SEPARATOME-BASED PROTEIN EXPRESSION AND PURIFICATION PLATFORM

20170218422 · 2017-08-03

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided is a separatome-based recombinant peptide, polypeptide, and protein expression and purification platform based on the juxtaposition of the binding properties of host cell genomic peptides, polypeptides, and proteins with the characteristics and location of the corresponding genes on the host cell chromosome, such as that of E. coli, yeast, Bacillus subtilis or other prokaryotes, insect cells, mammalian cells, etc. The separatome-based protein expression and purification platform quantitatively describes and identifies priority deletions, modifications, or inhibitions of certain gene products to increase chromatographic separation efficiency, defined as an increase in column capacity, column selectivity, or both. Moreover, the separatome-based protein expression and purification platform provides a computerized knowledge tool that, given separatome data and a target recombinant peptide, polypeptide, or protein, intuitively suggests strategies leading to efficient product purification. The separatome-based protein expression and purification platform is an efficient bioseparation system that intertwines host cell expression systems and chromatography.

    Claims

    1. A host cell for expression of a target recombinant peptide, polypeptide, or protein, wherein the chromatographic separation efficiency of said target recombinant peptide, polypeptide, or protein expressed in said host cell is improved in an amount in the range of from about 3% to about 50%, wherein the genome of said host cell: i) is a reduced genome, ii) a modified genome, or iii) a genome in which expression of genes is reduced or completely inhibited; wherein genes that are deleted, modified, or the expression of which is reduced or completely inhibited in said host cell code for host cell proteome peptides, polypeptides, or proteins that impair the chromatographic separation efficiency of said target recombinant peptide, polypeptide, or protein expressed in said host cell; wherein said genes are identified, quantified, scored, and ranked according to chromatographic importance in adversely affecting the chromatographic separation efficiency of said target recombinant peptide, polypeptide, or protein; and wherein deletion, modification, reduction of expression, or complete inhibition of expression of said genes in said host cell improves the chromatographic separation efficiency of said target recombinant peptide, polypeptide, or protein expressed in said host cell in an amount in the range of from about 3% to about 50% compared to the chromatographic separation efficiency of said target recombinant peptide, polypeptide, or protein expressed in said host cell when said genes are not deleted, not modified, or the expression of which is not reduced or completely inhibited in said host cell, respectively.

    2. The host cell of claim 1, wherein said genes are identified and quantified by: 1) fractionating (a) a lysate of said host cell in the case where said target recombinant peptide, polypeptide, or protein is not secreted from said host cell, or (b) the culture medium in which said host cell is grown in the case where said target recombinant peptide, polypeptide, or protein is secreted from said host cell, on an affinity chromatography column comprising an affinity ligand bound to a solid phase, or on an adsorption-based, non-affinity chromatography column comprising an adsorption-based, non-affinity chromatography medium, wherein each of said columns is equilibrated using a mobile loading or eluting phase or an operational variable, and then washed with an elution gradient to elute host cell proteome peptide-, polypeptide-, and protein-containing fractions from each of said columns; and 2) determining and quantifying the host cell proteome peptides, polypeptides, and proteins present in each of said eluted fractions.

    3. The host cell of claim 2, wherein determining the host cell proteome peptides, polypeptides, and proteins present in each of said eluted fractions in 2) is performed by liquid chromatography-tandem mass spectroscopy, and quantifying the host cell proteome peptides, polypeptides, and proteins present in each of said eluted fractions in 2) is performed by either (a) spectral counting or (b) a combination of Bradford protein assay, 2-dimensional electrophoresis, and densitometry.

    4. The host cell of claim 2, wherein scoring and ranking the chromatographic importance of said host cell proteome peptides, polypeptides, and proteins in adversely affecting the chromatographic separation efficiency of said target recombinant peptide, polypeptide, or protein comprise: (1) determining for each of said host cell proteome peptides, polypeptides, and proteins present in each of said eluted fractions: (a) an adsorption strength; (b) an adsorption specificity; (c) an adsorption abundance; (d) a steric effect; and (e) a metabolic necessity; (2) multiplying the values of (a) through (e) in 1) for each of said host cell proteome peptides, polypeptides, and proteins to produce an importance score for each of said host cell proteome peptides, polypeptides, and proteins in each of said eluted fractions; and (3) summing each of said importance scores for each of said host cell proteome peptides, polypeptides, and proteins in each of said eluted fractions to determine its overall importance score, and comparing each of said overall importance scores for each of said host cell proteome peptides, polypeptides, and proteins to the overall importance scores of each of the other host cell proteome peptides, polypeptides, and proteins eluted from said affinity chromatography column or said adsorption-based, non-affinity chromatography column, respectively, wherein a higher overall importance score identifies a host cell proteome peptide, polypeptide, or protein having a greater adverse effect on the chromatographic separation efficiency of said target recombinant peptide, polypeptide, or protein than a host cell proteome peptide, polypeptide, or protein having a lower overall importance score.

    5. The host cell of claim 4, wherein: the adsorption strength in (1)(a) is manifested as the ratio of the concentration of mobile phase eluent in each of said eluted fractions compared to the maximum mobile phase eluent concentration with which said column is washed; the adsorption specificity in (1)(b) is manifested as the ratio of the amount of each individual host cell proteome peptide, polypeptide, or protein present in an eluted fraction compared to the total amount thereof bound on said column; the adsorption abundance in (1)(c) is manifested as the ratio of the amount of each individual host cell proteome peptide, polypeptide, or protein present in an eluted fraction compared to the total amount of all host cell proteome peptides, polypeptides, and proteins present in said eluted fraction; the steric effect in (1)(d) is manifested as the ratio of the molecular weight of each of said host cell proteome peptides, polypeptides, and proteins compared to the molecular weight of a reference protein within said host cell proteome; and the metabolic necessity in (1)(e)) is assessed by bioinformatics or as disclosed in published literature.

    6. The host cell of claim 4, wherein scoring and ranking of host cell proteome peptides, polypeptides, and proteins in adversely affecting the chromatographic separation efficiency of said target recombinant peptide, polypeptide, or protein are performed employing the following equation: importance i = .Math. j .Math. [ b 1 ( y c j y max ) .Math. ( h i .Math. , j h i , total ) .Math. ( h i .Math. , j h j , total ) .Math. ( MW i MW ref ) α ] i wherein b.sub.1=scaling parameter; y.sub.cj and y.sub.max=concentration of mobile phase eluent in fraction (j) and maximum value, respectively; h.sub.i,j and h.sub.i,total=the amount of protein (i) in fraction (j) and total bound protein (i), respectively; h.sub.j,total=total amount of protein in fraction (j); MW.sub.i=molecular weight of protein (i); MW.sub.ref=molecular weight of a reference protein within said host cell proteome; α=steric factor; and i=protein, wherein: ratios of y's and h's adopt values between 0 and 1; a protein that remains bound and requires stringent conditions for elution exhibits a y ratio ( y c j y max )  close to, or equal to, unity; a protein that emerges as a tight peak has an h ratio ( h i .Math. , j h i , total )  close to unity and a j ratio ( h i .Math. , j h j , total )  close to unity if it constitutes the majority of fraction (j); a non-zero α between 0 and 1 indicates steric effects; and wherein the quantitative ranking for a protein is calculated by multiplying b 1 ( y c j y max ) ( h i .Math. , j h i , total ) ( h i .Math. , j h j , total ) ( MW i MW ref ) α ,  and summing the product for each fraction (j) where (i) is present.

    7. The host cell of claim 1, wherein cell viability, growth rate, or capacity for expression of said target recombinant peptide, polypeptide, or protein expressed in said host cell in the range of from about 75% to about 100% or more compared to that of said host cell when said genes are not deleted, not modified, or the expression of which is not reduced or completely inhibited in said host cell.

    8. The host cell of claim 1, which is selected from a bacterium, a fungus, a mammalian cell, an insect cell, a plant cell, or a protozoal cell.

    9. The host cell of claim 8, wherein said bacterium is selected from E. coli, L. lactis, B. subtilis, B. licheniformis, B. amyloliquefaciens, P. fluorescens, or C. glutamicum; said fungus is a yeast selected from S. cerevisiae, K. pastoris, or P. methanolica; said mammalian cell is selected from a CHO cell, a HEK cell, a mouse myeloma cell, a BHK cell, or a human retinal cell; said insect cell is selected from an S. frugiperda cell, a T. ni cell, or a D. melanogaster cell; said plant cell is selected from a tobacco cell, an alfalfa cell, a rice cell, a tomato cell, a soybean cell, or an algal cell; and said protozoal cell is a L. tarentolae cell.

    10. A method of preparing a pharmaceutical or veterinary composition comprising a recombinant therapeutic peptide, polypeptide, or protein, the method comprising: a) expressing said recombinant therapeutic peptide, polypeptide, or protein in said host cell of claim 1; b) in the case where said recombinant therapeutic peptide, polypeptide, or protein is not secreted from said host cell, preparing a lysate of said host cell containing said recombinant therapeutic peptide, polypeptide, or protein, producing an initial recombinant therapeutic peptide-, polypeptide-, or protein-containing mixture; or c) in the case where said recombinant therapeutic peptide, polypeptide, or protein is secreted from said host cell, harvesting culture medium in which said host cell is grown, containing said recombinant therapeutic peptide, polypeptide, or protein, thereby obtaining an initial recombinant therapeutic peptide-, polypeptide-, or protein-containing mixture; d) chromatographing said initial recombinant therapeutic peptide-, polypeptide-, or protein-containing mixture of step b) or step c) on an affinity chromatography column comprising an affinity ligand bound to a solid phase or on an adsorption-based, non-affinity chromatography column comprising an adsorption-based, non-affinity chromatography medium, and collecting elution fractions, thereby obtaining one or more fractions containing an enriched amount of said recombinant therapeutic peptide, polypeptide, or protein relative to other peptides, polypeptides, or proteins in said one or more fractions compared to the amount of said recombinant therapeutic peptide, polypeptide, or protein relative to other peptides, polypeptides, or proteins in said initial recombinant therapeutic peptide-, polypeptide-, or protein-containing mixture; e) further chromatographing an enriched fraction of step d) to obtain said recombinant therapeutic peptide, polypeptide, or protein in a desired degree of purity; f) recovering purified recombinant therapeutic peptide, polypeptide, or protein of step e); and g) formulating said purified recombinant therapeutic peptide, polypeptide, or protein of step f) with a pharmaceutically or veterinarily acceptable carrier, diluent, or excipient to produce a pharmaceutical or veterinary composition, respectively.

    11. The method of claim 10, wherein said genes that are deleted, modified, or the expression of which is reduced or completely inhibited in said host cell are identified and quantified by: 1) fractionating (a) a lysate of said host cell in the case where said recombinant therapeutic peptide, polypeptide, or protein is not secreted from said host cell, or (b) the culture medium in which said host cell is grown in the case where said recombinant therapeutic peptide, polypeptide, or protein is secreted from said host cell, on an affinity chromatography column comprising an affinity ligand bound to a solid phase or on an adsorption-based, non-affinity chromatography column comprising an adsorption-based, non-affinity chromatography medium, wherein each of said columns is equilibrated using a mobile loading or eluting phase or an operational variable, and then washed with an elution gradient to elute host cell proteome peptide-, polypeptide-, and protein-containing fractions from said affinity chromatography column or said adsorption-based, non-affinity chromatography column, respectively; and 2) determining and quantifying the host cell proteome peptides, polypeptides, and proteins present in each of said eluted fractions.

    12. The method of claim 11, wherein scoring and ranking the chromatographic importance of said host cell proteome peptides, polypeptides, and proteins in adversely affecting the chromatographic separation efficiency of said recombinant therapeutic peptide, polypeptide, or protein comprise: (1) determining for each of said host cell proteome peptides, polypeptides, and proteins present in each of said eluted fractions: (a) its adsorption strength, manifested as the ratio of the concentration of mobile phase eluent in each of said eluted fractions compared to the maximum mobile phase eluent concentration with which said affinity chromatography column or said adsorption-based, non-affinity chromatography column, respectively, is washed; (b) its adsorption specificity, manifested as the ratio of the amount of each individual host cell proteome peptide, polypeptide, or protein present in an eluted fraction compared to the total amount thereof bound on said affinity chromatography column or on said adsorption-based, non-affinity chromatography column, respectively; (c) its adsorption abundance, manifested as the ratio of the amount of each individual host cell proteome peptide, polypeptide, or protein present in an eluted fraction compared to the total amount of all host cell proteome peptides, polypeptides, and proteins present in said eluted fraction; (d) its steric effect, manifested as the ratio of the molecular weight of each of said host cell proteome peptides, polypeptides, and proteins compared to the molecular weight of a reference protein within said host cell proteome; and (e) its metabolic necessity, assessed by bioinformatics or as disclosed in published literature; (2) multiplying the values of (a) through (e) in 1) for each of said host cell proteome peptides, polypeptides, and proteins to produce an importance score for each of said host cell proteome peptides, polypeptides, and proteins in each of said eluted fractions; and (3) summing each of said importance scores for each of said host cell proteome peptides, polypeptides, and proteins in each of said eluted fractions to determine its overall importance score, and comparing each of said overall importance scores for each of said host cell proteome peptides, polypeptides, and proteins to the overall importance scores of each of the other host cell proteome peptides, polypeptides, and proteins eluted from said affinity chromatography column or said adsorption-based, non-affinity chromatography column, respectively, wherein a higher overall importance score identifies a host cell proteome peptide, polypeptide, or protein having a greater adverse effect on the chromatographic separation efficiency of said recombinant therapeutic peptide, polypeptide, or protein than a host cell proteome peptide, polypeptide, or protein having a lower overall importance score.

    13. The method of claim 10, wherein said host cell exhibits about 75% to about 100% or more of the viability, growth rate, or capacity for expression of said recombinant therapeutic peptide, polypeptide, or protein expressed in said host cell compared to that of said host cell when said genes are not deleted, not modified, or the expression of which is not reduced or completely inhibited in said host cell, respectively.

