffer (Mg.sup.2+ free) 5 μl dNTP Mix (2.5 mM each) 4 μl 25 mM MgCl.sub.2 3 μl TaKaRa Ex Taq 1 μl Primer MuR5-TR-NdeI (10 pmol/μl) 1 μl Primer TR-Eco-R (10 pmol/μl) 1 μl RNase-Free Water 34 μl
[0063] 2. Collect the solution into the bottom of pipe after briefly centrifugation when vortex shock is blended.
[0064] 3. Refer to Table 2 for reaction conditions of PCR amplification.
TABLE-US-00003 TABLE 2 TRAIL-MuR5 PCR reaction conditions Steps Temperature Time Predegeneration 94° C. 1 min Degeneration 94° C. 15 s Annealing 58° C. 15 s {close oversize brace} 25 cycles Extension 72° C. 30 s Final extension 72° C. 3 min
[0065] 4. Electrophoresis; take pictures.
[0066] 5. Conduct gel extraction on the PCR amplified TRAIL-MuR5 target fragment with the Omega Gel Extraction Kit; elute it with 50 μl of ultrapure water; conduct electrophoresis, take pictures; reserve for standby.
[0067] II. TRAIL-MuR5 Target Fragment Ligates to pET32a Plasmid after Double Enzyme Digestion
[0068] 1. Perform double digests on vectors and target gene fragments with NdeI and EcoRI; see table 3 for enzyme digestion system; the reaction system is of 100 μl.
TABLE-US-00004 TABLE 3 Double enzyme digestion system of TRAIL-MuR5 and pET32a (100 μl) Reagent Volume Name of DNA pET32a plasmid TRAIL-MuR5 DNA DNA 50 μl 45 μl NdeI 5 μl 3 μl EcoRI 5 μl 3 μl 10xH Buffer 10 μl 10 μl dH2O 30 μl 39 μl
[0069] 2. Place the Ep tube into a multi-purpose incubator at 30° C. for 2 hours.
[0070] 3. Conduct gel extraction with the OMEGA Gel Extraction Kit; elute the vector and the target fragment with 30 μl of ultrapure water. Conduct electrophoresis; take pictures.
[0071] 4. Ligate the target fragment to the vector after gel extraction; see Table 4 for the ligation system.
TABLE-US-00005 TABLE 4 Ligation reaction system of TRAIL-MuR5 and pET32a (10 μl) Reagent Reaction system Vector (pET32a) 1 μl TRAIL-MuR5 4 μl Ligase (sol I) 5 μl
[0072] 5. Incubate overnight in metal bath at 16° C.
[0073] 6. Add 100 μl of Top10 competent cell into 10 μl of ligation product for 30 min of ice-bath.
[0074] 7. Conduct thermal shock for 90 s in water bath at 42° C.
[0075] 8. Incubate on ice for 2 min.
[0076] 9. Add 500 μl of SOC culture medium and conduct shaking cultivation for 45 min at 37° C. 10.
[0077] After centrifugation of transformed competent cell, discard 400 μl and set aside about 100 μl as culture medium on clean bench. 11. Even the bacteria by blowing, and coat all bacteria on the LB solid medium containing Amp for overnight cultivation at 37° C.
[0078] III. Picking of Single Colony and Enzyme Digestion Identification
[0079] (I) Picking of Single Colony
[0080] 1. Prepare multiple sterilized test tubes and add 100 ml of ampicillin LB fluid medium into each tube.
[0081] 2. Put the about 4 ml of culture medium into each test tube.
[0082] 3. Clamp up sterile tips with the fully burned tweezers and pick up the bacterial colony grown on the plate. Pick 10 bacterial colonies from the pET32a/TRAIL-MuR5 μlate. Put the tips into the test tubes with LB culture medium.
[0083] 4. Tie up each test tube and fasten them on shaking table fixtures. Shake overnight at 37° C., 220 rpm.
[0084] (II) Plasmid Extraction
[0085] 1. Take 1 ml of each bacteria liquid and add it into centrifuge tubes respectively. 10000 g, centrifuge for 1 min; suck out the supernatant as far as possible.