    14. The method of claim 10, wherein said host cell is selected from a bacterium, a fungus, a mammalian cell, an insect cell, a plant cell, or a protozoal cell.

    15. The method of claim 14, wherein said bacterium is selected from E. coli, L. lactis, B. subtilis, B. licheniformis, B. amyloliquefaciens, P. fluorescens, or C. glutamicum; said fungus is a yeast selected from S. cerevisiae, K. pastoris, or P. methanolica; said mammalian cell is selected from a CHO cell, a HEK cell, a mouse myeloma cell, a BHK cell, or a human retinal cell; said insect cell is selected from an S. frugiperda cell, a T. ni cell, or a D. melanogaster cell; said plant cell is selected from a tobacco cell, an alfalfa cell, a rice cell, a tomato cell, a soybean cell, or an algal cell; and said protozoal cell is a L. tarentolae cell.

    16. The method of claim 10, wherein said recombinant therapeutic peptide, polypeptide, or protein is an antibody, an antibody fragment, a vaccine, α.sub.1-Antitrypsin, an enzyme, a growth factor, a blood clotting factor, a hormone, a nerve factor, an interferon, an interleukin, tumor necrosis factor, lung surfactant protein, or serum albumin.

    17. The method of claim 10, wherein said adsorption-based, non-affinity chromatography column is an ion exchange chromatography column.

    18. A method of purifying a recombinant enzyme, the method comprising: a) expressing said recombinant enzyme in said host cell of claim 1; b) in the case where said recombinant enzyme is not secreted from said host cell, preparing a lysate of said host cell containing said recombinant enzyme, producing an initial recombinant enzyme-containing mixture; or c) in the case where said recombinant enzyme is secreted from said host cell, harvesting culture medium in which said host cell is grown, containing said recombinant enzyme, thereby obtaining an initial recombinant enzyme-containing mixture; d) chromatographing said initial recombinant enzyme-containing mixture of step b) or step c) on an affinity chromatography column comprising an affinity ligand bound to a solid phase, or on an adsorption-based, non-affinity chromatography column comprising an adsorption-based, non-affinity chromatography medium, and collecting elution fractions, thereby obtaining one or more fractions containing an enriched amount of said recombinant enzyme relative to other peptides, polypeptides, or proteins in said one or more fractions compared to the amount of said recombinant enzyme relative to other peptides, polypeptides, or proteins in said initial recombinant enzyme-containing mixture; e) optionally, further chromatographing an enriched fraction of step d) to obtain said recombinant enzyme in a desired degree of purity; and f) recovering purified recombinant enzyme.

    19. The method of claim 18, wherein said genes that are deleted, modified, or the expression of which is reduced or completely inhibited in said host cell are identified and quantified by: 1) fractionating (a) a lysate of said host cell in the case where said recombinant enzyme is not secreted from said host cell, or (b) the culture medium in which said host cell is grown in the case where said recombinant enzyme is secreted from said host cell, on an affinity chromatography column comprising an affinity ligand bound to a solid phase, or on an adsorption-based, non-affinity chromatography column comprising an adsorption-based, non-affinity chromatography medium, wherein each of said columns is equilibrated using a mobile loading or eluting phase or an operational variable, and then washed with an elution gradient to elute host cell proteome peptide-, polypeptide-, and protein-containing fractions from said affinity chromatography column or said adsorption-based, non-affinity chromatography column, respectively; and 2) determining and quantifying the host cell proteome peptides, polypeptides, and proteins present in each of said eluted fractions.

    20. The method of claim 19, wherein scoring and ranking the chromatographic importance of said host cell proteome peptides, polypeptides, and proteins in adversely affecting the chromatographic separation efficiency of said recombinant enzyme comprise: (1) determining for each of said host cell proteome peptides, polypeptides, and proteins present in each of said eluted fractions: (a) its adsorption strength, manifested as the ratio of the concentration of mobile phase eluent in each of said eluted fractions compared to the maximum mobile phase eluent concentration with which said column is washed; (b) its adsorption specificity, manifested as the ratio of the amount of each individual host cell proteome peptide, polypeptide, or protein present in an eluted fraction compared to the total amount thereof bound on said affinity chromatography column or on said adsorption-based, non-affinity chromatography column, respectively; (c) its adsorption abundance, manifested as the ratio of the amount of each individual host cell proteome peptide, polypeptide, or protein present in an eluted fraction compared to the total amount of all host cell proteome peptides, polypeptides, and proteins present in said eluted fraction; (d) its steric effect, manifested as the ratio of the molecular weight of each of said host cell proteome peptides, polypeptides, and proteins compared to the molecular weight of a reference protein within said host cell proteome; and (e) its metabolic necessity, assessed by bioinformatics or as disclosed in published literature; (2) multiplying the values of (a) through (e) in (1) for each of said host cell peptides, polypeptides, and proteins to produce an importance score for each of said host cell proteome peptides, polypeptides, and proteins in each of said eluted fractions; and (3) summing each of said importance scores for each of said host cell proteome peptides, polypeptides, and proteins in each of said eluted fractions to determine its overall importance score, and comparing each of said overall importance scores for each of said host cell proteome peptides, polypeptides, and proteins to the overall importance scores of each of the other host cell proteome peptides, polypeptides, and proteins eluted from said affinity chromatography column or said adsorption-based, non-affinity chromatography column, respectively; wherein a higher overall importance score identifies a host cell proteome peptide, polypeptide, or protein having a greater adverse effect on the chromatographic separation efficiency of said recombinant enzyme than a host cell proteome peptide, polypeptide, or protein having a lower overall importance score.

    21. The method of claim 18, wherein said host cell exhibits about 75% to about 100% or more of the viability, growth rate, or capacity for expression of said recombinant enzyme expressed in said host cell compared to that of said host cell when said genes are not deleted, not modified, or the expression of which is not reduced or completely inhibited in said host cell, respectively.

    22. The method of claim 18, wherein said host cell is selected from a bacterium, a fungus, a mammalian cell, an insect cell, a plant cell, or a protozoal cell.

    23. The method of claim 22, wherein said bacterium is selected from E. coli, L. lactis, B. subtilis, B. licheniformis, B. amyloliquefaciens, P. fluorescens, or C. glutamicum; said fungus is a yeast selected from S. cerevisiae, K. pastoris, or P. methanolica; said mammalian cell is selected from a CHO cell, a HEK cell, a mouse myeloma cell, a BHK cell, or a human retinal cell; said insect cell is selected from an S. frugiperda cell, a T. ni cell, or a D. melanogaster cell; said plant cell is selected from a tobacco cell, an alfalfa cell, a rice cell, a tomato cell, a soybean cell, or an algal cell; and said protozoal cell is a L. tarentolae cell.

    24. The method of claim 18, wherein said adsorption-based, non-affinity chromatography column is an ion exchange chromatography column.

    25. E. coli, the genome of which comprises deletion, modification, or reduction or complete inhibition of expression of combinations of genes selected from: a) hldD, speA, nagD, usg, and gldA; b) hldD, speA, nagD, usg, gldA, and glnA; c) hldD, speA, nagD, usg, gldA, glnA, and metE; d) hldD, speA, nagD, usg, gldA, glnA, metE, and tgt; e) hldD, speA, nagD, usg, gldA, glnA, metE, tgt, and typA; f) hldD, speA, nagD, usg, gldA, glnA, metE, tgt, typA, and entF; g) hldD, speA, nagD, usg, gldA, glnA, metE, tgt, typA, entF, and ycaO; h) hldD, speA, nagD, usg, gldA, glnA, metE, tgt, typA, entF, ycaO, and gatZ; i) hldD, speA, nagD, usg, gldA, glnA, metE, tgt, typA, entF, ycaO, gatZ, and ilvB; j) hldD, speA, nagD, usg, gldA, glnA, metE, tgt, typA, entF, ycaO, gatZ, ilvB, and glgP; k) hldD, speA, nagD, usg, gldA, glnA, metE, tgt, typA, entF, ycaO, gatZ, ilvB, glgP, and nusA; or l) hldD, speA, nagD, usg, gldA, glnA, metE, tgt, typA, entF, ycaO, gatZ, ilvB, glgP, nusA, and metH.

    26. A method of preparing a pharmaceutical or veterinary composition comprising a recombinant therapeutic peptide, polypeptide, or protein, the method comprising: a) expressing said recombinant therapeutic peptide, polypeptide, or protein in said E. coli of claim 25; b) in the case where said recombinant therapeutic peptide, polypeptide, or protein is not secreted from said E. coli, preparing a lysate of said E. coli containing said recombinant therapeutic peptide, polypeptide, or protein, producing an initial recombinant therapeutic peptide-, polypeptide-, or protein-containing mixture; or c) in the case where said recombinant therapeutic peptide, polypeptide, or protein is secreted from said E. coli, harvesting culture medium in which said E. coli is grown, containing said recombinant therapeutic peptide, polypeptide, or protein, thereby obtaining an initial recombinant therapeutic peptide-, polypeptide-, or protein-containing mixture; d) chromatographing said initial recombinant therapeutic peptide-, polypeptide-, or protein-containing mixture of step b) or step c) on an adsorption-based, non-affinity chromatography medium-containing column, and collecting elution fractions, thereby obtaining one or more fractions containing an enriched amount of said recombinant therapeutic peptide, polypeptide, or protein relative to other peptides, polypeptides, or proteins in said one or more fractions compared to the amount of said recombinant therapeutic peptide, polypeptide, or protein relative to other peptides, polypeptides, or proteins in said initial recombinant therapeutic peptide-, polypeptide-, or protein-containing mixture; e) further chromatographing an enriched fraction of step d) to obtain said recombinant therapeutic peptide, polypeptide, or protein in a desired degree of purity; f) recovering purified recombinant therapeutic peptide, polypeptide, or protein of step e); and g) formulating said purified recombinant therapeutic peptide, polypeptide, or protein of step f) with a pharmaceutically or veterinarily acceptable carrier, diluent, or excipient to produce a pharmaceutical or veterinary composition, respectively.

    27. A method of purifying a recombinant enzyme, the method comprising: a) expressing said recombinant enzyme in said E. coli of claim 25; b) in the case where said recombinant enzyme is not secreted from said E. coli, preparing a lysate of said host cell containing said recombinant enzyme, producing an initial recombinant enzyme-containing mixture; or c) in the case where said recombinant enzyme is secreted from said E. coli, harvesting culture medium in which said E. coli is grown, containing said recombinant enzyme, thereby obtaining an initial recombinant enzyme-containing mixture; d) chromatographing said initial recombinant enzyme-containing mixture of step b) or step c) on an adsorption-based, non-affinity chromatography medium-containing column, and collecting elution fractions, thereby obtaining one or more fractions containing an enriched amount of said recombinant enzyme relative to other peptides, polypeptides, or proteins in said one or more fractions compared to the amount of said recombinant enzyme relative to other peptides, polypeptides, or proteins in said initial recombinant enzyme-containing mixture; e) optionally, further chromatographing an enriched fraction of step d) to obtain said recombinant enzyme in a desired degree of purity; and f) recovering purified recombinant enzyme.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0095] The above and other aspects, features, and advantages of the present invention will be better understood from the following detailed descriptions taken in conjunction with the accompanying drawing(s), all of which are given by way of illustration only, and are not limitative of the present invention, in which:

    [0096] FIG. 1 shows a CIRCOS® rendering of model data used to describe multiple separatomes. CIRCOS® is a software package that applies the circular ideogram layout to display relationships between genomic intervals. It is described in Krzywinski et al. (2009) “Circos: an Information Aesthetic for Comparative Genomics”, Genome Res. 19:1639-1645. In the figure, the ring is comprised of segments that represent either gene positions or % B. Four different separatomes associated with popular methods of chromatography (IMAC, immobilized metal affinity chromatography; AEX, anion exchange chromatography; CEX, cation exchange chromatography; and HIC, hydrophobic interaction chromatography) are represented. Connecting lines map individual proteins contained within a separatome to their gene (located on the outer ring), with the concentric (inner gray) ring describing the concentration of the protein found in the fractions as they elute from a column as indicated by the length of the black bar segments. Other data that could be depicted in a CIRCOS® rendering include gene designation, essentiality of gene product, metabolic category, or other parameter, placed on a series of concentric rings or attached to the connecting lines, for example as shown by the other concentric ring fragment.

    [0097] FIG. 2 shows a CIRCOS® rendering of model data describing the separatome of E. coli for ion exchange chromatography. Similar to FIG. 1 is the use of connecting lines that indicate genes associated with proteins found in the separatome of E. coli for a particular resin/equilibrating condition. However, this rendering provides detail as to the elution fraction by connecting a gene to a particular box on the ring that represents a salt concentration. The lower black fragment of the circle entitled “Escherichia coli genome” can contain the location of genes present on the E. coli chromosome. Each box represents a different cut from a column.

    [0098] FIG. 3 shows the distribution of proteins contained within various IMAC fractions that elute from a Ni(II) column. In particular, note the low concentration of host cell proteins within the 120 mM fraction.

    [0099] FIG. 4 shows a Western blot (a) and protein gel (b) that indicate lack of expression of gene products of yfbG, adhP, and cyoA. Lack of expression is indicated by absence of spot or band.

    [0100] FIG. 5 shows removal of thyA prior to homologous recombination.

    [0101] FIG. 6 shows removal of a gene targeted for deletion via a two step process.

    [0102] FIG. 1 relates to the detailed description of the invention. FIGS. 2, 5, and 6 relate to Example 2, Construction of the Ion Exchange Separatome of E. coli and Its Use to Design and Build Novel Host Strains for a Common Chromatography Resin. FIGS. 3 and 4 refer to Example 1, Identification of Host Cell Proteins Associated With a Specific Product, Histidine-Tagged Green Fluorescent Protein, as a Comparative Example.

    DETAILED DESCRIPTION OF THE INVENTION

    [0103] The following detailed description of the invention is provided to aid those skilled in the art in practicing the present invention. Even so, the following detailed description should not be construed to unduly limit the present invention, as modifications and variations in the embodiments herein discussed may be made by those of ordinary skill in the art without departing from the spirit or scope of the present inventive discovery.

    [0104] The contents of each of the references cited herein is herein incorporated by reference in its entirety.

    [0105] As noted above, Asenjo et al. (2004), “Is there a rational method to purify proteins? From expert systems to proteomics”, Journal of Molecular Recognition 17:236-247, points out that, “Until now, it has been virtually impossible to select separation and purification operations for proteins either for therapeutic or analytical application in a rational manner due to lack of fundamental knowledge on the molecular properties of the materials to be separated and the lack of an efficient system to organize such information.” The present invention provides solutions to this problem.

    [0106] The inventions disclosed herein include a separatome-based protein expression and purification platform based on the juxtaposition of the chromatographic binding properties of genomic peptides, polypeptides, and proteins with the characteristic and location of genes on the target chromosome, such as those of E. coli, Bacillus subtilis, yeasts, and other host cells. The separatome-based protein expression and purification platform maps the separatome of target chromosomes based on relationships between the loci of genes associated with nuisance peptides, polypeptides, and proteins. In addition, the separatome-based protein expression and purification platform reduces the genome of host cells through precisely targeted modifications to create custom, robust target host strains with reduced nuisance peptides, polypeptides, and proteins. Moreover, the present separatome-based protein expression and purification platform provides a computerized knowledge tool that, given separatome data regarding a target peptide, polypeptide, or protein, intuitively suggests strategies leading to efficient purification. The separatome-based protein expression and purification platform is an efficient bioseparation system that intertwines host cell strain and chromatography.

    Definitions

    [0107] The following definitions are provided to aid the reader in understanding the various aspects of the present invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention pertains.

    [0108] “An affinity ligand” for affinity chromatography refers to a chemical moiety, coupled to a stationary phase, that serves as a biospecific sorptive group.

    [0109] “Host cell” refers to a cell used to express an endogenous or heterologous nucleic acid sequence encoding a target peptide, polypeptide, or protein of interest.

    [0110] “Parent cell from which it is derived” refers to a cell that is modified to serve as a host cell of the present invention. As a non-limiting example, an E. coli parent cell can be a conventional E. coli K-12 cell.

    [0111] The phrase “a target recombinant therapeutic peptide, polypeptide, or protein” and the like refers to a peptide, polypeptide, or protein exhibiting human or veterinary medicinal properties, expressed using recombinant nucleic acid methodology. As used herein, “medicinal properties” broadly includes not only medical therapeutic applications, but use for nutritional purposes and personal care as well.

    [0112] The phrase “endogenous target recombinant peptide, polypeptide or protein” and the like refers to a peptide, polypeptide, or protein native to a host cell, which is expressed in such cell using recombinant nucleic acid methodology.

    [0113] It should be noted that the present invention, including all the parent cells, host cells, methods, etc., disclosed herein, are applicable not only to the expression and purification of endogenous peptides, polypeptides, or proteins via recombinant methods, but also to the expression and purification of endogenous peptides, polypeptides, and proteins that are naturally expressed within host cells, i.e., without the application of recombinant methodology.

    [0114] The phrase “heterologous target recombinant peptide, polypeptide or protein” and the like refers to a peptide, polypeptide, or protein not native to a host cell, which is expressed in such cell using recombinant nucleic acid methodology.

    [0115] The phrase “a modified genome compared to the genome in the parent cell from which it is derived” refers to modification of genes to abate the undesirable effect(s) of the gene products on separation efficiency performed by, for example, point mutation, isozyme substitution, transposon mutagenesis, etc. As indicated, modification includes gene substitution.

    [0116] “Proteome” refers to a collection of identifiable proteins expressed by a host cell.

    [0117] “Chromatotome” refers to a proteome defined by a set of host cell proteins that bind a chromatographic stationary phase.

    [0118] “Separatome” refers to a proteome defined by a set of host cell proteins that are associated with a separation technique (not limited to packed bed chromatography).

    [0119] “Metalloproteome” refers to a proteome with the identifying characteristic of interaction with metals or metal ions.

    [0120] “Metabolome” refers to a collection of small-molecule metabolites like glucose-6-phosphate and other molecules of similar molecular weight.

    [0121] “Separation efficiency” is manifested as separation capacity, separation selectivity, or both. In many cases, separation capacity is a more important parameter for the practice of the present invention.

    [0122] “Separation capacity” refers to the amount of peptides, polypeptides, and/or proteins that can be captured during the loading cycle of a chromatographic separation. Separation capacity is defined as the amount of target recombinant peptide, polypeptide, or protein adsorbed by a column per mass lysate fed to the column. The present invention encompasses increases in separation capacity in the range of from about 5% to about 35% or more. Such increases reflect an advantage of the present separatome invention concept over the separation capacities achievable using standard extraction and purification methods.

    [0123] “Separation selectivity” refers to the amount of target protein/total protein captured by a chromatographic adsorbent. Separation selectivity is defined as the amount of target recombinant peptide, polypeptide, or protein adsorbed by the column per total protein adsorbed to the column.

    [0124] “Percent B” refers to a proportion or amount, expressed as a number between 0 and 100%, of a mixture fed to a chromatography column comprised of a blend of two fluids of different compositions, i.e., composition A and composition B. As % B increases, the change in mobile phase composition causes proteins to be eluted in a differential fashion, beginning with those of low affinity.

    [0125] “Strongly retained” refers to peptides, polypeptides, and proteins that elute from a chromatography column upon desorption due to stringent changes in mobile phase composition identified by “percent B”.

    [0126] “Weakly retained” refers to peptides, polypeptides, and proteins that elute from a chromatography column upon desorption due to small changes in mobile phase composition identified by “percent B”.

    [0127] “Common salt” refers to a compound that dissociates in water to form a cation and an anion, such as a chloride salt, a sulfate salt, an acetate salt, a carbonate salt, a propionate salt, etc., as would be apparent to one of ordinary skill in the art. Common cations in such salts are, for example, sodium, potassium, and ammonium cations.

    [0128] The phrase “chromatographically relevant host cell peptides, polypeptides, or proteins for column affinity chromatography or column adsorption-based, non-affinity chromatography” refers to proteins of a separatome or chromatotome.

    [0129] “Importance” refers to the degree to which, should a host cell peptide, polypeptide, or protein be deleted, modified, or inhibited, capacity recovery is impacted. Proteins of chromatographic relevance are considered important should large gains in capacity recovery be achieved through deletion, modification, or inhibition. “Important” proteins are therefore a subset of relevant proteins.

    [0130] “Reduced” in the context of the level of expression of peptides, polypeptides, or proteins from host cell genes refers to diminution in the amount of such expression products in the range of from about 5% to about 95%, more preferably from about 10% to about 95%, or more, compared to the level of such products normally observed in parent cells from which such host cells are derived.

    [0131] “Scoring” refers to rank ordering members of a separatome to identify host cell peptides, polypeptides, or proteins that impair the chromatographic separation efficiency of a target recombinant peptide, polypeptide, or protein expressed in the host cell, and to establish quantitative improvements gained through their elimination.

    [0132] “Operational variable” refers to a condition or operating parameter that leads to different Damkohler, Biot, or Peclet numbers used to describe a separation technique.

    [0133] “Purify, purifying, purified” and the like refer to the process by which a peptide, polypeptide, or protein in a mixture is enriched so as to contain lesser amounts of materials derived from the host cell in which it is expressed, and the enriched product, respectively.

    [0134] “Plant cells” includes cells of flowering and non-flowering plants, as well as algal cells, for example Chlamydomonas, Chlorella, etc.

    [0135] Certain claims have unique formulae to mathematically define the non-metabolic aspects of the separatome, with specific regard to the overall impact a peptide, polypeptide, or protein has on column efficiency. A peptide, polypeptide, or protein elutes or emerges from a column as a peak of material, first at low concentration increasing to a maximum value, then decreasing back to zero, in the characteristic shape of a bell-like curve. The peak adopts a shape that may be described as sharp/narrow, with the majority of material of interest contained in a few fractions; broad/shallow, with the majority of material present in multiple fractions; or something in between. The time (retention time) at which the peak emerges is governed by binding strength. Peptides, polypeptides, and proteins with high affinity towards a ligand require more stringent conditions for desorption to occur, whereas those with low affinity pass through the column unretained. The ability to capture both phenomena, namely peak shape and retention time, is important to quantitatively establish the chromatographic relevance of a peptide, polypeptide, or protein. Once the relevance for a set of peptides, polypeptides, or proteins is established, molecular biology techniques are then used to delete, modify, inhibit the expression of, or substitute genes associated with these interfering molecules to directly increase column capacity and indirectly enhance purity.

    [0136] Defining “recovery potential” for protein (i) first involves determining the fractional capacity occupied by this particular host cell protein by:


    recovery potential.sub.i=h.sub.i,total/h.sub.total,ms

    with h.sub.total,ms=total amount of host cell proteins bound to column, and h.sub.i,total=the bound amount attributed to (i). The value of recovery potential is bound by zero and one, with a value of one indicative of a single host cell protein, if removed from the separatome, would achieve complete recovery of the column capacity. Extending this argument to the removal of (n) proteins, the term “capacity recovery” is defined in general as:

    [00003] capacity .Math. .Math. recovery = 100 .Math. % .Math. .Math. x .Math. .Math. i = 1 n .Math. recovery .Math. .Math. potential i

    where the sigma operator allows one to sum the individual contributions for the set of (n) proteins. In the equation, n refers to number of proteins, and i is an individual protein.

    [0137] These two simple relationships provide the starting point to define how much capacity can be gained as genes are deleted, modified, inhibited, or substituted. The relationships do not, however, establish order or priority within the context of peak shape and retention time. The latter is important to the disclosed invention because as mentioned previously, it is desired to focus efforts on common, problematic host cell proteins rather than those that are specific to a target recombinant product. Strongly retained or high affinity host cell proteins that are bound and that subsequently reduce column capacity would be generally problematic due to their persistent presence. Other qualifiers generally regarded as problematic would include high molecular weight (steric effects at high loading), sensitivity to proteolysis (multiple peaks or broad peak for a single protein), and propensity for subunit adsorption (multiple peaks or broad peak for a single protein). A criterion has been developed to score the “importance” of a protein (i) within a separatome, namely:

    [00004] importance i = .Math. j .Math. [ b 1 ( y c j y max ) .Math. ( h i .Math. , j h i , total ) .Math. ( h i .Math. , j h j , total ) .Math. ( MW i MW ref ) α ] i

    with the following definitions: b.sub.1=scaling parameter; y.sub.cj and y.sub.max=concentration of mobile phase eluent in fraction (j) and maximum value, respectively; h.sub.i,j and h.sub.i,total=the amount of protein (i) in fraction (j) and total bound protein (i), respectively; h.sub.j,total=total amount of protein in fraction (j); MW.sub.i=molecular weight of protein (i); MW.sub.ref=molecular weight of a reference protein within the separatome; α=steric factor; and i=protein. These ratio terms—the y's and h's-adopt values between 0 and 1, yet hold different significances. A protein that remains bound and requires stringent conditions for elution reflects a y ratio to be close to, if not equal to, unity. A protein that emerges as a tight peak presents with a ratio for h close to unity, and finally, should that emerging peak constitute the majority of fraction (j), the third ratio would be close to unity. Multiplying each ratio, and summing the product of these ratios for each fraction (j) where (i) is present provides a quantitative ranking. For example, a protein that is retained at high NaCl concentration and emerges as a sharp peak would be deemed chromatographically relevant and will be scored as high with this formula. A second example would be a protein that broadly elutes. It would also receive a high score or relevancy because its score would be high by virtue of its presence in multiple fractions.

    [0138] Lastly, there requires a consideration of steric effects. As a chromatography column becomes loaded, larger proteins interact with multiple ligands either directly through adsorption, or indirectly through hindrance of binding. When steric effects require consideration, the basic equation contains a molecular weight ratio raised to a power that is descriptive of these phenomena. A non-zero alpha in the above equation, with a preferred value between 0 and 1, would indicate some degree of steric effects. Note that the general form of the importance equation also permits scale-parameters (b.sub.1) to adjust the weighting of a particular score. For example, b.sub.1 may be used to indicate metabolic necessity (b.sub.1=0), meaning a zero value will force a low score because it likely will not be deleted form the genome.

    [0139] To summarize, the basic form of the equation favors the elimination or deletion of peptides, polypeptides, or proteins that have high affinity toward the adsorbent, with some degree of freedom to permit the tailoring of the modifications should the host cell be expressly used for a single recombinant DNA product and not a variety of products.

    Commercially Important Protein Products

    [0140] Exemplary, non-limiting, commercially important peptide, polypeptide, and protein products that can be expressed, recovered, and purified using the host cells, methods, and separatome information disclosed herein include, but are not limited to, the following.

    [0141] Therapeutic Proteins

    [0142] Examples of therapeutic human proteins that have been synthesized from genes cloned in bacteria and/or eukaryotic cells, or by expression in plants or animals, include antibodies and antigen-binding fragments; vaccines; α.sub.1-Antitrypsin (emphysema); deoxyribonuclease (cystic fibrosis); epidermal growth factor (ulcers); erythropoietin (anemia); Factor VIII (hemophilia); Factor IX (Christmas disease); fibroblast growth factor (ulcers); follicle stimulating hormone (infertility treatment); granulocyte colony stimulating factor (cancers); insulin (diabetes); insulin-like growth factor 1 (growth disorders); interferon-α (leukemia and other cancers); interferon-β (cancers, AIDS); interferon-γ (cancers, rheumatoid arthritis); interleukins (cancers, immune disorders); lung surfactant protein (respiratory distress); relaxin (aid in childbirth); serum albumin (plasma supplement); somatostatin (growth disorders); somatotrophin (growth disorders); superoxide dismutase (free radical damage in kidney transplants); tissue plasminogen activator (heart attack); tumor necrosis factor (cancers).