[0086] 2. Add 250 μl of Solution I (add RNAase A in advance) into the centrifuge tube with bacteria sediment, deposit all suspended bacteria completely.
[0087] 3. Add with 250 μl of Solution II and blend it gently for fully lysis of bacteria. Then the bacteria liquid becomes clear and thick. Finish this step in 5 min.
[0088] 4. Add 350 μl of Solution III into the centrifuge tube for blending reversely immediately, then white flocculent sediment appears. 13000 g, centrifuge for 10 min; then sediment is formed at the bottom of centrifuge tube.
[0089] 5. Equally split the supernatant obtained in Step 5 and put them into two HiBind Miniprep adsorption columns which have been put into collecting pipes. Do not suck out sediment. 10000 g, centrifuge for 1 min; discharge the waste liquid in the collecting pipes and put the adsorption columns back into the collecting pipes.
[0090] 6. Add 500 μl of Buffer HB into the collecting pipes; 10000 g, centrifuge for 1 min; discharge the waste liquid in the collecting pipes and put the adsorption columns back into the collecting pipes.
[0091] 7. Add 700 μl of Wash Buffer into the collecting pipes; 10000 g, centrifuge for 1 min; discharge the waste liquid in the collecting pipes and put the adsorption columns back into the collecting pipes.
[0092] 8. Repeat Step 7.
[0093] 9. Put the adsorption columns back into the collecting pipes; 13000 g, centrifuge for 2 min; dry the adsorption columns and discharge the waste liquid in the collecting pipes.
[0094] 10. Place each adsorption column into a new Ep tube of 1.5 ml; drop 65 μl of Elution Buffer into the intermediate section of each adsorption film and place them under ambient temperature for several minutes, above 13000 g, centrifuge for 1 min; collect the plasmid solution into the Ep tube of 1.5 ml.
[0095] 11. Obtain 60 μl of plasmid DNA each. Store the plasmid under −20° C.
[0096] (III) Enzyme Digestion Identification
[0097] 1. Conduct double enzyme digestion to pET32a/TRAIL-MuR5 plasmid with XbaI and EcoRI. See Table 5 for enzyme digestion reaction system.
TABLE-US-00006 TABLE 5 Enzyme digestion reaction system of pET32a/TRAIL-MuR5 (10 μl) Reagent Volume pET32a/TRAIL-Mu3 plasmid 5 μl XbaI 0.5 μl EcoRI 0.5 μl 10xM Buffer 1 μl dH2O 3 μl
[0098] 2. Place the Ep tube into a multi-purpose incubator at 37° C., incubate for 2 hours.
[0099] 3. Conduct electrophoresis identification after enzyme digestion.
[0100] (IV) Select the correctly enzyme digested and successfully ligated strain, preserve in with glycerin and send it for sequencing.
[0101] Experiment Results
[0102] I. Result of PCR Amplified Target Fragment
[0103] Amplify the TRAIL-MuR5 target fragment amplified through mutation by MuR5-TR-NdeI/TR-Eco-R primer pair; the molecular weight of the fragment is about 500 bp, as shown in
[0104] II. Theoretically, after double enzyme digestion to TRAIL-MuR5 and pET32a with NdeI and EcoRI, the target fragments of about 500 bp and 5.4 kb are obtained, as shown in
[0105] III. Results of Ligation and Transformation Between TRAIL-MuR5 Target Fragment and pET32a
[0106] 1. Bacterial colony grows with normal density in the plate.
[0107] 2. As for the picked single colony, partial test tubes are grown with bacteria of normal density on the next day.
[0108] 3. Identify plasmid through enzyme digestion; identify pET32a/TRAIL-MuR5 plasmid through double enzyme digestion with XbaI and EcoRI; the vector fragment of about 5.4 Kb and the target fragment of about 550 bp should be obtained after successful ligation of plasmid and enzyme digestion. As shown in
Embodiment 3
[0109] pET32a/TRAIL-MuR5 Expression Test
[0110] Select a single bacterium from the plasmid transformed competent E. coli BL21 (DE3) with correct sequence obtained in Embodiment 2 for expression test to inspect the effect of expression.