    [0143] Proteins and Enzymes Used in Analytical Applications

    [0144] In addition to the use of antibodies and enzymes as therapeutic agents, they are also used in the diagnosis of diseases as the components of some confirmatory tests of certain diagnostic procedures. Hexokinase and glucose oxidase are used in the quantification of glucose in the serum and urine. Glucose-oxidase is used in glucose electrodes. Uricase is used for the estimation of uric acid present in urine. Alkaline phosphatase, horseradish peroxidase, and antibodies are used in ELISA (Enzyme Linked Immunosorbent Assay).

    [0145] Industrial Enzymes and Proteins

    [0146] Industrially useful enzymes include carbohydrate-hydrolyzing enzymes such as amylases, cellulase, invertases, etc.; proteolytic enzymes such as papain, trypsin, chymotrypsin, etc.; and other bacterial and fungal-derived proteolytic enzymes and lipases that can hydrolyze various types of lipids and fats. All these enzymes are important in the food and beverage industries, the textile industry, paper industry, and detergent industry. Proteases have a special use in the beverage industry, meat and leather industries, cheese production, detergent industry, bread, and confectionary industry. Various types of lipases are used for the modifications of various types of lipids and fats, production of various organic acids including fatty acids, in detergents, and production of cocoa butter. In addition to all these, enzymes are used in chemical industries as reagents in organic synthesis for carrying out stereospecific reactions.

    [0147] Non-catalytic Functional Proteins

    [0148] These commercially important proteins are used in the food industry as emulsifiers, for inducing gelation, water binding, foaming, whipping, etc. These non-catalytic functional proteins are classified as whey proteins. The proteins that remain in solution after the removal of casein are by definition called whey proteins.

    [0149] Commercially available whey protein concentrates contain 35% to 95% protein. If they are added to food on a solid's basis, there will be large differences in functionality due to the differences in protein content. Most food formulations call for a certain protein content and thus whey-protein concentrates are generally utilized as a constant protein base. In this case, the differences due to protein content as such should be eliminated. As the protein content increases, the composition of other components in the whey-protein concentrate must also change and these changes in composition have an effect on functionality.

    [0150] Nutraceutical Proteins

    [0151] Nutraceutical proteins represent a class of nutritionally-important proteins having therapeutic activity. The whey-protein concentrates and some of the milk proteins of infant foods contain certain pharmaceutical proteins having high nutritive quality. Infants get the required proteins from the mother's milk, which also contains certain therapeutic proteins that protect the baby from infection and other problems. There are other infant foods, which also have more or less the same composition as that of mother's milk, made up of cow's and buffalo's milk. All these food proteins provide the infants the raw building materials in the form of essential amino acids and at the same time protect them from microbial infections and other diseases.

    Large scale Enzyme applications

    [0152] Detergents

    [0153] Bacterial proteinases are still the most important detergent enzymes. Lipases decompose fats into more water-soluble compounds. Amylases are used in detergents to remove starch based stains.

    [0154] Starch Hydrolysis and Fructose Production

    [0155] The use of starch degrading enzymes was the first large scale application of microbial enzymes in food industry. Mainly two enzymes carry out conversion of starch to glucose: alpha-amylase and fungal enzymes. Fructose is produced from sucrose as a starting material. Sucrose is split by invertase into glucose and fructose, and fructose is separated and crystallized.

    [0156] Beverages

    [0157] Enzymes have many applications in the beverage industry. Lactase splits milk-sugar lactose into glucose and galactose. This process is used for milk products that are consumed by lactose intolerant consumers. Addition of pectinase, xylanase, and cellulase improve the liberation of the juice from pulp. Similarly, enzymes are widely used in wine production.

    [0158] Textiles

    [0159] The use of enzymes in the textile industry is one of the most rapidly growing fields in industrial enzymology. The enzymes used in the textile field are amylases, catalase, and lactases, which are used to remove starch, degrade excess hydrogen peroxide, bleach textiles, and degrade lignin

    [0160] Animal Feed

    [0161] Addition of xylanase to wheat-based broiler feed has increased the available metabolizable energy 7-10% in various studies. Enzyme addition reduces viscosity, which increases absorption of nutrients, liberates nutrients either by hydrolysis of non-degradable fibers or by liberating nutrients blocked by these fibers, and reduces the amount of feces.

    [0162] Baking

    [0163] Alpha-amylases have been most widely studied in connection with improved bread quality and increased shelf life. Use of xylanases decreases the water absorption, and thus reduces the amount of added water needed, in baking. This leads to more stable dough. Proteinases can be added to improve dough-handling properties; glucose oxidase has been used to replace chemical oxidants and lipases to strengthen gluten, which leads to more stable dough and better bread quality.

    [0164] Pulp and Paper

    [0165] The major application in the pulp and paper industry is the use of xylanases in pulp bleaching. This considerably reduces the need for chlorine based bleaching chemicals. In paper making, amylase enzymes are used especially in modification of starch. Pitch is a sticky substance present mainly in softwoods. Pitch causes problems in paper machines and can be removed by lipases.

    [0166] Leather

    [0167] The leather industry uses proteolytic and lipolytic enzymes in leather processing. Enzymes are used to remove unwanted parts. In dehairing and dewooling phases, bacterial proteases are used to assist the alkaline chemical process. This results in a more environmentally friendly process and improves the quality of the leather. Bacterial and fungal enzymes are used to make leather soft and easier to dye.

    [0168] Specialty Enzymes

    [0169] There are a large number of specialty applications for enzymes. These include the use of enzymes in analytical applications, flavor production, protein modification, personal care products, DNA-technology, and in fine chemical production.

    [0170] Enzymes in Analytics

    [0171] Enzymes are widely used in clinical analytical methodology. Contrary to bulk industrial enzymes, these enzymes need to be free from side activities. This means that elaborate purification processes are needed.

    [0172] An important development in analytical chemistry is biosensors. The most widely used application is a glucose biosensor involving glucose oxidase catalyzed reaction. Several commercial instruments are available which apply this principle for measurement of molecules like glucose, lactate, lactose, sucrose, ethanol, methanol, cholesterol, and some amino acids.

    [0173] Enzymes in Personal Care Products

    [0174] Personal care products are a relatively new area for enzymes. Proteinase and lipase containing enzyme solutions are used for contact lens cleaning. Hydrogen peroxide is used in disinfections of contact lenses. The residual hydrogen peroxide after disinfections can be removed by catalase. Some toothpaste contains glucoamylase and glucose oxidase. Enzymes are also being studied for applications in skin and hair care products.

    [0175] Enzymes Used in DNA-Technology

    [0176] DNA-technology is an important tool in the enzyme industry. Most traditional enzymes are produced by organisms that have been genetically modified to overproduce desired enzymes. Recombinant DNA methodology has been used to engineer overproducing microorganisms, and employs enzymes such as nucleases (especially restriction endonucleases), ligases, polymerases, and DNA-modifying enzymes to modify genes and construct necessary expression cassettes and vectors.

    [0177] Enzymes in Fine Chemical Production

    [0178] In spite of some successes, commercial production of chemicals by living cells via pathway engineering is still in many cases the best alternative to apply biocatalysis. Isolated enzymes have, however, been successfully used in fine chemical synthesis. Some of the most important examples are:

    [0179] Chirally Pure Amino Acids and Aspartame

    [0180] Natural amino acids are usually produced by microbial fermentation. Novel enzymatic resolution methods have been developed for the production of L- and D-amino acids. Aspartame, the intensive non-calorie sweetener, is synthesized in non-aqueous conditions by thermolysin, a proteolytic enzyme.

    [0181] Rare Sugars

    [0182] Recently, enzymatic methods have been developed to manufacture practically all D- and L-forms of simple sugars. Glucose isomerase is one of the important industrial enzymes used in fructose manufacturing.

    [0183] Semisynthetic Penicillins

    [0184] Penicillin is produced by genetically modified strains of Penicillium strains. Most of the penicillin is converted by immobilized acylases to 6-aminopenicillanic acid, which serves as a backbone for many semisynthetic penicillins.

    [0185] Lipase-Based Reactions

    [0186] In addition to detergent applications, lipases can be used in versatile chemical reactions since they are active in organic solvents. Lipases are used in transesterification, for enantiomeric separation of alcohols, and for the separation of racemic mixtures. Lipases have also been used to form aromatic and aliphatic polymers.

    [0187] Enzymatic Oligosaccharide Synthesis

    [0188] The chemical synthesis of oligosaccharides is a complicated multi-step effort. Biocatalytic syntheses with isolated enzymes like glycosyltransferases and glycosidases or engineered whole cells are powerful alternatives to chemical methods. Oligosaccharides have found applications in cosmetics, medicines and as functional foods.

    Overview of the Invention

    [0189] The present invention provides a separatome-based host cell peptide, polypeptide, and protein expression and purification platform focusing on the proteomes of various chromatographic methods to provide a single host cell line, or set of host cell lines, that can be used for expression of a wide variety of recombinant peptides, polypeptides, and proteins, thereby eliminating the need to develop individual host cell lines for each purification process.

    [0190] The “separatome” of the present separatome-based protein expression and purification platform involves the juxtaposition of the binding properties of host cell peptides, polypeptides, and proteins in common chromatographic techniques (e.g., IMAC, IEX, and/or HIC) with the characteristics and location of the corresponding encoding genes on the target host cell chromosome(s). While the examples of the separatome-based protein expression and purification platform disclosed herein focus on Escherichia coli as the host cell, and its chromatotome, the invention is not limited thereto as the separatome-based peptide, polypeptide, and protein expression and purification platform can extend to any suitable host conventionally used for recombinant expression, such as Lactococcus lactis, Bacillus species such as B. licheniformis, B. amyloliquefaciens, and B. subtilis, Corynebacterium glutamicum, Pseudomonas fluorescens, or other prokaryotes; fungi, including various yeasts such as Saccharomyces cerevisiae, Pichia (now K) pastoris, and Pichia methanolica; insect cells; mammalian cells; plant cells, including for example, tobacco (e.g., cultivars BY-2 and NT-1), alfalfa, rice, tomato, soybean, as well as algal cells; and protozoal cells such as the non-pathogenic strain of Leishmania tarentolae, etc.

    [0191] The present separatome-based peptide, polypeptide, and protein expression and purification platform is an efficient bioseparation system that intertwines host cell strain and chromatography. Since the high cost of product purification often limits the availability of therapeutic proteins of interest to immunology, vaccine development, pharmaceutical production, and diagnostic reagents, as well as the availability of enzymes for various applications, the present separatome-based peptide, polypeptide, and protein expression and purification platform provides alternative pathways towards efficient purification based on the utilization of proteome data. In particular, the separatome-based protein expression and purification platform provides for: (i) a system of chromatographic data based on identified, conserved genomic regions that span resin- and gradient-specific chromatographies, or chromatotomes, for example, a database of E. coli proteins that span the chromatography total contaminant pool (TCP)/elution contaminant pool (ECP) and bind under various conditions to a variety of chromatographic resins; (ii) a process to minimize contaminant pools of nuisance or coeluting proteins associated with specific chromatographies, for example, gradients that substantially decrease the number of coeluting proteins encountered during bioseparation, and the specific, targeted deletion of nuisance host cell peptide-, polypeptide-, and protein-encoding genes to minimize contaminant pools associated with affinity adsorption and non-affinity adsorption chromatographies, including IMAC, cation IEX, anion IEX, HIC, and combinations thereof.

    [0192] The separatome-based peptide, polypeptide, and protein expression and purification platform is constructed based upon a computer system of identified, conserved genomic regions that span resin- and gradient specific-chromatographies, or chromatotomes. The computer system includes a data visualization program/application resident on a standard computer device, such as a mainframe, desktop, or other computer. For example, the computer may have a central processor that controls the overall operation of the computer and a system bus that connects the central processor to one or more conventional components, such as a network card or modem. The computer may also include a variety of interface ports and drives for reading and writing data or files. A user of the separatome-based protein expression and purification platform can interact with the computer with a keyboard, pointing device, microphone, pen device, or other input device. The computer may be connected via a suitable network connection, such as a T1 line, a common local area network (“LAN”), via the worldwide web, or via other mechanism for connecting computer devices.

    [0193] The separatome-based peptide, polypeptide, and protein expression and purification platform will utilize large amounts of data compiled on the metalloproteome and metabolome of the selected host cell, such as E. coli. The data visualization program/application, such as CIRCOS®, a software package for visualizing data and information in a circular layout (available from Canada's Michael Smith Genome Sciences Center), enables the user to visualize the large amounts of data and information for exploring relationships between objects or positions. FIGS. 1 and 2 illustrates examples of how the data visualization program/application could illustrate the E. coli chromosome mapped with the chromatotome of multiple chromatographic techniques, thus showing where the different chromatotomes lie within the greater genome. Each line in FIG. 1 represents a single contaminating protein, and the graph at its base shows the total concentration of the protein as a percent of the TCP or ECP. If each TCP is subdivided into its respective ECPs, then further corollaries can be drawn between proteins and genomic location. Further, segments of the ring represent the E. coli genome or the proteome associated with a particular isolation technique. With respect to E. coli, inner rings can represent additional information like essentiality, successful deletion, metabolic function, etc. For a given chromatographic technique, inner ring data can represent conditions that trigger adsorption or elution, concentration in the extract, and if this protein is differentially expressed during stress.

    [0194] In addition, the separatome-based peptide, polypeptide, and protein expression and purification platform may utilize and/or incorporate data about the target genome and proteome sequences, such as from ECOGENE® (Institute for Advanced Biosciences, Keio University and Integrated Genomics, Chicago, Ill.), a database and website that reports the structural and functional annotation of Escherichia coli K-12 described in Zhou et al. (2013) Nucleic Acids Research 41, Database issue, (D1): D613-D624. doi: 10.1093/nar/gks1235. The data visualization program/application of the separatome-based protein expression and purification platform provides the user a feasible means of utilizing the data by melding it into a productive format, and in particular, the data visualization program/application provides the ability to visually summarize large collections of data covering peptides, polypeptides, and proteins encountered in the chromatotome and their essentiality.

    [0195] The mapping and plotting of the IMAC, IEX and HIC data by the separatome-based peptide, polypeptide, and protein expression and purification platform allows for the identification of large contiguous regions of contaminants from several chromatography techniques that may be targeted for modification if necessary.

    [0196] Since the overall structure of a target recombinant peptide, polypeptide, or protein and the column resin are usually fixed constraints, a reduction in contaminant species has the ability to improve chromatographic recovery and purification via elimination of undesirable binding events. Overall reduction of contaminant species, including undesired host cell peptides, polypeptides, and proteins, can be achieved by removal, modification, or inhibition of the expression of the genomic regions coding for the contaminants.

    General Methods

    [0197] Practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology, recombinant DNA technology, microbiology, chemistry, etc., which are well known in the art and within the capabilities of those of ordinary skill in the art. Such techniques include the following non-limiting examples: preparation of cellular, plasmid, and bacteriophage DNA; manipulation of purified DNA using nucleases, ligases, polymerases, and DNA-modifying enzymes; introduction of DNA into living cells; cloning vectors for various organisms; PCR; gene deletion, modification, replacement, or inhibition; production of recombinant peptides, polypeptides, and proteins in host cells; chromatographic methods; etc.

    [0198] Such methods are well known in the art and are described, for example, in Green and Sambrook (2012) Molecular Cloning: A Laboratory Manual, Fourth Edition, Cold Spring Harbor Laboratory Press; Ausubel et al. (2003 and periodic supplements) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y.; Amberg et al. (2005) Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual, 2005 Edition, Cold Spring Harbor Laboratory Press; Roe et al. (1996) DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; J. M. Polak and James O'D. McGee (1990) In Situ Hybridization: Principles and Practice; Oxford University Press; M. J. Gait (Editor) (1984) Oligonucleotide Synthesis: A Practical Approach, IRL Press; D. M. J. Lilley and J. E. Dahlberg (1992) Methods in Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA, Academic Press; and Lab Ref A Handbook of Recipes, Reagents, and Other Reference Tools for Use at the Bench, Edited by Jane Roskams and Linda Rodgers (2002) Cold Spring Harbor Laboratory Press; Burgess and Deutscher (2009) Guide to Protein Purification, Second Edition (Methods in Enzymology, Vol. 463), Academic Press. Note also U.S. Pat. Nos. 8,178,339; 8,119,365; 8,043,842; 8,039,243; 7,303,906; 6,989,265; US20120219994A1; and EP1483367B1. The entire contents of each of these texts and patent documents is herein incorporated by reference.

    Methods for Deleting, Modifying, and Inhibiting the Expression of Genes

    [0199] Baba et al. (2006) Mol. Syst. Biol. 2:2006.0008 discloses methods for making precisely defined single gene deletions in E. coli.

    [0200] Datsenko et al. (2000) Proc. Natl. Acad. Sci. USA. 97(12):6640-5 discloses methods for inactivating chromosomal genes in E. coli using PCR products.

    [0201] Stringer et al. (2012) PLoS ONE 7(9): e44841. doi:10.1371/journal.pone.0044841 discloses a rapid, efficient, PCR-based recombineering method that can be used to introduce scar-free point mutations, deletions, epitope tags, and promoters into the genomes of multiple species of enteric bacteria.

    [0202] Methods for RNA silencing and antisense oligonucleotide inhibition of gene expression are well known in the art. Note, for example, the reviews in Nature (2009) 457, No. 7228, pp. 395-433 and Molecular Cancer Therapeutics (2002) 1:347-355, respectively.

    Frequently Used Expression Systems for Foreign Genes

    [0203] Yin et al. (2007) Journal of Biotechnology 127(3):335-347 reviews the most frequently used expression systems for foreign genes.

    [0204] Listed below are a number of representative papers describing protein production in frequently used host cell systems.

    [0205] Expression in E. coli

    [0206] Baneyx (1999) Curr. Opin. Biotechnol. 10(5): 411-21.

    [0207] Expression in Bacillus Species

    [0208] Bacillus species produce and secrete a large number of useful proteins and metabolites (Zukowski (1992) “Production of commercially valuable products,” In: Doi and McGlouglin (eds.) Biology of Bacilli: Applications to Industry, Butterworth-Heinemann, Stoneham, Mass., pp. 311-337). The most common Bacillus species used in industry are B. licheniformis, B. amyloliquefaciens, and B. subtilis. Because of their GRAS (generally recognized as safe) status, strains of these Bacillus species are natural candidates for the production of proteins utilized in the food and pharmaceutical industries. Important production enzymes include α-amylases, neutral proteases, and alkaline (or serine) proteases.

    [0209] Published U.S. application 2012/0183995 discloses methods and compositions for the improved expression and/or secretion of proteins of interest in Bacillus.

    [0210] Expression in Corynebacterium glutamicum

    [0211] Date et al. (2006) Lett Appl Microbiol. 42(1): 66-70.

    [0212] Expression in Pseudomonas fluorescens

    [0213] Retallack (2011) Protein Expression and Purification 81:157-65.

    [0214] Expression in Eukaryotes

    [0215] Yeasts and Other Fungi

    [0216] Cregg et al. (2000) Mol. Biotechnol. 16(1): 23-52.

    [0217] Malys et al. (2011) Methods Enzymol. 500:197-212.

    [0218] Expression in Plant Cells

    [0219] Hellwig et al. (2004) Nature Biotechnology 22(11):1415-1422 comprehensively reviews the field of plant cell cultures for the production of recombinant proteins. The authors note that suspension cell cultures have been prepared from several different plant species, including Arabidopsis thaliana, Taxus cuspidata, Catharanthus roseus, and domestic crops such as tobacco, alfalfa, rice, tomato, and soybean. They also point out that some researchers focus on plants with a high protein content, for example soybean and lupin, assuming that these might more readily facilitate higher protein expression levels.

    [0220] Hempel et al. ((2011) “Algae as Protein Factories: Expression of a Human Antibody and the Respective Antigen in the Diatom Phaeodactylum tricornutum”, PLoS ONE 6(12): e28424. doi:10.1371/journal.pone.0028424) provides an example of the use of an algal cell, Phaeodactylum tricornutum, to produce a monoclonal human IgG antibody against the Hepatitis B surface protein and the respective antigen. This reference further discusses the potential of algae as an efficient low cost and CO.sub.2-neutral expression system, exhibiting fast growth rates without the risk of human pathogenic contaminations. The authors note current investigations on the use of the green alga Chlamydomonas reinhardtii as an expression system.

    [0221] Expression in Insect and Mammalian Cells

    [0222] Baculovirus-Infected Insect Cells

    [0223] Baculovirus-infected insect cells such as the Sf9, Sf21, and Hi-5 strains can be used to express large quantities of glycosylated proteins that cannot be expressed using E. coli or yeasts. Genes are not expressed continuously because infected host cells eventually lyse and die during each infection cycle (Yin et al. (2007) Journal of Biotechnology 127:335-347).

    [0224] Non-Lytic Insect Cell Expression

    [0225] Non-lytic insect cell expression is an alternative to the lytic baculovirus expression system. In non-lytic expression, vectors are transiently or stably transfected into the chromosomal DNA of insect cells for subsequent protein expression (Dyring (2011) Bioprocessing Journal 10 (2011) 28-35; Olczak and Olczak (2006) Analytical Biochemistry 359 (2006) 45-53). This is followed by selection and screening of recombinant clones (McCarroll and King (1997) Current Opinions in Biotechnology 8:590-594). The non-lytic system has been used to give higher protein yield and quicker expression of recombinant proteins compared to baculovirus-infected cell expression (Olczak, supra). Cell lines used for this system include Sf9, Sf21 from Spodoptera frugiperda cells, Hi-5 from Trichoplusia ni cells, and Schneider 2 cells and Schneider 3 cells from Drosophila melanogaster cells (Dyring, supra; McCarroll and King, supra). With this system, cells do not lyse, and several cultivation modes can be used (Dyring, supra). Additionally, protein production runs are reproducible (Dyring, supra; Olczak and Olczak, supra). This system yields a homogeneous product.

    [0226] Kost et al. (2005) Nat. Biotechnol. 23(5):567-75.

    [0227] Rosser et al. (2005) Protein Expr. Purif. 40(2):237-43.

    [0228] Lackner et al. (2008) Anal. Biochem. 380(1):146-8.

    [0229] Expression in Animal Cells

    [0230] Currently, about 60-70% of all recombinant protein pharmaceuticals are produced in mammalian cells, and it is estimated that several hundred clinical candidate proteins are under development. Many of these are expressed in immortalized Chinese hamster ovary (CHO) cells, while other cell lines, such as those derived from mouse myeloma (NSO), baby hamster kidney (BHK), human embryo kidney (HEK-293), and human retinal cells have gained regulatory approval for recombinant protein production (F. M. Wurm (2004) Nature Biotechnology 22(11):1393-1398). This reference discusses various aspects of recombinant protein expression in mammalian cells, including the design of expression vectors for DNA delivery, and cell culture.

    [0231] Expression in Protozoal Cells

    [0232] The eukaryotic protozoan Leishmania tarentolae (non-pathogenic strain) expression system, available from Jena Bioscience as the LEXSY (Leishmania expression system) system, allows stable and lasting production of proteins at high yield, in chemically defined media. Produced proteins exhibit fully eukaryotic post-translational modifications, including glycosylation and disulfide bond formation.

    [0233] Examples of specific host cells useful in the present invention include the following. These listings should not be construed to be limiting as other host cells known in the art are also useful in the present methods, and are encompassed by the present invention.

    TABLE-US-00004 TABLE 1 References Disclosing E. coli Strain Genomic Sequences Table Genome Entry E. coli Strain Reference Size Number Number (Source of Genomic Sequence) (Mb) 1 E. coli K-12 Blattner FR, et al. Science 1997 4.639 Sep. 5; 277(5331): 1453-62. 2 E. coli MG1655 Blattner FR, et al. Science 1997 4.639 Sep. 5; 277(5331): 1453-62. 3 E. coli BL21 (DE3) Jeong Hm et al. J Mol Biol 2009 4.56  Dec. 11; 394(4): 644-52 4 E. coli DH10B Durfee et al. J Bacteriol. 2008 4.69  Apr.; 190(7): 2597-606

    TABLE-US-00005 TABLE 2 References Disclosing B. subtilis Strain Genomic Sequences Table Entry Reference Number B. subtilis Strain Number (Source of Genomic Sequence) 1 B. subtilis 168 Barbe et al. Microbiology. 2009 Jun.; 155(Pt 6): 1758-75 2 B. subtilis BSn5 Deng et al. J Bacteriol. 2011 Apr.; 193(8): 2070-1

    [0234] In Tables 3 and 4, the cited genomic sequence reference is for the permanent curation of the National Center for Biotechnology Information (NCBI). Since eukaryotic cells have multiple chromosomes, their genomic sequences are often spread across multiple publications that each address a specific chromosome or section of a chromosome. NCBI curates this information and compiles it under their permanent Entrez Gene database.

    TABLE-US-00006 TABLE 3 References Disclosing S. cerevisiae Strain Genomic Sequences Table Entry S. cerevisiae Reference Number Strain Number (Source of Genomic Sequence) 1 S. cerevisiae S288c NCBI-Entrez Gene, Nucleic Acids Res. 2011 Jan.; 39(Database issue): D52-7 2 S. cerevisiae NCBI-Entrez Gene, Nucleic Acids Res. AWRI796 2011 Jan.; 39(Database issue): D52-7

    TABLE-US-00007 TABLE 4 References Disclosing K. pastoris Strain Genomic Sequences (K. pastoris was formerly known as Pichia pastoris) Table Entry K. pastoris Reference Number Strain Number (Source of Genomic Sequence) 1 K. pastoris CBS7435 Kuberl A, et al. J Biotechnol 2011 2 K. pastoris GS115 NCBI-Entrez Gene, Nucleic Acids Res. 2011 Jan.; 39(Database issue): D52-7

    TABLE-US-00008 TABLE 5 References Disclosing CHO Cell Strain Genomic Sequences Table Entry Number CHO Cell Strain Number Reference 1 CHO-K1 Puck TT, et al. J. Exp. Med. 108: 945-956, 1958. Xu, et al. Nature Biotechnology 29, 735-741 (2011)

    [0235] Human embryonic kidney (HEK) cells have 4.5 kb of adenovirus 5 DNA in addition to the human genome. This information can also be found in the NCBI Entrez Gene Database.

    TABLE-US-00009 TABLE 6 References Disclosing HEK Cell Strain Genomic Sequences Table Entry HEK Cell Reference Number Strain Number (Source of Genomic Sequence) 1 HEK 293 NCBI-Entrez Gene, Nucleic Acids Res. 2011 Jan.; 39(Database issue): D52-7

    [0236] The following examples are provided to illustrate various aspects of the present invention, and should not be construed as limiting the invention only to these particularly disclosed embodiments. The materials and methods employed in the examples below are for illustrative purposes, and are not intended to limit the practice of the present invention thereto. Any materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present invention.

    Example 1

    Identification of Host Cell Proteins Associated With a Specific Product, Histidine-Tagged Green Fluorescent Protein, as a Comparative Example

    [0237] This comparative example demonstrates the identification of proteins of the 120 mM imidazole fraction (Ni(II) IMAC) and subsequent gene deletions. It demonstrates how to eliminate host cell contaminants for a specific target recombinant product, Green Fluorescent Protein (GFPuv), extended by a histidine-rich affinity tag (His.sub.6-GFP). His.sub.6-GFP elutes similarly to other histidine-tagged proteins found in the literature. While this example discloses three gene deletions that, in principle, would enhance the purity of the desired product, the knockouts of cyoA, adhP, and yfbG and their subsequent lack of expression does not favorably impact column capacity. These three proteins are insignificant in the metalloproteome of E. coli. Thus, no changes to the separatome are disclosed that lead to an overall increase in separation efficiency. The text of this example is an annotated version of the inventors' work described in Liu et al. (2009) J. Chromatog. A 1216:2433-2438.