Experimental Procedures
[0111] I. Plasmid Transformation and Strain Preservation
[0112] 1. Prepare a LB culture medium of 100 ml and sterilize it at 121° C. for 20 min.
[0113] 2. Take 1 μl of pET32a/TRAIL-MuR5 plasmid and add it into the BL21 (DE3) competent cell for 30 min of ice-bath.
[0114] 3. Conduct thermal shock for 90 s in water bath at 42° C.
[0115] 4. Incubate on ice for 3 min.
[0116] 5. Take 20 μl of transformed competent cell and coat on the LB solid medium containing Amp for overnight cultivation at 37° C.
[0117] 6. After plate is grown with bacterial colonies, select a single bacterium from the plate and add it into 50 ml of LB (Amp.sup.+) for overnight cultivation at 37° C.
[0118] 7. Save 20 pipes of glycerin bacteria with a final concentration of glycerin as 15% at −20° C.
[0119] II. Strain Expression
[0120] 1. Take 1000 μl of each overnight cultivated pET32a/TRAIL-MuR5 culture solution for inoculating into 50 ml of LB (Amp.sup.+) culture medium. The temperature after inoculation is 37° C.; conduct shaking cultivation for 3 h at 250 rpm and lower the temperature to 24° C. Add 0.1 M of IPTG as per the proportion of 1% for induction cultivation. Before induction, take a sample of 0.5 ml and discard the supernatant through centrifugation; add 50 μl of H.sub.2O and then add 50 μl of 2×loading buffer after weight drop to prepare a sample of post-induction electrophoresis.
[0121] 2. Collect the bacteria after overnight induction, detect A.sub.600 value; take a sample of 150 μl and discard the supernatant through centrifugation; add 50 μl of H.sub.2O and then add 50 μl of 2×loading buffer after resuspension to prepare a sample of post-induction electrophoresis; centrifuge the rest bacteria solution at 12000 rpm for 5 min with the 5430R-type centrifugal machine.
[0122] 3. Take 50 ml of culture solution and obtain the bacteria through centrifugation; conduct resuspension with 8 ml of 50 mM Na.sub.2HPO.sub.4 solution for bacteria breaking with ultrasonic wave. Conditions for bacteria breaking: Φ6 probe; 200 W pulse bacteria breaking for 2 s and suspended for 2 s for a circulation of 10 min.
[0123] 4. Take 1 ml of bacteria breaking liquid for 10 min of centrifugation at 12000 rpm; separate the supernatant and the sediment; conduct resuspension for the sediment with 1 ml of H.sub.2O; take 20 μl of each supernatant and sediment resuspension solution and add with 30 μl of H.sub.2O and 50 μl of 2×loading buffer for preparing the electrophoresis sample.
[0124] 5. Place the prepared electrophoresis sample into boiling water bath for 10 min of treatment; using a 5430R-type centrifugal machine with A-45-30-11 type rotor; after centrifugation at 12000 rpm for 10 min; take 10 μl of supernatant for electrophoresis.
Experiment Results
[0125] See
Embodiment 4
Purification Preparation of TRAIL-MuR5 Protein
[0126] After abundant exploration to lab scale process of TRAIL-MuR5, TRAIL-MuR5 protein purification process is established. TRAIL-MuR5 protein is purified in batch through a three-step approach as SP Sepharose Fast Flow gel chromatographic column, Sephadex G-25 medium chromatographic column and anion exchange penetration for obtaining internal and external activity analysis of sample donor.
Experimental Procedures
[0127] I. Breaking and Centrifugation of Bacteria
[0128] 1. Take 80 g of MuR5 bacteria, add Na.sub.2CO.sub.3, glycerin, Tween80, DTT and NaCl, and add H.sub.2O to achieve a total volume of 400 ml, keeping the final concentration of the above substances at 20 mM Na.sub.2CO.sub.3, 5% glycerin, 0.1% Tween80, 1 mM DTT and 500 mM NaCl.
[0129] 2. Conduct ultrasonic bacteria breaking to the bacteria liquid. Conditions for bacteria breaking: Φ10 probe; 500 W pulse bacteria breaking for 2 s and suspended for 2 s for a circulation of 15 min.