    Strains, Plasmids, and Growth Conditions

    [0238] Escherichia coli BL21 DE3 expressing GFPuv tagged with (His.sub.6) (SEQ ID NO:1) were constructed using basic molecular biology techniques. PCR primers F (5′-GCCAAGCTTGTGGCATCATCATCCGCATATGAGTAAAGGAGAAGAACTTTTC-3′) (SEQ ID NO:2) and R (5′-TTGGAATTCATTATTTGTAG AGCT-3′) (SEQ ID NO:3) containing Hind III and EcoRI sites (underlined correspondingly), were used to amplify and extend GFPuv. These enzymes were used to digest the PCR fragment and the parent plasmid. T4 DNA ligase was then used to construct a new vector that was built from the PCR-extended gene and the major part of the pGFPuv plasmid. Transformants were selected in LB agar containing 50 μg/ml ampicillin. E. coli cells were grown in Luria-Bertani (LB) overnight and inoculated in a 2-liter flask containing 500 ml M9 supplemented with 10 g/L glucose such that the initial A.sub.660 was 0.1. To express His.sub.6-GFPuv, 4% inoculations of overnight cultures were made in 500 mL LB and induced with 1 mM of IPTG after 1-2 hours. Fermentations were carried out at 37° C. and the agitation speed of the shaker was set at 200 rpm. Cell pellets were collected by centrifugation at 5000 g and frozen at −80° C. before cell lysis.

    Sample Preparation and Chromatography

    [0239] Cell pellets were suspended in 20 ml 1× native purification buffer (50 mM NaH.sub.2PO.sub.4, pH 8.0; 500 mM NaCl) combined with 100 μl Triton X-100, 80 μl 100 mM MgCl.sub.2, 20 μl phenylmethylsulphonyl fluoride (PMSF) and 100 μl 100 mg/mL lysozyme. The mixture was sonicated on ice at 4W for 30 min using a Vibra cell ultrasonifier (Fisher Scientific, Pittsburgh, Pa., USA), and centrifuged at 5000 rpm for 20 min. The supernatants were collected and passed through a 0.45 μm filter before column loading.

    [0240] For experiments identifying natural contaminants or to follow the adsorption and elution of His.sub.6-GFP, the cleared lysate was applied to 4 ml ProBond nickel-chelating resin in an open column followed by equilibration using 1× native purification buffer (5× native purification buffer, as supplied with the resin, is comprised of 250 mM NaH2PO4, pH 8.0. 2.5 M NaCl). Step elutions were carried out with native purification buffer with the following imidazole concentrations: 60 mM, 80 mM, 100 mM, 120 mM, and 200 mM. This was followed by a 500 mM EDTA elution. The elution volumes for each step were 24 ml, or 6 column volumes (CVs), and applied at an approximate flow rate of 0.5 ml/min. Fractions were collected and measured for protein concentration with a BCA Protein Assay Kit (Pierce, Rockford, Ill., USA) and/or assayed for GFPuv in triplicate with a Tecan Infinite M200 96-well plate reader with excitation/emission spectra set to 395/509 nm.

    SDS-PAGE and Mass Spectrometry.

    [0241] Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was performed for 6 hours at 100 V. Gels were stained with Coomassie Blue. The Genomics and Proteomics Core Laboratories at the University of Pittsburgh performed the protein identification. To account for the experimental accuracy of the measurement, three spots were excised from each band and each digested with trypsin. Peptides were separated by liquid chromatography (LC), then identified by tandem mass spectrometry (MS/MS) fragmented by collision-induced dissociation. MASCOT v2.1 (Matrix Science, Boston Mass. USA) was used to match LC/MS data with E. coli proteins. For positive identification, spectral data from each of the three spots matched.

    Functional Prediction of Identified Proteins in 120 mM Elution Fraction.

    [0242] Functional classification of all identified proteins was based on the Profiling of Escherichia coli chromosome (PEC) database (Hashimoto et al. (2005) Molecular Microbiology 55: 137-149).

    Construction of Knockout Mutants.

    [0243] All the knockout mutants of this Example were generated with the same deletion system according to the manual accompanying the Quick and Easy E. coli Gene Deletion Kit (Gene Bridges, Heidelberg, Germany). This kit uses plasmid pRedET to facilitate homologous recombination events. During the progression of the work, a triple mutant of BL21 (ΔcyoAΔyfbGΔadhP) was constructed through a series operation consisting of recombination, selection with kanamycin, confirmation, and removal of the selection marker using flipase recognition site (FRT flanked kanamycin gene).

    Southern Blot Analysis

    [0244] DNA probes used for Southern hybridization were prepared from PCR-amplified fragments. Probes were labeled according to the manual of Amersham Gene Images Random Prime Labeling Kit (GE Healthcare). Genomic DNA was isolated from knockout mutants using standard protocols. DNA samples were digested with Bam HI, separated by electrophoresis on 1% agarose gels, transferred to Amersham Hybond-N+ membranes (GE Healthcare), and then baked at 80° C. for 2 hours. The probes were hybridized to these blots and detected according to the protocol of the Gene Images ECL Detection Kit (GE Healthcare).

    SDS-PAGE Evaluation of CyoA, YfbG and AdhP Knockout in Mutant Strains.

    [0245] Cell preparations of BL21, mutants, and chromatography fractions were evaluated by SDS-PAGE. Approximately 15 μg sample/well were loaded into a 12% acrylamide gel.

    Identification of Knockout Candidates and Confirmation of their Deletion

    [0246] A total extract of E. coli protein was loaded to the ProBond nickel-chelating column using 1× native purification buffer (5× native purification buffer, as supplied with the resin, is comprised of 250 mM NaH2PO4, pH 8.0. 2.5 M NaCl). Step elutions were carried out with native purification buffer with the following imidazole concentrations: 60 mM, 80 mM, 100 mM, 120 mM, and 200 mM. FIG. 3 shows the protein concentrations in each fraction normalized to the total protein used for column loading. The bar graph indicates order of magnitude changes in the total protein encountered with each imidazole challenge. Note that the elution fraction containing the 120 mM imidazole fraction contained the least amount of protein. Coincidentally, this fraction that contains low host cell protein is also the fraction where His.sub.6-GFPuv elutes.

    [0247] SDS-PAGE and LC-MS/MS were used to identify the cellular proteins present in the concentrated sample of pooled 120 mM imidazole elution fractions. A total of 18 proteins were identified (Table 7), with cyoA, yfbG, and adhP selected for deletion due to lack of essentiality. Southern blot analysis and gel electrophoresis indicated lack of expression of the three gene products cyoA, yfbG, and adhP. FIG. 4 shows this confirmation due to lack of spots associated with positive hybridization and bands of the molecular weights of these products, respectively.

    TABLE-US-00010 TABLE 7 Proteins eluted at 120 mM from a Ni(II)-NTA column dnaK yfbG adhP cyoA rplB slyD nagD ahpC rpsG rplO rpsE rplM Fur Hypothetical protein ECs2542 rplJ rpsL Hns rplL

    [0248] These results demonstrate that it is possible to apply a limited set of data and to produce a knockout strain capable of enhancing the purity of a recombinant peptide, polypeptide, or protein. It is used as a comparative example to illustrate the lack of a rigorous methodology to identify specific changes to the host cell that lead to an altered separatome capable of broadly improving separation efficiency, and column capacity in particular, regardless of desired recombinant product.

    Example 2

    Construction of the Ion Exchange Separatome of E. coli and its Use to Design and Build Novel Host Strains for a Common Chromatography Resin

    [0249] This example describes the process by which a separatome is constructed for a chromatography resin and subsequently used to guide modifications to E. coli to increase chromatographic efficiency. It begins by describing how data are acquired by fractionating an extract derived from fed batch growth over a DEAE ion exchange bed, and continues by constructing the separatome—a data structure that includes information on the genes responsible for identified proteins coupled to a quantitative scoring to rank order molecular biology efforts that lead to a reduced separatome. Finally, construction of example strains is described, concluding with information regarding high priority strain modifications necessary for significant gains in separation efficiency through their deletion, modification, or inhibition.

    Cloning Strains and Vectors

    [0250] E. coli strain MG1655 (K-12 derivative) was selected as the base strain for cell line modification because of its widespread use and lack of commercial license. Its genotype is F.sup.− lambda.sup.− rph.sup.−1, meaning that it lacks an F pilus, the phage lambda, and has al 5 codon frame-shift as result of the rph 1 bp deletion (Yale University. E. coli Genetic Stock Center Database. 2013). This frame-shift interrupts the pyrE gene and reduces pyrimidine levels (Jensen et al. (1993) Journal of Bacteriology 175(11):3401-7).

    [0251] Plasmid pKD46 was used as part of the k-red recombination system. This plasmid is ampicillin resistant and replication is temperature sensitive. For plasmid maintenance, growth is at 30° C. and the plasmid can be removed by growth at 37° C. without antibiotic pressure. The plasmid encodes for lambda Red genes exo, bet, and gam, and includes an arabinose-inducible promoter for expression (Datsenko et al. (2000) PNAS 97(12):6640-5). The plasmid was provided in conjunction with MG1655 from the Yale E. Coli Genetic Stock Center (New Haven, Conn.).

    Expression Strains and Vectors

    [0252] E. coli strain BL21 (DE3) was used for initial cell culture and cell lysate preparation. Its genotype is F-ompT hsdSB(rB-, mB-) gal dcm (DE3). The strain and genotype was provided by Novagen (EMD-Millipore/Merck). The cell line was transformed with a recombinant pGEX plasmid provided by Dr. Joshua Sakon (Department of Chemistry, University of Arkansas). This plasmid, pCHC305, contains the genetic information for the recombinant fusion protein, glutathione-S-transferase—parathyroid hormone—collagen binding domain (GST-PTH-CBD, 383 amino acids).

    Storage Strains and Vectors

    [0253] For storage of DNA constructs, E. coli strain DH5α was selected. Its genotype is F-, Δ(argF-lac)169 φ80dlacZ58(M15) ΔphoA glnV44(AS)8λ-deoR481 rfbC gyrA96(NalR)1 recA1 endA1 thiE1 hsdR17. DH5 is a non-mutagenized derivative of DH1, which transforms more efficiently due to a deoR mutation. The recA mutation eliminates homologous recombination and minimizes undesired modification to stored plasmids. pUC19 was used as a DNA storage vector. It is a high copy number plasmid that carriers ampicillin resistance. This plasmid was provided in conjunction with DH5α from the Yale E. Coli Genetic Stock Center (New Haven, Conn.).

    Liquid Growth Media

    [0254] M9 medium was used where a minimal defined medium was required. M9 Medium was made in 3 separate stock solutions: glucose solution (500 g/L), trace elements (2.8 g of FeSo4-7H2O, 2 g of MnCl2-4H2O, 2.8 g off CoCl2-7H2O, 1.5 g of CaCl2-2H2O, 0.2 g CuCl2-2H2O, 0.3 g of ZnSO4-7H2O), and 5×M9 (75 g of K2HPO4, 37.5 g of KH2PO4, 10 g of citric acid, 12.5 g of (NH4)2SO4, 10 g of MgSO4-7H2O). Each of these components must be autoclaved individually to minimize salt precipitation. To prepare 1 L of M9, 14.5 ml of the glucose solution is mixed with 1 ml trace element solution, 200 ml of 5× M9, and enough water to bring the final volume up to 1 L (approximately 784.5 ml).

    [0255] Where rich medium was required, Luria-Burtani (LB) Medium was used. LB powder was purchased from Difco and was prepared per the manufacturer's instructions: 20 g LB powder per 1 L of MILLI-Q® water (ultrapure water in agreement with the quantitative specifications of Type I water as described in ISO 3696, ASTM D1193, and of EP and USP Purified Water, as well as the CLSI®-CLRW).

    Solid Growth Media

    [0256] Solid M9 medium was prepared as previously described for liquid M9 with the addition of agar to the water and concentrated M9 solution prior to autoclaving. To prepare 500 ml of M9 agar, 7.5 g agar, 100 ml of 5×M9 solution, and 300 ml of water are mixed and autoclaved. Added to this is 7.25 ml sterile glucose solution (700 g/L), 500 μl trace elements, and enough sterile water to bring the final volume up to 500 ml. The other solid medium used was LB agar, which was prepared the same as the LB liquid medium described earlier plus the addition of 7.5 g agar per liter.

    Fed-Batch Cultivation

    [0257] Fed-batch cultivation was used to prepare the cell lysate for use in downstream protein purification and identification of natively expressed proteins. The cell line used was BL21 pCHC305. To begin fermentation, a single colony was isolated from a LB ampicillin agar plate and transferred to a 5 ml culture tube containing liquid LB plus 150 μg/ml ampicillin. This culture tube was allowed to incubate overnight at 37° C. After overnight growth, the 5 ml culture tube is supplemented with 100 ml of M9 with ampicillin and allowed to grow at 37° C. for six to eight hours. This 100 ml culture is then centrifuged at 4750 rpm for 25 minutes (Beckman Coulter Allegra) and re-suspended in 50 ml of fresh M9 medium with 150 μg/ml ampicillin. This culture is used as the inoculant for the fed-batch growth. The 3-liter Applikon bioreactor (Foster City, Calif.) contained 1 liter of M9 plus 150 m/mlampicillin and 1 ml silicone anti-foam.

    [0258] The Applikon was equipped with BioXpert Advisory software from Applikon, an Applisense pH probe, and a dissolved oxygen probe. To maintain proper dissolved oxygen, the reactor was supplemented with a compressed oxygen cylinder with a controllable flow rate. To insure effective gas dispersal, the culture was initially stirred at 750 rpm and was later increased to 1000 rpm based on cell density. Adjustments in oxygen delivery were made as necessary during the process to ensure that the dissolved oxygen concentration did not drop below 35%. The pH was maintained at approximately 6.8 (with a range of 6.75 to 7) during the cultivation by adding 7M NH.sub.4OH as needed. Temperature was maintained at 37° C. using a heating jacket and cooling loop. Optical densities were monitored using a BUGEYE™ optical density probe (BUGLAB®, Foster City, Calif.) and a DU800 Beckman Coulter spectrophotometer (Brea, Calif.). BUGEYE™ is a non-invasive optical biomass measuring device for measuring biomass through the side wall of a shake flask using a handheld sensor, described in U.S. Pat. No. 8,405,033. A linear correlation for the BUGEYE™ response to the actual optical density (OD) as measured by the spectrophotometer was determined for each individual experiment.