[0130] 3. Use a 5430R-type centrifugal machine with F-35-6-30 type rotor; after centrifugation at 7850 rpm for 40 min, take supernatant for filtration with a filter membrane of 0.45 μm and take it as an upper column sample.
[0131] II. Preparation of Protein Purification Solution and Column
[0132] 1. The following solutions should be prepared:
[0133] (1) Cation exchange buffer A: 20 mM Na.sub.2CO.sub.3-NaHCO.sub.3, 0.5 M NaCl, 5% glycerin, 0.1% Tween80, 1 mM DTT and adjust the pH value to 10.50.
[0134] (2) Cation exchange buffer B: 20 mM Na.sub.2CO.sub.3-NaHCO.sub.3, 1.2 M NaCl, 5% glycerin, 0.1% Tween80, 1 mM DTT and adjust the pH value to 10.20.
[0135] (3) 0.5 M NaOH.sub.∘
[0136] (4) 2 M NaCl.sub.∘
[0137] (5) Desalination and anion exchange buffer: 0.15 M NaCl, 0.3 M glycine and 0.2 M arginine.
[0138] 2. Use SP Sepharose Fast Flow gel chromatographic column; use 5 CV of pure water to wash the residual ethyl alcohol on the column and then equilibrate it with 5 CV of corresponding equilibration buffer.
[0139] 3. Use Sephadex G-25 medium gel chromatographic column; use 5 CV of pure water to wash the residual ethyl alcohol on the column and then equilibrate it with 5 CV of anion exchange buffer.
[0140] 4. Use Q Sepharose Fast Flow gel chromatographic column; use 5 CV of pure water to wash the residual ethyl alcohol on the column and then equilibrate it with 5 CV of anion exchange buffer.
[0141] III. Cation Exchange and Purification
[0142] Conduct cation exchange and purification as per the following steps. Collect all penetration and elution compositions during purification for electrophoretic analysis:
[0143] 1. Equilibration: equilibrate SP Sepharose Fast Flow chromatographic column with cation exchange buffer A until UV is stabilized.
[0144] 2. Sample preparation and sample loading: take the centrifugal supernatant of broken bacterium and load the sample.
[0145] 3. Cleaning: clean the column with 2 CV of cation exchange buffer A to remove the residual uncombined protein.
[0146] 4. Elution: elute the impure protein with 2 CV of 14.3% of cation exchange buffer B and elute the target protein with 2 CV of 100% of cation exchange buffer B.
[0147] 5. NaOH cleaning: clean the column with 2 CV of 0.5 M NaOH solution.
[0148] 6. Reequilibration: reequilibrate the column with 5 CV of cation exchange buffer A.
[0149] IV. Anion Exchange and Purification
[0150] Conduct the second step of anion exchange and purification as per the following steps. Collect all penetration and elution compositions during purification for electrophoretic analysis:
[0151] 1. Equilibration: equilibrate Q Sepharose Fast Flow chromatographic column with anion exchange buffer until UV is stabilized.
[0152] 2. Sample preparation and sample loading: take cation exchange purified and eluted sample, load the sample after the buffer solution is displaced to anion exchange buffer through Sephadex G-25 medium chromatographic column.
[0153] 3. Cleansing of equilibrium liquid: clean the column with 2 CV of anion exchange buffer to obtain the target protein uncombined onto the column.
[0154] 4. NaCl cleaning: clean the column with 2 CV of 2 M NaCl to remove the protein combined onto the column.
[0155] 5. NaOH cleaning: clean the column with 2 CV of 0.5 M NaOH solution.
[0156] 6. Reequilibration: reequilibrate the column with anion exchange buffer.
Experiment Results
[0157] See
Embodiment 6
Western Blot Detection of TRAIL-MuR5 Protein
[0158] Because TRAIL-MuR5 is obtained by mutation of 3 sites at the N-terminal of wild-type TRAIL, the antigenic determinant of TRAIL is still remained and can be specifically bound to the polyclonal antibody of TRAIL. Therefore, the polyclonal antibody of TRAIL can be used for detection and identification.