    [0259] The fed-batch fermentation process has two phases, a batch phase and a feeding phase. In the batch phase, the culture uses only the carbon sources provided in the media at the start of the cultivation and no nutrients are fed to the reactor. This phase lasts approximately 7-8 hours, depending on the lag phase of the culture and how rapidly the culture grew on the initial carbon substrate. The shift from batch phase to feeding phase can be determined by two indicators, a rise in pH and a sharp decline in oxygen concentration, which indicate that the initial carbon substrate has been depleted. In the fed-batch experiments, these two events occur simultaneously and are displayed by the Applikon software. The feeding profile used for fermentation experiments is based on that of a collaborator (McKinzie Fruchtl) and was originally proposed by Korz et al. (1995) Journal of Biotechnology 39(1):59-65 and Lee et al. (1996) Trends in Biotechnology 14(3):98-105. A feeding profile was programmed into the Applikon software that mimics the exponential feed based on substrate concentrations.

    [0260] An exponential fed-batch fermentation method commonly used to pre-determine the amount of glucose that should be fed into the reactor to achieve a certain growth rate was proposed by Korz et al. and Lee et al., supra:

    [00005] M s ( t ) = F ( t ) .Math. S F ( t ) = ( μ Y X / S + m ) .Math. X ( t ) .Math. V ( t ) = ( μ Y X / S + m ) .Math. X ( t F ) .Math. V ( t F ) .Math. exp μ ( t - t F )

    where M.sub.S is the mass flow rate (g/h) of the substrate, F is the feeding rate (1/h), S.sub.F is the concentration of the substrate in the feed (g/l), μ is the specific growth rate (1/h), Y.sub.X/S represents the biomass on substrate yield coefficient (g/g), m is the maintenance coefficient (g/g h), and X and V represent the biomass concentration (g/1) and cultivation volume (1), respectively. The yield coefficient for E. coli on glucose is generally taken to be 0.5 g/g (Korz et al., supra; Shiloach et al. (2005) Biotechnology Advances 23(5):345-57). The maintenance coefficient is often 0.025 g/g h (Korz D J et al., supra. This equation has been widely adapted for fed-batch fermentation processes, as exponential feeding allows cells to grow at a constant rate (Kim et al. (2004) 26(3):147-50).

    [0261] During fed-batch fermentation, the cells were left un-induced to prevent the addition of the recombinant protein to the native protein pool. The fermentation was allowed to grow for a total of 24 hours from inoculation to harvest. At the end of the fermentation process, cells were harvested from the reactor by pumping the reactor contents into centrifuge bottles. The reactor contents were then centrifuged at 12,000×g for 30 minutes at 5° C. (Beckman Coulter Avanti, JLA-10.500 fixed angle rotor) to separate the cell pellet from the media. The pellet was separated into four 50 ml conical bottom tubes for storage at −20° C.

    Lysate Preparation

    [0262] One of the 50 ml pellets (58.9 g) was re-suspended in 150 ml of 25 mM Tris buffer, pH 7. To enable cell lysis, 2 mg/ml lysozyme were added to the mixture. In addition, 1 mM phenylmethylsulphonyl fluoride (PMSF), 20 μg/ml aprotinin, and 1 mM ethylenediamine-tetraacetic acid (EDTA) was added to minimize protein degradation. The mixture was then incubated on ice with stirring for 30 minutes to lyse the cells. The mixture was then centrifuged at 50,000×g (Beckman Coulter Avanti, JA-25.50 fixed-angle rotor) for 30 minutes at 5° C. to separate the proteins from the cell debris.

    [0263] The proteins in the supernatant were carefully pipetted out of the centrifuge tubes, to minimize contaminants from the insoluble fraction, and were clarified by syringe filtration through 0.45 μm cellulose acetate. Lastly, the total protein concentration of the cell lysate was determined by using a Bio-Rad DC Protein Assay which is a detergent compatible colorimetric assay that is read by spectrophotometer at 750 nm (Beckman Coulter DU 800 HP). Bovine serum albumin standards were used to determine the baseline correlation between protein concentration and absorbance at 750 nm.

    Fast Protein Liquid Chromatography

    [0264] Fast protein liquid chromatography (FPLC) was used to separate the natively expressed proteins into groups based on the salt concentration at which they elute, which correlates to their surface charge. The chromatography was performed using an Amersham ÄkTA FPLC. The system consists of dual syringe pumps (P-920), gradient mixer, a monitor (UPC-900) for UV (280 nm), pH and conductivity, a fraction collector (Frac-900) and UNICORN® V3.21 data collection and archive software.

    Resin

    [0265] For the initial database development, diethylaminoethyl cellulose (DEAE) was selected as the ion exchange (IEX) resin due to its prevalence of use in industrial manufacturing. Specifically, the column used was a 1 ml HiTrap DEAE FF from GE Healthcare. DEAE is a weak anion exchanger, meaning that it is a positively charged matrix with a narrow working pH of 2-9 (GE Healthcare. Instructions 71-5017-51 AG HiTrap ion exchange columns. 1-24.).

    Buffer Composition

    [0266] 25 mM Tris buffer, pH 7, was selected for all of the FPLC purification steps. The loading buffer contained 10 mM NaCl to minimize non-specific binding (Buffer A). The elution buffer contained 1M NaCl, which is sufficient to desorb bound proteins (Buffer B).

    Column Loading Conditions

    [0267] Prior to loading the column, the system was washed with buffer A until equilibrium was achieved (roughly 10 ml). At this point, all system monitors were base-lined. The column was loaded at 10% breakthrough as per industry standard. The amount of total lysate to be applied to the column to achieve this breakthrough was determined as follows. According to GE Healthcare, the dynamic binding capacity (DBC) of HiTrap DEAE FF is 110 mg HSA (human serum albumin)/ml solvent (resin). This number gives the amount of protein that can be bound per milliliter of resin. The next step was to determine what percentage of the native proteins bound to the DEAE resin at pH 7. To do this, 5 ml of lysate was loaded on the column and washed with 10 ml of buffer A. The flow-through was collected in a single fraction. The column was then washed with the buffer B and the resulting flow-through was collected. Both fractions were then analyzed for their total protein concentration using the previously mentioned Bio-Rad assay. The amount of lysate (ml) to load onto the column was determined by the following equation:

    [00006] lysate .Math. .Math. ( ml ) = DBC * ( 1 + % BT ) * V C % bound * C l

    where DBC is the dynamic binding capacity of the resin (mg/ml), %.sub.BT is the desired percent breakthrough, V.sub.c is the volume of the column (ml), %.sub.bound is the percent of the total lysate that binds to the resin, and C.sub.1 is the protein concentration of the lysate (mg/ml).

    [0268] The column was loaded at 1 ml/min and then washed with 10 column volumes (CV) of buffer A to remove any unbound proteins. The unbound fraction was collected for later analysis.

    Column Elution Conditions

    [0269] To identify where the bulk of the bound proteins eluted, the proteins were desorbed through roughly 100 mM salt steps from 10 mM to 1M. This process allows for the identification of the priority salt fractions that need to be spaced out into smaller steps for later analysis.

    TABLE-US-00011 TABLE 8 10% Elution Steps Step NaCl Length Step # % B (mM) (CV) wash  0%  10 10  1  10%  109  5  2  20%  208  5  3  30%  307  5  4  40%  406  5  5  50%  505  5  6  60%  604  5  7  70%  703  5  8  80%  802  5  9  90%  901  5 10 100% 1000  5 clean 100% 1000  5

    [0270] The flow rate was maintained at 1 ml/min and the pressure limit was set to 0.5 MPa for the duration of the experiment. During elution, all fractions were collected and immediately stored at 2° C. to reduce protein degradation. After all of the proteins have been desorbed in the 1000 mM step, the fraction collector is stopped and the column is cleaned with buffer B to ensure all proteins have been desorbed and washed out of the column. The column is then washed with sufficient buffer A to re-equilibrate the column.

    [0271] For finer focusing on the primary elution windows, smaller 5% steps are used (Table 9). In this instance, the focus was on the 10 mM to 500 mM window.

    TABLE-US-00012 TABLE 9 5% Elution Steps Step NaCl Length Step # % B (mM) (CV) wash  0% 10 20  1  5% 59.5 15  2  10% 109 15  3  15% 158.5 15  4  20% 208 15  5  25% 257.5 15  6  30% 307 15  7  35% 356.5 15  8  40% 406 15  9  45% 455.5 15 10  50% 505 15 wash 100% 1000 20

    Analytical Assays

    Sample Processing

    [0272] Prior to the samples undergoing further analysis, they were concentrated using a GE Lifesciences VIVASPIN™ 20 (5,000 MWCO). VIVASPIN™ is a centrifugal membrane ultrafiltration sample concentrator employing a semipermeable membrane with a molecular weight cutoff selected by the user for non-denaturing concentration of biological samples by membrane ultrafiltration. Centrifugation is applied to force solvent through the membrane, leaving a more concentrated sample in the upper chamber of the device. This reduced the 20 ml fractions to 2 ml total volume. This was split into two 1 ml samples, one was sent for LC-MS/MS, and the other was kept for SDS-PAGE.

    Protein Gels—SDS-PAGE

    [0273] Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was used to observe the approximate number of proteins in each FPLC salt fraction and their molecular weight. Prior to SDS-PAGE, the samples were desalted by buffer exchange. To do this, the previously mentioned 1 ml sample of the desired fraction was concentrated in a GE Lifesciences VIVASPIN™ 2 (5,000 MWCO) and re-suspended in 25 mM Tris buffer, pH 7. The concentration and re-suspension process was repeated two more times to ensure all salt had been removed. After the last concentration step, the sample was left in its concentrated form to be loaded onto the SDS-PAGE.

    [0274] A Bio-Rad PROTEAN® II system (large format vertical electrophoresis cell used for common electrophoretic techniques such as SDS-PAGE, native electrophoresis, and agarose gel electrophoresis) was used for the electrophoresis with SDS buffer. The SDS buffer is made as a 10× stock, where the 1× running buffer is 25 mM Tris, 192 mM glycine, and 0.1% SDS at a pH of 8.6. For visualization of the chromatography samples, a 12.5% gel was used. The samples are mixed 5:1 with a 5× loading dye.

    [0275] Electrophoresis was carried out at 100V until the sample was through the stacking gel, then increased to 140V. Average run time was around 1 hour. Gels were stained using a Coomassie Blue stain (40% methanol, 10% acetic acid and 0.5% Coomassie blue) for 3 hours and then de-stained with a 10% acetic acid and 40% methanol solution. Gel images were captured by scanning on a computer flatbed scanner.

    Liquid Chromatography Mass Spectroscopy (LC-MS/MS)

    [0276] Samples of each FPLC salt fraction were sent to Bioproximity (Chantilly, Va.) for protein identification via liquid chromatography mass spectroscopy (LC-MS/MS). The protocol for the LC-MS/MS was provided by Bioproximity as follows.

    Protein Denaturation and Digestion

    [0277] Prior to digestion, proteins were prepared using the filter-assisted sample preparation (FASP) method (Wiśniewski et al. (2009) 6(5):359-62). Next, the sample was mixed with 8 M urea, 10 mM dithiothreitol (DTT), 50 mM Tris-HCl at pH 7.6 and sonicated briefly. Samples were then concentrated in a Millipore AMICON® Ultra (30,000 MWCO) device (a cellulose membrane centrifugal filter unit for concentrating biological samples) and centrifuged at 13,000×g for 30 mM. The remaining sample was buffer exchanged with 6 M urea, 100 mM Tris-HCl at pH 7.6, then alkylated with 55 mM iodoacetamide. Concentrations were measured using a QUBIT® fluorometer (Invitrogen) for quantitating DNA, RNA, and proteins using fluorescent dyes that emit signals only when bound to specific target molecules. The urea concentration was reduced to 2 M, trypsin was added at a 1:40 enzyme to substrate ratio, and the sample incubated overnight on a THERMOMIXER® temperature-controlled device used for mixing liquids in closed micro- and larger test tubes, and micro test plates (Eppendorf) at 37 C. The AMICON® was then centrifuged and the filtrate collected.

    Peptide Desalting

    [0278] Digested peptides were desalted using C18 stop-and-go extraction (STAGE) tips (Rappsilber et al. (2003) Analytical Chemistry. American Chemical Society 75(3):663-70). For each sample, the C18 STAGE tip was briefly activated with methanol, and then conditioned with 60% acetonitrile and 0.5% acetic acid, followed by 2% acetonitrile and 0.5% acetic acid. Samples were loaded onto the tips and desalted with 0.5% acetic acid. Peptides were eluted with a 60% acetonitrile, 0.5% acetic acid solution and dried in a vacuum centrifuge (Thermo Savant).

    Liquid Chromatography-Tandem Mass Spectrometry

    [0279] Peptides were analyzed by LC-MS/MS. LC was performed on an Easy-nanoLC II HPLC system (Thermo). Mobile phase A was 94.5% MILLI-Q® water, 5% acetonitrile, 0.5% acetic acid. Mobile phase B was 80% acetonitrile, 19.5% MILLI-Q® water, 0.5% acetic acid. The 120 min LC gradient ran from 2% B to 50% B over 90 min, with the remaining time used for sample loading and column regeneration. Samples were loaded to a 2 cm×100 um I.D. trap column positioned on an actuated valve (Rheodyne). The column was 13 cm×100 μm I.D. fused silica with a pulled tip emitter. Both trap and analytical columns were packed with 3.5 μm C 18 resin (Magic C 18-AQ, Michrom). The LC was interfaced to a dual pressure linear ion trap mass spectrometer (LTQ Velos, Thermo Fisher) via nano-electrospray ionization. An electrospray voltage of 2.4 kV was applied to a pre-column tee. The mass spectrometer was programmed to acquire, by data-dependent acquisition, tandem mass spectra from the top 15 ions in the full scan from 400-1400 m/z. Dynamic exclusion was set to 30 seconds.