Experimental Procedures
[0159] I. Sample Preparation
[0160] 1. After the TRAIL-MuR5 protein purified in Embodiment 5 is unfrozen from −20° C., dilute it to 1 mg/ml with ultrapure water according to the provided concentration. Take 50 μl of sample and add 50 μl of 2×loading buffer to prepare an electrophoresis sample. Take 10 μl of electrophoresis, i.e., the amount of sample loading is 5 ug.
[0161] 2. Dissolve the reference substance TRAIL-20131204 dried frozen aquatic products (prepared in laboratory and compared with NIBSC international standard substan; the activity is more than 10.sup.7 IU/mg) with 1 ml of PBS; take 50 μl of sample and add 50 μl of 2×loading buffer to prepare an electrophoresis sample. Take 10 μl of electrophoresis, i.e., the sample loading amount is 5 ug.
[0162] II. Detection Process
[0163] After electrophoretic separation with 15% of SDS-PAGE, transfer the sample to the PVDF membrane. Close it at 4° C. for overnight firstly and incubate it with primary antibody [rabbit-anti-human TRAIL polyclonal antibody (1:500)] under ambient temperature for 2 hours; then incubate it with secondary antibody [goat-anti-rabbit IgG-HRP (1:5000)] under ambient temperature for 2 hours; then detect it through enhance chemiluminescence (ECL). The specific steps are as follows:
[0164] 1. Separate protein with 15% of SDS-PAGE electrophoretically; take out the gel, cut off the edge and immerse it into the TBST buffer for 15 min.
[0165] 2. Transfer membrane with PVDF membrane (wet transferring): soak the PVDF membrane with methyl alcohol for 15 s before use; immerse it into the distilled water for 1-3 min and then equilibrate it in membrane transferring buffer; pave sponge mat, filter paper (4-8 pieces), target glue, PVDF membrane, filter paper (4-8 pieces) and sponge mat in membrane transferrin clamp successively from cathode to anode; fasten the clamp after bubble is exhausted and put it in the membrane transferring slot at the voltage of 40 V for 45 min.
[0166] 3. Closing membrane: close the membrane in confining liquid (3% BSA) at 4° C. for overnight; take it out on the next day and shake it for 30 min under ambient temperature so as to close the nonspecific binding sites.
[0167] 4. Primary antibody incubation: dilute the confining liquid for primary antibody to a working concentration [rabbit-anti-human TRAIL polyclonal antibody (1:500)] and shake it with the membrane and incubate it under ambient temperature for 2 hours.
[0168] 5. Membrane cleansing: clean the membrane with washing membrane for three times, 10 min for each time. The membrane of 10×10 cm needs more than 50 ml of cleaning solution.
[0169] 6. Secondary antibody incubation: dilute the HRP-marked confining liquid for secondary antibody to a working concentration [goat-anti-rabbit IgG-HRP (1:5000)] and shake it with the membrane and incubate it under ambient temperature for 2 hours.
[0170] 7. Membrane cleansing: clean the membrane with washing membrane for three times, 10 min for each time. The membrane of 10×10 cm needs more than 50 ml of cleaning solution.
[0171] 8. Coloration: (1) mix the Solution A and Solution B of the same volume to prepare mixed liquid enough for detection (0.125 ml/cm.sup.2). Use the mixed liquid for detection immediately after preparation. It can remain stable within 1 hour under ambient temperature. (2) Drain off the redundant cleaning solution on the blotting membrane but do not dry the membrane. Add the mixed liquid for detection on one side of the membrane which contains protein, drain off the redundant mixed liquid and put the membrane on the Image Station 4000R of Kodak gel imaging for exposure with X-ray. Select 1 min for the first time of exposure and adjust the time of exposure according to the imaging result. Record the image with computer.
[0172] 9. Result judgment: positive result should show obvious colored tape. Negative result shows no color.
Experiment Results
[0173] As shown in
Embodiment 7
Protein TRAIL-MuR5 and TRAIL Bioactivity Analysis
[0174] Detect the in vitro anti-proliferative activity IC50 value of 2 protein samples as TRAIL-MuR5 and wide-type TRAIL to 12 tumor cell strains with CCK-8 detection kit and evaluate the in vitro bioactivity.
[0175] Materials and Methods
[0176] The cell strains for detection are all from Shanghai Institute of Biochemistry and Cell Biology or Wuhan Institute of Virology of the Chinese Academy of Sciences Wuhan Institute of Virology.
TABLE-US-00007 Cell type Cell strain Source 1 Pancreatic cancer BxPC-3 Purchased from Shanghai Institute of (3) Biochemistry and Cell Biology 2 CFPAC-1 Purchased from Shanghai Institute of Biochemistry and Cell Biology 3 PANC-1 Purchased from Shanghai Institute of Biochemistry and Cell Biology 4 Lung cancer (2) A549 Purchased from Wuhan Institute of Virology 5 NCI-H460 Purchased from Shanghai Institute of Biochemistry and Cell Biology 6 Colon cancer (3) HCT116 Purchased from Shanghai Institute of Biochemistry and Cell Biology 7 HT-29 Purchased from Wuhan Institute of Virology 8 SW620 Purchased from Shanghai Institute of Biochemistry and Cell Biology 9 Breast cancer (3) MCF-7 Purchased from Wuhan Institute of Virology 10 MDA- Purchased from Wuhan Institute of MB-231 Virology 11 T47D Purchased from Wuhan Institute of Virology 12 Acute t Jurkat Purchased from Wuhan Institute of lymphocytic Virology leukemia (1)
[0177] Reagents and Consumables
[0178] Cell Counting Kit-8 (Cat# CK04-13, Dojindo)
[0179] 96-well culture plate (Nest Biotech Co)
[0180] Fetal calf serum (Code: FS101-02, TransGen)
[0181] Culture medium (purchased from GIBCO)
[0182] Desktop microplate reader Infinite F50 (TECAN)
[0183] 2 protein samples: prepared through Embodiment 5 or in laboratory.
Experimental Procedures
[0184] 1. Preparation of Reagent
[0185] Preparation of Culture Medium
TABLE-US-00008 Inoculum Cell type Cell strain Culture medium and conditions density 1 Pancreatic BxPC-3 RPMI-1640 + 10% FBS + 1.0 mM sodium pyruvate; CO.sub.2, 4 × 10.sup.3/well cancer (3) 5%; 37.0° C. 2 CFPAC-1 IMEM (GIBCO Art. No.: 1460614) + 10% FBS; CO.sub.2, 7 × 10.sup.3/well 5%; 37.0° C. 3 PANC-1 Low glucose DMEM + 10% FBS; CO.sub.2; 5%; 37.0° C. 5 × 10.sup.3/well 4 Lung A549 Low glucose DMEM + 10% FBS; CO.sub.2; 5%; 37.0° C. 5 × 10.sup.3/well 5 cancer (2) NCI-H460 RPMI-1640 + 10% FBS; CO.sub.2, 5%; 37.0° C. 8 × 10.sup.3/well 6 Colon HCT116 McCoy's 5a Medium Modified (GIBCO Art. No.: 4 × 10.sup.3/well cancer (3) 1459946) + 10% FBS; CO.sub.2, 5%; 37.0° C. 7 HT-29 Low glucose DMEM + 10% FBS; CO.sub.2, 5%; 37.0° C. 5 × 10.sup.3/well 8 SW620 Leibovitz's L-15 + 10% FBS; without CO.sub.2; 37° C. 8 × 10.sup.3/well 9 Breast MCF-7 Low glucose DMEM (GIBCO Art. No.: 11443791) + cancer (3) 0.01 mg/ml bovine insulin; FBS, 10%; CO.sub.2, 5%; 8 × 10.sup.3/well 37.0° C. 10 MDA-MB-231 Leibovitz's L-15 (GIBCO Art. No.: 1466860) + 10% FBS; without CO.sub.2; 37° C. 8 × 10.sup.3/well 11 T47D RPMI-1640 + 10% FBS + 0.2 Units/ml bovine insulin; 10 × 10.sup.3/well CO.sub.2, 5%; 37.0° C. 12 Acute t Jurkat RPMI-1640 Medium (GIBCO Art. No.: 31800022); 5 × 10.sup.4/well lymphocytic FBS, 10%; CO.sub.2, 5%; 37.0° C. leukemia (1)
[0186] Preparation of Protein Samples
[0187] Dilute the 2 protein samples with sterile PBS buffer to achieve a final concentration of 5 mg/ml and conduct filtration and sterilization.
[0188] 2. IC50 Experiment
[0189] a) Collect logarithmic cells in growing period, count the number and re-suspend the cells with complete medium, adjust the cell concentration to an appropriate one (determined by the result of cell density optimization experiment), inoculate with 96-well plate and add 100 μl of cell suspension in each well. Incubate the cell (except SW620, with no need for 5% of CO.sub.2) in an incubator for 24 hours at 37° C., relative humidity of 100% and 5% of CO.sub.2.
[0190] b) Dilute the protein samples to be measured with sterile PBS buffer to 5 mg/ml, then conduct gradient dilution for 8 times and add cells as per 25 μl/well. From 1 mg/ml to 0, the final concentration of the compound is diluted in a gradient of three-times, involving 10 concentration points; then adjust the action final concentration for the protein samples according to the primary experiment results.
[0191] c) Incubate the cell (except SW620, with no need for 5% of CO.sub.2) in an incubator for 48 hours at 37° C., relative humidity of 100% and 5% of CO.sub.2.
[0192] d) Suck to discard the culture medium, add the complete medium containing 10% of CCK-8 in the incubator at 37° C. for incubation for 2-4 hours.
[0193] e) After gently shaking, determinate the absorbance at the wave length of 450 nm on SpectraMax M5 Microplate Reader, take the absorbance at 650 nm for reference and calculate the inhibition ratio.
[0194] 3. Data Processing
[0195] Calculate the inhibition ratio of the drug to tumor cell growth as per the following formula: Inhibition ratio of tumor cell growth %=[(Ac-As)/(Ac-Ab)]×100%
[0196] As: OA/RLU of sample (cell+CCK-8+compound to be measured)
[0197] Ac: OA/RLU of negative control (cell+CCK-8)
[0198] Ab: OA/RLU of positive control (culture medium+CCK-8)
[0199] Use the software Graphpad Prism 5 and the formula as log (inhibitor) vs. normalized response-Variable slope for IC50 curve fitting and calculate the value of IC50.
Experiment Results
[0200] The experiment tested the in vitro anti-cell proliferative activities of 2 protein samples (TRAIL-MuR5 and wild-type TRAIL) to 3 pancreatic cancer cell strains (CFPAC-1, BxPC-3 and PANC-1), 2 lung cancer cell strains (NCI-H460, A 549), 3 colon (rectal) cancer cell strains (SW620, HT-29, HCT 116), 3 breast cancer cell strains (MDA-MB-231, MCF-7, T47D) and 1 acute T lymphocytic leukemia cell strains (Jurkat). The results are as follows:
TABLE-US-00009 Comparison of IC50 values of 12 tumor cells (μg/mL) Cell type Cell strain TRAIL-MuR5 TRAIL 1 Pancreatic cancer BxPC-3 0.0092 >100 2 (3) CFPAC-1 0.0819 >100 3 PANC-1 0.014 >100 4 Lung cancer (2) A549 0.0223 >100 5 NCI-H460 0.0044 0.002 6 Colon cancer (3) HCT116 0.0035 0.015 7 HT-29 0.0304 >100 8 SW620 0.001 0.008762 9 Breast cancer (3) MCF-7 0.0026 >100 10 MDA-MB-231 0.008 0.003 11 T47D 0.0364 >100 12 Acute t Jurkat 0.0029 lymphocytic leukemia (1)
[0201] Compared with TRAIL wild-type protein, the antineoplastic activity of TRAIL CPPs-like mutant TRAIL-MuR5 is largely improved among almost all types of tested tumor cells [including multiple colon (rectal) cancer cells, multiple lung cancer cells, multiple pancreatic cancer cells and multiple breast cancer cells], and especially has stronger therapeutical effect on the tumor cell strain which is drug-resistant to TRAIL wild-type protein and can apparently reverse the tolerance of the cells to TRAIL wild-type protein.
[0202] The above are the preferred embodiments rather than the limitations of the Invention. Any amendment, equivalent replacement and improvement made within the range of the spirit and rule of the Invention shall be included in the protection scope of the Invention.