    Data Processing and Library Searching

    [0280] Mass spectrometer RAW data files were converted to MGF (Mascot generic format) using msconvert (Kessner et al. (2008) Bioinformatics 24(21):2534-6). Detailed search parameters are printed in the search output XML (extensible markup language) files. All searches required strict cryptic cleavage, up to three missed cleavages, fixed modification of cysteine alkylation, variable modification of methionine oxidation and expectation value scores of 0.01 or lower. Searches used the sequence libraries: UniProt Escherichia coli (strain B/BL21-DE3, The UniProt Consortium (2012) Nucleic Acids Research 40 (Database issue):D71-5), the common Repository of Adventitious Proteins (cRAP) (The Global Proteome Machine. Common Repository of Adventitious Proteins, 2012 Jan. 1) and the given sequence for plasmid product GST-PTH-CBD. MGF files were searched using X!!Tandem (Craig et al. (2004) Bioinformatics 20(9):1466-7) using both the native and k-score (MacLean et al. (2006) Bioinformatics 22(22):2830-2) scoring algorithms and by the Open Mass Spectrometry Search Algorithm (OMSSA) (Geer et al. Journal of Proteome Research 3(5):958-64). All searches were performed on Amazon Web Services-based cluster compute instances using the Proteome Cluster interface. XML output files were parsed and non-redundant protein sets determined using MassSieve. Proteins were required to have two or more unique peptides across the analyzed samples with E-value scores of 0.01 or less, 0.001 for X!Hunter and protein E-value scores of 0.0001 or less.

    Protein Quantitation

    [0281] Proteins were quantified the spectral counting method (Liu et al. (2004) Analytical Chemistry 76(14):4193-201). This results in a hit count, which is approximate of protein concentration in the sample.

    Database Construction

    Compilation of Data

    [0282] The received LC-MS/MS data was imported into Microsoft Access 2010 for data management. The ECOGENE®'s EcoTools Database Table Download (Rudd K E. Database Table Download ECOGENE® 3.0. Department of Biochemistry and Molecular Biology R-629, University of Miami Miller School of Medicine; 2012) was used to supplement the received LC-MS/MS data with additional genomic and proteomic data. The data added were: the protein length (in amino acids), direction of replication (clockwise or counterclockwise), left end position of the gene (in base pairs), right end position of the gene (in base pairs), molecular weight of the protein, common gene name, synonym gene name, protein name, protein function, description, GenBank GI ID (Benson et al. (2013) GenBank. Nucleic acids Research 41(Database issue):D36-42) and UniProtKB/Swiss-Prot ID (The Uniprot Consortium (2012) Nucleic acids Research 40(Database issue):D71-5). The ECOGENE® Cross Reference Mapping and Download tool was used to Bnum (Blattner number) (Blattner et al. (1997) Science 277(5331):1453-62). Microsoft Access was used to build relationships between the various datasets that allowed for searches across the compiled database.

    [0283] Gene essentiality data were retrieved from Gerdes et al. (2003) J. Bacteriol. 185(19):5673-84) which compiles gene essentiality from their own research as well as the Profiling of E. coli Chromosome (PEC) database (Hashimoto et al. (2005) Molecular Microbiology 55(1):137-49; Kato and Hashimoto (2007) Molecular Systems Biology 3(132):132; and Kang Y et al. (2004) J Bacteriol. 186(15):4921-30).

    Data Manipulation

    [0284] In order to determine the priority of genes to be deleted, each gene was given a score for each elution window. This score or importance criterion was defined by:

    [00007] importance i = .Math. j .Math. [ b 1 ( y c j y max ) .Math. ( h i .Math. , j h i , total ) .Math. ( h i .Math. , j h j , total ) .Math. ( MW i MW ref ) α ] i

    with the following definitions: y.sub.cj and y.sub.max=concentration of mobile phase eluent in fraction (j) and maximum value, respectively; and h.sub.i,j and h.sub.i,total=the amount of protein (i) in fraction (j) and total bound protein (i), respectively; and h.sub.j,total=total amount of protein in fraction (j).

    [0285] In the function given, the score can range from 1 (high) to 0 (low). The summation ranges over the desired elution windows (j) and can be adjusted to cover all of the windows, or target a select few. The first ratio accounts for adsorption strength with y.sub.cj being the concentration of the elution solvent (in the case of ion exchange, this is NaCl) and y.sub.max being the maximum solvent concentration. The second ratio accounts for adsorption specificity with h.sub.i,j being the protein concentration in the window, over the total protein concentration in all windows (h.sub.i,total). For proteins that elute in only one window, this value will be 1, where proteins that elute in multiple windows will have a lower ratio. The third ratio describes the relative amount a protein has in a given fraction, and the forth ratio accounts for the possibility of steric hindrance.

    [0286] The second and third equations define how much capacity is recovered when the protein is removed, and the overall capacity recovery as one modifies, deletes, or inhibits n genes, respectively

    [00008] recovery .Math. .Math. potential i = h i , total h total , ms and capacity .Math. .Math. recovery = 100 .Math. % .Math. .Math. x .Math. .Math. i = 1 n .Math. recovery .Math. .Math. potential i

    Homologous Recombination

    [0287] Removal of Genomic thyA

    [0288] Flexible Recombineering Using Integration of thyA (FRUIT) as described by Stringer et al. ((2012) PloS one. 7(9):e44841), a modification of the Datsenko λ-Red homologous recombination system (Datsenko et al. (2000) PNAS 97(12):6640-5), was used to delete the targeted genes from the genome of E. coli strain MG1655. The method begins by creating an MG1655 ΔthyA strain by swapping the gene for an oligonucleotide designed to have 60 bp of homology at the beginning and the end of the thyA gene. FIG. 5 shows the process by which this deletion is performed.

    [0289] This oligonucleotide was ordered as two linear single stranded DNA fragments from Integrated DNA Technologies (Coralville, Iowa). The fragments were hydrated in Qiagen EB buffer (Tris, pH 8, 1.4M NaCl) and mixed in a 1:1 ratio. The mixture was then placed in a MJ Research PTC-200 DNA Engine thermocycler that was programed to heat to 98° C. and then drop the temperature by 2° C. every 30 seconds until it reached 25° C.

    To Delete thyA

    [0290] MG1655:pKD46 was cultured overnight at 30° C. in LB plus ampicillin (100 μg/ml). The following morning, the overnight was sub-cultured 1:100 into 5 ml of fresh LB-ampicillin with 0.2% L-arabinose and allowed to grow for approximately three hours, until the culture reached an OD.sub.600 (HP DU800) of 0.6 to 0.8. All proper controls were also taken to validate the recombination event. To prepare the cells for electroporation, the 5 ml induced culture was split into four 1 ml aliquots and moved to 1.5 ml microfuge tubes. The final 1 ml was refrigerated for later analysis or for further sub-culturing. The microfuge tubes were centrifuged for 60 seconds at 14,000 rpm in a cooled (placed in refrigerator, 2° C.) compact bench-top microfuge centrifuge (Eppendorf, MINISPIN®). The supernatant was discarded by gently pouring off the liquid and then the pellet was placed on ice. The pellet was then re-suspended in 1 ml of chilled distilled/deionized water (ddH.sub.2O) and then centrifuged again. This process was repeated once more. After the supernatant is poured off the final time, there is roughly 100 μl of liquid left in the tube. Next, the cells are re-suspended in the remaining fluid and kept on ice. To this, the prepared linear fragment is added, in this case the thyA deletion template, various concentrations, usually ranging from 200-1000 nmol. This mixture was then pipetted into chilled sterile electroporation cuvettes (Bio-Rad, 0.1 cm gap). The sample was the electroporated using a Bio-Rad MICROPULSER™ set to Ec1 (E. coli, 0.1 cm cuvette, 1.8 kV, one pulse). The Bio-Rad MICROPULSER™ is an apparatus used for the electroporation of bacteria, yeast, and other microorganisms where a high voltage electrical pulse is applied to a sample suspended in a small volume of high resistance media, consisting of a pulse generator module, a shocking chamber, and a cuvette with incorporated electrodes. Next, 1 ml of LB containing ampicillin (50 μg/ml), thymine (100 μg/ml) and trimethoprim (20 μg/ml) (LB-amp-thy-tri) was gently added directly to the cuvette before incubating the sample at 30° C. with shaking for 3 hours. Since the strain now lacks thyA, it is necessary to supplement the media with thymine. Trimethoprim acts as a secondary selector because if the strain still contains an active thyA gene, the trimethoprim is toxic. After that time, the cultures were streaked out onto LB-ampicillin-thymine-trimethoprim agar plates and allowed to incubate at 30° C. overnight. In addition, 250 μl of each culture were sub-cultures into 5 ml of onto LB-ampicillin-thymine-trimethoprim and incubated overnight at 30° C. with shaking.

    Gene Deletion

    [0291] The gene deletion protocol is a two-step process. The first step uses thyA as a selection marker that disrupts the targeted gene. The second step removes thyA from the genome again, following a similar protocol as described previously. For the first step, strain LTS00 is grown overnight in LB-amp-thy-tri and is sub-cultured 1:100 the following morning into 5 ml LB-amp-thy-tri plus 0.2% L-arabinose. These cells are allowed to grow for approximately 6 hours (growth is significantly diminished when lacking thyA) until the OD.sub.600 reaches 0.6 to 0.8. The cells are then prepared for electroporation as described previously. Prior to electroporation 2 μl of the PCR product containing the thyA gene with homology to the gene to be deleted is added to the sample. Electroporation follows the same protocol as earlier. After electroporation, 1 ml of LB with ampicillin (50 μg/ml) is added, and the cells are allowed to incubate for 3 hours at 30° C. with shaking. After that time, the cultures were streaked out onto LB-ampicillin (150 μg/ml) agar plates and allowed to incubate at 30° C. overnight. In addition, 250 μl of each culture were sub-cultures into 5 ml of onto LB-ampicillin (150 μg/ml) and incubated overnight at 30° C. with shaking.

    [0292] FIG. 6 shows the process by which the selection marker is used to cause a gene deletion. Step 1 creates the intermediary thyA+ strain, where the target gene has been deleted but the selection marker remains. At this point, the cell is able to survive on thymine-depleted media. Step 2 removes the thyA marker so that it can be used again for future gene deletions. The protocol is the same as that for the removal of thyA but the 120 bp oligo has homology to the new gene target and removes thyA and its promoter.

    [0293] Successful deletion of the gene was confirmed via PCR amplification of the deleted region and agarose gel electrophoresis. The amplified regions were also sent for genomic sequencing to further confirm that the homologous recombination event successfully occurred.

    TABLE-US-00013 TABLE 10 Deletion Fragments. Deletion Fragments Gene Name Target Sequence thyAdt thyA GCAAAATTTCGGGAAGGCGTCTCGAAGAATTTAACGG AGGGTAAAAAAACCGACGCACACGTGTTGCTGTGGGC TGCGACGATATGCCCAGACCATCATGATCACACCCGC GACAATCAT (SEQ ID NO: 4) metHdt metH TTTGTTGAATTTTTATTAAATCTGGGTTGAGCGTGTCG GGAGCAAGTGCTGGGGTATGACGCGGACTGATTCACA AATCTGTCACTTTTCCTTACAAC (SEQ ID NO: 5) entFdt entF GGCGTACTCTGACACCGACGAATTTTACCCAGTTGCA GGAGGCACACGCGCAACGCTAAACAGGTAAATTAATA TTATTTATAAACCCATAATTAC (SEQ ID NO: 6) tgtdt tgt CGCTGGTTTAAAACGTTGGACTGTTTTTCTGACGTAGT GGAGAAAAACCACCTTTGAACGTTGATTAATATTAAT AATGAGGGAAATTTAATGAGCT (SEQ ID NO: 7) rnrdt rnr GTGGAGTGACGAAAATCTTCATCAGAGATGACAACGG AGGAACCGAGAAGAAAAAAGTGGCAGAGTGATCAAT ACCCTCTTTAAAAGAAGAGGGTTA  (SEQ ID NO: 8) ycaOdt ycaO TAAAACCCGTATTATTGCGCGCTTTCCGTACGACTAAA GTGATTTTCGCAGCATTCTGGGCAAAATAAAATCAAA TAGCCTACGCAATGTAGGCTTA (SEQ ID NO: 9)

    [0294] These results demonstrate how the separatome can be defined for a chromatographic technique, ion exchange in particular, and can be used to design and construct novel host cells that have certain genes deleted, modified, or inhibited. For example, Table 11 describes ten separate E. coli MG1655 derivatives that have one or more gene deletions associated with high affinity host cell proteins. These strains in their current form can be used to express a target recombinant protein and will have enhanced separation efficiency, column capacity in particular, as these proteins are contained in several fractions of high salt concentration.

    TABLE-US-00014 TABLE 11 E. coli Deletion Strains Name Genotype MG1655 Wild Type: F−, λ.sup.−, rph-1 LTS00 ΔthyA LTS01+ ΔmetH LTS01 ΔthyAΔmetH LTS02+ ΔmetHΔentF LTS02 ΔthyAΔmetHΔentF LTS03+ ΔmetHΔentFΔtgt LTS03 ΔthyAΔmetHΔentFΔtgt LTS04+ ΔmetHΔentFΔtgΔrnr LTS04 ΔthyAΔmetHΔentFΔtgtΔrnr LTS05+ ΔmetHΔentFΔtgtΔrnrΔycaO

    [0295] Table 12 lists high priority genes for DEAF ion exchange media. Future strains of the LTS series of Table 11 will have additional genes identified in Table 12 deleted, modified, or inhibited as the recovery capacity is pushed towards higher values.

    TABLE-US-00015 TABLE 12 High priority genes of the DEAE separatome, loading pH 7 GeneName rpoC rpoB hldD metH entF mukB tgt rnr glgP recC ycaO glnA ptsI metE sucA hrpA groL gatZ speA thiI nusA tufA degP clpB rapA metL ycfD nagD ilvA fusA cyaA gldA dnaK ygiC gyrA glnE carB ppsA degQ usg ilvB thrS recB entB dusA typA prs cysN atpD purL

    [0296] The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the invention, and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims.