Products and Methods Relating to Micro RNAS and Cancer

20170218454 · 2017-08-03

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention encompasses products and methods relating to microRNAs involved in various cancers.

    Claims

    1. A method of calculating a risk score for developing cancer comprising (a) obtaining inputs about an individual comprising the level of biomarkers in at least one biological sample from said individual and (b) calculating a cancer risk score from said inputs, wherein said biomarkers comprise one or more miRNA biomarkers selected from FIGS. 12, 13 and 14.

    2. A method of evaluating risk for developing cancer comprising (a) obtaining biomarker measurement data, wherein the biomarker measurement data is representative of measurements of biomarkers in a least one biological sample from an individual and (b) evaluating risk for developing cancer based on an output from a model, wherein the model is executed based on an input of the biomarker measurement data, wherein the biomarkers comprise one or more biomarkers selected form FIGS. 12, 13 and 14.

    3. A method of evaluating risk for developing cancer comprising (a) obtaining biomarker measurements from at least one biological sample from an individual who is a subject that has not been previously diagnosed as having cancer, (b) comparing the biomarker measurement to normal control levels and (c) evaluating the risk for the individual developing a cancer from the comparison; wherein the biomarkers comprise one or more biomarkers selected from FIGS. 12, 13 and 14.

    4. A method of evaluating risk for developing cancer comprising (a) obtaining biomarker measurement data, wherein the biomarker measurement data is representative of measurements of biomarkers in at least one biological sample from an individual and (b) evaluating risk for developing cancer based on an output from a model, wherein the model is executed based on an input of the biomarker measurement data; wherein said biomarkers the biomarkers comprise one or more biomarkers selected from FIGS. 12, 13 and 14.

    5. A method of calculating a risk score for cancer progression comprising (a) obtaining inputs about an individual suffering from cancer comprising the level of biomarkers in a least one biological sample from said individual; and (b) calculating a cancer risk score form said inputs, wherein said biomarkers comprise one or more biomarkers selected from FIGS. 12,13 and 14.

    6. The method of claim 1, 2, 3, 4, or 5 further comprising advising the individual of the individual's risk of developing cancer or risk of cancer progression.

    7. A method of ranking or grouping a population of individuals according to cancer risk comprising (a) obtaining a cancer risk score for individuals comprised within said population, wherein said cancer risk score is calculated according to claim 1 and (b) ranking individuals within the population relative to the remaining individuals in the population or dividing the population into at least two groups, based on factors comprising said obtained cancer risk scores.

    8. A diagnostic test system comprising (a) means for obtaining test results comprising levels of biomarkers in at least one biological sample; (b) means for collecting and tracking test results for one or more individual biological samples; (c) means for calculating an cancer risk score from inputs, wherein said inputs comprise measured levels of biomarkers, and further wherein said measured levels of biomarkers comprise the levels of one or more biomarkers selected from FIGS. 12, 13 and 14; and (d) means for reporting said cancer risk score.

    9. A diagnostic test system comprising (a) means for obtaining test results data representing levels of multiple biomarkers in at least one biological sample, (b) means for collecting and tracking test results data for one or more individual biological samples (c) means for computing a cancer risk score from biomarker measurement data, wherein said biomarker measurement data is representative of measured levels of biomarkers, and further wherein said measured levels of biomarkers comprise the levels of a panel of one or more biomarkers selected from FIGS. 12, 13 and 14, and (d) means for reporting said index value.

    10. A medical diagnostic test system for evaluating risk for developing a cancer or risk for cancer progression comprising (a) a data collection tool adapted to collect biomarker measurement data representative of measurements of one or more biomarkers in at least one biological sample from an individual, (b) an analysis tool comprising a statistical analysis engine adapted to generate a representation of a correlation between a risk for developing a cancer and measurements of the biomarkers, wherein the representation of the correlation is adapted to be executed to generate a result and (c) an index computation tool adapted to analyze the result to determine the individual's risk for developing a cancer or for cancer progression, and represent the result as a cancer risk score; wherein said one or more biomarkers are selected from FIGS. 12, 13 and 14.

    11. A computer readable medium having computer executable instructions for evaluating risk for developing a cancer, the computer readable medium comprising (a) a routine, stored on the computer readable medium and adapted to be executed by a processor, to store biomarker measurement data representing a panel of one or more biomarkers and (b) a routine stored on the computer readable medium and adapted to be executed by a processor to analyze the biomarker measurement data to evaluate a risk for developing a cancer or for risk of cancer progression; wherein said biomarkers are one or more biomarkers selected from FIGS. 12, 13 and 14.

    12. A kit comprising reagents for measuring a panel of one or more miRNA biomarkers selected from FIGS. 12, 13 and 14, wherein the reagents are primers for reverse transcription of miRNA into DNA, primers for amplification of the DNA, or both primers for reverse transcription of miRNA in the panel and primers for amplification of the reverse transcribed DNA.

    13. A kit comprising reagents for detecting a panel of one or more miRNA biomarkers selected from FIGS. 12, 13 and 14, wherein the reagents hybridize to miRNA in the panel.

    14. A system for diagnosing susceptibility to cancer in a human subject, the system comprising: (a)at least one processor; (b)at least one computer-readable medium; (c) a susceptibility database operatively coupled to a computer-readable medium of the system and containing information associating measurements of one or more biomarkers selected from FIGS. 12, 13 and 14 and cancer in a population of humans; (d) a measurement tool that receives an input about the human subject and generates information from the input about one or more biomarkers selected from FIGS. 12, 13 and 14 from the human subject; and (e) an analysis tool (routine) that: (i) is operatively coupled to the susceptibility database and the measurement tool, (ii) is stored on a computer-readable medium of the system, (iii) is adapted to be executed on a processor of the system, to compare the information about the human subject with the information about the population in the susceptibility database and generate a conclusion with respect to susceptibility to cancer in the human subject.

    15. A system for diagnosing cancer in a human subject, the system comprising: (a)at least one processor; (b)at least one computer-readable medium; (c) a susceptibility database operatively coupled to a computer-readable medium of the system and containing information associating measurements of biomarkers selected from FIGS. 12, 13 and 14 and cancer in a population of humans; (d)a measurement tool that receives an input about the human subject and generates information from the input about one or more biomarkers selected from FIGS. 12, 13 and 14 from the human subject; and (e)an analysis tool (routine) that: (i) is operatively coupled to the susceptibility database and the measurement tool, (ii) is stored on a computer-readable medium of the system, (iii) is adapted to be executed on a processor of the system, to compare the information about the human subject with the information about the population in the susceptibility database and generate a conclusion with respect to the presence of cancer in the human subject.

    16. The system according to claim 14 or 15, wherein the input about the human subject is a biological sample from the human subject, and wherein the measurement tool comprises a tool to measure one or more biomarkers selected from FIGS. 12, 13 and 14 in the biological sample, thereby generating biomarker measurements from a human subject.

    17. The system of claim 16 wherein the biomarkers are measured by polymerase chain reaction or hybridization to a microarray.

    18. The system of claim 14 or 15 further comprising a communication tool operatively coupled to the analysis tool, stored on a computer-readable medium of the system and adapted to be executed on a processor of the system to generate a communication for the human subject, or a medical practitioner for the subject, containing the conclusion with respect to cancer for the subject.

    19. The system according to claim 18, wherein the communication tool is operatively connected to the analysis tool or routine and comprises a routine stored on a computer-readable medium of the system and adapted to be executed on a processor of the system, to: generate a communication containing the conclusion; and transmit the communication to the subject or the medical practitioner, or enable the subject or medical practitioner to access the communication.

    20. The system of claim 14, 15, 18 or 19 further comprising: a medical protocol database operatively connected to a computer-readable medium of the system and containing information correlating the conclusion and medical protocols for human subjects at risk for or suffering from cancer; and a medical protocol tool (or routine), operatively connected to the medical protocol database and the analysis tool or routine, stored on a computer-readable medium of the system, and adapted to be executed on a processor of the system, to compare the conclusion from the analysis routine with respect to cancer for the subject and the medical protocol database, and generate a protocol report with respect to the probability that one or more medical protocols in the database will: reduce susceptibility to cancer; or delay onset of cancer; increase the likelihood of detecting cancer at an early stage to facilitate early treatment; or treat the cancer.

    21. The system according to claim 20, wherein the communication tool is operatively connected to the medical protocol tool or routine, and generates a communication that further includes the protocol report.

    22. A method for the prophylactic treatment of a individual at risk for a cancer comprising (a) obtaining a cancer risk score for an individual based on one or more biomarkers selected from FIGS. 12, 13 and 14 and (b) generating prescription treatment data representing a prescription for a treatment regimen to delay or prevent the onset of cancer in the individual identified by the cancer risk score as being at elevated risk for cancer.

    23. A method for the therapeutic treatment of a individual suffering from a cancer comprising (a) obtaining a cancer diagnosis based on one or more miRNA biomarkers selected from FIGS. 12, 13 and 14 and (b) generating prescription treatment data representing a prescription for a treatment regimen to treat the cancer in the individual identified by the cancer risk score as being at elevated risk for cancer.

    24. The method of claim 22 or 23 wherein the treatment regimen comprises the standard of care for the cancer.

    25. The method of claim 22, 23 or 24 wherein the treatment regimen comprises administering a drug that increases the amount of the one or more miRNAs selected from FIGS. 12, 13 and 14.

    26. The method of claim 22, 23 or 24 wherein the treatment regimen comprises administering a drug to inhibit the one or more miRNAs or decrease the amount of the one or more miRNAs selected from FIGS. 12, 13 and 14.

    27. The method of claim 22, 23, 24, 25 or 26 further comprising (c) treating the individual according to the treatment regimen.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0007] FIG. 1. Overview of Weeder-miRvestigator tandem developed to identify miRNAs driving co-expression of transcripts. Quantitative assays of the transcriptome are used to identify gene co-expression signatures comprised of genes with significantly similar gene expression profiles. The 3′ UTR sequences for the co-expressed genes are then extracted from the genome and used as input into the Weeder algorithm. The Weeder algorithm searches the 3′ UTR sequences for an over-represented motif which is turned into a miRvestigator hidden Markov model (HMM). All of the miRNA seed sequences from the miRNA repository miRBase are compared to the HMM model of the over-represented sequence motif using the Viterbi algorithm. The miRNA seed sequence with the most significant complementarity p-value is the most likely miRNA driving the co-expression signature and a hypothesis that can be tested experimentally.

    [0008] FIG. 2. The sensitivity and specificity of the miRvestigator algorithm and framework is estimated using simulated datasets. A. The ROC AUC was computed by simulating miR-1 motifs across a range of motif entropies. Shown are the ROC AUC for the consensus matched to 8 bp miRNA seed sequences from miRBase using regular expression and the miRvestigator IIMM derived scoring metrics Viterbi P-value. B. We then tested the sensitivity and specificity of coupling de novo motif detection algorithm Weeder to the miRvestigator (FIG. 1) by applying them to 30 simulated sequences with varying levels of inserted miR-1 seed sequence (0 to 100%). C. Histogram of Weeder identified miRNA binding sites for whole transcripts where transcripts are centered on the stop codon (0 bp). Instances of miRNA binding sites were either stratified based upon their complementarity to the motif identified by Weeder (8 bp, 7 bp or 6 bp) or the combination of all complementarities. As described by the gene structure below the histogram upstream of the stop codon are the 5′ UTR and coding regulatory regions, and downstream is the 3′ UTR. In the gene structure below the histogram the coding sequences is a wider grey box, the start codon is a green arrow, and the stop codon is a red stop sign. D. Significance of the enrichment of miRNA binding sites per 1 Kbp was computed as a meta statistic are shown for each gene region and each stratified site complementarity.

    [0009] FIG. 3. A. Determining the optimal method(s) (most sensitive and specific) to infer miRNA mediated regulation from co-expressed genes. The methods tested were: 1) Weeder coupled to miRvestigator (Weeder-miRvestigator) (black line), 2) enrichment of PITA predicted milMA target genes (blue line), 3) enrichment of TargetScan predicted target genes (green line), 4) enrichment of miRSVR predicted target genes (orange line), and 5) enrichment of miRanda predicted target genes (red line). B. Overlap of co-expression signatures between putative miRNA regulators predicted by the three methods (Weeder-miRvestigator, PITA and TargetScan) in FIRM. Pairwise overlap of co-expression signatures between methods is statistically significant (Weeder-miRvestigator vs. PITA=0.045; Weeder-miRvestigator vs. TargetScan=0.019; PITA vs. TargetScan=7.4×10.sup.−22). All three methods identified miRcustom-character29a/b/c as the regulator for the lung adenocarcinoma co-expression signature AD Lung Beer 31.

    [0010] FIG. 4. Metastatic and cross cancer-miRNA regulatory networks. Hierarchy of filters applied to cancer-miRNA regulatory network to produce both the metastatic and cross cancer miRNA regulatory networks is depicted above the networks, and a legend for the networks can be found in the upper right corner. Nodes are cancers (purple octagons), co-expression signatures (orange circles), inferred miRNAs (red diamonds), or hallmarks of cancer (green parallelogram). Orange edges describe the cancer where a co-expression signature was observed, blue edges link a putative miRNA regulator to a co-expression signature (putative miRNA regulation from cancer miRNA regulatory network), and red edges link putative miRNAs to the hallmarks of cancer based upon functional enrichment of the co-expression signatures they regulate (GO term semantic similarity). Thicker dashed edges indicate experimental validation for the inferred relationship. A. Metastatic cancer-miRNA regulatory network was filtered for the sake of space to show only cancers with at least one predicted regulatory interactions that has been validated. B. Cross cancer-miRNA regulatory network was generated by identifying miRNAs with more than one co-expression signature that are functionally enriched for the same GO terms that are sufficiently similar to GO terms characterizing the hallmarks of cancer.

    [0011] FIG. 5. Luciferase reporter assay validation of miRNA binding site predictions from FIRM. A. Deletion of miR-29 binding sites ablates response to miR-29a mimic. The wild type 3′ UTRs are MMP2 and SPARC. The miR-29 binding site deleted 3′ UTRs are MMP2 Δ and SPARC Δ. The deletions have a slight increase in normalized luminescence over their corresponding vector control which is similar to what is observed for the negative control HIST1H2AC which doesn't have a miR-29 binding site. B. Dose response curves for COL3A1 and SPARC titrating the amounts of miR-29a mimic (50 nM, 5 nM, 500 pM, 50 pM and 5 pM).

    [0012] FIG. 6. Summary of FIRM predictions for the miR-29a/b/c and miR-767-5p cancer-miRNA regulatory subnetwork. This subnetwork is included in both the metastatic- and cross-cancer miRNA regulatory networks. The network is laid out hierarchically with from the top down cancers, miRNAs, co-expression signatures, genes that were experimentally validated through luciferase assays, significantly enriched GO biological process terms for the co-expression signature, and finally the GO terms associated hallmarks of cancers. On the left side we show the FIRM integration strategy which is a flow of information through this hierarchy where the red arrows indicate a FIRM prediction. The meanings of the FIRM predictions are described on the right side where inference of a miRNA regulating a cancer co-expression signature predicts that the miRNA is dysregulated in that cancer. This same inference predicts that the miRNA regulates the genes in the signature which can be tested experimentally. Functional enrichment of GO term annotations among the co-regulated genes predicts the effect of regulating this set of genes and association of the enriched GO terms with hallmarks of cancer predicts the oncogenic processes that might be affected.

    [0013] FIG. 7 is a flowchart showing how cancer gene expression signatures are used to identify cancer miRNA regulatory networks according to various methods described herein.

    [0014] FIG. 8 is a flow diagram representing an exemplary FIRM method 800.

    [0015] FIG. 9 is a flow diagram representing an exemplary method 900 for performing de novo identification of one or more 3′ UTR motifs that are complementary to seed sequences of miRNA stored on a memory device (i.e., an exemplary method corresponding to the block 802).

    [0016] FIG. 10 is a flow diagram representing an exemplary method 1000 for identifying enriched predicted miRNA binding sites (i.e., an exemplary method corresponding to the block 804).

    [0017] FIG. 11 is a flowchart showing how the identification of cancer miRNA regulatory networks leads therapeutic options according to methods described herein.

    [0018] FIG. 12 is a panel of miRNAs involved in oncogenic processes across diverse cancers.

    [0019] FIG. 13 is a panel of miRNAs involved in cancer metastasis and tissue invasion.

    [0020] FIG. 14 shows miRNAs variously involved in sustained angiogenesis, tumor-promoting inflammation, self-sufficiency in growth signals, reprogramming energy metabolism, evading apoptosis, genome instability and mutation, limitless replicative potential, evading immune detection, and insensitivity to anti-growth signals in a number of cancers.

    [0021] FIG. 15 is an alignment of miR-767-5p, miR-29a, miR-29c and miR-29b.

    DESCRIPTION

    [0022] In a first aspect, a Framework for Inference of Regulation by miRNAs (FIRM) is provided. FIRM integrates three best performing algorithms to infer miRNA that mediate regulation from co-expression signatures. In an exemplary embodiment, FIRM limits the Weeder-miRvestigator method to only those inferences of miRNA mediated regulation with a perfect 7- or 8-mer miRvestigator complementarity p-value (p-value=6.1×10.sup.−5 or 1.5×10.sup.−5, respectively) to a miRNA seed in miRBase. Inferences of miRNA mediated regulation from the PITA and TargetScan enrichment of predicted miRNA target genes methods are filtered to include only those with Benjamini-Hochberg FDR=0.00. FIRM produces a listing (i.e., a panel) of all co-expression signatures predicted to be regulated by an miRNA. See also, the embodiments represented in FIGS. 7 and 11.

    [0023] FIRM is, at the most basic level, an assemblage of methods combined to produce a data set of co-expression signatures predicted to be regulated by one or more miRNAs. The methods are performed by one or more computer processors executing one or more sets of instructions. The instructions may be hard-encoded into the processor, as in an application-specific integrated circuit (ASIC), may be semi-permanently encoded into the processor, as is the case in, for example, a field-programmable gate array (FPGA), or may be stored on a memory device and executed by a general purpose processor that, after retrieving the instructions from the memory device, becomes a special purpose processor programmed to perform the methods. Generally, the methods may be stored (or encoded, in hardware implementations such as ASICs and FPGAs) as one or more modules or routines. While described below with respect to three methods (and, accordingly, three modules or routines), the methods of which FIRM is comprised may form more than three routines or fewer than three routines. Additionally, individual steps of the methods need not necessarily be performed in the order described. That is, unless a data dependency exists between two steps, it is possible—as will be understood—for steps to be performed in orders other than those described. Further, any particular step may, as will also be understood, represent one or more sub-steps, operations, functions, etc. As but one illustrative example, any particular method step may include retrieving input data from memory, performing one or more processing steps on the data, and storing one or more outputs to the memory.

    [0024] FIG. 8 depicts a flow diagram representing an exemplary FIRM method 800. Generally, the method 800 integrates algorithms to accurately identify the miRNA most likely implicated in the co-regulation of a set of genes represented in a set of genetic expression signatures. Using a first algorithm, the processor performs de novo identification of one or more 3′ UTR motifs that are complementary to seed sequences of miRNA stored on a memory device (block 802). Using a second algorithm, the processor also identifies enriched predicted miRNA binding sites determined from data produced by one or more (two, in an embodiment) of a variety of sub-algorithms such as PITA, TargetScan, miRanda, and miRSVR, etc. (block 804). The results of the blocks 802 and 804 are combined (block 806) as the union of the miRNA to gene co-expression signature predictions.

    [0025] An interface is optionally provided to allow one or more users to access the combined results (block 808). In one embodiment, the interface takes the form of a Web page available via a network connection (e.g., the Internet), allowing one or more users to access, search, and filter the combined data from any web-enabled device (e.g., workstations, laptop computers, smart phones, tablet devices, etc.). In another embodiment, the interface takes the form of an additional routine operating on a processor (the same processor or a different processor) communicatively connected to a memory on which the combined results are stored. For example, the interface routine may execute on a computing device and, via a network, may access/retrieve the combined results from a database or memory device located remotely. Alternatively, the interface routine may execute on the processor executing the routines related to blocks 802-806.

    [0026] In any event, the combined data may later be used for any purpose as generally described throughout the remainder of this application (block 810).

    [0027] FIG. 9 depicts a flow diagram representing an exemplary method 900 for performing de novo identification of one or more 3′ UTR motifs that are complementary to seed sequences of miRNA stored on a memory device (i.e., an exemplary method corresponding to the block 802). The exemplary method 900 corresponds generally to the miRvestigator algorithm. Overrepresented miRNA binding sites in 3′ UTR of supposed miRNA co-regulated genes (“motifs”) are identified (block 902). For each miRNA seed, the probability describing the complementarity of the miRNA seed to a 3′ UTR motif is computed (block 904). The resulting 3′ UTR motifs are converted to a hidden Markov model (HMM) (block 906). The processor uses the Viterbi algorithm to provide a complementarity p-value by comparing the HMM to all potential seed sequences in a set (e.g., miRBase) (block 908). The complete distribution of complementarity probabilies for all potential miRNA k-mer seed sequences (k=6, 7, or 8 bp) is exhaustively computed (block 910). miRNAs having the smallest complementarity p-values (e.g., below a pre-determined threshold) are selected as most likely to regulate the set of transcripts from which the 3′ UTR motif was derived (block 912). In an embodiment, the threshold is based upon the smallest possible p-value given the size of the search space. For example, for an 8 bp motif, the smallest p-value is 1/4.sup.8, or 1.5×10.sup.−5, for a 6 bp motif the smallest p-value would be 1/4.sup.6, or 2.4×10.sup.−4, etc. The threshold is a quality metric that demonstrates the certainty that a particular miRNA is the driving factor for a particular hallmark of cancer. Other thresholds could be used depending on the type of study being conducted.

    [0028] FIG. 10 depicts a flow diagram representing an exemplary method 1000 for identifying enriched predicted miRNA binding sites (i.e., an exemplary method corresponding to the block 804). Data produced by operation of one or more miRNA target gene prediction algorithms (e.g., PITA, TargetScan, miRanda, miRSVR) are analyzed by calculating the hypergeometric p-value for each miRNA in each set of data (block 1002). The sets of data may be stored locally on a memory device and/or may be stored remotely and accessed via a network connection. In any event, in FIG. 10, for example, hypergeometric p-values are calculated for each miRNA in the TargetScan and PITA data sets. The results are optionally filtered to control the false discovery rate (e.g., to be equal to or less than a predetermined value, e.g., 0.001) (block 1004). In an embodiment, the Benjamini-Hochberg False Discovery Rate Procedure (BHFDR) is implemented. Other methods may be used, alternatively or additionally, to control the false discovery rate. The results are optionally filtered to exclude results for which less than a pre-determined portion (e.g., 10 percent) of the genes are targeted by the specific miRNA (block 1006). Further, in some embodiments, the results are filtered based upon the presence of a particular miRNA in the tissue of interest. miRNAs having the smallest hypergeometic p-values (e.g., below a pre-determined threshold) are selected as most likely to regulate the signature (block 1008). Alternatively, in other embodiments the top set of results are selected. In still other embodiments, results with BHFDR corrected p-values below a threshold (e.g., below 0.05) could be selected. The individual miRNAs are sometimes referred to herein as “biomarkers” and sets of miRNAs identified are sometimes referred to as “panels” herein.

    [0029] By “statistically significant”, it is meant that the inference is greater than what might be expected to happen by chance alone (which could be a “false positive”). Statistical significance can be determined by any method known in the art. Commonly used measures of significance include the p-value, which presents the probability of obtaining a result at least as extreme as a given data point, assuming the data point was the result of chance alone. A result is often considered highly significant at a p-value of 0.05 or less.

    [0030] In another aspect, miRNAs are described herein as associated with particular cancers or cancer characteristics. The miRNAs can be measured in an individual and used to evaluate the risk that an individual will develop cancer in the future, for example, the risk that an individual will develop cancer in the next 1, 2, 2.5, 5, 7.5, or 10 years. As used herein, “measuring” includes at least “detecting” a biomarker, but can also include determining the level/quantity of a biomarker. Exemplary miRNAs are shown in the figures. The miRNAs can be employed for methods, kits, computer readable media, systems, and other aspects of the invention which employ individual miRNAs or sets of miRNAs. A panel of miRNAs may comprise one or more miRNAs. MicroRNAs are set out in FIGS. 12 (showing the miRNAs miR-29a/b/c, miR-130a, miR-296-5p, miR-338-5p, miR-369-5p, miR-656, miR-760, miR-767-5p, miR-890, miR-1275, miR-1276 and miR-1291 forming a cross-cancer miRNA regulatory network), 13 (showing the miRNAs forming a metastatic cancer miRNA regulatory network), and 14 (showing the miRNAs forming a sustained angiogenesis miRNA regulatory network, a tumor-promoting inflammation miRNA regulatory network, miRNAs involved in self-sufficiency in growth signals, miRNAs involved in reprogramming energy metabolism, miRNAs involved in evading apoptosis, miRNAs involved in genome instability and mutation, miRNAs involved in limitless replicative potential, miRNAs involved in evading immune detection and miRNAs involved in insensitivity to anti-growth signals).

    [0031] In still another aspect, methods of calculating a risk score for developing cancer are provided, comprising (a) obtaining inputs about an individual comprising the level of biomarkers in at least one biological sample from said individual; and (b) calculating a cancer risk score from said inputs; wherein said biomarkers comprise one or more biomarkers selected from FIGS. 12, 13 and 14.

    [0032] Cancers include, but are not limited to, cancers such as those set out in FIG. 14. These cancers include, but are not limited to, cancers of the bladder, brain, colon, blood, lung, skin, ovary, testes, breast, head, neck and prostate.

    [0033] In yet another aspect of evaluating risk for developing cancer, the method comprises: (a) obtaining biomarker measurement data, wherein the biomarker measurement data is representative of measurements of biomarkers in at least one biological sample from an individual; and (b) evaluating risk for developing cancer based on an output from a model, wherein the model is executed based on an input of the biomarker measurement data; wherein the biomarkers comprise one or more biomarkers selected from FIGS. 12, 13 and 14.

    [0034] In an additional aspect, the invention is method of evaluating risk for developing cancer comprising: obtaining biomarker measurements from at least one biological sample from an individual who is a subject that has not been previously diagnosed as having cancer, comparing the biomarker measurement to normal control levels; and evaluating the risk for the individual developing a cancer from the comparison; wherein the biomarkers are defined as set forth in the preceding paragraph.

    [0035] Similarly, methods are provided of evaluating risk for developing cancer, the method comprising: obtaining biomarker measurement data, wherein the biomarker measurement data is representative of measurements of biomarkers in at least one biological sample from an individual; and evaluating risk for developing cancer based on an output from a model, wherein the model is executed based on an input of the biomarker measurement data; wherein said biomarkers are defined as above.

    [0036] In some embodiments, the step of evaluating risk comprises computing an index value using the model based on the biomarker measurement data, wherein the index value is correlated with risk of developing cancer in the subject. In some embodiments, evaluating risk comprises normalizing the biomarker measurement data to reference values.

    [0037] In another aspect, a method of calculating a risk score for cancer progression is provided, comprising (a) obtaining inputs about an individual suffering from cancer comprising the level of biomarkers in at least one biological sample from said individual; and (b) calculating a cancer risk score from said inputs; wherein said biomarkers comprise one or more biomarkers selected from FIGS. 12, 13 and 14.

    [0038] In some embodiments of the methods disclosed herein, the obtaining biomarker measurement data step comprises measuring the level of at least one of the biomarkers in at least one biological sample from said individual. Optionally, the method includes a step (prior to the step of obtaining biomarker measurement data) of obtaining at least one biological sample from the individual.

    [0039] In some embodiments, at least one biomarker input is obtained from one or more biological samples collected from the individual, such as from a blood sample, saliva sample, urine sample, cerebrospinal fluid sample, sample of another bodily fluid, or other biological sample including, but not limited to, those described herein.

    [0040] In some embodiments, at least one biomarker input is obtained from a preexisting record, such as a record stored in a database, data structure, other electronic medical record, or paper, microfiche, or other non-electronic record.

    [0041] In some embodiments, the biomarkers comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, or more (up to all or all) biomarkers selected from FIG. 12, 13 and/or 14.

    [0042] In another aspect, the invention embraces a method comprising advising an individual of said individual's risk of developing cancer or risk of cancer progression, wherein said risk is based on factors comprising a cancer risk score, and wherein said cancer risk score is calculated as described above. The advising can be performed by a health care practitioner, including, but not limited to, a physician, nurse, nurse practitioner, pharmacist, pharmacist's assistant, physician's assistant, laboratory technician, dietician, or nutritionist, or by a person working under the direction of a health care practitioner. The advising can be performed by a health maintenance organization, a hospital, a clinic, an insurance company, a health care company, or a national, federal, state, provincial, municipal, or local health care agency or health care system. The health care practitioner or person working under the direction of a health care practitioner obtains the medical history of the individual from the individual or from the medical records of the individual. The advising can be done automatically, for example, by a computer, microprocessor, or dedicated device for delivering such advice. The advising can be done by a health care practitioner or a person working under the direction of a health care practitioner via a computer, such as by electronic mail or text message.

    [0043] In some embodiments of the invention, the cancer risk score is calculated automatically. The cancer risk score can be calculated by a computer, a calculator, a programmable calculator, or any other device capable of computing, and can be communicated to the individual by a health care practitioner, including, but not limited to, a physician, nurse, nurse practitioner, pharmacist, pharmacist's assistant, physician's assistant, laboratory technician, dietician, or nutritionist, or by a person working under the direction of a health care practitioner, or by an organization such as a health maintenance organization, a hospital, a clinic, an insurance company, a health care company, or a national, federal, state, provincial, municipal, or local health care agency or health care system, or automatically, for example, by a computer, microprocessor, or dedicated device for delivering such advice.

    [0044] In another embodiment, methods providing two or more cancer risk scores to a person, organization, or database are disclosed, where the two or more cancer risk scores are derived from biomarker information representing the biomarker status of the individual at two or more points in time. In any of the foregoing embodiments, the entity performing the method can receive consideration for performing any one or more steps of the methods described.

    [0045] In another aspect, a method is provided of ranking or grouping a population of individuals, comprising obtaining a cancer risk score for individuals comprised within said population, wherein said cancer risk score is calculated as described above; and ranking individuals within the population relative to the remaining individuals in the population or dividing the population into at least two groups, based on factors comprising said obtained cancer risk scores. The ranking or grouping of the population of individuals can be utilized for one or more of the following purposes: to determine an individual's eligibility for health insurance; an individual's premium for health insurance; to determine an individual's premium for membership in a health care plan, health maintenance organization, or preferred provider organization; to assign health care practitioners to an individual in a health care plan, health maintenance organization, or preferred provider organization; to recommend therapeutic intervention or lifestyle intervention to an individual or group of individuals; to manage the health care of an individual or group of individuals; to monitor the health of an individual or group of individuals; or to monitor the health care treatment, therapeutic intervention, or lifestyle intervention for an individual or group of individuals.

    [0046] In another aspect, a panel of biomarkers is provided comprising biomarkers selected from FIG. 12, 13 and/or 14. Exemplary panel embodiments contemplated are a panel comprising one, two or more (up to all or all) miRNAs in FIG. 12; a panel comprising one, two or more (up to all or all) miRNAs in claim 13; a panel comprising one, two or more (up to all or all) miRNAs in FIG. 14 associated with sustained angiogenesis; a panel comprising one, two or more (up to all or all) miRNAs in FIG. 14 associated with tumor-promoting inflammation; a panel comprising one, two or more (up to all or all) miRNAs in FIG. 14 associated with self-sufficiency in growth signals; a panel comprising one, two or more (up to all or all) miRNAs in FIG. 14 associated with reprogramming energy metabolism; a panel comprising one, two or more (up to all or all) miRNAs in FIG. 14 associated with evading apoptosis; a panel comprising one, two or more (up to all or all) miRNAs in FIG. 14 associated with genome instability and mutation; a panel comprising one, two or more (up to all or all) miRNAs in FIG. 14 associated with limitless replicative potential; a panel comprising one, two or more (up to all or all) miRNAs in FIG. 14 associated with evading immune detection; a panel comprising one, two or more (up to all or all) miRNAs in FIG. 14 associated with insensitivity to anti-growth signals; and panels including one, two or more (up to all or all) miRNAs in FIG. 14 respectively associated with a particular tissue or type of cancer [e.g., a panel comprising one, two or more (up to all or all) miRNAs in FIG. 14 associated with a colon cancer; or panel comprising one, two or more (up to all or all) miRNAs in FIG. 14 associated with a carcinoma]. Panels representing every possible combination of miRNAs in FIGS. 12, 13 and 14 are specifically contemplated.

    [0047] In another aspect, one or more data structures or databases are provided comprising values for one or more biomarkers in FIGS. 12, 13 and 14. A machine-readable storage medium can comprise a data storage material encoded with machine readable data or data arrays which, when using a machine programmed with instructions for using said data, is capable of use for a variety of purposes, such as, without limitation, subject information relating to cancer risk factors over time or in response to cancer-modulating drug therapies, drug discovery, and the like. Measurements of effective amounts of the biomarkers of the invention and/or the resulting evaluation of risk from those biomarkers can implemented in computer programs executing on programmable computers, comprising, inter alia, a processor, a data storage system (including volatile and non-volatile memory and/or storage elements), at least one input device, and at least one output device. Program code can be applied to input data to perform the functions described above and generate output information. The output information can be applied to one or more output devices, according to methods known in the art. The computer may be, for example, a personal computer, microcomputer, or workstation of conventional design.

    [0048] In another aspect, diagnostic test systems are provided comprising (1) means for obtaining test results comprising levels of multiple biomarkers in at least one biological sample; (2) means for collecting and tracking test results for one or more individual biological sample; (3) means for calculating an index value from inputs, wherein said inputs comprise measured levels of biomarkers, and further wherein said measured levels of biomarkers comprise the levels of one or more biomarkers selected from FIGS. 12, 13 and 14; and (4) means for reporting said index value. In some embodiments, said index value is a cancer risk score; the cancer risk score can be calculated according to any of the methods described herein. The means for collecting and tracking test results for one or more individuals can comprise a data structure or database. The means for calculating a cancer risk score can comprise a computer, microprocessor, programmable calculator, dedicated device, or any other device capable of calculating the cancer risk score. The means for reporting the cancer risk score can comprise a visible display, an audio output, a link to a data structure or database, or a printer.

    [0049] A diagnostic system is any system capable of carrying out the methods of the invention, including computing systems, environments, and/or configurations that may be suitable for use with the methods or system of the claims include, but are not limited to, personal computers, server computers, hand-held or laptop devices, multiprocessor systems, microprocessor-based systems, set top boxes, programmable consumer electronics, network PCs, minicomputers, mainframe computers, distributed computing environments that include any of the above systems or devices, and the like.

    [0050] In some embodiments, a diagnostic test system comprises: means for obtaining test results data representing levels of multiple biomarkers in at least one biological sample; means for collecting and tracking test results data for one or more individual biological samples; means for computing an index value from biomarker measurement data, wherein said biomarker measurement data is representative of measured levels of biomarkers, and further wherein said measured levels of biomarkers comprise the levels of a set or panel of biomarkers as defined elsewhere herein; and means for reporting said index value. In some variations of the diagnostic test system, the index value is a cancer risk score. In some preferred variations, the cancer risk score is computed according to the methods described herein for computing such scores. In some variations, the means for collecting and tracking test results data representing for one or more individuals comprises a data structure or database. In some variations, the means for computing a cancer risk score comprises a computer or microprocessor. In some variations, the means for reporting the cancer risk score comprises a visible display, an audio output, a link to a data structure or database, or a printer.

    [0051] In some embodiments, a medical diagnostic test system for evaluating risk for developing a cancer or risk for cancer progression, the system comprises: a data collection tool adapted to collect biomarker measurement data representative of measurements of biomarkers in at least one biological sample from an individual; and an analysis tool comprising a statistical analysis engine adapted to generate a representation of a correlation between a risk for developing a cancer and measurements of the biomarkers, wherein the representation of the correlation is adapted to be executed to generate a result; and an index computation tool adapted to analyze the result to determine the individual's risk for developing a cancer or for cancer progression, and represent the result as an index value; wherein said biomarkers are defined as a set or panel as described elsewhere herein. In some variations, the analysis tool comprises a first analysis tool comprising a first statistical analysis engine, the system further comprising a second analysis tool comprising a second statistical analysis engine adapted to select the representation of the correlation between the risk for developing a cancer or risk for cancer progression and measurements of the biomarkers from among a plurality of representations capable of representing the correlation. In some variations, the system further comprising a reporting tool adapted to generate a report comprising the index value.

    [0052] In some embodiments, a system for diagnosing susceptibility to cancer in a human subject comprises (a) at least one processor; (b) at least one computer-readable medium; (c) a susceptibility database operatively coupled to a computer-readable medium of the system and containing information associating measurements of one or more biomarkers selected from FIGS. 12, 13 and 14 and cancer in a population of humans; (d) a measurement tool that receives an input about the human subject and generates information from the input about one or more biomarkers selected from FIGS. 12, 13 and 14 from the human subject; and (e) an analysis tool (routine) that (i) is operatively coupled to the susceptibility database and the measurement tool, (ii) is stored on a computer-readable medium of the system, (iii) is adapted to be executed on a processor of the system, to compare the information about the human subject with the information about the population in the susceptibility database and generate a conclusion with respect to susceptibility to cancer in the human subject.

    [0053] In some embodiments, a system for diagnosing cancer in a human subject comprises (a) at least one processor; (b) at least one computer-readable medium; (c) a susceptibility database operatively coupled to a computer-readable medium of the system and containing information associating measurements of biomarkers selected from FIGS. 12, 13 and 14 and cancer in a population of humans; (d) a measurement tool that receives an input about the human subject and generates information from the input about one or more biomarkers selected from FIGS. 12, 13 and 14 from the human subject; and (e) an analysis tool (routine) that (i) is operatively coupled to the susceptibility database and the measurement tool, (ii) is stored on a computer-readable medium of the system, (iii) is adapted to be executed on a processor of the system, to compare the information about the human subject with the information about the population in the susceptibility database and generate a conclusion with respect to the presence of cancer in the human subject. In some embodiments, the biomarkers are measured by amplification or by hybridization to a microarray.

    [0054] In the systems in the preceding two paragraphs, the input about the human subject can be a biological sample from the human subject, and the measurement tool comprises a tool to measure one or more biomarkers selected from FIGS. 12, 13 and 14 in the biological sample, thereby generating biomarker measurements from a human subject. In some embodiments, the systems further comprise a communication tool operatively coupled to the analysis tool, stored on a computer-readable medium of the system and adapted to be executed on a processor of the system to generate a communication for the human subject, or a medical practitioner for the subject, containing the conclusion with respect to cancer for the subject.

    [0055] In some embodiments of systems comprising a communication tool operatively connected to the analysis tool or routine, the systems comprise a routine stored on a computer-readable medium of the system and adapted to be executed on a processor of the system, to: generate a communication containing the conclusion; and transmit the communication to the subject or the medical practitioner, or enable the subject or medical practitioner to access the communication.

    [0056] In some embodiments, any of the systems comprise a medical protocol database operatively connected to a computer-readable medium of the system and containing information correlating the conclusion and medical protocols for human subjects at risk for or suffering from cancer; and a medical protocol tool (or routine), operatively connected to the medical protocol database and the analysis tool or routine, stored on a computer-readable medium of the system, and adapted to be executed on a processor of the system, to compare the conclusion from the analysis routine with respect to cancer for the subject and the medical protocol database, and generate a protocol report with respect to the probability that one or more medical protocols in the database will reduce susceptibility to cancer, delay onset of cancer, increase the likelihood of detecting cancer at an early stage to facilitate early treatment or treat the cancer. Where the communication tool is operatively connected to the medical protocol tool or routine, the system may generate a communication that further includes the protocol report.

    [0057] Yet another aspect is a computer readable medium having computer executable instructions for evaluating risk for developing a cancer, the computer readable medium comprising: a routine, stored on the computer readable medium and adapted to be executed by a processor, to store biomarker measurement data representing a set or panel of biomarkers; and a routine stored on the computer readable medium and adapted to be executed by a processor to analyze the biomarker measurement data to evaluate a risk for developing a cancer or for risk of cancer progression. The panels of biomarkers are defined as described in any of the preceding paragraphs.

    [0058] Still another aspect is a method developing a model for evaluation of risk for developing a cancer or for cancer progression, the method comprising: obtaining biomarker measurement data, wherein the biomarker measurement data is representative of measurements of biomarkers from a population and includes endpoints of the population; inputting the biomarker measurement data of at least a subset of the population into a model; training the model for endpoints using the inputted biomarker measurement data to derive a representation of a correlation between a risk of developing a cancer or for cancer progression and measurements of biomarkers in at least one biological sample from an individual; wherein said biomarkers for which measurement data is obtained comprise a set or panel of markers of the invention as defined elsewhere herein.

    [0059] Another aspect is a kit comprising reagents for measuring a panel of biomarkers, wherein the panel of biomarkers are defined as described in any of the preceding paragraphs, or in a figures, or in other descriptions of preferred panels of markers found herein. In some embodiments, such reagents are packaged together. In some embodiments, the reagents are primers used to amplify miRNA(s) in a panel. In some embodiments, the reagents are DNA arrays that hybridize to miRNA(s) in a panel. In some embodiments, the kit further includes an analysis program for evaluating risk of an individual developing a cancer from measurements of the group of biomarkers from at least one biological sample from the individual.

    [0060] In measuring miRNA, an amplification reaction using appropriate primers as reagents may be done quantitatively, and the amount of amplified RNA can then be determined with an appropriate probe with a detectable label. The probe may be an oligonucleotide including oligos with nonnative linkages such as phosphothiolate or phosphoramidate, or a peptide nucleic acid (PNA). Nonnative bases may also be included. Thus, a kit may comprise a reagent for an assay which reagent is specific for the miRNA(s), as well as additional reagents needed in order to quantitate the results. Specific miRNA levels can also be measured using general molecular biology techniques commonly known in the art such as Northern blot, quantitative reverse transcription polymerase chain reaction (qRT-PCR), next-generation sequencing or microarray. qRT-PCR is a more sensitive and efficient procedure detect specific messenger RNA or microRNA. The RNA sample is first reverse transcribed, the target sequences can then be amplified using thermostable DNA polymerase. The concentration of a particular RNA sequence in a sample can be determined by examining the amount of amplified products. Microarray technology allows simultaneous measurement of the concentrations of multiple RNA species. Oligonucleotides complementary to specific miRNA sequences are immobilized on solid support. The RNA in the sample is labeled with ColorMatrix™ or florescent dye. After subsequent hybridization of the labeled material to the solid support, the intensities of fluorescent for ColorMatrix™ dye remaining on the solid support determines the concentrations of specific RNA sequences in the samples. The concentration of specific miRNA species can also be determined by NanoString™ nCounter™ system which provides direct digital readout of the number of RNA molecules in the sample without the use of amplification. NanoString™ technology involves mixing the RNA sample with pairs of capture and reporter probes, tailored to each RNA sequence of interest. After hybridization and washing away excess probes, probe-bound target nucleic acids are stretched on a surface and scanned to detect fluorescent-barcodes of the reporter probes. This allows for up to 1000-plex measurement with high sensitivity and without amplification bias. Technologies such as electrochemical biosensor arrays, surface plasma resonance and other targeted capture assays can also be utilized to quantify molecular markers simultaneously by measuring changes in electro-current, light absorption, fluorescence, or enzymatic substrates reactions.

    [0061] Another aspect includes methods for the prophylactic treatment of a subject at risk for a cancer according to procedures described herein. In some embodiments, the invention includes a method of prophylaxis for cancer comprising: obtaining risk score data representing a cancer risk score for an individual, wherein the cancer risk score is computed according to a method or improvement of the invention; and generating prescription treatment data representing a prescription for a treatment regimen to delay or prevent the onset of cancer to an individual identified by the cancer risk score as being at elevated risk for cancer. In some embodiments, a method of prophylaxis for cancer comprises: evaluating risk, for at least one subject, of developing a cancer according to the method or improvement of the invention; and treating a subject identified as being at elevated risk for a cancer with a treatment regimen to delay or prevent the onset of cancer.

    [0062] Another aspect includes methods for the therapeutic treatment of a subject indentified as having a cancer according to procedures described herein.

    [0063] In some embodiments, methods for the prophylactic or therapeutic treatment of a subject comprise administering a drug that increases the amount of a miRNA identified herein that is produced by the body to fight a cancer. In some embodiments, methods comprise administering a drug to inhibit a miRNA or decrease the amount of a miRNA identified herein that is part of the cause of or exacerbates a cancer. In some embodiments, methods comprise both administering a drug that increases the amount of a miRNA identified herein that is produced by the body to fight a cancer, and administering a drug to inhibit a miRNA or decrease the amount of a miRNA identified herein that is part of the cause of or exacerbates a cancer. In some embodiments, the subject is treated with the drug and also receives any other standard of care treatment for the cancer. A drug can be any product including, but not limited, to: small molecules; RNAs or vectors encoding RNAs, such as miRNAs (including miRNAs identified herein), snRNAs and antisense RNAs; peptides or polypeptides; and antibody products that penetrate cells.

    [0064] A further aspect is a method of evaluating the current status of a cancer in an individual comprising obtaining biomarker measurement data and evaluating the current status of a cancer in the individual based on an output from a model, wherein the biomarkers are any biomarker of the invention.

    [0065] The foregoing paragraphs are not intended to define every aspect of the invention, and additional aspects are described in other sections. This entire document is intended to be related as a unified disclosure, and it should be understood that all combinations of features described herein are contemplated, even if the combination of features are not found together in the same sentence, or paragraph, or section of this document. With respect to aspects of the invention described as a genus, all individual species are individually considered separate aspects of the invention. With respect to aspects described as a range, all sub-ranges and individual values are specifically contemplated.

    [0066] Aspects and embodiments of the invention are illustrated by the following non-limiting example.

    EXAMPLES

    [0067] A generalized framework for the inference of regulation by miRNAs (FIRM) was constructed. In Example 1, a compendium of transcriptome profiles was compiled from studies that had interrogated differential expression of genes in response to targeted perturbation of specific miRNAs (Brueckner et al 2007; Ceppi et al. 2009; Tsung-Cheng Chang et al. 2007; Fasanaro et al. 2009; Frankel et al. 2008; Georges et al. 2008; Grimson et al. 2007; Lin He et al. 2007; Hendrickson et al. 2008; Charles D Johnson et al. 2007; Karginov et al. 2007; Lee P Lim et al. 2005; Linsley et al. 2007; Malzkorn et al. 2010; Ozen et al. 2008; Sengupta et al. 2008; Tan et al. 2009; Tsai et al. 2009; Valastyan et al. 2009; Wang-Xia Wang et al. 2010; Frank Weber et al. 2006). In Example 2, using this compendium of miRNA-perturbed transcriptomes it was demonstrated that functional miRNA binding sites (8 bp of complementarity) preferentially reside in the 3′ UTRs. Further, using preferential 3′ UTR localization as a heuristic was demonstrated to significantly increase sensitivity and specificity of miRNA-binding site discovery by Weeder-miRvestigator. In Example 3, using the compendium of miRNA-perturbed transcriptomes the best performing algorithms were identified and integrated into a generalized framework for inference of miRNA regulatory networks. Finally, the utility of this framework was demonstrated by applying it to a set of 2,240 co-expression signatures from 46 different cancers. The original study was able to associate only four signatures to putative regulation by a known miRNA (Goodarzi et al. 2009). In contrast, using the integrated framework 1,324 signatures were explained as potential outcomes of regulation by specific miRNAs in miRBase. By applying functional enrichment and semantic similarity identified within this expansive network specific miRNAs associated with hallmarks of cancer were identified. Further, filtering gene co-expression signatures for specific hallmarks of cancer such as “tissue invasion and metastasis” generated a metastatic cancer-miRNA regulatory network of 33 miRNAs. Importantly, this revealed that a relatively small subset of miRNAs regulate multiple oncogenic processes across different cancers. Through in depth analyses of data from prior studies as well as new data from targeted miRNA-perturbation experiments, the role of miR-29 family members in lung adenocarcinoma was validated and gene targets for regulation by the relatively unknown miR-767-5p were discovered. Example 4 relates to the use of the FIRM approach to identify other miRNAs associated with hallmarks of cancer. The discussion in Example 5 illustrates how these analyses and validations demonstrate how the cancer-miRNA regulatory network can be used to accelerate discovery of miRNA-based biomarkers and therapeutics.

    Methods

    De Novo Identification of 3′ UTR Motifs

    [0068] Sequences and RefSeq gene definition files were downloaded from the UCSC genome browser FTP site (ftp://hgdownload.cse.ucsc.edulgoldenPath/currentGenomes/Homo_sapiens). Details can be found in the Supplementary Method section below. The Weeder de novo motif detection algoirthm (Pavesi et al. 2006) was then used to identify over-represented miRNA binding sites in the 3′ UTR of putatively miRNA co-regulated genes (Fan et al. 2009; Linhart et al. 2008).

    miRvestigator Identification of Complementary miRNA for 3′ UTR Motif

    [0069] MiRvestigator employs a hidden Markov model (BIMM) to align and compute a probability describing the complementarity of a specific miRNA seed to a 3′ UTR motif (Plaisier et al. 2011). The miRvestigator HIVIM is described in detail in the supplementary methods. The 3′ UTR motif is first converted to a miRvestigator HIVIM and the Viterbi algorithm is used to provide a complementarity p-value by comparing the HIVIM to all potential seed sequences from miRBase. There are different models for the base-pairing of miRNA seeds to the complementary protein coding transcript binding sites as described in FIG. 1 (Bartel 2009; Brennecke et al. 2005). The significance of the complementarity for a given miRNA is then calculated by exhaustively computing the complete distribution of complementarity probabilities for all potential miRNA k-mer seed sequences (where k=6, 7 or 8 bp). The miRNA(s) with the smallest complementarity p-value are considered the most likely to regulate the set of transcripts from which the 3′ UTR motif was derived.

    Simulating Synthetic Motifs and 3′ UTRs Sequences

    [0070] Motifs were simulated based upon the reverse complement of the 8 bp seed sequence 5′-UGGAAUGU-3′ for miR-1 (MIMAT0000416). The miRNA seed signal determined the percent that the seed nucleotide was given in each column of the PSSM and the remaining signal was distributed randomly to the other three nucleotides. We simulated motifs with different entropies by adding between 10 to 75% noise at a 5 percent interval to each seed nucleotide position. A seed nucleotide signal of 25 percent is the random case as one of the other three nucleotides is likely to have a higher frequency than the seed nucleotide. Thirty sequences were simulated by randomly sampling 8 mers from the distribution 8 mers in 3′ UTRs and inserting an instance of the reverse complement of the miR-1 seed sequence at varying proportions (0 to 100%). The reciever operating characteristic (ROC) area under the curve (AUC) was calculated using the ROCR package (Sing et al. 2005).

    Assessing Bias in the Distribution of miRNA Binding Sites

    [0071] Instances of Weeder motif binding sites from either full transcripts (5′ UTR, coding sequence (CDS), 3′ UTR) or just 3′ UTRs of genes matching to the perturbed miRNA were identified for the compendium of experimentally determined miRNA target gene sets. Significance for the normalized counts per 1 Kbp was calculated for the distribution of matches in each gene region and for each experimentally determined miRNA target gene set by comparison to 1,000,000 randomly sampled gene sets of the same size. A combined p-value was computed by using Stouffer's Z-score method. The ROCR package was again used to compute ROC curves and ROC AUCs for each method. The pROC package was used to calculate the 95% confidence interval and pairwise p-values to determine if there is a significant difference between the ROC curves of the methods (Robin et al. 2011).

    Identifying Enriched Predicted miRNA Binding Sites

    [0072] The PITA, TargetScan, miRanda and miRSVR miRNA target gene prediction databases were downloaded from their respective web sites. The significance for enrichment of genes with a predicted miRNA binding site was calculated using the hypergeometric p-value for each miRNA. The miRNA(s) with the smallest hypergeometric p-value are considered the most likely to regulate the signature. Multiple hypothesis testing correction was applied using the BenjaminHochberg approach for controlling the false discovery rate (FDR) equal to or less than 0.001 (FDR<0.001), and requiring at least 10% of the genes to be targeted by the specific miRNA.

    Selecting Optimal Methods to Infer miRNA Regulatory Network

    [0073] Each inference method was applied to the compendium of 50 miRNA target gene sets (Supplementary Table 2). The ROCR and pROC packages in R were used to compute ROC curves, ROC AUC and p-values between ROC curves.

    miR2Disease Overlap

    [0074] First, we created a mapping between the 46 cancer subtypes and the disease classifications in the manually curated miR2Disease database. Instances were then identified where an inferred miRNA regulator was previously observed to be dysregulated or causal in the same cancer type. Significance of the enrichment of overlap between miR2Disease and the cancer-miRNA regulatory network was calculated using a hypergeometric p-value in R.

    Functional Enrichment and Semantic Similarity to Hallmarks of Cancer

    [0075] Enrichment of GO biological process terms in each cancer co-expression signature were assessed using the topG0 package in R (Alexa et al. 2006) by computing a hypergeometric pvalue with Benjamini-Hochberg correction (FDR<0.05). All GO terms passing the significance threshold for a co-expression signature were included in downstream analyses. Semantic similarity between a significantly enriched GO term and each hallmark of cancer was assessed by using the Jiang and Conrath similarity measure as implemented in the R package GOSim (Fröhlich et al. 2007). For each co-expression signature the similarity scores between its enriched GO terms and the GO terms for each hallmark of cancer was computed, and the maximum for each hallmark was returned. Similarity scores gyeater than or equal to 0.8 were considered sufficient for inferring a link between the enriched GO terms for a co-expression signature and a hallmark of cancer. Random sampling of 1,000 GO terms and computing the Jiang and Conrath scores demonstrated that a similarity score greater than or equal to 0.8 resulted in a permuted p-value<5.1×10.sup.−4.

    miR-29 Family Co-Expression Signature Overlaps

    [0076] A hypergeometric p-value was used to test for significant overlap between the lung adenocarcinoma signature genes and the genes up-regulated by in vitro due to knock-down of miR-29 family milMAs.

    Luciferase Reporter Assay

    [0077] The 3′ UTRs for genes of interest were amplified from cDNA (primers in Supplementary Table 12) and cloned into the pmirGLO Dual-Luciferase miRNA target expression vector behind firefly luciferase. The sequence and orientation for all 3′ UTRs inserted into pmirGLO were verified by sequencing. HEK293 cells were plated at a density of 100,000 cells per well and cotransfected in 96 well plates 24 hours after plating. Cells were transfected using DharmaFect DUO (Dharmacon) with 75 ng of the 3′ UTR fused reporter vector and either 50 nM of miR-29a, miR-29b, miR-29c, miR-767-5p or cel-miR-67 (negative control) miRNA mimic (Dharmacon). Twenty-four hours after transfection firefly and renilla luciferase activities were measured using the Dual-Glo assay (Promega) on a Synergy 114 hybrid multi-mode microplate reader (BioTek) per manufacturer recommendations. Experiments were conducted in biological triplicates. Luminescence measurements were first background subtracted using a vehicle only control, and then firefly luminescence was normalized to renilla luminescence. Experimental comparisons are made to vector only controls. Student's T-test and fold-changes were calculated using standard methods. MiRNA binding sites for MMP2 and SPARC were deleted using recombinant PCR (primers in Supplementary Table 12). Dose response curves for COL3A1 and SPARC were conducted using 50 nM, 5 nM, 500 pM, 50 pM and 5 pM miRNA mimic concentrations.

    Supplementary Methods

    De Novo Identification of 3′ UTR Motifs

    [0078] Sequences and RefSeq gene definition files were downloaded from the UCSC genome browser FTP site (ftp://hgdownload.cse.ucsc.edu/goldenPath/currentGenomes/Homo sapiens). To reduce overlap the set of RefSeq genes that mapped to an Entrez gene were collapsed and the regulatory regions were merged to include all potential regulatory sequences. The RefSeq to Entrez gene mapping was downloaded from NCBI Gene FTP site (ftp://ftp.ncbi.nih.gov/gene/DATA/gene2refseq.gz). To provide a 3′ untranslated region (UTR) for as many genes as possible we set the minimum 3′ UTR length to the median annotated 3′ UTR length of 844 bp (Kertesz et al. 2007). The same approach was used for the 5′ UTR with a minimum 5′ UTR length of 183 bp. The coding sequences were acquired as they were annotated, and were not filtered in anyway. All annotated introns were removed as they are present only transiently in expressed transcripts. The Weeder de novo motif detection algoirthm (Pavesi et al. 2006) was then used to identify over-represented miRNA binding sites in the 3′ UTR of putatively miRNA co-regulated genes (Fan et al. 2009; Linhart et al. 2008).

    miRvestigator Hidden Markov Model (HMM) from Position Specific Scoring Matrix

    [0079] Two general problems are faced when comparing an miRNA seed which is a string of nucleotides 8 base pairs long (and may be complementary for 6, 7 or 8 base pairs) to a PSSM (a matrix of 4 nucleotide probabilities that must sum to 1 in a column by a variable number of columns). First the miRNA seed sequence must be aligned to the PSSM, and second the certainty of the match between the miRNA seed and the PSSM must be computed. The Viterbi algorithm identifies the optimal path through an HMM for an observed sequence of events, and there can solve both of these problems simultaneously by turning the PSSM into an Hidden Markov Model (HMM) and the miRNA seed nucleotide sequence into the observed sequence of events. The overall structure of the miRvestigator HMM is described in FIG. 5. Each column n of the PSSM is converted into a hidden state PSSM.sub.n which emits the nucleotides A, G, C and T with the probability of each nucleotide in the PSSM column. There are also two non-matching states NM.sub.1 and NM.sub.2, which are used to buffer entry and exit respectively to and from the PSSM. The non-matching states emit nucleotides at a random frequency of 0.25 for each nucleotide, thus not favoring any nucleotide over another. This buffering allows for non-matching states at the start and end of the aligned seed to the PSSM, and do not allow for gapping. From the start state the transmission probability is evenly distributed to each PSSM.sub.n state and the NM.sub.1 state (1/(length of PSSM+1)). This allows the alignment to start with equal probability at any point in the miRvestigator HMM. If the alignment starts with NM.sub.1 the transition probability back to NM.sub.i is 0.01 and the transition to the next PSSM column state is 0.99. The transition between PSSM.sub.n column state and PSSM.sub.n+1 column state is 0.99, and 0.01 to the end buffering NM.sub.2 non-matching state. The last PSSM.sub.N state transitions to the end state with a probability of 1. The NM.sub.2 non-matching state transitions to itself and the end state with a probability of 1, therefore when an alignment transitions to the NM.sub.2 state it stays there till it transitions to the end state. The emitted observations are the miRNA seed sequence being fed into the miRvestigator HMM. The output from the Viterbi algorithm is the optimal state path (a path made up of the PSSM.sub.m, NM.sub.1, NM.sub.2, WOBBLE.sub.n states) through the mirvestigator HMM given the miRNA seed nucleotide sequence and a probability for this optimal alignment.

    Significance of the Viterbi Optimal State Path Probability

    [0080] The significance of a the Viterbi optimal state path probability for a given miRNA is then calculated by exhaustively computing the complete distribution of Viterbi optimal state path probabilities for all potential miRNA k-mer seed sequences (where k=6, 7 or 8 base pairs). Only k-mers which are present in the regulatory regions of the transcripts being investigated are included in the exhaustive computation. The complete distribution of Viterbi probabilities is then used to provide a p-value for each miRBase miRNA seed sequence by counting the number of k-mers with a Viterbi optimal state path probability greater than or equal to the miRNA seed of interest divided by the total number of potential k-mers. This provides a p-value for the alignment and match for each miRNA seed sequences to a PSSM identified from cis-regulatory regions. The miRNAs are then ranked based upon the Viterbi optimal state path p-values and the miRNA(s) with the smallest p-values is the most likely to regulate the set of transcripts.

    Modeling Wobble Base-Pairing with miRvestigator HMM

    [0081] Wobble base-pairing was included in the miRvestigator HMM for the case where a G=U wobble base-pairing defines the miRNA to protein coding transcript complementarity (Baek et al. 2008; Guo et al. 2010; Hendrickson et al. 2009; Selbach et al. 2008). The individual miRNA to protein coding transcript G=U wobble base-pairing is a problem that will need to be solved at the level of de novo motif identification. A wobble base-pairing state is added to the model only if a G and/or U have a nucleotide seed frequency of 25%. For the case where the G seed nucleotide frequency is greater than 25% and the U seed nucleotide frequency is below 25% the wobble state emits the nucleotide A with a probability of 1. For the case where the U seed nucleotide frequency is greater than 25% and the G seed nucleotide frequency is below 25% the wobble state emits the nucleotide C with a probability of 1. For the case where both the G and U seed nucleotide frequencies are greater than 25% the wobble state emits A and C with a probability of 0.5. When a wobble state is added the transition probability from the PSSM.sub.n state to the WOBBLE.sub.n+1 state is set to 0.19, the transition probability from the PSSM.sub.n state to the PSSM.sub.n+1 state is set to 0.8, and the transition probability from the PSSM.sub.n state to the NM.sub.2 state remains at 0.01. The transition probability from the wobble state WOBBLE.sub.n to PSSM.sub.n+1 is set to 1, which precludes a wobble base-pairing at the terminus of a state path for either transitioning to the NM.sub.2 state or to the end state.

    Example 1

    [0082] Inferring miRNA Mediated Regulation through Analysis of Co-Expressed Genes

    [0083] The inference of a miRNA regulatory network can be accomplished in two ways. The first approach requires prior knowledge of genome-wide binding site locations for known miRNAs (Sethupathy et al. 2006). There are many algorithms that utilize this target enrichment strategy for inference of miRNA regulatory networks (Betel et al. 2010; Grimson et al. 2007; Linhart et al. 2008). The second approach performs the de novo discovery of conserved putative miRNA-binding sites within the 3′ UTRs of co-expressed genes. Weeder is one such algorithm that accurately discovers conserved cis-regulatory elements in 3′ UTRs (Fan et al. 2009; Linhart et al. 2008). The information of conserved cis-regulatory sequences can then be utilized for pattern matching to seed sequences of known miRNAs in miRBase. We had previously reported a web framework using the miRvestigator algorithm for performing such pattern matching (Plaisier et al. 2011). Here, we present results on the performance of Weeder and miRvestigator applied to simulated datasets. We then utilize a compendium of experimentally generated data from targeted miRNA perturbation studies to demonstrate that restricting Weeder's search space to 3′ UTRs sequences increases the sensitivity and specificity of Weeder-miRvestigator. Finally, we use the compendium to compare the performance of algorithms for the inference of miRNA regulation and combine the optimal methods into an integrated framework.

    Weeder-miRvestigator

    [0084] We constructed a framework for accurate inference of miRNA-mediated regulation using as input just the 3′ UTR sequences of co-expressed genes by coupling Weeder de novo motif detection and miRvestigator for subsequent association to known miRNA seeds (FIG. 1). We tested the sensitivity and specificity of miRvestigator independent of Weeder using synthetic 3′ UTR motifs. Starting with the seed sequence of miR-1 we computationally generated a set of synthetic motifs with increasing entropy. Using these synthetic motifs we computed the receiver operating characteristic (ROC) area under the curve (AUC) across a range of motif entropies. The ROC AUC is a standard approach to evaluate the sensitivity and specificity of classification or feature selection by an algorithm. This statistical analysis demonstrated that the miRvestigator scoring function (complementarity p-value metric) outperforms regular expression in both sensitivity and specificity for higher entropies (FIG. 2A, Supplementary Methods). Using the same approach we tested the performance of the integrated Weeder-miRvestigator framework in recovering the miR-1 seed sequence from a set of synthetic sequences into which it was inserted at a known frequency (0 to 100%). The results showed that by integrating the two algorithms we can sensitively and specifically recover the complementary miRNA seed (ROC AUC-0.9) even when it is present in just 40% of the query sequences (FIG. 2B). We conclude from these experiments that the integrated Weeder-miRvestigator approach is a sensitive and specific method for inference of miRNA mediated regulation from 3′ UTRs of coregulated genes.

    Example 2

    [0085] Restricting Searches to 3′ UTR Increases Sensitivity and Specificity of WeedermiRvestigator

    [0086] MiRNA target prediction algorithms (including PITA, TargetScan, miRANDA, and miRSVR) improved their performance by restricting searches to the 3′ UTRs of transcripts where it has been demonstrated statistically that functional miRNA binding sites are preferentially located (Grimson et al. 2007). To determine the validity of this heuristic we investigated the distribution of functional miRNA binding sites within co-regulated transcripts by applying Weeder-miRvestigator to full transcript sequences (5′ UTR, coding sequence (CDS) and 3′ UTR). First, we compiled a compendium of miRNA target gene sets from 50 transcriptomes that were generated by perturbing specific miRNAs (22 independent studies, 41 unique mIRNAs, Supplementary Table 2). The analysis was then restricted to target gene sets in the compendium where Weeder-miRvestigator was able to identify the corresponding perturbed miRNA (27 of 50 sets). The 3′ UTRs were significantly enriched for miRNA-binding sites with 8 bp complementarity to the miRNA seed sequence (p-value=3.2×10-5, FIGS. 2C and D). Remarkably, none of the other transcript regions showed significant enrichment of miRNA-binding sites (p-value >1.5×10-4, p-value corrected for 27 miRNAs ×3 transcript regions ×4 instance complementarities to the miRNA seed (All, 8 bp, 7 bp and 6 bp complementarities)). This unbiased analysis has independently confirmed the observation of Grimson, et al. that functional miRNA binding sites preferentially reside in the 3′ UTRs. Next, we compared the sensitivity and specificity of searching full transcripts versus restricting the search space to the 3′ UTRs by computing ROC curves for Weeder-miRvestigator. Restricting the search space to 3′UTRs (ROC AUC=0.96) significantly increased the sensitivity and specificity of miRNA-binding site discovery by Weeder (p-value=1.8×10-2) relative to corresponding searches on full transcript sequences (ROC AUC=0.80). Therefore, all subsequent miRNA-binding site searches with Weeder were restricted to the 3′ UTR of putatively co-regulated gene sets.

    Example 3

    [0087] Selecting Optimal Methods to Infer a Comprehensive miRNA Regulatory Network

    [0088] While multiple hypotheses testing correction procedures can reduce the number of false positives (incorrectly inferred regulatory interactions), it also results in a higher false negative rate (i.e. missing regulatory interactions). Therefore, we hypothesized that integrating results from multiple inference methods would construct a more comprehensive cancer-miRNA regulatory network as each method identifies a different subset of the miRNA regulatory network. To assess this we first identified the best performing network inference methods by computing a ROC curve from the predictions of applying each method to the compendium of experimentally determined miRNA target gene sets. In addition to Weeder-miRvestigator, we tested four additional algorithms that infer miRNA regulation through enrichment of predicted binding sites in 3′ UTRs of co-expressed genes: PITA, TargetScan, miRanda and miRSVR. This comparative analysis demonstrated that Weeder-miRvestigator, PITA and TargetScan are the best performing algorithms for inference of miRNA mediated regulation (FIG. 3A; ROC AUC±95% confidence interval=0.96±0.03, 0.94±0.04 and 0.90±0.05, respectively; Supplementary Table 3). Using cancer as an example, we explain in subsequent sections how the integration of these three best performing algorithms provides a generalizable framework for inference of regulation by miRNAs (FIRM) to infer comprehensive miRNA regulatory networks for complex diseases.

    Constructing a Cancer-miRNA Regulatory Network Using FIRM

    [0089] A previous study published by Goodarzi, et al. analyzed transcriptome profiles from 46 different cancers and identified 2,240 cancer-subtype characteristic co-expression signatures. Interestingly, the authors were able to associate only four of these signatures to regulation by a specific miRNA in miRBase (Goodarzi et al. 2009). We analyzed these co-expression signatures using FIRM with the intent of constructing a comprehensive cancer-miRNA regulatory network. Weeder-miRvestigator, PITA and TargetScan predicted miRNA regulators for 119, 662 and 1,029 co-expression signatures, respectively (Weeder-miRvestigator criteria: perfect 7-mer or 8-mer match, FDR<0.05, Supplementary Table 4; PITA and TargetScan criteria: FDR<0.001 and enrichment>10%, Supplementary Tables 5 and 6, respectively). There was significant overlap in pairwise comparisons of predictions for the same cancer (Weeder-miRvestigator vs. PITA=0.045, Weeder-miRvestigator vs. TargetScan=0.019 and PITA vs. TargetScan=7.4×10.sup.−22; FIG. 3B). While this significant overlap demonstrates concordance across the methods, a large fraction of the inferred miRNA regulation was unique to each method. This is not surprising given the high false negative rates of these methods and the different principles they use for identifying miRNA mediated regulation. In other words, predictions made by the three algorithms are mostly complementary. Combining results from all three methods in FIRM resulted in the construction of a comprehensive miRNA regulatory network that links 1,324 co-expression signatures to post-transcriptional regulation mediated by 608 miRNAs (Supplementary Table 7). Within this network 443 co-expression signatures were associated to miRNAs by more than one algorithm. Twenty co-expression signatures were independently associated to the same miRNA by two different algorithms (Supplementary Table 7). Interestingly, the only prediction that was consistent across all algorithms was that the miR-29 family regulates genes whose co-expression is observed in lung adenocarcinoma. In the following sections we investigate which miRNAs regulate oncogenic processes and the degree to which this network recapitulates known dysregulation of miRNAs in miR2Disease.

    The Cancer-miRNA Network Recapitulates miR2Disease and Discovers miRNAs that are Causal in Cancers

    [0090] We investigated whether the cancer-miRNA regulatory network was able to recapitulate miRNAs that are both dysregulated in tumors and causally linked to specific oncogenic processes. We performed this analysis by comparing the cancer-miRNA network to entries in miR2Disease, a manually curated database of miRNAs that are dysregulated and causally associated with 163 human diseases, including the 46 cancers in our study. Remarkably, there was significant enrichment of known dysregulated miRNAs in the cancer-miRNA network. Altogether 191 putative miRNA regulators in our inferred network were previously shown to be dysregulated in patient tumors of the same cancer type (p-value=2.1×10.sup.−91, Supplementary Table 7). Importantly, there were significant overlaps with predictions by each of the three algorithms (Weeder-miRvestigator p-value=0.029, PITA p-value=7.4×10.sup.−23 and TargetScan p-value=1.1×10.sup.−32). This result further demonstrates the value of combining the three algorithms in FIRM to infer a more comprehensive miRNA regulatory network.

    [0091] Using miR2Disease, we further investigated whether the dysregulated miRNAs predicted by FIRM were also known to causally influence cancer phenotypes. It was striking that over a third of the putative miRNA regulators that were dysregulated were also known to causally affect cancer phenotypes (66 miRNAs, p-value=1.4×10.sup.−34, Supplementary Table 7). Among these, three of the most highly connected miRNAs (miR-29b, miR-200b and miR-296-5p) were dysregulated in at least 8 cancers and causal in at least 4 cancers. These results demonstrate that the network inferred by FIRM had captured disease-relevant miRNA regulation of cancer. It also suggests that the network contains novel testable hypotheses regarding the role of miRNAs in regulation of cancer beyond what is documented in miR2Disease. A key next step is the prioritization of these novel testable hypotheses by integrating orthogonal information.

    Identifying miRNAs Regulating the Hallmarks of Cancer

    [0092] Associating a miRNA to a co-expression signature in patient tumors does not by itself implicate it in the regulation of key oncogenic processes. However, the network enables the discovery of cancer-relevant miRNAs through analysis of target genes for functional enrichment of one or more hallmarks of cancer (Douglas Hanahan and Robert A Weinberg 2011; D Hanahan and R A Weinberg 2000): 1) “self sufficiency in growth signals”, 2) “insensitivity to antigrowth signals”, 3) “evading apoptosis”, 4) “limitless replicative potential”, 5) “sustained angiogenesis”, 6) “tissue invasion and metastasis”, 7) “genome instability and mutation”, 8) “tumor promoting inflammation”, 9) “reprogramming energy metabolism”, and 10) “evading immune detection”. We analyzed genes within each of the co-expression signatures for hallmarks of cancer through their associations to specific Gene Ontology (GO) biological process terms.

    [0093] In total 627 of the 2,240 co-expression signatures were significantly enriched for GO terms (FDR<0.05), and 314 were associated with a putative miRNA in the regulatory network (Supplementary Table 8). To further filter this set and discover specific co-expression signatures associated with oncogenesis, we manually curated the lowest level GO terms for each of the 10 hallmarks of cancer (Supplementary Table 9), e.g. the hallmark of cancer “Evading Apoptosis” is associated with the GO term “Positive Regulation of Anti-Apoptosis”. Based on semantic similarity between GO terms we then associated 158 of the 314 putatively miRNA regulated co-expression signatures to one or more hallmarks of cancer (Jiang-Conrath Semantic Similarity Score>0.8, permuted p-value<5.1×10-4, Supplementary Table 8).

    [0094] Metastatic potential is one of the defining features of malignant tumors making putative miRNA-regulators of “tissue invasion and metastasis” excellent biomarker candidates. As an initial filter we selected 85 of the 158 “hallmarks of cancer”-associated co-expression signatures that had significant overlap (p-value<0.05) between GO annotated- and putatively miRNAregulated genes. Next, we extracted from these 85 co-expression signatures a subnetwork of 33 miRNAs and their predicted regulatory influences on 47 co-expression signatures associated with “tissue invasion and metastasis”—i.e. the metastatic cancer miRNA-regulatory network (FIG. 4A, Supplementary Table 10). Notably, at least three miRNAs, miR-29a/b/c, miR199a/b-3p and miR-222 are known to be differentially expressed in the cancer type predicted by this subnetwork. While some of these prior studies had independently revealed phenotypic consequences of perturbing the miR-29 family on tumor invasiveness, FIRM proposes a mechanistic explanation by predicting that these miRNAs directly regulate specific genes involved in “tissue invasion and metastasis”. We have performed detailed experimental validations demonstrating the regulation of metastasis associated genes by the miR-29 miRNAs and results of these experiments are presented in a later section.

    A Relatively Small Subset of miRNAs Regulate Oncogenic Processes in Diverse Cancers

    [0095] Regulation of the same oncogenic process by the same miRNA across different cancers reinforces the likelihood that the inferred miRNA regulation is real. In the cancer-miRNA regulatory network the number of co-expression signatures regulated by a miRNA follows a power-law distribution (y=2.1±0.0; goodness of fit p-value<1.0×10-4) with each miRNA predicted to regulate on average 3.3±3.3 co-expression signatures (Barabasi and Albert 1999). This suggests that some miRNAs regulate common biological processes across multiple cancers. Therefore, we filtered the cancer-miRNA regulatory network for miRNAs predicted to regulate genes within two or more co-expression signatures enriched for the same GO term(s). This analysis recovered 24 miRNAs that were predicted to combinatorially regulate 74 non-redundant co-expression signatures. Again, using semantic similarity to the hallmarks of cancer we discovered a subnetwork of 38 co-expression signatures from 30 cancer types that are regulated by 13 highly connected miRNAs (miR-29a/b/c, miR-130a, miR-296-5p, miR-338-5p, miR-369-5p, miR-656, miR-760, miR-767-5p, miR-890, miR-939, miR-1275, miR-1276 and miR-1291)—i.e. a cross-cancer-miRNA regulatory network (FIG. 4B, Supplementary Table 11). Each of the 13 miRNAs putatively regulates the same oncogenic processes across two or more cancers (FIG. 4B). We have already discussed role of miR-29 family in regulation of “tissue invasion and metastasis”. Further, reversing down regulation of miR-130a in metastatic prostate cancer cell lines has been previously demonstrated to increase apoptosis (Boll et al. 2012). This independently validates the cancer-miRNA regulatory network predicted effect of miR-130a on “evading apoptosis”. Finally, the predicted role of miR-296-5p in “activating invasion and metastasis” has also been validated by an independent study that discovered down-regulation of this miRNA in metastases relative to primary tumors (Vaira et al. 2011). Notably, 5 of the 13 miRNAs (hsa-miR-29a/b/c, miR-296-5p, miR-760, miR-767-5p and miR-1276) were inferred for co-expression signatures where a significant fraction of genes are direct miRNA targets and have GO annotated functions in oncogenic processes (FIG. 4A). It is noteworthy that such filtering is too stringent and would have excluded known cancer-related miRNAs such as miR-130a. Therefore, the integration of co-expression, shared miRNA-binding sites, and GO annotations, together overcome the incompleteness and uncertainties across all of these orthogonal datasets to discover novel biologically-meaningful regulation by miRNAs. Thus, we contemplate that all of the 13 miRNAs are useful as general purpose cancer biomarkers.

    Extracellular Matrix Genes Co-Regulated by miR-29 Family in Lung Adenocarcinoma

    [0096] In both the metastatic and cross-cancer-miRNA regulatory network, the miR-29 family (miR-29a, miR-29b and miR-29c) was predicted to be responsible for 8 co-expression signatures, five of which were associated with four hallmarks of cancer, viz. “tissue invasion and metastasis”, “sustained angiogenesis”, “insensitivity to anti-growth signals” and “self sufficiency in growth signals” (FIG. 4A and 4B). Two of these co-expression signatures were from lung adenocarcinoma patient tumors, “AD Lung Beer 31” and “AD Lung Bhattacharjee 59” (Bhattacharjee et al. 2001; David G Beer et al. 2002). The miR-29 family was associated to the co-expression signature from “AD Lung Beer 31” by all three inference methods; on the other hand, only PITA picked miR-29 as the putative regulator responsible for the co-expression signature from “AD Lung Bhattacharjee 59”.

    [0097] Two independent studies demonstrated that over-expression of miR-29a reduces the invasiveness of lung carcinoma cell lines (Muniyappa et al. 2009) and knock-down of miR-29b increases invasiveness (Rothschild et al. 2012). Serving as independent validation of the network predicted role of miR-29 family as regulators of “activating invasion and metastasis” in lung cancer. The direction of this association is concordant with a different set of studies which independently discovered that miR-29 family members were down-regulated in lung adenocarcinomas relative to normal lung (Landi et al. 2010; Yanaihara et al. 2006). Taken together these orthogonal sets of results strongly suggest that down-regulation of the miR-29 family increases tumor invasiveness thereby decreasing patient survival (Rothschild et al. 2012).

    [0098] A major strength of the cancer-miRNA regulatory network is that it identifies specific genes that are directly regulated by a specific miRNA. For instance, miR-29 family is implicated in modulating metastatic potential of patient tumors because it is predicted to directly regulate 79 and 64 genes in two co-expression signatures—“AD Lung Beer 31” and “AD Lung Bhatacharjee 59”. Notably, the two co-expression signatures have a significant overlap of 32 genes (p-value=2.1×10.sup.−46). We assessed whether these genes were indeed targets for regulation by the miR-29 family by investigating if they were differentially regulated when endogenous miRNAs of the miR29 family were knocked-down in a fetal lung fibroblast cell line (Cushing et al. 2011). Sixteen genes from “AD Lung Beer 31”, and 9 genes from “AD Lung Bhattacharjee 59” were up-regulated in response to knock-down of the three miR-29 family members (p-values=6.1×10.sup.−14 and 1.5×10.sup.−8, respectively). Altogether 17 genes from both co-expression signatures were up-regulated in the Cushing et al. study (Table 1), and notably all of these genes contain one or more miR-29 family binding sites in their 3′ UTRs (Table 1).

    [0099] Differential regulation of the seventeen genes in the Cushing et al. study does not demonstrate direct regulation by miR29 family miRNAs through physical interaction with predicted binding sites within 3′ UTRs of these genes. However, it is possible to demonstrate direct miRNA regulation by fusing the 3′ UTR of each putative target gene to a luciferase reporter, selectively deleting specific binding sites, and performing luciferase assays in cell lines that are co-transfected with the wildtype or mutated reporter-fusion construct and the synthetic miRNA mimic (at different concentrations) (Lal et al. 2011). We selected a total of 8 genes (COL3A1, COL4A1, COL4A2, FBN1, PDGFRB, SERP1NH1, and SPARC—see Table 1) to investigate using the aforementioned luciferase assay whether they were direct targets for regulation by miR29 family miRNAs (miR-29a, miR-29b and miR-29c). These genes were selected because they were predicted by the FIRM methods to (i) be in co-expression signatures regulated by the miR-29 family, (ii) contain miR-29 family binding sites, (iii) have functional association to “tissue invasion and metastasis” (e.g. collagens, metallo-proteases, etc.), and (iv) be up-regulated by miR-29 family knock-down in lung fibroblasts in the Cushing et al. study.

    [0100] First, we used qRT-PCR to demonstrate that the miR-29a mimic significantly down regulates transcript levels of luciferase when it is fused to 3′ UTRs of either COL3 A1 or SPARC (COL3A1 p-value=3.2×10.sup.−2, fold-change=−3.9; SPARC p-value=4.2×10.sup.−2, fold-change=−1.7). This validates our central thesis that perturbing a miRNA results in observable changes in transcript levels of the predicted target transcripts with corresponding miRNA-binding sites in the 3′ UTR. We then assayed the effects of all three miR-29 mimics (miR-29a, miR-29b and miR-29c) on normalized luciferase activity relative to a control (i.e. no miRNA mimic). Significant reduction in normalized luciferase expression (p-value<0.05) was observed for 7 of the 8 genes tested (Table 2), and there was no consequence when luciferase was fused to the negative control 3′ UTR from HIST1H2AC (miR-29a: p-value=0.99, fold-change=1.2). Deletion of all the putative miR-29 binding sites from the 3′ UTRs of MMP2 and SPARC abolished down regulation of luciferase activity by the miR-29 family mimics, conclusively demonstrating that miR-29 directly regulates abundance of predicted target transcripts via binding to the predicted 3′ UTR sites (MMP2-deletion: 1 site deleted, fold-change=1.1, p-value=8.6×10.sup.−1; SPARC-deletion: 2 sites deleted, fold-change=1.4, p-value=1.0; FIG. 5A).

    [0101] Finally, titration of the miR-29a mimic demonstrated it down regulates COL3A1 and SPARC in a dose-dependent manner (FIG. 5B).

    miR-767-5p Regulates a Collagen-Specific Subset of miR-29 Target Genes

    [0102] Analysis of predicted regulation by miR-29 demonstrates that the cancer-miRNA regulatory network makes accurate predictions that can be validated experimentally through a combination of miRNA perturbation and targeted mutagenesis of specific binding sites in the 3′ UTRs. We conducted further experimental analysis of predicted regulation by miR-767-5p to assess the specificity of using FIRM inferences to identify genes regulated by a miRNA. We selected miR-767-5p because this miRNA partially shares the miR-29 seed sequence. Specifically, both the metastatic and cross cancer-miRNA regulatory networks contain the PITA predictions that miR-767-5p regulates genes associated with four hallmarks of cancer (“insensitivity to antigrowth signals”, “self sufficiency in growth signals”, “sustained angiogenesis” and “tissue invasion and metastasis”) from four co-expression signatures (AD Ovarian Welsh 20, HSCC Head-Neck Chung 1, and SQ Bhattacharjee 18 and 44) across 3 cancer types (Bhattacharjee et al. 2001; Chung et al. 2004; Welsh et al. 2001).

    [0103] Unlike the miR-29 family, miR-767-5p has not been previously associated with any oncogenic processes. Therefore, we first evaluated whether there is any evidence for expression of miR-767-5p in head and neck, lung, or ovarian cancers to support the prediction by the cancer-miRNA regulatory network. A scan of miRNA-seq data from The Cancer Genome Atlas (TCGA) shows that miR-767-5p is indeed expressed in lung squamous cell carcinoma, head and neck squamous cell carcinoma, and ovarian serous cystadenocarcinoma (data not shown). Additionally, the MirZ miRNA expression atlas identifies miR-767-5p expression in astrocytoma, osteosarcoma and teratocarcinoma cell lines (Hausser et al. 2009). Future studies with the completed TCGA data will be able to determine whether miR-767-5p is differentially expressed between tumor and normal and whether miR-767-5p is predictive of patient survival. Based on this evidence we proceeded to test the effect of perturbing miR-767-5p on transcript abundance of the PITA predicted targets. Over-expression of miR-767-5p using a miRNA mimic led to significant reduction (p-value<0.05) in the normalized luciferase activity for 3 of the 4 predicted miRNA target genes (COL3A1, COL5A2, COL10A1 and LOX; Table 2).

    [0104] In addition to validating a novel oncogenesis-associated miRNA, the aforementioned rationale for selecting miR-767-5p was that it also shares 6 bp of similarity to the 8 bp seed region of the miR-29 family leading to a significant overlap between their predicted target genes (65% for PITA and 35% for TargetScan). This may explain why miR-767-5p and the miR-29 family are both predicted regulators of the HSCC Head-Neck Chung 1 co-expression signature. However, the two seed sequences have little similarity in the 3′ region (FIG. 15). The partial overlap in the miRNA seeds and their predicted targets provides an opportunity to test the specificity of using FIRM inferences to identify genes regulated by a miRNA. First, we tested all 11 3′ UTR luciferase fusions by over-expressing miR-29a, miR-29b, and miR-29c and miR-767-5p. Of the 22 regulatory interactions tested (Table 2) we observed only 1 false positive (miR-767-5p did not affect LOXtranscript levels) and 2 false negatives (the cancer-miRNA network did not predict the experimentally observed regulation of COL4A2 by miR-767-5p, and regulation of COL10,41 by the miR-29 family). Thus the false discovery rate was 7.1% -a significant improvement over previously published estimates (Sethupathy et al. 2006). Consistent with the cancer-miRNA network predictions, of the 11 genes that were tested only the five collagens were significantly regulated (p-value<0.05) by both miR-767-5p and miR-29 family. Despite sharing 6 bp of similarity in the seed sequence, miR-767-5p had no effect on transcript abundance of the other six bona fide miR-29 family targets to underscore the specificity of the cancer-miRNA regulatory network predictions filtered through FIRM.

    Example 4

    [0105] The FIRM approach was used to identify miRNAs regulating a number of hallmarks of cancer as described above as well as additional hallmarks of cancer. The miRNAs associated with additional hallmarks of cancer are set out in FIG. 14 along with their particular tissues and cancer types.

    Example 5

    Discussion

    [0106] As genome-wide analyses for discovery of molecular signatures of complex disease becomes routine it is imperative that these data are integrated into predictive and actionable models that drive targeted hypothesis-driven discovery of diagnostics, prognostics and, ultimately, therapeutics. The systems integration of disparate kinds of information boosts signal to noise enabling the discovery of biologically meaningful patterns as we have demonstrated here through inference of a cancer miRNA regulatory network. The success of the FIRM approach depended not only on integration of three best performing algorithms that use complementary strategies for inference of miRNA regulatory networks, but also on the integration of disparate data types such as gene co-expression, and distributions of both known and de novo discovered miRNA binding sites (FIG. 6). This is a remarkable achievement given that the information for miRNA binding and regulation exists in a contiguous stretch of merely 6-8 nucleotides located within the expansive 3′ UTRs of >20,000 genes in a genome of 6 billion bps.

    [0107] Further, we have also demonstrated that by incorporating the mechanistic basis of miRNA regulation, i.e. binding to complementary sequences in the 3′ UTRs of co-expressed genes, the network can be more easily assayed with targeted experimental and functional evaluation. In doing so we were able to demonstrate that the cancer-miRNA regulatory network had captured a significant proportion of known miRNA dysregulation and their causal influence on cancer phenotypes. In fact the network also made specific experimentally testable novel predictions regarding the role of 158 miRNAs in mediating co-expression of genes associated with oncogenic processes. Among these were 33 miRNAs that were predicted to regulate metastatic processes including a core set of 13 miRNAs that were predicted to regulate the same set of oncogenic processes across different cancer types. Our focused investigation of the role of miR-29 family in promoting metastasis in lung adenocarcinoma demonstrates how these network predictions can drive discovery of new biology.

    [0108] As a generalizable framework for inferring miRNA mediated regulation, FIRM will also benefit from simultaneous measurement of changes in miRNA and mRNA levels in patient tumors. However, negative correlation with gene expression changes alone does not accurately identify bona fide targets for the miRNA (Tsunglin Liu et al. 2007; Ritchie et al. 2009; Liang Wang et al. 2009). Thus clustering of the gene expression data and subsequent analysis with FIRM will be necessary for the inference of accurate miRNA regulatory networks. Correlation with the putative miRNA regulators could be used post hoc as a secondary screen to filter the predicted list of targets, and prioritize miRNAs for further experimental validation. We have demonstrated the power of this approach by performing targeted experiments to test predictions from the cancer-miRNA regulatory network. These experiments have discovered novel regulation of specific oncogenesis-associated genes by miRNAs that are shared across different cancer types. Importantly, in addition to providing mechanistic linkages between a known tumor suppressor miRNA (miR-29) and regulation of specific genes with metastatic potential, we have also discovered a novel oncogenesis associated miRNA (miR-767-5p). The choice of miRNAs for validating network predictions has also helped to highlight the sensitivity and specificity of FIRM performance. As such, we have not only demonstrated the extraordinary value of the cancer-miRNA network in cancer research; but also the power of FIRM to construct from easily generated gene expression data similar miRNA regulatory networks for any disease.

    [0109] We contemplate integrating inference of miRNA regulation into the clustering procedure. This will act as a constraint for accurate discovery of genes co-regulated by the same miRNA. The cMonkey biclustering algorithm already incorporates de novo discovery of transcription factor binding sites within gene promoters to limit the space of gene-gene associations to accurately discover sets of genes that are regulated by the same transcription factor (Reiss et al. 2006). The incorporation of constraints based on mechanisms of miRNA regulation will greatly improve the ability of cMonkey to model eukaryotic transcriptional regulatory networks. We contemplate that the ability of cMonkey to discover conditional coregulation of genes increases the sensitivity of FIRM and also provides the context (disease type, stage of progression, etc.) for regulatory influence of a miRNA.

    Availability of miRvestigator, FIRM and Cancer-miRNA Regulatory Network

    [0110] MiRvestigator was developed as an open source project using the Python programming language and is available both as a web service (http://mirvestigator.systemsbiology.net) and as source code (http://github.com/cplaisier/miRvestigator) (Plaisier et al. 2011). The FIRM and cancer-miRNA regulatory network are freely available at http://cmrn.systemsbiology.net

    Data Access

    [0111] To facilitate reader access and usability we have developed and hosted a freely available website (http://cmrn.systemsbiology.net) containing: 1) all data contained within the cancer-miRNA regulatory network, 2) including the compendium of 50 experimentally defined miRNA target gene sets, and 3) the FIRM framework to infer miRNA regulatory networks from gene coexpression information. Our hope is that this will provide cancer researchers with a usable interface to explore the cancer-miRNA regulatory network, computational biologists with a valuable resource to compare methods of inferring miRNA mediated regulation, and researchers with the tools to infer miRNA regulatory networks for their disease of interest.

    [0112] While the present invention has been described in terms of various embodiments and examples, it is understood that variations and improvements will occur to those skilled in the art. Therefore, only such limitations as appear in the claims should be placed on the invention.

    [0113] All documents referred to in this application, including priority documents, are hereby incorporated by reference in their entirety with particular attention to the content for which they are referred.

    REFERENCES

    [0114] Alexa A, Rahnenfiihrer J, and Lengauer T. 2006. Improved scoring of functional groups from gene expression data by decorrelating GO gaph structure. Bioinformatics 22: 1600-1607.

    [0115] Baek D, Villén J, Shin C, Camargo F D, Gygi S P, and Bartel D P. 2008. The impact of microRNAs on protein output. Nature 455: 64-71.

    [0116] Barabasi, and Albert. 1999. Emergence of scaling in random networks. Science 286: 509-512.

    [0117] Bartel D P. 2009. MicroRNAs: target recognition and regulatory functions. Cell 136: 215-233.

    [0118] Beer D G, Kardia SLR, Huang C-C, Giordano T J, Levin A M, Misek D E, Lin L, Chen G, Gharib T G, Thomas D G, et al. 2002. Gene-expression profiles predict survival of patients with lung adenocarcinoma. Nat. Med. 8: 816-824.

    [0119] Betel D, Koppal A, Agius P, Sander C, and Leslie C. 2010. Comprehensive modeling of microRNA targets predicts functional non-conserved and non-canonical sites. Genome Biol. 11: R90.

    [0120] Betel D, Wilson Manda, Gabow A, Marks D S, and Sander C. 2008. The microlMA.org resource: targets and expression. Nucleic Acids Res. 36: D149-153.

    [0121] Bhattacharjee A, Richards WG, Staunton J, Li C, Monti S, Vasa P, Ladd C, Beheshti J, Bueno R, Gillette M, et al. 2001. Classification of human lung carcinomas by mRNA expressionprofiling reveals distinct adenocarcinoma subclasses. Proc. Natl. Acad. Sci. U.S.A. 98: 13790-13795.

    [0122] Boll K, Reiche K, Kasack K, Morbt N, Kretzschmar A K, Tomm J M, Verhaegh G, Schalken J, von Bergen M, Horn F, et al. 2012. MiR-130a, miR-203 and miR-205 jointly repress key oncogenic pathways and are downregulated in prostate carcinoma. Oncogene. http://www.ncbi.nlm.nih.gov/pubmed/22391564 (Accessed Apr. 12, 2012).

    [0123] Brennecke J, Stark A, Russell R B, and Cohen S M. 2005. Principles of microRNA-target recognition. PLoS Biol. 3: e85.

    [0124] Brueckner B, Stresemann C, Kuner R, Mund C, Musch T, Meister M, Silltmann H, and Lyko F. 2007. The human let-7a-3 locus contains an epigenetically regulated microRNA gene with oncogenic function. Cancer Res. 67: 1419-1423.

    [0125] Ceppi M, Pereira P M, Dunand-Sauthier I, Bums E, Reith W, Santos M A, and Pierre P. 2009. MicroRNA-155 modulates the interleukin-1 signaling pathway in activated human monocyte-derived dendritic cells. Proc. Natl. Acad Sci. U.S.A. 106: 2735-2740.

    [0126] Chang T-C, Wentzel E A, Kent O A, Ramachandran K, Mullendore M, Lee K H, Feldmann G, Yamakuchi M, Ferlito M, Lowenstein C J, et al. 2007. Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis. Mol. Cell 26: 745-752.

    [0127] Chung C H, Parker J S, Karaca G, Wu Junyuan, Funkhouser W K, Moore D, Butterfoss D, Xiang D, Zanation A, Yin X, et al. 2004. Molecular classification of head and neck squamous cell carcinomas using patterns of gene expression. Cancer Cell 5: 489-500.

    [0128] Cushing L, Kuang P P, Qian J, Shao F, Wu Junjie, Little F, Thannickal V J, Cardoso W V, and Lu J. 2011. miR-29 is a major regulator of genes associated with pulmonary fibrosis. Am. J. Respir. Cell Mol. Biol. 45: 287-294.

    [0129] Dalmay T, and Edwards D R. 2006. MicroRNAs and the hallmarks of cancer. Oncogene 25: 6170-6175.

    [0130] Fan D, Bitterman P B, and Larsson 0.2009. Regulatory element identification in subsets of transcripts: comparison and integyation of current computational methods. RNA 15: 1469-1482.

    [0131] Fasanaro P, Greco S, Lorenzi M, Pescatori M, Brioschi M, Kulshreshtha R, Banfi C, Stubbs A, Cahn George A, Ivan M, et al. 2009. An integyated approach for experimental target identification of hypoxia-induced miR-210. J. Biol. Chem. 284: 35134-35143.

    [0132] Frankel L B, Christoffersen N R, Jacobsen A, Lindow M, Krogh A, and Lund All. 2008. Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells. J. Biol. Chem. 283: 1026-1033.

    [0133] Friedman R C, Farh K K-H, Burge C B, and Bartel D P. 2009. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res. 19: 92-105.

    [0134] Fröhlich 11, Speer N, Poustka A, and Beissbarth T. 2007. GOSim—an R-package for computation of information theoretic GO similarities between terms and gene products. BMC Bioinformatics 8: 166.

    [0135] Garofalo M, and Croce C M. 2011. microRNAs: Master regulators as potential therapeutics in cancer. Annu. Rev. Pharmacol. Toxicol. 51: 25-43.

    [0136] Georges S A, Biery M C, Kim S-Y, Schelter J M, Guo J, Chang A N, Jackson A L, Carleton M O, Linsley P S, Cleary M A, et al. 2008. Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 68: 10105-10112.

    [0137] Goodarzi II, Elemento 0, and Tavazoie S. 2009. Revealing global regulatory perturbations across human cancers. Mol. Cell 36: 900-911.

    [0138] Grimson A, Farh K K-H, Johnston W K, Garrett-Engele P, Lim L P, and Bartel D P. 2007. MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol. Cell 27: 91-105.

    [0139] Hanahan D, and Weinberg R A. 2000. The hallmarks of cancer. Cell 100: 57-70.

    [0140] Hausser J, Berninger P, Rodak C, Jantscher Y, Wirth S, and Zavolan M. 2009. MirZ: an integrated microRNA expression atlas and target prediction resource. Nucleic Acids Res. 37: W266-272.

    [0141] He L, He X, Lim LP, de Stanchina E, Xuan Z, Liang Y, Xue W, Zender L, Magnus J, Ridzon D, et al. 2007. A microRNA component of the p53 tumour suppressor network. Nature 447: 1130-1134.

    [0142] Hendrickson D G, Hogan D J, Herschlag D, Ferrell J E, and Brown P O. 2008. Systematic identification of mRNAs recruited to argonaute 2 by specific microRNAs and corresponding changes in transcript abundance. PLoS ONE 3: e2126.

    [0143] Jiang Q, Wang Y, Hao Y, Juan L, Teng M, Zhang X, Li M, Wang G, and Liu Y. 2009. miR2Disease: a manually curated database for microRNA deregulation in human disease. Nucleic Acids Res. 37: D98-104.

    [0144] Johnson C D, Esquela-Kerscher A, Stefani G, Byrom M, Kelnar K, Ovcharenko D, Wilson Mike, Wang Xiaowei, Shelton J, Shingara J, et al. 2007. The let-7 microRNA represses cell proliferation pathways in human cells. Cancer Res. 67: 7713-7722.

    [0145] Karginov F V, Conaco C, Xuan Z, Schmidt B H, Parker J S, Mandel G, and Hannon G J. 2007. A biochemical approach to identifying microRNA targets. Proc. Natl. Acad. Sci. U.S.A. 104: 19291-19296.

    [0146] Kertesz M, lovino N, Unnerstall U, Gaul U, and Segal E. 2007. The role of site accessibility in microRNA target recognition. Nat. Genet. 39: 1278-1284.

    [0147] Kozomara A, and Griffiths-Jones S. 2011. miRBase: integrating microRNA annotation and deep-sequencing data. Nucleic Acids Res. 39: D152-157.

    [0148] Lal A, Thomas M P, Altschuler G, Navarro F, O′Day E, Li X L, Concepcion C, Han Y-C, Thiery J, Rajani D K, et al. 2011. Capture of microRNA-bound mRNAs identifies the tumor suppressor miR-34a as a regulator of gyowth factor signaling. PLoS Genet. 7: el 002363.

    [0149] Landi M T, Zhao Y, Rotunno M, Koshiol J, Liu H, Bergen A W, Rubagotti M, Goldstein A M, Linnoila I, Marincola F M, et al. 2010. MicroRNA expression differentiates histology and predicts survival of lung cancer. Clin. Cancer Res. 16: 430-441.

    [0150] Lim L P, Lau N C, Garrett-Engele P, Grimson A, Schelter J M, Castle J, Bartel D P, Linsley P S, and Johnson J M. 2005. Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature 433: 769-773.

    [0151] Linhart C, Halperin Y, and Shamir R. 2008. Transcription factor and microRNA motif discovery: the Amadeus platform and a compendium of metazoan target sets. Genome Res. 18: 1180-1189.

    [0152] Linsley P S, Schelter J, Burchard J, Kibukawa M, Martin M M, Bartz S R, Johnson J M, Cummins J M, Raymond C K, Dai H, et al. 2007. Transcripts targeted by the microRNA-16 family cooperatively regulate cell cycle progression. Mol. Cell. Biol. 27: 2240-2252.

    [0153] Liu T, Papagiannakopoulos T, Puskar K, Qi S, Santiago F, Clay W, Lao K, Lee Y, Nelson S F, Komblum H I, et al. 2007. Detection of a microRNA signal in an in vivo expression set of mRNAs. PLoS ONE 2: e804.

    [0154] Malzkorn B, Wolter M, Liesenberg F, Grzendowski M, Stiihler K, Meyer H E, and Reifenberger G. 2010. Identification and functional characterization of microRNAs involved in the malignant progression of gliomas. Brain Pathol. 20: 539-550.

    [0155] Muniyappa M K, Dowling P, Henry M, Meleady P, Doolan P, Gammell P, Clynes M, and Barron N. 2009. MiRNA-29a regulates the expression of numerous proteins and reduces the invasiveness and proliferation of human carcinoma cell lines. Eur. J. Cancer 45: 3104-3118.

    [0156] Nana-Sinkam S P, and Croce C M. 2011. MicroRNAs as therapeutic targets in cancer. Transl Res 157: 216-225.

    [0157] Ozen M, Creighton C J, Ozdemir M, and Ittmann M. 2008. Widespread deregulation of microRNA expression in human prostate cancer. Oncogene 27: 1788-1793.

    [0158] Pavesi G, Mereghetti P, Zambelli F, Stefani M, Mauri G, and Pesole G. 2006. MoD Tools: regulatory motif discovery in nucleotide sequences from co-regulated or homologous genes. Nucleic Acids Res. 34: W566-570.

    [0159] Plaisier C L, Bare J C, and Baliga N S. 2011. miRvestigator: web application to identify miRNAs responsible for co-regulated gene expression patterns discovered through transcriptome profiling. Nucleic Acids Res. 39: W125-131.

    [0160] Reiss D J, Baliga N S, and Bonneau R. 2006. Integrated biclustering of heterogeneous genomewide datasets for the inference of global regulatory networks. BMC Bioinformatics 7: 280.

    [0161] Ritchie W, Rajasekhar M, Flamant S, and Rasko J E J. 2009. Conserved expression patterns predict microRNA targets. PLoS Comput. Biol. 5: e1000513.

    [0162] Robin X, Turck N, Hainard A, Tiberti N, Lisacek F, Sanchez J-C, and Muller M. 2011. pROC: an open-source package for R and S+ to analyze and compare ROC curves. BMC Bioinformatics 12: 77.

    [0163] Rothschild S I, Tschan M P, Federzoni E A, Jaggi R, Fey M F, Gugger M, and Gautschi 0. 2012. MicroRNA-29b is involved in the Src-ID1 signaling pathway and is dysregulated in human lung adenocarcinoma. Oncogene. http://www.ncbi.nlm.nih.gov/pubmed/22249264 (Accessed Apr. 12, 2012).

    [0164] Ruan K, Fang X, and Ouyang G. 2009. MicroRNAs: novel regulators in the hallmarks of human cancer. Cancer Lett. 285: 116-126.

    [0165] Selbach M, Schwanhausser B, Thierfelder N, Fang Z, Khanin R, and Rajewsky N. 2008. Widespread changes in protein synthesis induced by microRNAs. Nature 455: 58-63.

    [0166] Sengupta S, den Boon J A, Chen I-H, Newton M A, Stanhope S A, Cheng Y-J, Chen C-J, Hildesheim A, Sugden B, and Ahlquist P. 2008. MicroRNA 29c is down-regulated innasopharyngeal carcinomas, up-regulating mRNAs encoding extracellular matrix proteins. Proc. Natl. Acad. Sci. U.S.A. 105: 5874-5878.

    [0167] Sethupathy P, Megraw M, and Hatzigeorgiou AG. 2006. A guide through present computational approaches for the identification of mammalian microRNA targets. Nat. Methods 3: 881-886.

    [0168] Sing T, Sander 0, Beerenwinkel N, and Lengauer T. 2005. ROCR: visualizing classifier performance in R. Bioinformatics 21: 3940-3941.

    [0169] Tan L P, Seinen E, Duns G, de Jong D, Sibon O C M, Poppema S, Kroesen B-J, Kok K, and van den Berg A. 2009. A high throughput experimental approach to identify miRNA targets in human cells. Nucleic Acids Res. 37: el 37.

    [0170] Tsai W-C, Hsu PW-C, Lai T-C, Chau G-Y, Lin C-W, Chen C-M, Lin C-D, Liao Y-L, Wang J-L, Chau Y-P, et al. 2009. MicroRNA-122, a tumor suppressor microRNA that regulates intrahepatic metastasis of hepatocellular carcinoma. Hepatology 49: 1571-1582.

    [0171] Vaira V, Faversani A, Dohi T, Montorsi M, Augello C, Gatti S, Coggi G, Alfieri D C, and Bosari S. 2011 miR-296 regulation of a cell polarity-cell plasticity module controls tumor progression. Oncogene. http://www.ncbi.nlm.nih.gov/pubmed/21613016 (Accessed Oct. 8, 2011).

    [0172] Valastyan S, Reinhardt F, Benaich N, Calogrias D, Szasz A M, Wang Z C, Brock J E, Richardson A L, and Weinberg Robert A. 2009. A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Cell 137: 1032-1046.

    [0173] Wang L, Oberg A L, Asmann Y W, Sicotte H, McDonnell S K, Riska S M, Liu W, Steer C J, Subramanian S, Cunningham J M, et al. 2009. Genome-wide transcriptional profiling reveals microRNA-correlated genes and biological processes in human lymphoblastoid cell lines. PLoS ONE 4: e5878.

    [0174] Wang W-X, Wilfred B R, Hu Y, Stromberg A J, and Nelson P T. 2010. Anti-Argonaute RIP-Chip shows that miRNA transfections alter global patterns of mRNA recruitment to microribonucleoprotein complexes. RNA 16: 394-404.

    [0175] Weber F, Teresi R E, Broelsch C E, Frilling A, and Eng C. 2006. A limited set of human MicroRNA is deregulated in follicular thyroid carcinoma. J. Clin. Endocrinol. Metab. 91: 3584-3591.

    [0176] Welsh J B, Zarrinkar P P, Sapinoso L M, Kern S G, Behling C A, Monk B J, Lockhart D J, Burger R A, and Hampton G M. 2001. Analysis of gene expression profiles in normal and neoplastic ovarian tissue samples identifies candidate molecular markers of epithelial ovarian cancer. Proc. Natl. Acad. Sci. U.S.A. 98: 1176-1181.

    [0177] Yanaihara N, Caplen N, Bowman E, Seike M, Kumamoto K, Yi M, Stephens R M, Okamoto A, Yokota J, Tanaka T, et al. 2006. Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell 9: 189-198.

    [0178] Zen K, and Zhang C-Y. 2010. Circulating MicroRNAs: a novel class of biomarkers to diagnose and monitor human cancers. Med Res Rev http://www.ncbi.nlm.nih.gov/pubmed/21064190 (Accessed Oct. 8, 2011).

    SUPPLEMENTARY REFERENCES

    [0179] Baek D, Villén J, Shin C, Camargo F D, Gygi S P, and Bartel D P. 2008. The impact of microRNAs on protein output. Nature 455: 64-71.

    [0180] Fan D, Bitterman P B, and Larsson O. 2009. Regulatory element identification in subsets of transcripts: comparison and integration of current computational methods. RNA 15: 1469-1482.

    [0181] Guo H, Ingolia N T, Weissman J S, and Bartel D P. 2010. Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 466: 835-840.

    [0182] Hendrickson D G, Hogan D J, McCullough H L, Myers J W, Herschlag D, Ferrell J E, and Brown P O. 2009. Concordant regulation of translation and mRNA abundance for hundreds of targets of a human microRNA. PLoS Biol. 7: e1000238.

    [0183] Kertesz M, lovino N, Unnerstall U, Gaul U, and Segal E. 2007. The role of site accessibility in microRNA target recognition. Nat. Genet. 39: 1278-1284.

    [0184] Linhart C, Halperin Y, and Shamir R. 2008. Transcription factor and microRNA motif discovery: the Amadeus platform and a compendium of metazoan target sets. Genome Res. 18: 1180-1189.

    [0185] Pavesi G, Mereghetti P, Zambelli F, Stefani M, Mauri G, and Pesole G. 2006. MoD Tools: regulatory motif discovery in nucleotide sequences from co-regulated or homologous genes. Nucleic Acids Res. 34: W566-570.

    [0186] Selbach M, Schwanhäusser B, Thierfelder N, Fang Z, Khanin R, and Rajewsky N. 2008. Widespread changes in protein synthesis induced by microRNAs. Nature 455: 58-63.

    TABLE-US-00001 TABLE 1 Genes validated to be regulated by miR-29 family. miR-29 Family Target Sites Gene Entrez AD Lung AD Lung Weeder- Symbols Gene ID Beer 31 Bhattacharjee 59 miRvestigator PITA TargetScan COL1A1 1277 Yes a/b/c a/b/c a COL1A2 1278 Yes a/b/c a COL3A1 1281 Yes Yes a/b/c a/b/c b COL4A1 1282 Yes Yes a/b/c a/b/c b COL4A2 1284 Yes a/b/c a/b/c a COL5A1 1289 Yes a/b/c a/b/c a COL5A2 1290 Yes Yes a/b/c a/b/c a COL15A1 1306 Yes Yes a/b/c a/b/c b FBN1 2200 Yes Yes a/b/c a/b/c a FSTL1 11167 Yes a/b/c a LOXL2 4017 Yes a/b/c a MMP2 4313 Yes a/b/c a/b/c a PDGFRB 5159 Yes Yes a/b/c a/b/c a PPIC 5480 Yes a/b/c b SERPINH1 871 Yes Yes a/b/c b SPARC 6678 Yes Yes a/b/c a TRIB2 28951 Yes a/b/c a/b/c a a = miR-29a, b = miR-29b, c = miR-29c.

    TABLE-US-00002 SUPPLEMENTARY TABLE 1 Free Gene miRNA Cross- Energy of Expression Seed Species Free Secondary miRNA Inference Comple- Conser- Energy of mRNA Perturbation Method mentarity vation Annealing Structure Experiments PITA X X X X TargetScan X X miRanda X X X miRSVR X X X X

    TABLE-US-00003 SUPPLEMENTARY TABLE 2 PMID miRNA Perturbation System Biological Model Environment Assay Target Genes 15685193 hsa-miR-1 miRNA HeLa Ovarian Cancer in vitro Transcriptomics 98 15685193 hsa-miR-124 miRNA HeLa Ovarian Cancer in vitro Transcriptomics 165 15685193 hsa-miR-hes-3 .sup.B miRNA HeLa Ovarian Cancer in vitro Transcriptomics 61 16549876 hsa-miR-124 miRNA HepG2 Liver Cancer in vitro Transcriptomics 13 16822819 hsa-miR-192 Patient GE & Patients Follicular Thyroid in vivo Transcriptomics 48 Microcosm Cancer 16822819 hsa-miR-197 Patient GE & Patients Follicular Thyroid in vivo Transcriptomics 57 Microcosm Cancer 16822819 hsa-miR-346 Patient GE & Patients Follicular Thyroid in vivo Transcriptomics 24 Microcosm Cancer 17242205 hsa-miR-103 miRNA HCT116 & DLD-1 Colon Cancer in vitro Transcriptomics 110 17242205 hsa-miR-106b miRNA HCT116 & DLD-1 Colon Cancer in vitro Transcriptomics 22 17242205 hsa-miR-107 miRNA HCT116 & DLD-1 Colon Cancer in vitro Transcriptomics 81 17242205 hsa-miR-141 miRNA HCT116 & DLD-1 Colon Cancer in vitro Transcriptomics 100 17242205 hsa-miR-15a miRNA HCT116 & DLD-1 Colon Cancer in vitro Transcriptomics 102 17242205 hsa-miR-15b miRNA HCT116 & DLD-1 Colon Cancer in vitro Transcriptomics 186 17242205 hsa-miR-16 miRNA HCT116 & DLD-1 Colon Cancer in vitro Transcriptomics 64 17242205 hsa-miR-17 miRNA HCT116 & DLD-1 Colon Cancer in vitro Transcriptomics 75 17242205 hsa-miR-192 miRNA HCT116 & DLD-1 Colon Cancer in vitro Transcriptomics 483 17242205 hsa-miR-195 miRNA HCT116 & DLD-1 Colon Cancer in vitro Transcriptomics 185 17242205 hsa-miR-20 miRNA HCT116 & DLD-1 Colon Cancer in vitro Transcriptomics 65 17242205 hsa-miR-200a miRNA HCT116 & DLD-1 Colon Cancer in vitro Transcriptomics 89 17242205 hsa-miR-200b miRNA HCT116 & DLD-1 Colon Cancer in vitro Transcriptomics 68 17242205 hsa-miR-215 miRNA HCT116 & DLD-1 Colon Cancer in vitro Transcriptomics 165 17242205 hsa-let-7c miRNA HCT116 & DLD-1 Colon Cancer in vitro Transcriptomics 52 17308078 hsa-let-7a miRNA A549, HeLa & Lung, Ovarian in vitro Transcriptomics 195 HepG2 & Liver Cancer 17540599 hsa-miR-34a miRNA IMR90 Primary Normal in vitro Transcriptomics 100 Lung 17554337 hsa-miR-34a miRNA HCT116 Colon Cancer in vitro Transcriptomics 421 17612493 hsa-miR-7 miRNA HeLa Ovarian Cancer in vitro Transcriptomics 49 17612493 hsa-miR-9 miRNA HeLa Ovarian Cancer in vitro Transcriptomics 13 17612493 hsa-miR-122a miRNA HeLa Ovarian Cancer in vitro Transcriptomics 33 17612493 hsa-miR-128 miRNA HeLa Ovarian Cancer in vitro Transcriptomics 34 17612493 hsa-miR-132 miRNA HeLa Ovarian Cancer in vitro Transcriptomics 60 17612493 hsa-miR-133a miRNA HeLa Ovarian Cancer in vitro Transcriptomics 197 17612493 hsa-miR-142-3p miRNA HeLa Ovarian Cancer in vitro Transcriptomics 81 17612493 hsa-miR-148b miRNA HeLa Ovarian Cancer in vitro Transcriptomics 56 17612493 hsa-miR-181a miRNA HeLa Ovarian Cancer in vitro Transcriptomics 19 17699775 hsa-let-7b miRNA HCT116 Colon Cancer in vitro Transcriptomics 197 17891175 hsa-miR-125a Patient GE Patients Prostate Cacner in vivo Transcriptomics 25 17991735 hsa-miR-21 Anti-miR MCF-7 Breast Cancer in vitro Transcriptomics 309 18042700 hsa-miR-124 RIP-Chip + HEK293S Human in vitro Transcriptomics 287 miRNA Embryonic Kindey 18390668 hsa-miR-29c miRNA HeLa & HepG2 Ovarian Cancer in vitro Transcriptomics 12 & Human Embryonic Kidney 18461144 hsa-miR-1 RIP-Chip + HEK293T Human in vitro Transcriptomics 68 miRNA Embryonic Kindey 18461144 hsa-miR-124 RIP-Chip + HEK293T Human in vitro Transcriptomics 419 miRNA Embryonic Kindey 19074876 hsa-miR-192 miRNA HCT116 Colon Cancer in vitro Transcriptomics 18 19193853 hsa-miR-155 Anti-miR Cultured Moncyte Derived in vitro Transcriptomics 22 Dendritic Cells Dendritic Cells 19296470 hsa-miR-122 miRNA Mahlavu, HuH-7 Hepatocellular in vitro Transcriptomics 31 and SK-HEP-1 Carcinoma 19524507 hsa-miR-31 miRNA MDA-MB-231 Breast Cancer in vitro Luciferase 16 19734348 hsa-miR-17-5p/ RIP-Chip + L428 & L1236 Hodgkin in vitro Transcriptomics 84 20a/93/106a/ Anti-miR Lymphoma 106b .sup.E 19775293 hsa-miR-184 miRNA & A172 & T98G Glioma in vitro Transcriptomics 17 miRBase 19826008 hsa-miR-210 Anti-miR HUVEC Human in vitro Transcriptomics 32 Umbilical Vein Embryonic Cells 20042474 hsa-miR-124 RIP-Chip + H4 & SH-SY5Y Neuroblastoma in vitro Transcriptomics 10 miRNA 20042474 hsa-miR-128 RIP-Chip + H4 & SH-SY5Y Neuroblastoma in vitro Transcriptomics 11 miRNA

    TABLE-US-00004 SUPPLEMENTARY TABLE 4 Complementarity P-value  Dataset Cluster miRNAname Model Complementarity Viterbi AC_Brain_Sun 4 hsa-miR-937 7mer-a1 CGCGCGGA 6.10E−05 _||||||| -CGCGCCT AC_Brain_Sun 5 hsa-miR-523 7mer-a1 CGCGCGTT 6.10E−05 _||||||| -CGCGCAA AC_Brain_Sun 17 hsa-miR-487b 7mer-a1 NGTANGAT 6.10E−05 _||||||| -CATGCTA AC_Brain_Sun 50 hsa-miR-1234 7mer-m8 TAGGCCNA 6.10E−05 _||||||| -TCCGGCT AD_Lung_Beer 19 hsa-miR-487b 7mer-a1 GTANNATC 6.10E−05 |||||||_ CATGCTA- AD_Lung_Beer 31 hsa-miR-29b   8mer TGGTGCTA 1.53E−05 hsa-miR-29c |||||||| hsa-miR-29a ACCACGAT AD_Lung_Bhattacharjee 6 hsa-miR-941 8mer GCCGGGTG 1.53E−05 |||||||| CGGCCCAC AD_Lung_Bhattacharjee 27 hsa-miR-487b 7mer-a1 CGTACGAT 6.10E−05 _||||||| -CATGCTA AD_Lung_Bhattacharjee 44 hsa-miR-655 7mer-a1 CTGTATTA 6.10E−05 _||||||| -ACATAAT AD_Lung_Bhattacharjee 64 hsa-miR-150 7mer-a1 GTTGGGAG 6.10E−05 _||||||| -AACCCTC AD_Lung_Bhattacharjee 65 hsa-miR-3177 7mer-a1 CGCCSTGC 6.10E−05 _||||||| -CGGCACG AD_Lung_Stearman 29 hsa-miR-598 7mer-m8 TGANNTAT 6.10E−05 |||||||_ ACTGCAT- AD_Ovarian_Welsh 6 hsa-let-7e-3p 8mer CYNTATAG 1.53E−05 |||||||| GGCATATC AD_Ovarian_Welsh 13 hsa-miR-3178 7mer-a1 TCNCGCCC 6.10E−05 _||||||| -GCGCGGG AD_Ovarian_Welsh 24 hsa-miR-1469 7mer-a1 GCGCCGAT 6.10E−05 |||||||_ CGCGGCT- AD_Ovarian_Welsh 29 hsa-miR-3194 7mer-m8 GCTGGCCN 6.10E−05 |||||||_ CGACCGG- AD_Pancreas_Logsdon 3 hsa-miR-3178 7mer-m8 GCGCCCCG 6.10E−05 |||||||_ CGCGGGG- AD_Pancreas_Logsdon 10 hsa-miR-1273 7mer-m8 GGTCKCCC 6.10E−05 _||||||| -CAGCGGG AD_Pancreas_Logsdon 12 hsa-let-7f hsa-miR-98 7mer-a1 CTNCCTCN 6.10E−05 hsa-let-7b hsa-let-7c |||||||_ hsa-let-7a hsa-let-7g GATGGAG- hsa-let-7e hsa-let-7i hsa-let-7d AO_Brain_Bredel 10 hsa-miR-4285 7mer-m8 TCNCCNCA 6.10E−05 |||||||_ AGCGGCG- B-CLL_Leukemia_Haslinger 54 hsa-miR-937 7mer-a1 CGCGCGGA 6.10E−05 _||||||| -CGCGCCT B-CLL_Leukemia_Haslinger 58 hsa-miR-337 7mer-m8 CNCCNTTC 6.10E−05 _||||||| -CGGCAAG B-CLL_Leukemia_Haslinger 69 hsa-miR-450a 7mer-a1 ATNNCAAA 6.10E−05 _||||||| -AGCGTTT BPH_Prostate_Dhanasekaran 13 hsa-miR-423-3p 7mer-a1 GACNGAGC 6.10E−05 _||||||| -TGGCTCG CA_Bladder_Dyrskjot 13 hsa-miR-548k 7mer-a1 NNTACTTT 6.10E−05 _||||||| -CATGAAA CA_Bladder_Dyrskjot 17 hsa-miR-885-3p 7mer-a1 CNCTGCCN 6.10E−05 |||||||_ GCGACGG- CA_Bladder_Dyrskjot 26 hsa-miR-194 7mer-m8 TGTTANAA 6.10E−05 |||||||_ ACAATGT- CA_Bladder_Dyrskjot 35 hsa-miR-1469 7mer-a1 GCGCCGAT 6.10E−05 |||||||_ CGCGGCT- CA_Breast_Richardson 15 hsa-let-7d-3p 7mer-a1 TNNTATAC 6.10E−05 |||||||_ AGCATAT- CA_Breast_Richardson 17 hsa-miR-566 7mer-m8 TGGNNCCC 6.10E−05 _||||||| -CCGCGGG CA_Breast_Richardson 46 hsa-miR-487b 7mer-m8 TANNATTA 6.10E−05 |||||||_ ATGCTAA- CA_Breast_Sorlie 24 hsa-miR-1538 8mer CCGGGCCN 1.53E−05 |||||||| GGCCCGGC CA_Colon_Graudens 11 hsa-miR-523 8mer GCGCNTTC 1.53E−05 |||||||| CGCGCAAG CCC_Ovarian_Hendrix 11 hsa-miR-638 7mer-a1 CCNNTCCC 6.10E−05 _||||||| -GCTAGGG CCC_Ovarian_Hendrix 23 hsa-miR-523 7mer-a1 GCGCKTTA 6.10E−05 |||||||_ CGCGCAA- CCC_Ovarian_Hendrix 55 hsa-miR-1471 7mer-a1 TACGCGGG 6.10E−05 _||||||| -TGCGCCC COID_Lung_Bhattacharjee 10 hsa-miR-138-2-3p 7mer-m8 AAATAGNN 6.10E−05 |||||||_ TTTATCG- COID_Lung_Bhattacharjee 48 hsa-miR-886 7mer-a1 CCNACCCA 6.10E−05 |||||||_ GGCTGGG- COID_Lung_Bhattacharjee 84 hsa-miR-615 7mer-m8 CNACCCCC 6.10E−05 _||||||| -CTGGGGG COID_Lung_Bhattacharjee 87 hsa-miR-1181 7mer-m8 GNGACGGA 6.10E−05 |||||||_ CGCTGCC- DLBCL_Lymphoma_Alizadeh 5 hsa-miR-132-3p 7mer-m8 ACCACNGT 6.10E−05 _||||||| -GGTGCCA END_Ovarian_Hendrix 0 hsa-miR-598 8mer ATGANNTA 1.53E−05 |||||||| TACTGCAT END_Ovarian_Hendrix 18 hsa-miR-487b 7mer-a1 NGTACGAT 6.10E−05 _||||||| -CATGCTA END_Ovarian_Hendrix 19 hsa-miR-3195 7mer-a1 ACCGGCGC 6.10E−05 _||||||| -GGCCGCG END_Ovarian_Hendrix 45 hsa-miR-1471 7mer-a1 TACGCGGG 6.10E−05 _||||||| -TGCGCCC END_Ovarian_Hendrix 47 hsa-miR-1471 7mer-m8 CGCGGGCG 6.10E−05 |||||||_ GCGCCCG- END_Ovarian_Hendrix 52 hsa-miR-1538 7mer-a1 CNNGGCCT 6.10E−05 |||||||_ GGCCCGG- END_Ovarian_Hendrix 58 hsa-miR-621 7mer-m8 GCTAGCNG 6.10E−05 |||||||_ CGATCGG- END_Ovarian_Hendrix 82 hsa-let-7d-3p 7mer-a1 GTNNTATA 6.10E−05 _||||||| -AGCATAT FL_Lymphoma_Alizadeh 2 hsa-miR-425-3p 7mer-a1 TTCCNGAC 6.10E−05 |||||||_ AAGGGCT- FL_Lymphoma_Alizadeh 4 hsa-miR-4261 7mer-a1 TGTTTCCC 6.10E−05 |||||||_ ACAAAGG- GBM_Brain_Liang 14 hsa-miR-496 7mer-a1 CAATACTC 6.10E−05 |||||||| -TTATGAG GBM_Brain_Liang 17 hsa-miR-361 7mer-a1 TCTGATAG 6.10E−05 |||||||_ AGACTAT- GBM_Brain_Liang 18 hsa-miR-369 7mer-a1 GTNGATNG 6.10E−05 |||||||_ CAGCTAG- GCT_Seminoma_Korkola 3 hsa-miR-324 8mer GGGATGNG 1.53E−05 |||||||| CCCTACGC GCT_Seminoma_Korkola 42 hsa-miR-1181 8mer GGNGASGG 1.53E−05 |||||||| CCGCTGCC GCT_Seminoma_Korkola 75 hsa-miR-25   7mer-a1 NNTGCAAT 6.10E−05 hsa-miR-32 _||||||| hsa-miR-92a  -CACGTTA hsa-miR-92b   hsa-miR-363 hsa-miR-367 GL_Brain_Bredel 15 hsa-miR-126 8mer CGGTANGA 1.53E−05 |||||||| GCCATGCT GL_Brain_Bredel 18 hsa-miR-187 8mer AGACANGA 1.53E−05 |||||||| TCTGTGCT GL_Brain_Bredel 24 hsa-miR-516b 7mer-a1 ACTCCAGA 6.10E−05 _||||||| -GAGGTCT GL_Brain_Bredel 48 hsa-miR-2277 7mer-a1 CGCTGTCN 6.10E−05 |||||||_ GCGACAG- GL_Brain_Bredel 66 hsa-miR-223 7mer-a1 AACTGACT 6.10E−05 |||||||_ TTGACTG- GL_Brain_Bredel 78 hsa-miR-126 8mer CGGTAMGA 1.53E−05 |||||||| GCCATGCT GL_Brain_Rickman 2 hsa-miR-718 7mer-a1 GGNGGAAC 6.10E−05 |||||||_ CCGCCTT- GL_Brain_Rickman 26 hsa-miR-1469 7mer-a1 GCGCCSAT 6.10E−05 |||||||_ CGCGGCT- GLB_Brain_Sun 29 hsa-miR-1181 7mer-m8 CGCGACGG 6.10E−05 _||||||| -CGCTGCC GLB_Brain_Sun 64 hsa-let-7e-3p 7mer-a1 CCNTATAC 6.10E−05 |||||||_ GGCATAT- HSCC_Head-Neck_Chung 1 hsa-miR-29b  7mer-m8 NNGTGCTA 6.10E−05 hsa-miR-29c  _||||||| hsa-miR-29a -CCACGAT IDC_Breast_Radvanyi 8 hsa-miR-604 7mer-a1 CNCAGCCN 6.10E−05 |||||||_ GCGTCGG- IDC_Breast_Radvanyi 14 hsa-miR-590-3p 7mer-a1 ATAAAATT 6.10E−05 _||||||| -ATTTTAA IDC_Breast_Radvanyi 23 hsa-miR-376a-3p 7mer-a1 NNAATCTA 6.10E−05 _||||||| -CTTAGAT IDC_Breast_Radvanyi 50 hsa-miR-1247 7mer-m8 CGACGGGT 6.10E−05 _||||||| -CTGCCCA IDC_Breast_Radvanyi 59 hsa-miR-1469 7mer-a1 GCGCCGAC 6.10E−05 |||||||_ CGCGGCT- ILC_Breast_Radvanyi 6 hsa-let-7d-3p 7mer-a1 TNNTATAC 6.10E−05 |||||||_ AGCATAT- ILC_Breast_Radvanyi 11 hsa-miR-483 7mer-a1 TCCCNTCT 6.10E−05 _||||||| -GGGCAGA ME_Melanoma_Hoek 3 hsa-miR-4285 8mer CTCGCCGC 1.53E−05 |||||||| GAGCGGCG ML_Melanoma_Talantov 13 hsa-miR-337 7mer-m8 GCCNTTCG 6.10E−05 |||||||_ CGGCAAG- ML_Melanoma_Talantov 19 hsa-miR-302c-3p 7mer-m8 TKTTAAAT 6.10E−05 |||||||_ ACAATTT- ML_Melanoma_Talantov 28 hsa-miR-3175 7mer-m8 NCTCCCCN 6.10E−05 _||||||| -GAGGGGC ML_Melanoma_Talantov 34 hsa-miR-548c-3p 7mer-a1 ANATTTTT 6.10E−05 _||||||| -CTAAAAA MPC_Prostate_Dhanasekaran 0 hsa-miR-3074 7mer-a1 GCTGATAT 6.10E−05 _||||||| -GACTATA MPC_Prostate_Dhanasekaran 42 hsa-miR-582-3p 7mer-a1 TACCAGTT 6.10E−05 _||||||| -TGGTCAA MPM_Mesothelioma_Gordon 9 hsa-miR-219 7mer-a1 NNACAATC 6.10E−05 _||||||| -CTGTTAG MPM_Mesothelioma_Gordon 13 hsa-miR-1250 7mer-m8 CNCACCGT 6.10E−05 _||||||| -CGTGGCA MPM_Mesothelioma_Gordon 19 hsa-miR-615 7mer-m8 CSACCCCC 6.10E−05 _||||||| -CTGGGGG MPM_Mesothelioma_Gordon 22 hsa-miR-1284 7mer-m8 NGTATAGA 6.10E−05 _||||||| -CATATCT MPM_Mesothelioma_Gordon 40 hsa-miR-3178 7mer-a1 TCNCNCCC 6.10E−05 _||||||| -GCGCGGG MUC_Ovarian_Hendrix 42 hsa-miR-1181 7mer-m8 GNGACGGT 6.10E−05 |||||||_ CGCTGCC- MUC_Ovarian_Hendrix 56 hsa-miR-508-3p 7mer-a1 TACAATNN 6.10E−05 |||||||_ ATGTTAG- OD_Brain_Bredel 5 hsa-miR-423-3p 7mer-a1 TACCNAGC 6.10E−05 _||||||| -TGGCTCG OD_Brain_Bredel 16 hsa-miR-1181 8mer GGNGANGG 1.53E−05 |||||||| CCGCTGCC OD_Brain_Bredel 19 hsa-miR-551a  7mer-m8 CGGGTCGC 6.10E−05 hsa-miR-551b _||||||| -CCCAGCG OD_Brain_Bredel 37 hsa-miR-29a-3p 7mer-m8 AATCAGTA 6.10E−05 |||||||_ TTAGTCA- ODGL_Brain_Sun 37 hsa-miR-126 8mer CGGTACGA 1.53E−05 |||||||| GCCATGCT ODGL_Brain_Sun 38 hsa-miR-1469 7mer-a1 GCGCCGAT 6.10E−05 |||||||_ CGCGGCT- PDC_Pancreas_Ishikawa 3 hsa-miR-369 7mer-a1 GTNGATCG 6.10E−05 |||||||_ CAGCTAG- PPC_Prostate_Dhanasekaran 19 hsa-miR-101-3p 7mer-a1 AGATAACT 6.10E−05 _||||||| -CTATTGA RCCC_Renal_Boer 7 hsa-miR-32   7mer-m8 TGCAATAC 6.10E−05 hsa-miR-92a |||||||_ hsa-miR-92b ACGTTAT- RCCC_Renal_Lenburg 2 hsa-miR-487b 8mer GTANNATT 1.53E−05 |||||||| CATGCTAA RCCC_Renal_Lenburg 3 hsa-miR-548f  7mer-m8 TANTTTTT 6.10E−05 hsa-miR-548e  _||||||| hsa-miR-548x -TCAAAAA SMCL_Lung_Bhattacharjee 16 hsa-miR-339-3p 7mer-a1 CGGCGCTC 6.10E−05 _||||||| -CCGCGAG SMCL_Lung_Bhattacharjee 23 hsa-miR-3183 7mer-m8 GAGAGGCC 6.10E−05 |||||||_ CTCTCCG- SMCL_Lung_Bhattacharjee 51 hsa-miR-1273 8mer TGTNNCCC 1.53E−05 |||||||| ACAGCGGG SMCL_Lung_Bhattacharjee 60 hsa-miR-671-3p 7mer-a1 GAACCKGC 6.10E−05 |||||||_ CTTGGCC- SQ_Lung_Bhattacharjee 8 hsa-miR-1203 7mer-a1 CNCTCCGG 6.10E−05 _||||||| -CGAGGCC SQ_Lung_Bhattacharjee 34 hsa-miR-718 8mer GGNGGAAG 1.53E−05 |||||||| CCGCCTTC SQ_Lung_Bhattacharjee 35 hsa-miR-449c-3p 7mer-m8 GCTAGCAA 6.10E−05 _||||||| -GATCGTT SQ_Lung_Bhattacharjee 44 hsa-miR-4285 7mer-m8 TCNCCGCG 6.10E−05 |||||||_ AGCGGCG- SRS_Ovarian_Hendrix 67 hsa-miR-886 7mer-a1 CCNACCCT 6.10E−05 |||||||_ GGCTGGG- SRS_Ovarian_Hendrix 75 hsa-miR-937 7mer-a1 CGCGCGGA 6.10E−05 _||||||| -CGCGCCT SRS_Ovarian_Hendrix 81 hsa-miR-3135 7mer-a1 CCTAGGNN 6.10E−05 |||||||_ GGATCCG- TU_Prostate_Lapointe 14 hsa-miR-138-1-3p 7mer-a1 NNAAGTAG 6.10E−05 _||||||| -CTTCATC TU_Prostate_Lapointe 24 hsa-miR-487b 8mer GTANNATT 1.53E−05 |||||||| CATGCTAA TU_Prostate_Lapointe 26 hsa-miR-566 7mer-m8 GGCGCCCG 6.10E−05 |||||||_ CCGCGGG- TU_Prostate_Lapointe 40 hsa-miR-369 7mer-a1 GTNGATCG 6.10E−05 |||||||_ CAGCTAG-

    TABLE-US-00005 SUPPLEMENTARY TABLE 5 Uncorrected Dataset Cluster miRNA P-value miR2Disease AC Brain Sun 4 hsa-mir-222 0.000357084 glioma AC Brain Sun 6 hsa-mir-1284 4.83E−06 — AC Brain Sun 7 hsa-mir-582-3p 1.18E−05 — AC Brain Sun 12 hsa-mir-485-3p 2.89E−06 — AC Brain Sun 19 hsa-mir-218 3.23E−05 — AC Brain Sun 32 hsa-mir-1266 0.000659312 — AC Brain Sun 39 hsa-mir-1266 0.00017731  — AC Brain Sun 46 hsa-mir-548c-3p 4.75E−09 — AC Brain Sun 50 hsa-mir-32 0.000138143 — AC Brain Sun 51 hsa-mir-922 0.000626124 — AD Lung Beer 1 hsa-mir-766 2.26E−05 — AD Lung Beer 3 hsa-mir-338 3.66E−05 lung cancer AD Lung Beer 7 hsa-mir-548b hsa-mir-548a hsa-mir-548d hsa-mir-548i 2.53E−05 — hsa-mir-548j hsa-mir-548c hsa-mir-548h AD Lung Beer 8 hsa-mir-939 9.03E−05 — AD Lung Beer 9 hsa-mir-548k 1.61E−05 — AD Lung Beer 11 hsa-mir-9 0.000564437 lung cancer|lung cancer|non-small cell lung cancer (NSCLC) AD Lung Beer 12 hsa-mir-1208 7.53E−05 — AD Lung Beer 14 hsa-mir-571 4.68E−06 — AD Lung Beer 18 hsa-mir-876-3p 0.00023225  — AD Lung Beer 24 hsa-mir-770 2.97E−05 — AD Lung Beer 27 hsa-mir-320 hsa-mir-320a hsa-mir-320b hsa-mir-320d 0.000120148 — AD Lung Beer 28 hsa-mir-147 0.00058663  — AD Lung Beer 29 hsa-mir-661 0.000210827 — AD Lung Beer 31 hsa-mir-29 hsa-mir-29a hsa-mir-29b 5.80E−06 lung cancer|lung cancer AD Lung Beer 32 hsa-mir-656 0.000276057 — AD Lung Beer 33 hsa-mir-380 0.000197824 — AD Lung Beer 34 hsa-mir-193b 0.000113204 — AD Lung Beer 35 hsa-mir-222 0.000175181 non-small cell lung cancer (NSCLC) AD Lung Beer 40 hsa-mir-320 hsa-mir-320a hsa-mir-320b hsa-mir-320d 4.80E−05 — AD Lung Beer 44 hsa-mir-484 3.38E−05 — AD Lung Beer 46 hsa-mir-874 2.07E−05 — AD Lung Beer 51 hsa-mir-1202 0.00026996  — AD Lung Beer 52 hsa-mir-372 0.000455224 non-small cell lung cancer (NSCLC) AD Lung Beer 53 hsa-mir-581 3.77E−06 — AD Lung Bhattacharjee 2 hsa-mir-645 0.000246382 — AD Lung Bhattacharjee 7 hsa-mir-570 3.97E−05 — AD Lung Bhattacharjee 14 hsa-mir-517 hsa-mir-517a 6.67E−05 — AD Lung Bhattacharjee 19 hsa-mir-1322 0.00026893  — AD Lung Bhattacharjee 20 hsa-mir-599 8.73E−05 — AD Lung Bhattacharjee 22 hsa-mir-875-3p 2.47E−05 — AD Lung Bhattacharjee 28 hsa-mir-122 0.00016338  — AD Lung Bhattacharjee 30 hsa-mir-607 1.31E−05 — AD Lung Bhattacharjee 33 hsa-mir-892a 0.000442944 — AD Lung Bhattacharjee 39 hsa-mir-525-3p hsa-mir-524-3p 0.000313314 — AD Lung Bhattacharjee 42 hsa-mir-760 0.000234775 — AD Lung Bhattacharjee 44 hsa-mir-633 9.95E−06 — AD Lung Bhattacharjee 46 hsa-mir-548a-3p hsa-mir-548e hsa-mir-548f 4.38E−07 — AD Lung Bhattacharjee 47 hsa-mir-409-3p 1.02E−05 — AD Lung Bhattacharjee 49 hsa-mir-567 0.000411819 — AD Lung Bhattacharjee 53 hsa-mir-146b hsa-mir-146a 0.000204499 lung cancer AD Lung Bhattacharjee 58 hsa-mir-655 2.48E−05 — AD Lung Bhattacharjee 59 hsa-mir-29 hsa-mir-29a hsa-mir-29b 6.04E−07 lung cancer|lung cancer AD Lung Bhattacharjee 60 hsa-mir-190b hsa-mir-190 9.50E−06 — AD Lung Bhattacharjee 67 hsa-mir-361 0.000188291 — AD Lung Bhattacharjee 69 hsa-mir-23b hsa-mir-23a 2.83E−06 — AD Lung Bhattacharjee 72 hsa-mir-507 hsa-mir-557 5.02E−05 — AD Lung Bhattacharjee 75 hsa-mir-1270 hsa-mir-620 0.000200137 — AD Lung Bhattacharjee 76 hsa-mir-371-3p 3.23E−05 — AD Lung Stearman 0 hsa-mir-518a hsa-mir-527 7.85E−06 — AD Lung Stearman 7 hsa-mir-1269 8.43E−05 — AD Lung Stearman 9 hsa-mir-548g 0.000161471 — AD Lung Stearman 13 hsa-mir-455 0.000102984 — AD Lung Stearman 18 hsa-mir-1257 0.000200203 — AD Lung Stearman 25 hsa-mir-200a hsa-mir-141 0.000459035 cancer|lung cancer AD Lung Stearman 33 hsa-mir-196b hsa-mir-196a 9.42E−05 — AD Ovarian Welsh 0 hsa-mir-510 0.000176975 — AD Ovarian Welsh 2 hsa-mir-122 0.00027714  — AD Ovarian Welsh 3 hsa-mir-1283 2.12E−05 — AD Ovarian Welsh 5 hsa-mir-188-3p 0.000360695 — AD Ovarian Welsh 7 hsa-mir-650 0.00037885  — AD Ovarian Welsh 11 hsa-mir-1323 hsa-mir-548o 0.00020088  — AD Ovarian Welsh 15 hsa-mir-1282 6.41E−06 — AD Ovarian Welsh 20 hsa-mir-767 0.000326469 — AD Ovarian Welsh 21 hsa-mir-96 0.000127997 — AD Ovarian Welsh 25 hsa-mir-572 6.54E−06 ovarian cancer (OC) AD Ovarian Welsh 26 hsa-mir-210 8.63E−05 — AD Ovarian Welsh 29 hsa-mir-1280 1.97E−06 — AD Ovarian Welsh 30 hsa-mir-1207 2.62E−05 — AD Ovarian Welsh 31 hsa-mir-380 0.000597339 — AD Pancreas Logsdon 13 hsa-mir-486 0.000129758 — AD Pancreas Logsdon 14 hsa-mir-517 hsa-mir-517a 4.15E−05 — AD Pancreas Logsdon 15 hsa-mir-556-3p 9.44E−05 — AD Pancreas Logsdon 16 hsa-mir-561 0.000136915 — AO Brain Bredel 11 hsa-mir-608 1.92E−05 — AO Brain Bredel 13 hsa-mir-506 0.000219864 — AO Brain Bredel 17 hsa-mir-191 3.22E−05 — AO Brain Bredel 20 hsa-mir-324 0.000220545 — AO Brain Bredel 30 hsa-mir-1255b hsa-mir-1255a 0.000171809 — AO Brain Bredel 33 hsa-mir-450b 0.000452261 — AO Brain Bredel 35 hsa-mir-939 0.000489612 — B-CLL Leukemia Haslinger 15 hsa-mir-338 6.09E−05 — B-CLL Leukemia Haslinger 21 hsa-mir-429 hsa-mir-200b hsa-mir-200 5.23E−09 cancer B-CLL Leukemia Haslinger 25 hsa-mir-1237 9.44E−05 — B-CLL Leukemia Haslinger 27 hsa-mir-760 1.19E−07 — B-CLL Leukemia Haslinger 29 hsa-mir-520f 0.000157234 — B-CLL Leukemia Haslinger 30 hsa-mir-654-3p 0.000489152 — B-CLL Leukemia Haslinger 34 hsa-mir-492 4.95E−05 — B-CLL Leukemia Haslinger 35 hsa-mir-1294 2.05E−06 — B-CLL Leukemia Haslinger 37 hsa-mir-545 2.30E−05 — B-CLL Leukemia Haslinger 40 hsa-mir-582-3p 0.000202998 — B-CLL Leukemia Haslinger 46 hsa-mir-1249 0.000175139 — B-CLL Leukemia Haslinger 48 hsa-mir-520d hsa-mir-524 0.000143885 — B-CLL Leukemia Haslinger 49 hsa-mir-660 0.000361137 — B-CLL Leukemia Haslinger 52 hsa-mir-323-3p 0.000171267 — B-CLL Leukemia Haslinger 53 hsa-mir-513a-3p 5.06E−05 — B-CLL Leukemia Haslinger 55 hsa-mir-1323 hsa-mir-548o 2.12E−07 — B-CLL Leukemia Haslinger 59 hsa-mir-636 1.65E−05 — B-CLL Leukemia Haslinger 62 hsa-mir-515 2.65E−05 — B-CLL Leukemia Haslinger 64 hsa-mir-1278 0.000299993 — B-CLL Leukemia Haslinger 68 hsa-mir-377 0.000193905 — B-CLL Leukemia Haslinger 69 hsa-mir-532 0.000295895 — BPH Prostate Dhanasekaran 4 hsa-mir-543 1.06E−05 — BPH Prostate Dhanasekaran 5 hsa-mir-1283 0.000141737 — BPH Prostate Dhanasekaran 6 hsa-mir-648 0.000281772 — BPH Prostate Dhanasekaran 7 hsa-mir-508 0.000256525 — BPH Prostate Dhanasekaran 8 hsa-mir-891b 7.31E−05 — BPH Prostate Dhanasekaran 10 hsa-mir-1290 0.000500185 — BPH Prostate Dhanasekaran 11 hsa-mir-520d hsa-mir-524 5.08E−05 — BPH Prostate Dhanasekaran 12 hsa-mir-33b hsa-mir-33a 0.000395585 — BPH Prostate Dhanasekaran 15 hsa-mir-770 2.71E−05 — BPH Prostate Dhanasekaran 16 hsa-mir-548e 4.60E−05 — CA Bladder Dyrskjot 0 hsa-mir-607 6.23E−05 — CA Bladder Dyrskjot 1 hsa-mir-940 1.95E−05 — CA Bladder Dyrskjot 8 hsa-mir-140-3p 0.000606179 — CA Bladder Dyrskjot 9 hsa-mir-452 6.57E−08 bladder cancer CA Bladder Dyrskjot 12 hsa-mir-607 0.000333178 — CA Bladder Dyrskjot 16 hsa-mir-1205 4.42E−05 — CA Bladder Dyrskjot 19 hsa-mir-659 0.00021994  — CA Bladder Dyrskjot 21 hsa-mir-590-3p 0.000292988 — CA Bladder Dyrskjot 25 hsa-mir-550 0.000110985 — CA Bladder Dyrskjot 26 hsa-mir-1224 9.15E−06 — CA Bladder Dyrskjot 27 hsa-mir-365 1.19E−05 — CA Bladder Dyrskjot 31 hsa-mir-520d hsa-mir-524 0.000672309 — CA Bladder Dyrskjot 32 hsa-mir-320 hsa-mir-320a hsa-mir-320b hsa-mir-320d 3.19E−06 — CA Bladder Dyrskjot 36 hsa-mir-548n 2.24E−07 — CA Bladder Dyrskjot 42 hsa-mir-1183 4.30E−05 — CA Bladder Dyrskjot 47 hsa-mir-331 1.08E−05 — CA Bladder Dyrskjot 51 hsa-mir-1276 0.000118306 — CA Bladder Dyrskjot 53 hsa-mir-1206 3.97E−05 — CA Bladder Dyrskjot 56 hsa-mir-335 8.82E−06 — CA Bladder Dyrskjot 64 hsa-mir-590-3p 3.58E−12 — CA Bladder Dyrskjot 66 hsa-mir-1827 0.00059065  — CA Bladder Dyrskjot 71 hsa-mir-633 4.25E−05 — CA Bladder Dyrskjot 75 hsa-mir-487a 0.000410448 — CA Bladder Dyrskjot 79 hsa-mir-147b 4.66E−05 — CA Bladder Dyrskjot 81 hsa-mir-455-3p 0.000167082 — CA Bladder Dyrskjot 82 hsa-mir-519d 0.000101549 — CA Breast Richardson 2 hsa-mir-590-3p 9.05E−05 — CA Breast Richardson 4 hsa-mir-433 5.10E−05 — CA Breast Richardson 13 hsa-mir-590-3p 8.34E−05 — CA Breast Richardson 32 hsa-mir-1245 3.51E−05 — CA Breast Richardson 33 hsa-mir-876 0.000262306 — CA Breast Richardson 34 hsa-mir-410 2.79E−07 — CA Breast Richardson 38 hsa-mir-1271 5.68E−05 — CA Breast Richardson 43 hsa-mir-1246 0.000277995 — CA Breast Richardson 45 hsa-mir-181d hsa-mir-181b 0.000100856 breast cancer CA Breast Richardson 46 hsa-mir-323-3p 3.35E−05 — CA Breast Richardson 53 hsa-mir-548m 1.84E−05 — CA Breast Richardson 55 hsa-mir-130b hsa-mir-301a hsa-mir-301b hsa-mir-130a 0.000665578 — hsa-mir-454 CA Breast Richardson 56 hsa-mir-146b hsa-mir-146a 0.000198109 breast cancer CA Breast Sorlie 2 hsa-mir-653 0.000159728 — CA Breast Sorlie 5 hsa-mir-220 0.000125447 — CA Breast Sorlie 8 hsa-mir-494 0.000325493 — CA Breast Sorlie 10 hsa-mir-23b hsa-mir-23a 0.000228613 — CA Breast Sorlie 11 hsa-mir-33a 0.000170146 — CA Breast Sorlie 12 hsa-mir-548c-3p 0.00053872  — CA Breast Sorlie 14 hsa-mir-632 0.000123817 — CA Breast Sorlie 18 hsa-mir-490-3p 0.000434944 — CA Breast Sorlie 19 hsa-mir-155 6.17E−05 breast cancer|breast cancer|breast cancer|breast cancer CA Breast Sorlie 20 hsa-mir-1279 9.67E−07 — CA Colon Graudens 2 hsa-mir-551b hsa-mir-551a 2.41E−05 — CA Colon Graudens 3 hsa-mir-552 0.000397074 — CA Colon Graudens 8 hsa-mir-595 0.000150353 — CA Colon Graudens 9 hsa-mir-338-3p 0.000383018 — CA Colon Graudens 14 hsa-mir-1244 0.000207966 — CA Colon Graudens 17 hsa-mir-642 0.000254189 — CA Colon Graudens 19 hsa-mir-148a 6.28E−05 — CA Colon Graudens 24 hsa-mir-381 hsa-mir-300 1.03E−05 — CA Colon Graudens 25 hsa-mir-202 0.000193429 — CA Colon Graudens 28 hsa-mir-566 0.000134232 — CA Colon Graudens 29 hsa-mir-337-3p 0.00025569  — CA Colon Graudens 30 hsa-mir-125b hsa-mir-125a 0.000141991 colorectal cancer|colorectal cancer CA Colon Graudens 35 hsa-mir-325 1.27E−06 — CA Colon Graudens 36 hsa-mir-576 0.000293879 — CA Colon Graudens 38 hsa-mir-320 hsa-mir-320a hsa-mir-320b hsa-mir-320d 9.49E−06 colorectal cancer|colorectal cancer CA Colon Graudens 39 hsa-mir-873 1.14E−05 — CA Colon Graudens 40 hsa-mir-507 hsa-mir-557 0.000113046 — CA Colon Graudens 41 hsa-mir-1243 9.02E−05 — CA Renal Higgins 1 hsa-mir-590-3p 0.000514794 — CA Renal Higgins 10 hsa-mir-875-3p 3.13E−05 — CA Renal Higgins 13 hsa-mir-423 4.95E−06 — CA Renal Higgins 14 hsa-mir-140 0.000244645 — CCC Ovarian Hendrix 1 hsa-mir-1200 0.000441527 — CCC Ovarian Hendrix 4 hsa-mir-194 2.92E−06 — CCC Ovarian Hendrix 7 hsa-mir-532 0.000214675 — CCC Ovarian Hendrix 11 hsa-mir-29 hsa-mir-29a hsa-mir-29b 3.61E−07 ovarian cancer (OC) CCC Ovarian Hendrix 12 hsa-mir-876 1.89E−05 — CCC Ovarian Hendrix 13 hsa-mir-143 1.94E−05 epithelial ovarian cancer (EOC) CCC Ovarian Hendrix 23 hsa-mir-105 0.00057308  epithelial ovarian cancer (EOC) CCC Ovarian Hendrix 24 hsa-mir-19b hsa-mir-19a 0.000228998 — CCC Ovarian Hendrix 25 hsa-mir-183 2.99E−05 ovarian cancer (OC) CCC Ovarian Hendrix 30 hsa-mir-590 6.39E−05 — CCC Ovarian Hendrix 33 hsa-mir-127 0.000208615 cancer|epithelial ovarian cancer (EOC) CCC Ovarian Hendrix 35 hsa-mir-1283 0.000100312 — CCC Ovarian Hendrix 37 hsa-mir-1302 9.90E−05 — CCC Ovarian Hendrix 42 hsa-mir-590-3p 3.94E−05 — CCC Ovarian Hendrix 45 hsa-mir-382 0.000105777 — CCC Ovarian Hendrix 47 hsa-mir-548p 4.74E−05 — CCC Ovarian Hendrix 51 hsa-mir-1279 0.000323532 — CCC Ovarian Hendrix 56 hsa-mir-409-3p 0.000166079 — CCC Ovarian Hendrix 59 hsa-mir-552 2.65E−05 — CCC Ovarian Hendrix 60 hsa-mir-105 1.20E−06 epithelial ovarian cancer (EOC) CLL Lymphoma Alizadeh 0 hsa-mir-1283 9.53E−05 — CLL Lymphoma Alizadeh 3 hsa-mir-513b 1.11E−05 — CLL Lymphoma Alizadeh 7 hsa-mir-1263 9.63E−05 — CLL Lymphoma Alizadeh 8 hsa-mir-222 0.000378332 — CLL Lymphoma Alizadeh 10 hsa-mir-21 hsa-mir-590 6.63E−05 chronic lymphocytic leukemia (CLL) COID Lung Bhattacharjee 0 hsa-mir-663 9.57E−05 — COID Lung Bhattacharjee 2 hsa-mir-548d-3p 0.000222684 — COID Lung Bhattacharjee 3 hsa-mir-940 7.85E−05 — COID Lung Bhattacharjee 5 hsa-mir-361 0.000204845 — COID Lung Bhattacharjee 7 hsa-mir-431 6.94E−05 — COID Lung Bhattacharjee 8 hsa-mir-607 0.000109642 — COID Lung Bhattacharjee 9 hsa-mir-622 0.000578648 — COID Lung Bhattacharjee 10 hsa-mir-513a-3p 9.27E−06 — COID Lung Bhattacharjee 11 hsa-mir-501 0.000106934 — COID Lung Bhattacharjee 12 hsa-mir-509 hsa-mir-509-3 0.00045535  — COID Lung Bhattacharjee 17 hsa-mir-885-3p 2.71E−07 — COID Lung Bhattacharjee 19 hsa-mir-553 2.94E−05 — COID Lung Bhattacharjee 21 hsa-mir-590-3p 0.000341529 — COID Lung Bhattacharjee 25 hsa-mir-1276 1.52E−05 — COID Lung Bhattacharjee 28 hsa-mir-758 0.000192537 — COID Lung Bhattacharjee 31 hsa-mir-331-3p 0.000462838 — COID Lung Bhattacharjee 40 hsa-mir-1181 2.31E−05 — COID Lung Bhattacharjee 41 hsa-mir-1303 0.000150263 — COID Lung Bhattacharjee 44 hsa-mir-504 3.96E−05 — COID Lung Bhattacharjee 47 hsa-mir-574-3p 2.48E−05 — COID Lung Bhattacharjee 60 hsa-mir-505 0.00037429  — COID Lung Bhattacharjee 61 hsa-mir-494 1.43E−05 — COID Lung Bhattacharjee 67 hsa-mir-512-3p 0.000326325 — COID Lung Bhattacharjee 71 hsa-mir-1237 0.000255541 — COID Lung Bhattacharjee 73 hsa-mir-1262 0.000380974 — COID Lung Bhattacharjee 74 hsa-mir-513a-3p 4.85E−06 — COID Lung Bhattacharjee 75 hsa-mir-1300 0.000178305 — COID Lung Bhattacharjee 78 hsa-mir-920 0.000256218 — COID Lung Bhattacharjee 81 hsa-mir-369-3p 3.12E−05 — COID Lung Bhattacharjee 86 hsa-mir-580 5.05E−05 — COID Lung Bhattacharjee 89 hsa-mir-1254 0.000134399 — COID Lung Bhattacharjee 91 hsa-mir-1275 5.25E−06 — DLBCL Lymphoma Alizadeh 1 hsa-mir-138 3.63E−05 — DLBCL Lymphoma Alizadeh 5 hsa-mir-198 0.000115292 — DLBCL Lymphoma Alizadeh 6 hsa-mir-542 1.20E−05 — DLBCL Lymphoma Alizadeh 7 hsa-mir-532-3p 3.78E−05 — DLBCL Lymphoma Alizadeh 9 hsa-mir-892b 0.000231852 — DLBCL Lymphoma Alizadeh 10 hsa-mir-325 0.00021668  — DLBCL Lymphoma Alizadeh 11 hsa-mir-1203 6.38E−05 — END Ovarian Hendrix 3 hsa-mir-510 1.61E−06 — END Ovarian Hendrix 4 hsa-mir-608 2.66E−05 ovarian cancer (OC) END Ovarian Hendrix 6 hsa-mir-29 hsa-mir-29a hsa-mir-29b 6.95E−05 ovarian cancer (OC) END Ovarian Hendrix 7 hsa-mir-1302 1.69E−05 — END Ovarian Hendrix 8 hsa-mir-200a hsa-mir-141 0.000119842 cancer|epithelial ovarian cancer (EOC)|ovarian cancer (OC)|ovarian cancer (OC)|ovarian cancer (OC) END Ovarian Hendrix 13 hsa-mir-1276 0.000413656 — END Ovarian Hendrix 18 hsa-mir-890 6.81E−05 — END Ovarian Hendrix 22 hsa-mir-15b hsa-mir-15a hsa-mir-16 hsa-mir-497 0.000286656 ovarian cancer (OC) hsa-mir-195 END Ovarian Hendrix 23 hsa-mir-1259 0.000453022 — END Ovarian Hendrix 25 hsa-mir-653 0.000151323 — END Ovarian Hendrix 26 hsa-mir-548c-3p 1.03E−05 — END Ovarian Hendrix 32 hsa-mir-802 0.000186055 — END Ovarian Hendrix 35 hsa-mir-1276 9.71E−20 — END Ovarian Hendrix 38 hsa-mir-944 0.000151186 — END Ovarian Hendrix 39 hsa-mir-508 0.000310807 ovarian cancer (OC) END Ovarian Hendrix 48 hsa-mir-125a-3p 0.000130068 — END Ovarian Hendrix 50 hsa-mir-539 3.78E−05 — END Ovarian Hendrix 51 hsa-mir-130b hsa-mir-301a hsa-mir-301b hsa-mir-130a 6.35E−05 — hsa-mir-454 END Ovarian Hendrix 60 hsa-mir-580 1.92E−06 — END Ovarian Hendrix 69 hsa-mir-607 0.000218523 — END Ovarian Hendrix 82 hsa-mir-505 8.54E−06 — FL Lymphoma Alizadeh 4 hsa-mir-1295 1.54E−05 — FL Lymphoma Alizadeh 6 hsa-mir-338 0.000302415 follicular lymphoma (FL) FL Lymphoma Alizadeh 9 hsa-mir-767-3p 0.000117612 — FL Lymphoma Alizadeh 11 hsa-mir-148a hsa-mir-148b hsa-mir-152 0.000429493 — GBM Brain Liang 12 hsa-mir-520g hsa-mir-520h 0.000557506 — GBM Brain Liang 14 hsa-mir-125a-3p 0.000424903 — GBM Brain Liang 15 hsa-mir-144 0.000662353 — GBM Brain Liang 17 hsa-mir-600 0.00022619  — GCT Seminoma Korkola 6 hsa-mir-34b 0.000166029 — GCT Seminoma Korkola 8 hsa-mir-940 1.62E−05 — GCT Seminoma Korkola 14 hsa-mir-1323 hsa-mir-548o 3.12E−05 — GCT Seminoma Korkola 20 hsa-mir-632 4.09E−05 — GCT Seminoma Korkola 21 hsa-mir-548k 4.81E−06 — GCT Seminoma Korkola 25 hsa-mir-105 0.000213709 — GCT Seminoma Korkola 26 hsa-mir-138 0.000182637 — GCT Seminoma Korkola 31 hsa-mir-22 3.97E−06 — GCT Seminoma Korkola 36 hsa-mir-196b hsa-mir-196a 0.000488975 — GCT Seminoma Korkola 37 hsa-mir-106b hsa-mir-17 hsa-mir-106a hsa-mir-93 7.12E−05 — hsa-mir-20b hsa-mir-20a GCT Seminoma Korkola 38 hsa-mir-370 0.000160824 — GCT Seminoma Korkola 39 hsa-mir-769 2.72E−05 — GCT Seminoma Korkola 40 hsa-mir-577 0.000614553 — GCT Seminoma Korkola 42 hsa-mir-149 0.000282927 — GCT Seminoma Korkola 47 hsa-mir-485 0.000532439 — GCT Seminoma Korkola 56 hsa-mir-499-3p 0.000181753 — GCT Seminoma Korkola 62 hsa-mir-548m 7.00E−07 — GCT Seminoma Korkola 66 hsa-mir-532-3p 0.000274953 — GCT Seminoma Korkola 72 hsa-mir-490-3p 8.74E−07 — GCT Seminoma Korkola 74 hsa-let-7f hsa-let-7g hsa-let-7a hsa-let-7b hsa-let-7d 1.23E−06 — hsa-let-7i hsa-mir-98 hsa-let-7 GCT Seminoma Korkola 75 hsa-mir-664 0.000114433 — GCT Seminoma Korkola 76 hsa-mir-220b 5.80E−05 — GCT Seminoma Korkola 80 hsa-mir-623 8.85E−05 — GCT Seminoma Korkola 87 hsa-mir-1179 4.11E−05 — GCT Seminoma Korkola 88 hsa-mir-129 7.94E−05 — GCT Seminoma Korkola 89 hsa-mir-568 0.00034329  — GCT Seminoma Korkola 90 hsa-mir-362 3.27E−06 — GCT Seminoma Korkola 93 hsa-mir-193a 0.000207726 — GCT Seminoma Korkola 95 hsa-mir-1283 3.81E−07 — GCT Seminoma Korkola 98 hsa-mir-224 0.000173618 — GCT Seminoma Korkola 100 hsa-mir-486-3p 0.000207588 — GCT Seminoma Korkola 102 hsa-mir-125b hsa-mir-125a 5.68E−06 — GCT Seminoma Korkola 105 hsa-mir-34a hsa-mir-34c hsa-mir-449a hsa-mir-449b 0.000332836 — GCT Seminoma Korkola 107 hsa-mir-199b-3p hsa-mir-199a-3p 0.000212588 cancer GCT Seminoma Korkola 108 hsa-mir-570 0.000279799 — GCT Seminoma Korkola 109 hsa-mir-548p 5.74E−06 — GCT Seminoma Korkola 110 hsa-mir-18a hsa-mir-18b 2.70E−05 — GCT Seminoma Korkola 112 hsa-mir-590-3p 5.49E−06 — GL Brain Bredel 0 hsa-mir-1208 9.31E−05 — GL Brain Bredel 9 hsa-mir-549 0.000116643 — GL Brain Bredel 11 hsa-mir-542-3p 0.000201348 — GL Brain Bredel 12 hsa-mir-384 0.000466337 — GL Brain Bredel 15 hsa-mir-654-3p 6.04E−07 — GL Brain Bredel 20 hsa-mir-487b 0.000468745 — GL Brain Bredel 21 hsa-mir-633 6.38E−05 — GL Brain Bredel 24 hsa-mir-1245 0.000261253 — GL Brain Bredel 25 hsa-mir-338 0.000377267 — GL Brain Bredel 33 hsa-mir-625 0.000450263 — GL Brain Bredel 36 hsa-mir-661 0.00010024  — GL Brain Bredel 37 hsa-mir-544 0.000666316 — GL Brain Bredel 39 hsa-mir-363 0.000215653 — GL Brain Bredel 40 hsa-mir-526b 0.000108823 — GL Brain Bredel 41 hsa-mir-484 0.000147486 — GL Brain Bredel 46 hsa-mir-154 0.000413209 — GL Brain Bredel 54 hsa-mir-582-3p 5.64E−05 — GL Brain Bredel 57 hsa-mir-769-3p hsa-mir-450b-3p 5.61E−05 — GL Brain Bredel 59 hsa-mir-125a-3p 2.04E−06 — GL Brain Bredel 60 hsa-mir-513a 0.000188295 — GL Brain Bredel 61 hsa-mir-572 5.05E−06 — GL Brain Bredel 64 hsa-mir-220b 9.88E−05 — GL Brain Bredel 65 hsa-mir-532 0.000243031 — GL Brain Bredel 71 hsa-mir-651 0.000504986 — GL Brain Bredel 75 hsa-mir-889 0.000677584 — GL Brain Rickman 1 hsa-mir-493 3.61E−05 — GL Brain Rickman 4 hsa-mir-302f 3.04E−05 — GL Brain Rickman 9 hsa-mir-1207 0.000100819 — GL Brain Rickman 11 hsa-mir-653 8.21E−05 — GL Brain Rickman 13 hsa-mir-486-3p 0.000165893 — GL Brain Rickman 14 hsa-mir-149 0.000224784 glioblastoma multiforme (GBM) GL Brain Rickman 21 hsa-mir-624 8.28E−05 — GL Brain Rickman 22 hsa-mir-542-3p 5.93E−05 — GL Brain Rickman 23 hsa-mir-490 1.28E−05 — GL Brain Rickman 29 hsa-mir-544 3.71E−06 — GL Brain Rickman 31 hsa-let-7e hsa-let-7f hsa-let-7g hsa-let-7a hsa-let-7b 1.86E−05 — hsa-let-7d hsa-let-7i hsa-mir-98 hsa-let-7 GL Brain Rickman 34 hsa-mir-125a-3p 5.67E−05 — GLB Brain Sun 1 hsa-mir-767 9.57E−05 — GLB Brain Sun 2 hsa-mir-577 0.000325921 — GLB Brain Sun 8 hsa-mir-140-3p 6.49E−07 — GLB Brain Sun 10 hsa-mir-588 2.76E−05 — GLB Brain Sun 12 hsa-mir-924 0.000279414 — GLB Brain Sun 14 hsa-mir-1299 0.0006165  — GLB Brain Sun 15 hsa-mir-582-3p 6.42E−06 — GLB Brain Sun 17 hsa-mir-621 4.22E−05 — GLB Brain Sun 18 hsa-mir-655 2.74E−05 — GLB Brain Sun 20 hsa-mir-556-3p 1.56E−05 — GLB Brain Sun 21 hsa-mir-188 0.000650779 — GLB Brain Sun 24 hsa-mir-381 hsa-mir-300 6.92E−05 — GLB Brain Sun 27 hsa-mir-590-3p 0.000472328 — GLB Brain Sun 28 hsa-mir-369-3p 5.05E−05 — GLB Brain Sun 31 hsa-mir-936 1.07E−05 — GLB Brain Sun 40 hsa-mir-1274a 0.000402526 — GLB Brain Sun 41 hsa-mir-760 7.71E−09 — GLB Brain Sun 43 hsa-mir-331 5.34E−05 — GLB Brain Sun 50 hsa-mir-664 6.69E−05 — GLB Brain Sun 51 hsa-mir-28-3p 0.000446009 — GLB Brain Sun 54 hsa-mir-548m 5.72E−06 — GLB Brain Sun 62 hsa-mir-216a 0.000157554 — GLB Brain Sun 67 hsa-mir-544 4.07E−07 — GLB Brain Sun 68 hsa-mir-888 7.93E−05 — GLB Brain Sun 69 hsa-mir-1288 0.000168213 — GLB Brain Sun 71 hsa-mir-1182 0.000395608 — GLB Brain Sun 72 hsa-mir-571 6.09E−05 — GLB Brain Sun 76 hsa-mir-561 3.82E−05 — HSCC Head-Neck Chung 1 hsa-mir-767 9.70E−05 — HSCC Head-Neck Chung 2 hsa-mir-148a hsa-mir-148b hsa-mir-152 0.000575605 head and neck squamous cell carcinoma (HNSCC)|Oral Squamous Cell Carcinoma (OSCC) HSCC Head-Neck Chung 7 hsa-mir-487a 4.23E−05 — HSCC Head-Neck Chung 10 hsa-mir-1226 0.000450182 — HSCC Head-Neck Cromer 3 hsa-mir-496 2.71E−05 — HSCC Head-Neck Cromer 11 hsa-mir-129 4.13E−05 — HSCC Head-Neck Cromer 12 hsa-mir-1297 hsa-mir-26a hsa-mir-26b 3.36E−05 Oral Squamous Cell Carcinoma (OSCC) HSCC Head-Neck Cromer 13 hsa-mir-875-3p 1.98E−05 — HSCC Head-Neck Cromer 18 hsa-mir-214 0.000212009 head and neck squamous cell carcinoma (HNSCC) HSCC Head-Neck Cromer 20 hsa-mir-543 0.000173579 — HSCC Head-Neck Cromer 22 hsa-mir-218 0.000659831 — HSCC Head-Neck Cromer 23 hsa-mir-380 0.000341454 — HSCC Head-Neck Cromer 25 hsa-mir-1264 7.12E−05 — HSCC Head-Neck Cromer 26 hsa-mir-199a hsa-mir-199b 0.000146104 cancer|Oral Squamous Cell Carcinoma (OSCC)|Oral Squamous Cell Carcinoma (OSCC)|Oral Squamous Cell Carcinoma (OSCC) IDC Breast Radvanyi 4 hsa-mir-661 0.00019994  breast cancer IDC Breast Radvanyi 5 hsa-mir-1274a 9.35E−05 — IDC Breast Radvanyi 6 hsa-mir-652 4.44E−06 — IDC Breast Radvanyi 8 hsa-mir-1273 1.23E−05 — IDC Breast Radvanyi 14 hsa-mir-556 0.000534734 — IDC Breast Radvanyi 15 hsa-mir-182 2.40E−05 breast cancer IDC Breast Radvanyi 16 hsa-mir-9 0.000460178 breast cancer|breast cancer|breast cancer IDC Breast Radvanyi 21 hsa-mir-493 0.000515054 — IDC Breast Radvanyi 22 hsa-mir-1274a 0.000321613 — IDC Breast Radvanyi 34 hsa-mir-532 6.62E−05 — IDC Breast Radvanyi 35 hsa-mir-488 0.000481039 — IDC Breast Radvanyi 41 hsa-mir-361-3p 5.52E−05 — IDC Breast Radvanyi 44 hsa-mir-548a-3p 0.000104312 — IDC Breast Radvanyi 47 hsa-mir-760 0.000124285 — IDC Breast Radvanyi 48 hsa-mir-630 0.000196602 — IDC Breast Radvanyi 51 hsa-mir-5481 0.000143163 — IDC Breast Radvanyi 54 hsa-mir-1277 0.000645264 — IDC Breast Radvanyi 56 hsa-mir-216b 0.00013594  — IDC Breast Radvanyi 60 hsa-mir-923 4.22E−05 — ILC Breast Radvanyi 4 hsa-mir-122 1.22E−06 — ILC Breast Radvanyi 5 hsa-mir-501 0.000523698 — ILC Breast Radvanyi 19 hsa-mir-663b 3.73E−05 — ILC Breast Radvanyi 22 hsa-mir-508-3p 0.000193266 — MCA Breast Radvanyi 7 hsa-mir-595 0.000118204 — MCA Breast Radvanyi 12 hsa-mir-489 0.000319697 — MCA Breast Radvanyi 21 hsa-mir-626 0.000107826 — ME Melanoma Hoek 0 hsa-mir-34b 9.82E−05 malignant melanoma ME Melanoma Hoek 3 hsa-mir-1308 9.97E−05 — ME Melanoma Hoek 6 hsa-mir-410 6.65E−05 — ME Melanoma Hoek 9 hsa-mir-106b hsa-mir-17 hsa-mir-106a hsa-mir-93 0.000626339 malignant melanoma hsa-mir-20b hsa-mir-20a ME Melanoma Hoek 12 hsa-mir-892a 2.65E−05 — ME Melanoma Hoek 15 hsa-mir-217 5.33E−05 — ME Melanoma Hoek 23 hsa-mir-32 0.000286963 — ME Melanoma Hoek 35 hsa-mir-200b hsa-mir-200 4.37E−05 cancer|malignant melanoma ME Melanoma Hoek 39 hsa-mir-212 hsa-mir-132 9.98E−05 — ME Melanoma Hoek 41 hsa-mir-938 4.28E−08 — ME Melanoma Hoek 44 hsa-mir-1299 3.96E−05 — ME Melanoma Hoek 47 hsa-mir-549 5.91E−05 — ME Melanoma Hoek 50 hsa-mir-548c-3p 0.000144326 — ML Melanoma Talantov 0 hsa-mir-603 0.000216878 — ML Melanoma Talantov 3 hsa-mir-181a hsa-mir-181 2.83E−06 malignant melanoma ML Melanoma Talantov 7 hsa-mir-125b hsa-mir-125a 4.64E−05 malignant melanoma ML Melanoma Talantov 9 hsa-mir-151-3p 0.000153257 — ML Melanoma Talantov 10 hsa-mir-623 4.85E−05 — ML Melanoma Talantov 12 hsa-mir-125b hsa-mir-125a 0.000126841 malignant melanoma ML Melanoma Talantov 14 hsa-mir-519a hsa-mir-519c-3p hsa-mir-519b-3p 2.70E−07 — ML Melanoma Talantov 19 hsa-mir-421 0.000150563 — ML Melanoma Talantov 22 hsa-mir-520d hsa-mir-524 3.48E−05 — ML Melanoma Talantov 23 hsa-mir-548p 7.57E−06 — ML Melanoma Talantov 25 hsa-mir-606 0.000376617 — ML Melanoma Talantov 26 hsa-mir-607 5.50E−05 — ML Melanoma Talantov 34 hsa-mir-767-3p 3.81E−06 — MM Myeloma Zhan 1 hsa-mir-519e 0.000195242 — MM Myeloma Zhan 2 hsa-mir-587 0.00038156  — MM Myeloma Zhan 3 hsa-mir-590-3p 2.57E−08 — MM Myeloma Zhan 4 hsa-mir-361-3p 0.00038289  — MM Myeloma Zhan 6 hsa-mir-516b 5.95E−05 — MM Myeloma Zhan 7 hsa-mir-510 0.000138587 — MM Myeloma Zhan 9 hsa-mir-9 0.000100248 — MM Myeloma Zhan 13 hsa-mir-655 7.50E−05 — MM Myeloma Zhan 17 hsa-mir-320 hsa-mir-320a hsa-mir-320b hsa-mir-320d 8.23E−06 — MM Myeloma Zhan 20 hsa-mir-1226 3.53E−05 — MM Myeloma Zhan 21 hsa-mir-183 0.000548746 — MM Myeloma Zhan 22 hsa-mir-1236 0.000330323 — MM Myeloma Zhan 24 hsa-mir-140-3p 4.31E−05 multiple myeloma (MM) MM Myeloma Zhan 25 hsa-mir-188 0.000241687 — MM Myeloma Zhan 29 hsa-mir-760 1.88E−08 — MM Myeloma Zhan 30 hsa-mir-588 0.000131928 — MM Myeloma Zhan 31 hsa-mir-597 0.000240387 — MM Myeloma Zhan 32 hsa-mir-212 hsa-mir-132 0.000138448 — MM Myeloma Zhan 35 hsa-mir-650 0.000432285 — MM Myeloma Zhan 40 hsa-mir-382 0.000167046 — MM Myeloma Zhan 43 hsa-mir-23b hsa-mir-23a 1.74E−05 — MM Myeloma Zhan 45 hsa-mir-595 0.00024781  — MM Myeloma Zhan 46 hsa-mir-425 5.54E−05 — MM Myeloma Zhan 47 hsa-mir-875-3p 0.000422238 — MPC Prostate Dhanasekaran 0 hsa-mir-1323 hsa-mir-548o 6.62E−07 — MPC Prostate Dhanasekaran 7 hsa-mir-330 hsa-mir-326 6.20E−05 prostate cancer MPC Prostate Dhanasekaran 9 hsa-mir-190b hsa-mir-190 2.92E−06 — MPC Prostate Dhanasekaran 12 hsa-mir-139 7.63E−07 — MPC Prostate Dhanasekaran 13 hsa-mir-1257 8.37E−06 — MPC Prostate Dhanasekaran 14 hsa-mir-133b hsa-mir-133a 0.00010216  — MPC Prostate Dhanasekaran 16 hsa-mir-944 7.22E−07 — MPC Prostate Dhanasekaran 19 hsa-mir-661 1.85E−05 — MPC Prostate Dhanasekaran 21 hsa-mir-498 0.000467932 prostate cancer MPC Prostate Dhanasekaran 22 hsa-mir-105 2.03E−05 — MPC Prostate Dhanasekaran 26 hsa-mir-935 0.000148827 — MPC Prostate Dhanasekaran 30 hsa-mir-659 0.000152617 — MPC Prostate Dhanasekaran 34 hsa-mir-544 6.81E−07 — MPC Prostate Dhanasekaran 35 hsa-mir-203 0.000205357 — MPC Prostate Dhanasekaran 44 hsa-mir-1323 hsa-mir-548o 1.10E−06 — MPC Prostate Dhanasekaran 45 hsa-mir-490-3p 1.70E−06 — MPM Mesothelioma Gordon 7 hsa-mir-526b 7.16E−05 — MPM Mesothelioma Gordon 11 hsa-mir-491-3p 3.42E−05 — MPM Mesothelioma Gordon 14 hsa-mir-361-3p 1.00E−04 — MPM Mesothelioma Gordon 16 hsa-mir-548m 3.90E−08 — MPM Mesothelioma Gordon 27 hsa-mir-1301 4.84E−05 — MPM Mesothelioma Gordon 35 hsa-mir-371 0.000204415 — MPM Mesothelioma Gordon 38 hsa-mir-1276 8.53E−06 — MPM Mesothelioma Gordon 41 hsa-mir-519e 0.000107989 — MPM Mesothelioma Gordon 42 hsa-mir-183 0.00048608  — MPM Mesothelioma Gordon 48 hsa-mir-561 0.000418507 — MPM Mesothelioma Gordon 51 hsa-mir-605 6.36E−05 — MPM Mesothelioma Gordon 53 hsa-mir-1182 0.00019028  — MPM Mesothelioma Gordon 56 hsa-mir-595 4.65E−05 Malignant mesothelioma (MM) MPM Mesothelioma Gordon 61 hsa-mir-545 5.77E−05 — MPM Mesothelioma Gordon 62 hsa-mir-1279 0.000304825 — MPM Mesothelioma Gordon 63 hsa-mir-548b hsa-mir-548a hsa-mir-548d hsa-mir-548i 3.47E−06 — hsa-mir-548j hsa-mir-548c hsa-mir-548h MPM Mesothelioma Gordon 65 hsa-mir-590-3p 0.00046845  — MUC Ovarian Hendrix 0 hsa-mir-556-3p 1.09E−05 — MUC Ovarian Hendrix 2 hsa-mir-22 0.00025469  — MUC Ovarian Hendrix 7 hsa-mir-607 0.000283493 — MUC Ovarian Hendrix 8 hsa-mir-1226 4.84E−05 — MUC Ovarian Hendrix 14 hsa-mir-148a hsa-mir-148b hsa-mir-152 8.43E−05 epithelial ovarian cancer (EOC) MUC Ovarian Hendrix 15 hsa-mir-340 1.89E−05 — MUC Ovarian Hendrix 18 hsa-mir-548n 0.000222366 — MUC Ovarian Hendrix 21 hsa-mir-216b 0.000279976 — MUC Ovarian Hendrix 25 hsa-mir-548c-3p 1.02E−05 — MUC Ovarian Hendrix 41 hsa-mir-34a hsa-mir-34c hsa-mir-449a hsa-mir-449b 0.000165758 ovarian cancer (OC)|ovarian cancer (OC) MUC Ovarian Hendrix 44 hsa-mir-217 0.000155736 — MUC Ovarian Hendrix 45 hsa-mir-765 8.97E−05 — MUC Ovarian Hendrix 57 hsa-mir-766 0.000194385 — MUC Ovarian Hendrix 60 hsa-mir-369-3p 0.000117663 — MUC Ovarian Hendrix 61 hsa-mir-940 2.22E−05 — MUC Ovarian Hendrix 63 hsa-mir-184 3.31E−05 epithelial ovarian cancer (EOC) MUC Ovarian Hendrix 67 hsa-mir-1224-3p 0.000283759 — MUC Ovarian Hendrix 68 hsa-mir-606 8.68E−06 — MUC Ovarian Hendrix 71 hsa-mir-361-3p 0.00031521  — MUC Ovarian Hendrix 74 hsa-mir-27a hsa-mir-27b 0.000125726 — MUC Ovarian Hendrix 76 hsa-mir-144 9.98E−05 — OD Brain Bredel 2 hsa-mir-768 2.72E−05 — OD Brain Bredel 3 hsa-mir-615-3p 0.000123587 — OD Brain Bredel 8 hsa-mir-651 0.000193833 — OD Brain Bredel 9 hsa-mir-548e 0.000425304 — OD Brain Bredel 12 hsa-mir-588 9.48E−05 — OD Brain Bredel 18 hsa-mir-1261 0.00060741  — OD Brain Bredel 19 hsa-mir-487a 0.000532445 — OD Brain Bredel 21 hsa-mir-369-3p 6.82E−05 — OD Brain Bredel 24 hsa-mir-193a-3p 0.000341762 — OD Brain Bredel 25 hsa-mir-512-3p 0.000343389 — OD Brain Bredel 33 hsa-mir-1231 4.51E−05 — OD Brain Bredel 41 hsa-mir-1276 5.88E−05 — OD Brain Bredel 43 hsa-mir-412 0.000207539 — OD Brain Bredel 45 hsa-mir-324 0.000220545 — OD Brain Bredel 52 hsa-mir-325 0.000190267 — OD Brain Bredel 56 hsa-mir-126 1.37E−05 — OD Brain Bredel 57 hsa-mir-148b hsa-mir-152 1.28E−05 — ODGL Brain Sun 9 hsa-mir-142-3p 2.46E−05 — ODGL Brain Sun 18 hsa-mir-1274b 4.99E−05 — ODGL Brain Sun 20 hsa-mir-570 1.84E−05 — ODGL Brain Sun 25 hsa-mir-548p 2.43E−05 — ODGL Brain Sun 26 hsa-mir-622 0.000200859 — ODGL Brain Sun 31 hsa-mir-490-3p 0.00051022  — ODGL Brain Sun 33 hsa-mir-335 4.85E−05 — ODGL Brain Sun 36 hsa-mir-361-3p 5.23E−06 — ODGL Brain Sun 39 hsa-mir-218 0.000131483 — ODGL Brain Sun 41 hsa-mir-374b hsa-mir-374a 1.52E−05 — ODGL Brain Sun 44 hsa-mir-1276 0.00049542  — ODGL Brain Sun 50 hsa-mir-548c-3p 3.15E−05 — ODGL Brain Sun 52 hsa-mir-1270 hsa-mir-620 6.91E−05 — ODGL Brain Sun 53 hsa-mir-548m 9.39E−05 — ODGL Brain Sun 58 hsa-mir-181d hsa-mir-181b 2.72E−05 glioma ODGL Brain Sun 60 hsa-mir-556-3p 0.000290266 — ODGL Brain Sun 64 hsa-mir-539 0.00028035  — ODGL Brain Sun 65 hsa-mir-340 3.02E−06 — PPC Prostate Dhanasekaran 0 hsa-mir-558 0.000302978 — PPC Prostate Dhanasekaran 1 hsa-mir-520d hsa-mir-524 0.000129964 — PPC Prostate Dhanasekaran 2 hsa-mir-217 0.000339362 — PPC Prostate Dhanasekaran 3 hsa-mir-624 0.000227035 — PPC Prostate Dhanasekaran 4 hsa-mir-760 0.000111326 — PPC Prostate Dhanasekaran 9 hsa-mir-153 1.70E−06 — PPC Prostate Dhanasekaran 10 hsa-mir-421 0.000113825 — PPC Prostate Dhanasekaran 11 hsa-mir-628-3p 4.46E−05 — PPC Prostate Dhanasekaran 14 hsa-mir-34a hsa-mir-34c hsa-mir-449a hsa-mir-449b 0.000448451 prostate cancer PPC Prostate Dhanasekaran 19 hsa-mir-548e 4.34E−07 — PPC Prostate Dhanasekaran 22 hsa-mir-802 1.01E−05 — PPC Prostate Dhanasekaran 23 hsa-mir-376 8.08E−05 — PPC Prostate Dhanasekaran 27 hsa-mir-654-3p 0.000130064 — PPC Prostate Dhanasekaran 28 hsa-mir-544 1.12E−10 — PPC Prostate Dhanasekaran 41 hsa-mir-18a hsa-mir-18b 1.28E−05 — RCCC Renal Boer 0 hsa-mir-140-3p 0.000185774 — RCCC Renal Boer 3 hsa-mir-217 0.000238884 — RCCC Renal Boer 4 hsa-mir-1262 0.0004252  — RCCC Renal Boer 8 hsa-mir-1206 0.000348303 — RCCC Renal Boer 9 hsa-mir-1256 0.000206072 — RCCC Renal Boer 12 hsa-mir-760 0.000652786 — RCCC Renal Boer 13 hsa-mir-200a hsa-mir-141 6.74E−05 cancer RCCC Renal Boer 14 hsa-mir-590-3p 0.000647061 — RCCC Renal Boer 15 hsa-mir-548k 0.000242163 — RCCC Renal Lenburg 6 hsa-mir-651 0.000604766 — RCCC Renal Lenburg 8 hsa-mir-660 3.63E−05 — SMCL Lung Bhattacharjee 1 hsa-mir-1237 0.00015325  — SMCL Lung Bhattacharjee 2 hsa-mir-1266 0.000383019 — SMCL Lung Bhattacharjee 9 hsa-mir-362-3p hsa-mir-329 0.000160237 — SMCL Lung Bhattacharjee 10 hsa-mir-720 0.000354772 — SMCL Lung Bhattacharjee 15 hsa-mir-216b 0.000194459 — SMCL Lung Bhattacharjee 16 hsa-mir-1274a 0.000233435 — SMCL Lung Bhattacharjee 17 hsa-mir-888 0.000289329 — SMCL Lung Bhattacharjee 18 hsa-mir-624 6.67E−06 — SMCL Lung Bhattacharjee 21 hsa-mir-570 0.000277837 — SMCL Lung Bhattacharjee 22 hsa-mir-548n 0.000215679 — SMCL Lung Bhattacharjee 25 hsa-mir-101 0.000395032 lung cancer|lung cancer SMCL Lung Bhattacharjee 29 hsa-mir-513a-3p 1.00E−05 — SMCL Lung Bhattacharjee 30 hsa-mir-548n 4.80E−06 — SMCL Lung Bhattacharjee 34 hsa-mir-1207 3.88E−05 — SMCL Lung Bhattacharjee 41 hsa-mir-512-3p 0.000567462 — SMCL Lung Bhattacharjee 45 hsa-mir-432 0.000596485 — SMCL Lung Bhattacharjee 46 hsa-mir-499 8.39E−05 — SMCL Lung Bhattacharjee 52 hsa-mir-483-3p 3.55E−05 — SMCL Lung Bhattacharjee 55 hsa-mir-590-3p 0.000205653 — SMCL Lung Bhattacharjee 56 hsa-mir-888 0.00034326  — SQ Lung Bhattacharjee 4 hsa-mir-423 0.000143527 lung cancer SQ Lung Bhattacharjee 15 hsa-mir-96 4.75E−05 non-small cell lung cancer (NSCLC) SQ Lung Bhattacharjee 16 hsa-mir-802 0.000178602 — SQ Lung Bhattacharjee 18 hsa-mir-767 2.17E−06 — SQ Lung Bhattacharjee 19 hsa-mir-423 3.84E−05 lung cancer SQ Lung Bhattacharjee 22 hsa-mir-548n 0.000156966 — SQ Lung Bhattacharjee 28 hsa-mir-616 0.000166731 — SQ Lung Bhattacharjee 32 hsa-mir-532-3p 0.000103573 — SQ Lung Bhattacharjee 33 hsa-mir-339 3.36E−06 lung cancer SQ Lung Bhattacharjee 37 hsa-mir-770 0.000210707 — SQ Lung Bhattacharjee 41 hsa-mir-885-3p 5.21E−05 — SQ Lung Bhattacharjee 42 hsa-mir-637 8.30E−06 — SQ Lung Bhattacharjee 43 hsa-mir-597 4.56E−05 — SQ Lung Bhattacharjee 44 hsa-mir-767 0.000168025 — SQ Lung Bhattacharjee 46 hsa-mir-650 0.0001481  — SQ Lung Bhattacharjee 52 hsa-mir-411 0.000356853 — SRS Ovarian Hendrix 1 hsa-mir-641 5.26E−05 — SRS Ovarian Hendrix 2 hsa-mir-505 8.02E−06 — SRS Ovarian Hendrix 11 hsa-mir-361 1.61E−05 ovarian cancer (OC) SRS Ovarian Hendrix 15 hsa-mir-1293 1.58E−05 — SRS Ovarian Hendrix 22 hsa-mir-624 0.000609064 — SRS Ovarian Hendrix 27 hsa-mir-362 3.10E−05 — SRS Ovarian Hendrix 30 hsa-mir-424 5.59E−07 ovarian cancer (OC) SRS Ovarian Hendrix 41 hsa-mir-650 7.93E−06 — SRS Ovarian Hendrix 45 hsa-mir-146b-3p 0.000287347 — SRS Ovarian Hendrix 52 hsa-mir-626 0.000199193 — SRS Ovarian Hendrix 53 hsa-mir-376b hsa-mir-376a 9.72E−08 epithelial ovarian cancer (EOC) SRS Ovarian Hendrix 54 hsa-mir-448 0.00035465  — SRS Ovarian Hendrix 55 hsa-mir-548l 4.93E−05 — SRS Ovarian Hendrix 57 hsa-mir-561 5.83E−05 — SRS Ovarian Hendrix 60 hsa-mir-188-3p 0.000485917 — SRS Ovarian Hendrix 66 hsa-mir-892b 6.69E−06 — SRS Ovarian Hendrix 69 hsa-mir-330-3p 9.80E−09 — SRS Ovarian Hendrix 70 hsa-mir-641 3.14E−07 — SRS Ovarian Hendrix 72 hsa-mir-1276 2.59E−10 — SRS Ovarian Hendrix 73 hsa-mir-340 3.32E−06 — TU Prostate Lapointe 0 hsa-mir-874 5.58E−05 — TU Prostate Lapointe 1 hsa-mir-1297 hsa-mir-26a hsa-mir-26b 0.000505563 prostate cancer|prostate cancer TU Prostate Lapointe 4 hsa-mir-532-3p 3.70E−07 — TU Prostate Lapointe 9 hsa-mir-208a hsa-mir-208b 1.34E−05 — TU Prostate Lapointe 17 hsa-mir-96 0.000125874 prostate cancer TU Prostate Lapointe 18 hsa-mir-760 6.17E−05 — TU Prostate Lapointe 24 hsa-mir-496 3.93E−06 — TU Prostate Lapointe 31 hsa-mir-631 0.000651307 — TU Prostate Lapointe 33 hsa-mir-802 9.41E−05 — TU Prostate Lapointe 35 hsa-mir-758 1.84E−05 — TU Prostate Lapointe 37 hsa-mir-199b-3p hsa-mir-199a-3p 0.000280073 cancer|prostate cancer TU Prostate Lapointe 38 hsa-mir-1264 0.000492613 — TU Prostate Lapointe 39 hsa-mir-590-3p 1.58E−05 —

    TABLE-US-00006 SUPPLEMENTRY TABLE 6 Uncorrected Dataset Cluster miRNA P-value miR2Disease IDC Breast Radvanyi 9 hsa-mir-661 1.62E−05 breast cancer CA Breast Richardson 16 hsa-mir-18a 3.62E−06 breast cancer IDC Breast Radvanyi 28 hsa-mir-149 2.94E−05 breast cancer ILC Breast Radvanyi 20 hsa-mir-328 0.000540368 breast cancer MCA Breast Radvanyi 18 hsa-mir-663 3.07E−05 breast cancer|breast cancer CA Breast Richardson 27 hsa-mir-663 2.76E−06 breast cancer|breast cancer MCA Breast Radvanyi 2 hsa-mir-204 0.000170357 breast cancer|breast cancer CA Breast Richardson 68 hsa-mir-663 1.21E−06 breast cancer|breast cancer IDC Breast Radvanyi 15 hsa-mir-205 6.43E−06 breast cancer|breast cancer|breast cancer MCA Breast Radvanyi 19 hsa-mir-210 0.00017588  breast cancer|breast cancer|breast cancer B-CLL Leukemia Haslinger 44 hsa-mir-200b 0.000562281 cancer OD Brain Bredel 12 hsa-mir-200a 1.77E−05 cancer MPM Mesothelioma Gordon 31 hsa-mir-127 0.000264768 cancer MPC Prostate Dhanasekaran 0 hsa-mir-200b 4.80E−05 cancer B-CLL Leukemia Haslinger 55 hsa-mir-200b 3.75E−07 cancer CA Renal Higgins 3 hsa-mir-199a-3p 0.000230566 cancer AD Ovarian Welsh 0 hsa-mir-200b 1.65E−06 cancer|epithelial ovarian cancer (EOC)|ovarian cancer (OC)|ovarian cancer (OC) MUC Ovarian Hendrix 49 hsa-mir-200b 3.93E−06 cancer|epithelial ovarian cancer (EOC)|ovarian cancer (OC)|ovarian cancer (OC) SRS Ovarian Hendrix 68 hsa-mir-200b 4.92E−06 cancer|epithelial ovarian cancer (EOC)|ovarian cancer (OC)|ovarian cancer (OC)|serous ovarian cancer ME Melanoma Hoek 35 hsa-mir-200b 1.13E−06 cancer|malignant melanoma B-CLL Leukemia Haslinger 69 hsa-mir-146a 0.000450962 chronic lymphocytic leukemia (CLL) CLL Lymphoma Alizadeh 4 hsa-mir-29b 0.000197019 chronic lymphocytic leukemia (CLL)|chronic lymphocytic leukemia (CLL)|chronic lymphocytic leukemia (CLL) CA Colon Graudens 32 hsa-mir-296 1.18E−06 colorectal cancer CA Colon Graudens 2 hsa-mir-451 1.16E−05 colorectal cancer CA Colon Graudens 37 hsa-mir-32 0.000107611 colorectal cancer CA Colon Graudens 15 hsa-mir-140 0.00034922  colorectal cancer CA Colon Graudens 38 hsa-mir-96 1.79E−05 colorectal cancer|colorectal cancer SRS Ovarian Hendrix 60 hsa-mir-184 0.000490759 epithelial ovarian cancer (EOC) SRS Ovarian Hendrix 64 hsa-mir-377 0.000266561 epithelial ovarian cancer (EOC) END Ovarian Hendrix 66 hsa-mir-101 4.40E−06 epithelial ovarian cancer (EOC) CCC Ovarian Hendrix 20 hsa-mir-495 2.23E−05 epithelial ovarian cancer (EOC) END Ovarian Hendrix 28 hsa-mir-495 1.97E−05 epithelial ovarian cancer (EOC) CCC Ovarian Hendrix 61 hsa-mir-145 0.000153611 epithelial ovarian cancer (EOC)|epithelial ovarian cancer (EOC) END Ovarian Hendrix 49 hsa-mir-145 0.000588653 epithelial ovarian cancer (EOC)|epithelial ovarian cancer (EOC) SRS Ovarian Hendrix 15 hsa-let-7d 0.000397689 epithelial ovarian cancer (EOC)|epithelial ovarian cancer (EOC)|ovarian cancer (OC) END Ovarian Hendrix 37 hsa-mir-125b 0.000475101 epithelial ovarian cancer (EOC)|ovarian cancer (OC) END Ovarian Hendrix 78 hsa-mir-125a 0.000362188 epithelial ovarian cancer (EOC)|ovarian cancer (OC) FL Lymphoma Alizadeh 2 hsa-mir-149 2.16E−05 follicular lymphoma (FL) GBM Brain Liang 7 hsa-mir-323 5.85E−05 glioblastoma multiforme (GBM) GL Brain Bredel 60 hsa-mir-25 9.54E−05 glioblastoma|glioma ODGL Brain Sun 57 hsa-mir-296 9.53E−06 glioma GL Brain Bredel 32 hsa-mir-15a 0.000311239 glioma OD Brain Bredel 14 hsa-mir-296 7.12E−06 glioma AO Brain Bredel 1 hsa-mir-181a 0.000168423 glioma AO Brain Bredel 28 hsa-mir-296 7.75E−06 glioma AC Brain Sun 12 hsa-mir-210 6.54E−05 glioma HSCC Head-Neck Cromer 22 hsa-mir-30b 3.14E−05 head and neck squamous cell carcinoma (HNSCC) RCCC Renal Lenburg 0 hsa-mir-489 2.02E−05 kidney cancer RCCC Renal Boer 7 hsa-mir-106b 0.000251281 kidney cancer SMCL Lung Bhattacharjee 58 hsa-mir-423 0.000179756 lung cancer AD Lung Beer 18 hsa-mir-19a 5.85E−07 lung cancer AO Lung Bhattacharjee 0 hsa-mir-338 1.12E−06 lung cancer SMCL Lung Bhattacharjee 20 hsa-mir-423 7.09E−06 lung cancer AD Lung Stearman 29 hsa-mir-425 3.76E−05 lung cancer SQ Lung Bhattacharjee 4 hsa-mir-214 7.88E−05 lung cancer COID Lung Bhattacharjee 78 hsa-mir-27b 0.000262632 lung cancer AD Lung Bhattacharjee 27 hsa-mir-451 0.000277652 lung cancer COID Lung Bhattacharjee 30 hsa-mir-423 0.000201932 lung cancer COID Lung Bhattacharjee 40 hsa-mir-93 0.000170538 lung cancer SMCL Lung Bhattacharjee 35 hsa-mir-212 0.000352999 lung cancer SMCL Lung Bhattacharjee 45 hsa-mir-125a 0.000506289 lung cancer|lung cancer SQ Lung Bhattacharjee 32 hsa-mir-210 0.000299713 lung cancer|lung cancer AD Lung Beer 31 hsa-mir-29b 1.59E−06 lung cancer|lung cancer COID Lung Bhattacharjee 10 hsa-mir-101 7.34E−07 lung cancer|lung cancer SMCL Lung Bhattacharjee 53 hsa-mir-20a 2.42E−05 lung cancer|lung cancer|lung cancer AD Lung Bhattacharjee 52 hsa-let-7a 0.000427939 lung cancer|lung cancer|lung cancer|lung cancer|lung cancer|lung cancer|non-small cell lung cancer (NSCLC)|non-small cell lung cancer (NSCLC) AD Lung Beer 0 hsa-let-7d 8.49E−05 lung cancer|non-small cell lung cancer (NSCLC) AD Lung Stearman 7 hsa-mir-16 6.72E−05 lung cancer|non-small cell lung cancer (NSCLC) ME Melanoma Hoek 20 hsa-mir-331 0.000508693 malignant melanoma ML Melanoma Talantov 8 hsa-mir-199b 3.48E−05 malignant melanoma ML Melanoma Talantov 27 hsa-mir-96 0.000474947 malignant melanoma MPM Mesothelioma Gordon 59 hsa-mir-423 7.33E−06 Malignant mesothelioma (MM) MPM Mesothelioma Gordon 19 hsa-mir-423 0.000166269 Malignant mesothelioma (MM) SQ Lung Bhattacharjee 49 hsa-mir-34a 0.000184016 non-small cell lung cancer (NSCLC) SRS Ovarian Hendrix 24 hsa-mir-635 0.000119101 ovarian cancer (OC) MUC Ovarian Hendrix 28 hsa-mir-296 8.33E−06 ovarian cancer (OC) AD Ovarian Welsh 25 hsa-mir-572 0.000107609 ovarian cancer (OC) MUC Ovarian Hendrix 30 hsa-mir-635 0.000153945 ovarian cancer (OC) SRS Ovarian Hendrix 83 hsa-mir-637 1.65E−06 ovarian cancer (OC) SRS Ovarian Hendrix 20 hsa-mir-296 0.000493587 ovarian cancer (OC) SRS Ovarian Hendrix 67 hsa-mir-608 6.23E−07 ovarian cancer (OC) MUC Ovarian Hendrix 26 hsa-mir-296 6.09E−05 ovarian cancer (OC) MUC Ovarian Hendrix 48 hsa-mir-608 8.32E−05 ovarian cancer (OC) SRS Ovarian Hendrix 78 hsa-mir-206 0.000254763 ovarian cancer (OC) END Ovarian Hendrix 15 hsa-mir-542-3p 3.11E−05 ovarian cancer (OC) END Ovarian Hendrix 17 hsa-mir-30e 0.000158264 ovarian cancer (OC) AD Ovarian Welsh 4 hsa-mir-424 9.76E−06 ovarian cancer (OC) TU Prostate Lapointe 10 hsa-mir-32 9.82E−06 prostate cancer PPC Prostate Dhanasekaran 34 hsa-mir-149 0.000124363 prostate cancer TU Prostate Lapointe 13 hsa-mir-497 0.000100169 prostate cancer TU Prostate Lapointe 23 hsa-mir-25 0.00024991  prostate cancer TU Prostate Lapointe 19 hsa-mir-296 6.89E−07 prostate cancer MPC Prostate Dhanasekaran 11 hsa-mir-34a 0.000291101 prostate cancer MPC Prostate Dhanasekaran 7 hsa-mir-296 4.29E−06 prostate cancer PPC Prostate Dhanasekaran 17 hsa-mir-34a 0.000201155 prostate cancer PPC Prostate Dhanasekaran 32 hsa-mir-296 1.77E−06 prostate cancer MPC Prostate Dhanasekaran 16 hsa-mir-101 2.53E−06 prostate cancer|prostate cancer|prostate cancer RCCC Renal Boer 0 hsa-mir-494 4.34E−06 renal clear cell carcinoma GCT Seminoma Korkola 87 hsa-mir-371 8.90E−07 testicular germ cell tumor GCT Seminoma Korkola 101 hsa-mir-372 3.92E−07 testicular germ cell tumor|testicular germ cell tumor MUC Ovarian Hendrix 21 hsa-mir-520d 3.10E−05 — MUC Ovarian Hendrix 19 hsa-mir-548g 1.81E−05 — AD Lung Bhattacharjee 55 hsa-mir-1286 5.31E−05 — GL Brain Bredel 22 hsa-mir-657 0.000105499 — GLB Brain Sun 36 hsa-mir-423 2.03E−07 — COID Lung Bhattacharjee 58 hsa-mir-23a 0.000106957 — AD Ovarian Welsh 1 hsa-mir-548d-3p 6.48E−07 — CA Colon Graudens 24 hsa-mir-522 1.62E−06 — SMCL Lung Bhattacharjee 18 hsa-mir-513 4.74E−05 — ME Melanoma Hoek 26 hsa-mir-577 0.00015717  — B-CLL Leukemia Haslinger 38 hsa-mir-548g 8.13E−05 — SMCL Lung Bhattacharjee 6 hsa-mir-1201 0.000464237 — AD Lung Beer 38 hsa-mir-933 2.88E−05 — BPH Prostate Dhanasekaran 18 hsa-mir-513a-3p 1.76E−05 — GCT Seminoma Korkola 89 hsa-mir-1257 5.15E−06 — MPM Mesothelioma Gordon 64 hsa-mir-655 6.39E−06 — GCT Seminoma Korkola 28 hsa-mir-146a 0.000148787 — HSCC Head-Neck Chung 9 hsa-mir-708 0.000132985 — GLB Brain Sun 72 hsa-mir-1294 6.36E−05 — B-CLL Leukemia Haslinger 36 hsa-mir-587 0.000191245 — CA Breast Sorlie 20 hsa-mir-590-3p 3.24E−07 — GCT Seminoma Korkola 112 hsa-mir-548n 7.79E−15 — AD Lung Stearman 13 hsa-mir-23a 5.53E−05 — COID Lung Bhattacharjee 51 hsa-mir-656 3.16E−09 — CA Breast Richardson 28 hsa-mir-765 0.000106308 — AD Lung Bhattacharjee 30 hsa-mir-548c-3p 9.03E−14 — ILC Breast Radvanyi 2 hsa-mir-423-3p 0.000203181 — MPM Mesotheiioma Gordon 29 hsa-mir-1265 0.000313362 — ML Melanoma Talantov 26 hsa-mir-664 2.21E−05 — CA Bladder Dyrskjot 39 hsa-mir-486-3p 0.000214753 — GLB Brain Sun 18 hsa-mir-498 6.03E−09 — PPC Prostate Dhanasekaran 29 hsa-mir-509-3p 0.000145973 — CA Breast Richardson 33 hsa-mir-1251 0.000477316 — CA Breast Richardson 3 hsa-mir-578 8.26E−06 — GCT Seminoma Korkola 37 hsa-mir-519a 1.33E−09 — GL Brain Rickman 22 hsa-mir-374b 4.01E−07 — CA Bladder Dyrskjot 1 hsa-mir-637 6.92E−11 — SRS Ovarian Hendrix 16 hsa-mir-548k 1.82E−06 — AD Lung Bhattacharjee 81 hsa-mir-516b 1.26E−05 — FL Lymphoma Alizadeh 0 hsa-mir-92a 1.01E−07 — MPC Prostate Dhanasekaran 29 hsa-mir-663 6.65E−05 — AD Lung Beer 43 hsa-mir-1275 0.000105766 — CA Bladder Dyrskjot 3 hsa-mir-1308 8.73E−07 — SRS Ovarian Hendrix 10 hsa-mir-34c-3p 4.69E−07 — MPC Prostate Dhanasekaran 26 hsa-mir-548j 0.000385787 — CCC Ovarian Hendrix 44 hsa-mir-548m 1.07E−05 — CA Bladder Dyrskjot 53 hsa-mir-944 1.08E−06 — GCT Seminoma Korkola 31 hsa-mir-891a 0.000233697 — COID Lung Bhattacharjee 25 hsa-mir-361 6.17E−05 — MM Myeloma Zhan 50 hsa-mir-28 7.86E−05 — AD Ovarian Welsh 10 hsa-mir-921 6.01E−06 — SMCL Lung Bhattacharjee 46 hsa-mir-891b 0.000383258 — RCCC Renal Boer 1 hsa-mir-371 0.000530325 — PPC Prostate Dhanasekaran 1 hsa-mir-561 1.34E−05 — GCT Seminoma Korkola 80 hsa-mir-573 3.65E−06 — CCC Ovarian Hendrix 14 hsa-mir-1276 1.06E−05 — GL Brain Bredel 17 hsa-mir-877 0.000266194 — END Ovarian Hendrix 32 hsa-mir-548d-3p 6.61E−11 — COID Lung Bhattacharjee 48 hsa-mir-886 0.00018962  — CA Bladder Dyrskjot 23 hsa-mir-211 8.07E−07 — MPM Mesothelioma Gordon 56 hsa-mir-590-3p 9.29E−06 — BPH Prostate Dhanasekaran 7 hsa-mir-380 4.14E−06 — SRS Ovarian Hendrix 75 hsa-mir-372 1.97E−08 — COID Lung Bhattacharjee 5 hsa-mir-548o 2.41E−05 — GL Brain Bredel 78 hsa-mir-424 0.000301626 — BPH Prostate Dhanasekaran 9 hsa-mir-574 0.000269626 — FL Lymphoma Alizadeh 11 hsa-mir-614 0.000529183 — GCT Seminoma Korkola 63 hsa-mir-889 3.04E−06 — END Ovarian Hendrix 77 hsa-mir-590-3p 4.95E−09 — DLBCL Lymphoma Alizadeh 3 hsa-mir-744 1.82E−05 — MPM Mesothelioma Gordon 52 hsa-mir-606 8.63E−08 — SQ Lung Bhattacharjee 30 hsa-mir-1233 0.000445813 — CA Bladder Dyrskjot 25 hsa-mir-1204 2.52E−05 — GCT Seminoma Korkola 73 hsa-mir-675 0.000190634 — MUC Ovarian Hendrix 55 hsa-mir-486-3p 1.46E−05 — SMCL Lung Bhattacharjee 2 hsa-mir-940 1.23E−05 — GCT Seminoma Korkola 3 hsa-mir-296 2.40E−07 — CCC Ovarian Hendrix 37 hsa-mir-1237 0.000328049 — AC Brain Sun 46 hsa-mir-590-3p 9.16E−09 — PPC Prostate Dhanasekaran 28 hsa-mir-944 3.15E−12 — HSCC Head-Neck Cromer 20 hsa-mir-567 4.16E−07 — MUC Ovarian Hendrix 23 hsa-mir-486-3p 2.97E−07 — GLB Brain Sun 73 hsa-mir-187 5.00E−06 — ME Melanoma Hoek 16 hsa-mir-631 0.000590804 — COID Lung Bhattacharjee 64 hsa-mir-661 6.54E−07 — COID Lung Bhattacharjee 75 hsa-mir-874 7.97E−05 — CA Breast Richardson 58 hsa-mir-889 6.58E−05 — CA Breast Richardson 53 hsa-mir-486 3.46E−05 — GCT Seminoma Korkola 85 hsa-mir-181 0.000115903 — ODGL Brain Sun 11 hsa-mir-219-1-3p 0.000228608 — CA Breast Richardson 65 hsa-mir-1254 4.75E−05 — AD Ovarian Welsh 21 hsa-mir-606 8.71E−05 — MPC Prostate Dhanasekaran 48 hsa-mir-625 0.000326443 — SMCL Lung Bhattacharjee 11 hsa-mir-1321 0.000308592 — HSCC Head-Neck Chung 10 hsa-mir-607 3.02E−05 — GBM Brain Liang 13 hsa-mir-1278 0.000208092 — GL Brain Rickman 23 hsa-mir-935 9.26E−06 — AC Brain Sun 28 hsa-mir-539 4.32E−05 — GLB Brain Sun 1 hsa-mir-324 3.16E−05 — DLBCL Lymphoma Alizadeh 7 hsa-mir-1301 0.000173451 — SRS Ovarian Hendrix 21 hsa-mir-944 4.95E−07 — ODGL Brain Sun 63 hsa-mir-410 0.000134983 — AD Lung Beer 15 hsa-mir-586 0.000587308 — MUC Ovarian Hendrix 72 hsa-mir-409 0.00020328  — CA Breast Richardson 51 hsa-mir-633 1.08E−05 — GCT Seminoma Korkola 83 hsa-mir-1254 0.000197016 — CCC Ovarian Hendrix 43 hsa-mir-1247 2.38E−07 — B-CLL Leukemia Haslinger 31 hsa-mir-1321 0.000537156 — MM Myeloma Zhan 39 hsa-mir-647 0.000511455 — CA Breast Richardson 25 hsa-mir-1252 0.000611632 — BPH Prostate Dhanasekaran 20 hsa-mir-1224-3p 9.26E−06 — GCT Seminoma Korkola 72 hsa-mir-760 4.02E−05 — SRS Ovarian Hendrix 55 hsa-mir-338 1.40E−06 — IDC Breast Radvanyi 7 hsa-mir-450b-3p 0.000288602 — MUC Ovarian Hendrix 34 hsa-mir-1291 0.000213025 — MUC Ovarian Hendrix 56 hsa-mir-548c-3p 2.02E−10 — OD Brain Bredel 57 hsa-mir-423 2.25E−06 — TU Prostate Lapointe 0 hsa-mir-219-2-3p 7.92E−05 — SMCL Lung Bhattacharjee 28 hsa-mir-744 9.04E−05 — TU Prostate Lapointe 17 hsa-mir-219 0.000106525 — END Ovarian Hendrix 20 hsa-mir-663b 9.77E−05 — GCT Seminoma Korkola 96 hsa-mir-29a 8.00E−05 — B-CLL Leukemia Haslinger 53 hsa-mir-513a-3p 1.99E−05 — CCC Ovarian Hendrix 7 hsa-mir-382 0.000180447 — CA Bladder Dyrskjot 9 hsa-mir-548c-3p 1.50E−14 — CA Bladder Dyrskjot 65 hsa-mir-888 1.94E−05 — END Ovarian Hendrix 76 hsa-mir-888 8.60E−06 — GLB Brain Sun 54 hsa-mir-921 2.44E−08 — GCT Seminoma Korkola 40 hsa-mir-548n 0.000170776 — GLB Brain Sun 0 hsa-mir-637 3.57E−05 — RCCC Renal Boer 13 hsa-mir-1279 1.39E−06 — MUC Ovarian Hendrix 76 hsa-mir-573 7.31E−08 — AD Lung Bhattacharjee 22 hsa-mir-619 0.000399164 — END Ovarian Hendrix 9 hsa-mir-486-3p 2.89E−06 — AD Lung Bhattacharjee 75 hsa-mir-637 2.83E−06 — ME Melanoma Hoek 0 hsa-mir-582 4.80E−05 — MUC Ovarian Hendrix 73 hsa-mir-361-3p 4.66E−10 — CA Breast Richardson 61 hsa-mir-1271 0.000378242 — AC Brain Sun 17 hsa-mir-617 0.000105979 — TU Prostate Lapointe 34 hsa-mir-886 0.000346316 — MUC Ovarian Hendrix 13 hsa-mir-1280 0.000351255 — DLBCL Lymphoma Alizadeh 2 hsa-mir-660 0.000277854 — GLB Brain Sun 31 hsa-mir-501-3p 0.000148691 — MUC Ovarian Hendrix 15 hsa-mir-944 7.48E−12 — GCT Seminoma Korkola 102 hsa-mir-34a 9.24E−05 — HSCC Head-Neck Cromer 10 hsa-mir-520a 0.000571699 — ODGL Brain Sun 0 hsa-mir-637 0.000354231 — MPM Mesothelioma Gordon 27 hsa-mir-128 0.000309287 — GL Brain Bredel 57 hsa-mir-193a-3p 0.000180522 — CA Bladder Dyrskjot 42 hsa-mir-362 9.61E−05 — MPC Prostate Dhanasekaran 22 hsa-mir-382 5.46E−06 — ILC Breast Radvanyi 4 hsa-mir-548a-3p 0.000525313 — CA Bladder Dyrskjot 13 hsa-mir-548c-3p 6.28E−07 — AD Lung Bhattacharjee 35 hsa-mir-133a 1.57E−05 — MUC Ovarian Hendrix 27 hsa-mir-423 0.000146228 — MUC Ovarian Hendrix 18 hsa-mir-606 5.19E−05 — GCT Seminoma Korkola 25 hsa-mir-607 1.21E−08 — MPM Mesothelioma Gordon 51 hsa-mir-376a 0.000159942 — GLB Brain Sun 20 hsa-mir-331 3.35E−05 — AD Lung Bhattacharjee 44 hsa-mir-1284 6.45E−06 — GCT Seminoma Korkola 21 hsa-mir-520f 2.04E−08 — SRS Ovarian Hendrix 66 hsa-mir-548c-3p 8.80E−09 — CA Breast Richardson 59 hsa-mir-608 1.67E−05 — AD Lung Bhattacharjee 10 hsa-mir-1321 6.35E−06 — DLBCL Lymphoma Alizadeh 6 hsa-mir-483-3p 0.000603016 — END Ovarian Hendrix 38 hsa-mir-944 3.49E−09 — CCC Ovarian Hendrix 51 hsa-mir-499-3p 0.000444328 — MPC Prostate Dhanasekaran 17 hsa-mir-1266 3.02E−06 — END Ovarian Hendrix 34 hsa-mir-1826 3.03E−05 — RCCC Renal Lenburg 8 hsa-mir-889 6.31E−06 — END Ovarian Hendrix 11 hsa-mir-940 9.79E−05 — GL Brain Bredel 72 hsa-mir-760 0.000219694 — AD Lung Bhattacharjee 17 hsa-mir-491 4.14E−05 — COID Lung Bhattacharjee 52 hsa-mir-154 0.000584551 — GCT Seminoma Korkola 75 hsa-mir-708 3.60E−05 — ML Melanoma Talantov 23 hsa-mir-1259 2.73E−07 — ME Melanoma Hoek 9 hsa-mir-494 4.40E−05 — ML Melanoma Talantov 14 hsa-mir-548c-3p 4.53E−14 — AD Lung Stearman 36 hsa-mir-1269 1.34E−05 — ILC Breast Radvanyi 24 hsa-mir-340 0.000381565 — ODGL Brain Sun 47 hsa-mir-1204 1.23E−05 — CCC Ovarian Hendrix 9 hsa-mir-1291 5.79E−05 — B-CLL Leukemia Haslinger 68 hsa-mir-520g 0.000419055 — GLB Brain Sun 68 hsa-mir-299 0.000302475 — BPH Prostate Dhanasekaran 13 hsa-mir-922 3.12E−05 — OD Brain Bredel 3 hsa-mir-195 0.00018012  — MUC Ovarian Hendrix 3 hsa-mir-1205 0.000111582 — SQ Lung Bhattacharjee 15 hsa-mir-569 3.55E−07 — AD Lung Beer 6 hsa-mir-548c-3p 1.66E−05 — CA Renal Higgins 17 hsa-mir-663 3.57E−07 — CCC Ovarian Hendrix 10 hsa-mir-615 2.06E−05 — SRS Ovarian Hendrix 30 hsa-mir-582 2.24E−07 — CA Renal Higgins 13 hsa-mir-663 4.59E−05 — CA Breast Richardson 50 hsa-mir-380 1.42E−05 — CA Bladder Dyrskjot 71 hsa-mir-662 0.000356281 — SMCL Lung Bhattacharjee 5 hsa-mir-1321 0.000105392 — SRS Ovarian Hendrix 17 hsa-mir-193b 0.000508028 — RCCC Renal Boer 9 hsa-mir-502-3p 0.000234434 — SQ Lung Bhattacharjee 19 hsa-mir-647 9.65E−06 — END Ovarian Hendrix 31 hsa-mir-1253 0.000484638 — MPM Mesothelioma Gordon 36 hsa-mir-487a 3.08E−06 — CA Breast Richardson 15 hsa-mir-494 1.40E−06 — MM Myeloma Zhan 4 hsa-mir-185 6.20E−06 — CA Colon Graudens 40 hsa-mir-369-3p 4.96E−06 — CA Breast Richardson 18 hsa-mir-135a 3.32E−06 — ILC Breast Radvanyi 10 hsa-mir-548c-3p 0.000529657 — MUC Ovarian Hendrix 8 hsa-mir-486-3p 2.29E−05 — GL Brain Rickman 32 hsa-mir-889 0.000162082 — AD Lung Bhattacharjee 34 hsa-mir-296 1.13E−05 — GCT Seminoma Korkola 52 hsa-mir-508 1.79E−05 — GLB Brain Sun 3 hsa-mir-320a 0.000334921 — CA Breast Richardson 46 hsa-mir-607 8.39E−07 — MPM Mesothelioma Gordon 15 hsa-mir-1229 0.000201101 — CA Colon Graudens 31 hsa-mir-548o 4.28E−06 — PPC Prostate Dhanasekaran 2 hsa-mir-641 0.000166542 — END Ovarian Hendrix 65 hsa-mir-331-3p 0.000108718 — SRS Ovarian Hendrix 59 hsa-mir-656 0.000449134 — MM Myeloma Zhan 34 hsa-mir-147b 0.000550706 — CA Bladder Dyrskjot 22 hsa-mir-663 9.26E−07 — CCC Ovarian Hendrix 13 hsa-mir-500 0.000239274 — ME Melanoma Hoek 15 hsa-mir-1292 0.000135688 — CA Bladder Dyrskjot 10 hsa-mir-597 7.62E−05 — AC Brain Sun 31 hsa-mir-1280 5.32E−05 — GCT Seminoma Korkola 16 hsa-mir-1183 4.57E−05 — SMCL Lung Bhattacharjee 47 hsa-mir-302e 0.000548428 — GL Brain Bredel 47 hsa-mir-1236 0.000346282 — GCT Seminoma Korkola 32 hsa-mir-608 0.000145012 — CCC Ovarian Hendrix 0 hsa-mir-194 6.00E−06 — MUC Ovarian Hendrix 65 hsa-mir-380 2.65E−05 — GLB Brain Sun 59 hsa-mir-1252 3.13E−05 — AC Brain Sun 18 hsa-mir-1305 0.000570172 — GCT Seminoma Korkola 69 hsa-mir-296 0.000405059 — END Ovarian Hendrix 43 hsa-mir-590-3p 1.16E−05 — MM Myeloma Zhan 26 hsa-mir-1321 5.01E−06 — MPM Mesothelioma Gordon 2 hsa-mir-1207 0.000107599 — HSCC Head-Neck Chung 4 hsa-mir-548l 5.28E−05 — CA Bladder Dyrskjot 36 hsa-mir-548c-3p 5.69E−13 — AD Lung Bhattacharjee 19 hsa-mir-1247 0.000325418 — CA Bladder Dyrskjot 16 hsa-mir-939 9.40E−07 — SRS Ovarian Hendrix 11 hsa-mir-590-3p 0.000114458 — MUC Ovarian Hendrix 66 hsa-mir-889 0.000101883 — AD Lung Stearman 6 hsa-mir-380 9.21E−05 — BPH Prostate Dhanasekaran 4 hsa-mir-1278 0.000153909 — CA Breast Richardson 29 hsa-mir-1302 5.51E−05 — AD Ovarian Welsh 11 hsa-mir-1225 0.000597055 — COID Lung Bhattacharjee 20 hsa-mir-615-3p 0.000534605 — MPM Mesothelioma Gordon 54 hsa-mir-548h 0.000153669 — GCT Seminoma Korkola 34 hsa-mir-136 9.69E−10 — CA Colon Graudens 5 hsa-mir-548h 0.000122758 — CA Breast Richardson 45 hsa-mir-513a-3p 7.34E−10 — TU Prostate Lapointe 11 hsa-mir-152 1.30E−05 — OD Brain Bredel 47 hsa-mir-219-1-3p 0.000375423 — SMCL Lung Bhattacharjee 50 hsa-mir-664 5.89E−14 — MPM Mesothelioma Gordon 33 hsa-mir-768 0.000220019 — MPC Prostate Dhanasekaran 8 hsa-mir-219-1-3p 0.000270967 — CCC Ovarian Hendrix 33 hsa-mir-770 0.000104352 — GLB Brain Sun 49 hsa-mir-340 5.60E−05 — END Ovarian Hendrix 48 hsa-mir-1304 1.80E−05 — CA Bladder Dyrskjot 72 hsa-mir-296 1.00E−10 — AD Lung Beer 42 hsa-mir-651 0.000137443 — MM Myeloma Zhan 15 hsa-mir-922 2.66E−05 — SRS Ovarian Hendrix 26 hsa-mir-325 9.20E−05 — CA Colon Graudens 14 hsa-mir-886 0.00042904  — MPC Prostate Dhanasekaran 36 hsa-mir-942 4.86E−05 — GL Brain Bredel 66 hsa-mir-27a 0.000131506 — ILC Breast Radvanyi 26 hsa-mir-486-3p 1.82E−06 — SRS Ovarian Hendrix 35 hsa-mir-220a 6.69E−06 — PPC Prostate Dhanasekaran 27 hsa-mir-1279 2.59E−05 — COID Lung Bhattacharjee 11 hsa-mir-513b 1.56E−05 — MUC Ovarian Hendrix 50 hsa-mir-889 4.39E−06 — ME Melanoma Hoek 12 hsa-mir-935 8.40E−06 — SQ Lung Bhattacharjee 24 hsa-mir-889 9.55E−06 — ODGL Brain Sun 20 hsa-mir-548e 2.16E−06 — ODGL Brain Sun 25 hsa-mir-548l 3.21E−08 — ODGL Brain Sun 2 hsa-mir-939 1.10E−11 — COID Lung Bhattacharjee 69 hsa-mir-765 0.000160635 — END Ovarian Hendrix 3 hsa-mir-1279 0.000316131 — END Ovarian Hendrix 61 hsa-mir-342 4.60E−05 — SQ Lung Bhattacharjee 45 hsa-mir-654 9.06E−05 — MPC Prostate Dhanasekaran 34 hsa-mir-1279 3.65E−08 — AD Lung Bhattacharjee 12 hsa-mir-590-3p 0.000565441 — AD Pancreas Logsdon 18 hsa-mir-939 9.11E−05 — B-CLL Leukemia Haslinger 41 hsa-mir-483 0.000426084 — ML Melanoma Talantov 36 hsa-mir-663 7.10E−09 — GCT Seminoma Korkola 106 hsa-mir-513b 0.000341133 — SQ Lung Bhattacharjee 50 hsa-mir-607 6.96E−05 — GCT Seminoma Korkola 111 hsa-mir-296 0.000178861 — SQ Lung Bhattacharjee 27 hsa-mir-940 8.78E−05 — MM Myeloma Zhan 47 hsa-mir-662 7.87E−05 — END Ovarian Hendrix 40 hsa-mir-944 8.92E−07 — IDC Breast Radvanyi 4 hsa-mir-608 0.000192757 — SRS Ovarian Hendrix 6 hsa-mir-185 0.000528828 — GL Brain Rickman 9 hsa-mir-1207 4.71E−06 — GL Brain Bredel 0 hsa-mir-548i 0.000241782 — B-CLL Leukemia Haslinger 65 hsa-mir-1247 0.000436296 — AD Lung Bhattacharjee 6 hsa-mir-602 0.000348747 — SRS Ovarian Hendrix 32 hsa-mir-331-3p 1.37E−05 — END Ovarian Hendrix 72 hsa-mir-548d-3p 8.31E−06 — CA Bladder Dyrskjot 40 hsa-mir-548d-3p 0.000121089 — ME Melanoma Hoek 39 hsa-mir-944 3.30E−06 — GCT Seminoma Korkola 39 hsa-mir-639 9.46E−05 — GCT Seminoma Korkola 98 hsa-mir-203 5.28E−08 — SRS Ovarian Hendrix 48 hsa-mir-1278 7.16E−05 — END Ovarian Hendrix 60 hsa-mir-570 2.61E−09 — GL Brain Rickman 15 hsa-mir-487a 0.000117352 — AD Lung Beer 53 hsa-mir-548d-3p 1.04E−06 — MUC Ovarian Hendrix 63 hsa-mir-1247 6.75E−05 — COID Lung Bhattacharjee 23 hsa-mir-1228 0.000222914 — SMCL Lung Bhattacharjee 61 hsa-mir-331-3p 3.73E−06 — MUC Ovarian Hendrix 0 hsa-mir-410 5.36E−08 — COID Lung Bhattacharjee 12 hsa-mir-494 8.53E−06 — ME Melanoma Hoek 41 hsa-mir-451 0.000175004 — MUC Ovarian Hendrix 69 hsa-mir-579 5.8SE−05 — MUC Ovarian Hendrix 60 hsa-mir-574-3p 3.68E−05 — END Ovarian Hendrix 50 hsa-mir-548c-3p 2.18E−10 — PPC Prostate Dhanasekaran 33 hsa-mir-548e 9.16E−06 — GLB Brain Sun 25 hsa-mir-600 6.06E−06 — MM Myeloma Zhan 11 hsa-mir-658 0.00033622  — IDC Breast Radvanyi 41 hsa-mir-939 6.12E−06 — CA Breast Richardson 37 hsa-mir-1289 0.000579338 — SRS Ovarian Hendrix 79 hsa-mir-944 5.09E−05 — AD Pancreas Logsdon 12 hsa-mir-933 0.000128551 — SRS Ovarian Hendrix 9 hsa-mir-1297 0.000150331 — RCCC Renal Lenburg 9 hsa-mir-1238 0.000381766 — AC Brain Sun 37 hsa-mir-569 0.000257268 — MPC Prostate Dhanasekaran 12 hsa-mir-340 5.22E−11 — IDC Breast Radvanyi 14 hsa-mir-323-3p 0.000103181 — PPC Prostate Dhanasekaran 37 hsa-mir-553 0.000599727 — CA Bladder Dyrskjot 15 hsa-mir-1323 2.35E−07 — END Ovarian Hendrix 82 hsa-mir-320b 1.53E−05 — HSCC Head-Neck Chung 7 hsa-mir-573 4.02E−05 — MM Myeloma Zhan 13 hsa-mir-770 3.53E−05 — B-CLL Leukemia Haslinger 35 hsa-mir-486-3p 5.55E−09 — CA Bladder Dyrskjot 54 hsa-mir-491 6.59E−06 — SRS Ovarian Hendrix 61 hsa-mir-1224-3p 0.000355435 — AO Brain Bredel 22 hsa-mir-663 3.41E−06 — IDC Breast Radvanyi 56 hsa-mir-576 0.000441942 — B-CLL Leukemia Haslinger 21 hsa-mir-548c-3p 1.93E−14 — MUC Ovarian Hendrix 7 hsa-mir-590-3p 1.46E−10 — B-CLL Leukemia Haslinger 52 hsa-mir-302a 0.000364911 — GL Brain Rickman 34 hsa-mir-1274a 4.31E−05 — ML Melanoma Talantov 9 hsa-mir-493 0.000491063 — MPC Prostate Dhanasekaran 40 hsa-mir-220 9.77E−06 — CA Breast Sorlie 23 hsa-mir-423 0.000106954 — AD Lung Bhattacharjee 82 hsa-mir-647 0.000162289 — AD Ovarian Welsh 9 hsa-mir-524 3.48E−05 — GL Brain Rickman 27 hsa-mir-182 7.81E−05 — CA Bladder Dyrskjot 80 hsa-mir-616 7.12E−05 — FL Lymphoma Alizadeh 5 hsa-mir-581 0.000111755 — TU Prostate Lapointe 32 hsa-mir-608 6.56E−07 — SRS Ovarian Hendrix 73 hsa-mir-340 1.71E−08 — B-CLL Leukemia Haslinger 51 hsa-mir-448 0.000227269 — CA Bladder Dyrskjot 24 hsa-mir-663 2.33E−05 — ODGL Brain Sun 7 hsa-mir-548k 0.000124326 — ODGL Brain Sun 41 hsa-mir-26b 5.24E−05 — AD Lung Beer 28 hsa-mir-1245 0.000608297 — CA Breast Sorlie 17 hsa-mir-640 0.000265634 — SMCL Lung Bhattacharjee 7 hsa-mir-615 0.00025691  — CA Bladder Dyrskjot 29 hsa-mir-548c-3p 1.79E−06 — CA Breast Richardson 2 hsa-mir-590-3p 8.86E−05 — PPC Prostate Dhanasekaran 20 hsa-mir-1207 0.000191478 — SRS Ovarian Hendrix 57 hsa-mir-548d-3p 5.11E−06 — OD Brain Bredel 54 hsa-mir-1275 7.51E−05 — MUC Ovarian Hendrix 68 hsa-mir-1305 1.03E−05 — MPM Mesothelioma Gordon 32 hsa-mir-541 0.000130877 — AD Lung Stearman 27 hsa-mir-300 5.00E−06 — RCCC Renal Boer 15 hsa-mir-300 0.000145597 — MPC Prostate Dhanasekaran 2 hsa-mir-548c-3p 2.35E−06 — CA Bladder Dyrskjot 64 hsa-mir-590-3p 1.06E−25 — AC Brain Sun 3 hsa-mir-1205 2.84E−05 — CA Breast Richardson 54 hsa-mir-361-3p 2.22E−12 — B-CLL Leukemia Haslinger 28 hsa-mir-376 0.000318075 — B-CLL Leukemia Haslinger 54 hsa-mir-1321 3.27E−05 — SMCL Lung Bhattacharjee 31 hsa-mir-513a-3p 1.28E−08 — AD Lung Bhattacharjee 41 hsa-mir-296 6.11E−05 — AD Lung Stearman 32 hsa-mir-588 0.00048611  — GCT Seminoma Korkola 0 hsa-mir-1251 3.03E−05 — AD Lung Bhattacharjee 14 hsa-mir-938 0.000464954 — GCT Seminoma Korkola 108 hsa-mir-590 0.000599626 — ODGL Brain Sun 65 hsa-mir-495 3.90E−08 — B-CLL Leukemia Haslinger 16 hsa-mir-1285 8.55E−08 — AD Ovarian Welsh 31 hsa-mir-548c-3p 1.17E−06 — GLB Brain Sun 37 hsa-mir-1256 0.000394523 — IDC Breast Radvanyi 18 hsa-mir-1207-3p 0.000171598 — AD Lung Bhattacharjee 8 hsa-mir-1324 2.99E−05 — IDC Breast Radvanyi 65 hsa-mir-802 3.44E−17 — CCC Ovarian Hendrix 56 hsa-mir-587 0.000320898 — SQ Lung Bhattacharjee 23 hsa-mir-586 0.000126996 — GLB Brain Sun 27 hsa-mir-889 4.14E−06 — CA Bladder Dyrskjot 32 hsa-mir-1270 1.86E−06 — CA Bladder Dyrskjot 58 hsa-mir-328 0.000324179 — COID Lung Bhattacharjee 74 hsa-mir-513a-3p 1.46E−07 — B-CLL Leukemia Haslinger 43 hsa-mir-483-3p 6.86E−05 — HSCC Head-Neck Cromer 26 hsa-mir-885 1.44E−05 — GLB Brain Sun 35 hsa-mir-922 0.000367795 — ML Melanoma Talantov 10 hsa-mir-1180 0.000368404 — AD Ovarian Welsh 8 hsa-mir-1260 3.07E−05 — CCC Ovarian Hendrix 58 hsa-mir-586 3.47E−08 — AC Brain Sun 50 hsa-mir-483-3p 0.000171585 — BPH Prostate Dhanasekaran 1 hsa-mir-579 0.00020642  — ODGL Brain Sun 27 hsa-mir-136 0.000113816 — COID Lung Bhattacharjee 43 hsa-mir-658 7.50E−05 — GL Brain Rickman 17 hsa-mir-146b-3p 0.000528862 — CA Breast Richardson 19 hsa-mir-586 0.000229107 — SRS Ovarian Hendrix 4 hsa-mir-1250 1.87E−05 — CA Breast Sorlie 16 hsa-mir-579 3.19E−05 — HSCC Head-Neck Cromer 18 hsa-mir-615-3p 0.000195451 — MPM Mesothelioma Gordon 62 hsa-mir-708 0.000307699 — ML Melanoma Talantov 40 hsa-mir-296 4.56E−06 — MUC Ovarian Hendrix 54 hsa-mir-921 1.11E−05 — CA Bladder Dyrskjot 12 hsa-mir-1244 0.000260354 — TU Prostate Lapointe 33 hsa-mir-548c-3p 1.75E−07 — MPC Prostate Dhanasekaran 27 hsa-mir-1271 0.000148676 — CA Renal Higgins 4 hsa-mir-34b 2.00E−07 — END Ovarian Hendrix 4 hsa-mir-612 0.00056313  — MPM Mesothelioma Gordon 44 hsa-mir-338 8.55E−05 — B-CLL Leukemia Haslinger 17 hsa-mir-590-3p 1.39E−13 — CA Bladder Dyrskjot 48 hsa-mir-520b 0.000475673 — CCC Ovarian Hendrix 46 hsa-mir-340 7.26E−09 — HSCC Head-Neck Chung 1 hsa-mir-450b 3.20E−05 — COID Lung Bhattacharjee 6 hsa-mir-874 4.15E−05 — CA Bladder Dyrskjot 37 hsa-mir-548n 9.02E−08 — CA Bladder Dyrskjot 14 hsa-mir-944 3.76E−05 — SRS Ovarian Hendrix 44 hsa-mir-584 0.000486209 — ODGL Brain Sun 22 hsa-mir-423 7.28E−09 — AD Lung Bhattacharjee 46 hsa-mir-548c-3p 3.06E−06 — AD Lung Stearman 19 hsa-mir-370 2.85E−06 — GL Brain Rickman 8 hsa-mir-634 0.000383758 — SRS Ovarian Hendrix 3 hsa-mir-146b-3p 0.000175563 — CA Bladder Dyrskjot 56 hsa-mir-1238 2.31E−06 — IDC Breast Radvanyi 43 hsa-mir-1224 5.00E−05 — ILC Breast Radvanyi 19 hsa-mir-338-3p 0.000520796 — SMCL Lung Bhattacharjee 22 hsa-mir-548n 9.61E−05 — SRS Ovarian Hendrix 53 hsa-mir-576 3.87E−05 — CA Bladder Dyrskjot 6 hsa-mir-939 1.03E−05 — AD Lung Bhattacharjee 7 hsa-mir-1305 2.19E−11 — AD Lung Beer 8 hsa-mir-637 3.07E−05 — CA Bladder Dyrskjot 49 hsa-mir-432 8.72E−06 — BPH Prostate Dhanasekaran 15 hsa-mir-1259 9.49E−05 — OD Brain Bredel 21 hsa-mir-548c-3p 0.000226458 — TU Prostate Lapointe 38 hsa-mir-633 9.66E−05 — AD Ovarian Welsh 5 hsa-mir-455 9.98E−05 — GL Brain Rickman 29 hsa-mir-568 3.23E−08 — IDC Breast Radvanyi 2 hsa-mir-513a-3p 3.57E−05 — GL Brain Bredel 31 hsa-mir-615-3p 2.09E−05 — AC Brain Sun 8 hsa-mir-196a 0.000415339 — SRS Ovarian Hendrix 19 hsa-mir-135a 6.95E−06 — ML Melanoma Talantov 29 hsa-mir-1257 0.00027138  — AD Lung Stearman 0 hsa-mir-369-3p 2.30E−06 — CA Bladder Dyrskjot 47 hsa-mir-197 7.26E−07 — COID Lung Bhattacharjee 72 hsa-mir-548n 9.38E−06 — AD Ovarian Welsh 30 hsa-mir-1204 0.000439516 — GLB Brain Sun 58 hsa-mir-1287 0.000103913 — SQ Lung Bhattacharjee 43 hsa-mir-635 0.000124798 — AC Brain Sun 34 hsa-mir-223 2.97E−05 — AD Lung Stearman 18 hsa-mir-1257 0.000397558 — GCT Seminoma Korkola 68 hsa-mir-1182 6.01E−05 — COID Lung Bhattacharjee 45 hsa-mir-615 5.02E−06 — GL Brain Bredel 25 hsa-mir-513b 0.000419468 — ML Melanoma Talantov 19 hsa-mir-548c-3p 7.99E−10 — MUC Ovarian Hendrix 32 hsa-mir-490-3p 9.00E−05 — BPH Prostate Dhanasekaran 8 hsa-mir-1246 7.27E−06 — B-CLL Leukemia Haslinger 5 hsa-mir-622 6.58E−05 — PPC Prostate Dhanasekaran 39 hsa-mir-139-3p 0.000138404 — AD Pancreas Logsdon 1 hsa-mir-1247 1.53E−05 — CCC Ovarian Hendrix 2 hsa-mir-423 1.48E−06 — SQ Lung Bhattacharjee 40 hsa-mir-339-3p 0.000101826 — GL Brain Bredel 30 hsa-mir-342 3.60E−07 — MCA Breast Radvanyi 7 hsa-mir-324-3p 3.23E−06 — B-CLL Leukemia Haslinger 0 hsa-mir-409 0.000378892 — TU Prostate Lapointe 25 hsa-mir-130a 3.79E−05 — MPM Mesothelioma Gordon 65 hsa-mir-548n 2.71E−09 — SRS Ovarian Hendrix 43 hsa-mir-299-3p 5.54E−06 — B-CLL Leukemia Haslinger 56 hsa-mir-548b-3p 0.000133402 — MM Myeloma Zhan 14 hsa-mir-548l 0.000147742 — AD Lung Beer 14 hsa-mir-542 0.000318042 — SRS Ovarian Hendrix 80 hsa-mir-324 4.34E−05 — OD Brain Bredel 40 hsa-mir-216b 9.25E−05 — END Ovarian Hendrix 35 hsa-mir-1276 0.000277741 — CCC Ovarian Hendrix 12 hsa-mir-508-3p 3.68E−05 — MM Myeloma Zhan 43 hsa-mir-124 2.37E−05 — END Ovarian Hendrix 16 hsa-mir-588 3.82E−06 — MPM Mesothelioma Gordon 13 hsa-mir-585 4.85E−05 — HSCC Head-Neck Cromer 12 hsa-mir-513a-3p 2.34E−05 — COID Lung Bhattacharjee 24 hsa-mir-342 7.55E−05 — IDC Breast Radvanyi 27 hsa-mir-323 0.000569837 — ODGL Brain Sun 50 hsa-mir-217 0.000123791 — AD Lung Bhattacharjee 24 hsa-mir-608 1.22E−06 — GCT Seminoma Korkola 71 hsa-mir-361-3p 4.76E−07 — AD Lung Beer 12 hsa-mir-378 0.000355275 — SQ Lung Bhattacharjee 29 hsa-mir-486-3p 8.12E−06 — MM Myeloma Zhan 35 hsa-mir-129 0.000200071 — CCC Ovarian Hendrix 4 hsa-mir-194 1.45E−05 — AD Ovarian Welsh 16 hsa-mir-548l 0.000120211 — AD Lung Beer 34 hsa-mir-646 0.00025737  — GBM Brain Liang 2 hsa-mir-548c-3p 0.000318973 — OD Brain Bredel 30 hsa-mir-1306 0.000381469 — END Ovarian Hendrix 75 hsa-mir-489 0.000119996 — AD Lung Beer 10 hsa-mir-600 1.44E−06 — MPC Prostate Dhanasekaran 18 hsa-mir-1263 1.48E−05 — PPC Prostate Dhanasekaran 35 hsa-mir-663b 0.000144273 — MPM Mesothelioma Gordon 61 hsa-mir-1287 2.33E−05 — AO Brain Bredel 32 hsa-mir-564 5.13E−06 — CA Bladder Dyrskjot 75 hsa-mir-513 7.29E−05 — CA Colon Graudens 28 hsa-mir-508 0.000295908 — ML Melanoma Talantov 3 hsa-mir-548n 4.08E−06 — GCT Seminoma Korkola 30 hsa-mir-588 0.000275648 — PPC Prostate Dhanasekaran 31 hsa-mir-515-3p 0.000197799 — ODGL Brain Sun 49 hsa-mir-423 1.08E−05 — CA Bladder Dyrskjot 62 hsa-mir-637 1.36E−05 — CA Bladder Dyrskjot 46 hsa-mir-342 3.59E−08 — HSCC Head-Neck Cromer 19 hsa-mir-548l 1.75E−07 — AD Lung Beer 40 hsa-mir-561 7.29E−05 — CCC Ovarian Hendrix 18 hsa-mir-326 7.22E−06 — MUC Ovarian Hendrix 61 hsa-mir-410 4.05E−06 — AC Brain Sun 19 hsa-mir-485 1.27E−05 — COID Lung Bhattacharjee 14 hsa-mir-557 0.000108663 — CA Bladder Dyrskjot 38 hsa-mir-1281 0.000191838 — CLL Lymphoma Alizadeh 0 hsa-mir-548j 0.000459332 — SMCL Lung Bhattacharjee 29 hsa-mir-548c-3p 9.77E−08 — SQ Lung Bhattacharjee 21 hsa-mir-455 0.000112719 — MM Myeloma Zhan 9 hsa-mir-185 7.75E−05 — HSCC Head-Neck Cromer 8 hsa-mir-142 1.01E−07 — CA Bladder Dyrskjot 18 hsa-mir-1291 2.29E−05 — PPC Prostate Dhanasekaran 4 hsa-mir-939 9.40E−06 — DLBCL Lymphoma Alizadeh 1 hsa-mir-16 8.17E−05 — PPC Prostate Dhanasekaran 14 hsa-mir-1202 0.000130297 — SRS Ovarian Hendrix 1 hsa-mir-409-3p 9.82E−05 — COID Lung Bhattacharjee 66 hsa-mir-507 9.71E−06 — MM Myeloma Zhan 10 hsa-mir-1305 6.75E−06 — ME Melanoma Hoek 37 hsa-mir-380 1.50E−07 — OOGL Brain Sun 62 hsa-mir-1294 6.05E−05 — CA Bladder Dyrskjot 21 hsa-mir-944 2.51E−06 — COID Lung Bhattacharjee 0 hsa-mir-518d 2.57E−05 — CA Colon Graudens 6 hsa-mir-658 8.78E−05 — GCT Seminoma Korkola 88 hsa-mir-338 3.32E−08 — AD Lung Stearman 35 hsa-mir-668 0.000306085 — B-CLL Leukemia Haslinger 45 hsa-mir-889 9.32E−06 — HSCC Head-Neck Cramer 27 hsa-mir-615 5.07E−06 — GCT Seminoma Korkola 66 hsa-mir-1291 1.92E−05 — AD Lung Beer 22 hsa-mir-525 0.000251267 — AO Brain Bredel 0 hsa-mir-635 9.52E−05 — MUC Ovarian Hendrix 75 hsa-mir-512-3p 1.28E−06 — SQ Lung Bhattacharjee 14 hsa-mir-486-3p 5.23E−06 — MPC Prostate Dhanasekaran 23 hsa-mir-302f 0.000532122 — IDC Breast Radvanyi 46 hsa-mir-675 0.000483213 — CA Bladder Dyrskjot 35 hsa-mir-486-3p 0.000273385 — CCC Ovarian Hendrix 45 hsa-mir-1250 2.30E−05 — ODGL Brain Sun 1 hsa-mir-647 1.96E−05 — CA Breast Richardson 62 hsa-mir-622 0.000211265 — OD Brain Bredel 15 hsa-mir-765 0.000578248 — B-CLL Leukemia Haslinger 8 hsa-mir-939 9.79E−06 — CA Breast Sorlie 8 hsa-mir-1255a 3.53E−05 — GLB Brain Sun 50 hsa-mir-548c-3p 2.66E−06 — GCT Seminoma Korkola 82 hsa-mir-576 0.000285312 — END Ovarian Hendrix 23 hsa-mir-22 6.91E−05 — OD Brain Bredel 62 hsa-let-7f 0.000585924 — MM Myeloma Zhan 36 hsa-mir-1273 0.000403952 — CA Colon Graudens 0 hsa-mir-138 6.29E−05 — GCT Seminoma Korkola 29 hsa-mir-548c-3p 3.74E−08 — B-CLL Leukemia Haslinger 15 hsa-mir-654-3p 2.08E−05 — ILC Breast Radvanyi 6 hsa-mir-579 8.72E−06 — MUC Ovarian Hendrix 12 hsa-mir-658 0.000144043 — TU Prostate Lapointe 1 hsa-mir-590-3p 3.15E−07 — HSCC Head-Neck Cromer 25 hsa-mir-495 1.15E−06 — CLL Lymphoma Alizadeh 1 hsa-mir-1204 3.50E−05 — AO Brain Bredel 18 hsa-mir-497 0.000198786 — TU Prostate Lapointe 31 hsa-mir-339-3p 5.79E−05 — CA Breast Richardson 55 hsa-mir-544 1.29E−06 — HSCC Head-Neck Chung 8 hsa-mir-410 4.98E−05 — IDC Breast Radvanyi 26 hsa-mir-886 0.000540903 — SRS Ovarian Hendrix 28 hsa-mir-186 1.67E−06 — BPH Prostate Dhanasekaran 11 hsa-mir-369-3p 0.000568201 — SQ Lung Bhattacharjee 7 hsa-mir-765 5.75E−05 — ML Melanoma Talantov 7 hsa-mir-296 6.02E−07 — ME Melanoma Hoek 33 hsa-mir-1265 0.000457688 — GCT Seminoma Korkola 50 hsa-mir-376 2.33E−06 — END Ovarian Hendrix 22 hsa-mir-944 1.00E−05 — MUC Ovarian Hendrix 22 hsa-mir-1293 5.80E−05 — AC Brain Sun 7 hsa-mir-548l 1.20E−07 — AC Brain Sun 16 hsa-mir-655 1.38E−06 — HSCC Head-Neck Chung 5 hsa-mir-1202 0.000335288 — PPC Prostate Dhanasekaran 23 hsa-mir-518a 7.91E−05 — GLB Brain Sun 55 hsa-mir-32 0.000230839 — MUC Ovarian Hendrix 31 hsa-mir-342 2.61E−05 — END Ovarian Hendrix 69 hsa-mir-186 6.88E−06 — ODGL Brain Sun 48 hsa-mir-384 0.000253138 — TU Prostate Lapointe 4 hsa-mir-185 0.000290147 — AD Lung Beer 5 hsa-mir-1292 9.07E−05 — PPC Prostate Dhanasekaran 10 hsa-mir-889 8.82E−06 — CA Bladder Dyrskjot 82 hsa-mir-656 1.37E−06 — AD Lung Bhattacharjee 4 hsa-mir-1321 3.68E−07 — IDC Breast Radvanyi 24 hsa-mir-1291 4.64E−05 — B-CLL Leukemia Haslinger 37 hsa-mir-323-3p 6.95E−10 — MPM Mesothelioma Gordon 17 hsa-mir-1296 0.000161062 — AC Brain Sun 6 hsa-mir-139 0.000306314 — GLB Brain Sun 4 hsa-mir-542 4.28E−07 — ODGL Brain Sun 30 hsa-mir-483 0.000412141 — ODGL Brain Sun 60 hsa-let-7d 0.000130896 — COID Lung Bhattacharjee 80 hsa-mir-548l 6.43E−13 — ODGL Brain Sun 32 hsa-mir-153 2.80E−06 — GCT Seminoma Korkola 17 hsa-mir-615 2.79E−07 — B-CLL Leukemia Haslinger 25 hsa-mir-548c-3p 7.95E−06 — AC Brain Sun 22 hsa-mir-185 3.82E−05 — BPH Prostate Dhanasekaran 12 hsa-mir-939 8.80E−05 — CA Bladder Dyrskjot 63 hsa-mir-372 1.77E−07 — B-CLL Leukemia Haslinger 13 hsa-mir-892b 0.000527397 — GL Brain Bredel 46 hsa-mir-548l 1.16E−05 — MPM Mesothelioma Gordon 41 hsa-mir-381 0.000443852 — ODGL Brain Sun 10 hsa-mir-208a 0.000136267 — MPC Prostate Dhanasekaran 44 hsa-mir-576-3p 9.02E−05 — CA Colon Graudens 10 hsa-mir-1225 0.000267591 — PPC Prostate Dhanasekaran 38 hsa-mir-607 2.03E−05 — GLB Brain Sun 29 hsa-mir-1275 9.58E−09 — SQ Lung Bhattacharjee 13 hsa-mir-296 2.05E−08 — END Ovarian Hendrix 62 hsa-mir-571 6.37E−05 — AC Brain Sun 23 hsa-mir-1207-3p 0.000547066 — CA Bladder Dyrskjot 7 hsa-mir-361 0.000142136 — ODGL Brain Sun 39 hsa-mir-1283 3.48E−05 — CLL Lymphoma Alizadeh 13 hsa-mir-423 0.000349636 — CCC Ovarian Hendrix 25 hsa-mir-744 0.000564266 — SQ Lung Bhattacharjee 18 hsa-mir-410 2.12E−05 — TU Prostate Lapointe 39 hsa-mir-656 3.01E−07 — GL Brain Bredel 79 hsa-mir-340 2.04E−18 — PPC Prostate Dhanasekaran 41 hsa-mir-369-3p 3.86E−06 — MUC Ovarian Hendrix 20 hsa-mir-640 0.000235199 — PPC Prostate Dhanasekaran 9 hsa-mir-661 1.10E−05 — MUC Ovarian Hendrix 52 hsa-mir-541 0.00046487  — GBM Brain Liang 5 hsa-mir-939 0.00056305  — FL Lymphoma Alizadeh 7 hsa-mir-1282 0.000138941 — AD Lung Bhattacharjee 47 hsa-mir-1245 2.22E−06 — B-CLL Leukemia Haslinger 62 hsa-mir-548c-3p 8.00E−10 — CCC Ovarian Hendrix 60 hsa-mir-1305 3.35E−05 — B-CLL Leukemia Haslinger 29 hsa-mir-1270 0.000171591 — HSCC Head-Neck Chung 3 hsa-mir-1286 9.91E−06 — MM Myeloma Zhan 16 hsa-mir-134 8.11E−05 — GCT Seminoma Korkola 60 hsa-mir-551a 6.95E−05 — COID Lung Bhattacharjee 21 hsa-mir-944 8.19E−10 — IDC Breast Radvanyi 8 hsa-mir-631 0.000564379 — CA Bladder Dyrskjot 70 hsa-mir-502 2.29E−05 — CA Breast Richardson 23 hsa-mir-544 0.000153218 — AO Brain Bredel 38 hsa-mir-1282 0.000299426 — ODGL Brain Sun 53 hsa-mir-548n 5.14E−09 — MUC Ovarian Hendrix 24 hsa-mir-361-3p 0.000241059 — GLB Brain Sun 5 hsa-mir-515 0.000373578 — MPM Mesothelioma Gordon 24 hsa-mir-361-3p 0.000101355 — AD Ovarian Welsh 17 hsa-mir-1321 1.68E−05 — HSCC Head-Neck Chung 6 hsa-mir-590-3p 1.29E−05 — MM Myeloma Zhan 3 hsa-mir-548c-3p 2.85E−14 — CA Colon Graudens 17 hsa-mir-597 7.44E−05 — B-CLL Leukemia Haslinger 46 hsa-mir-1247 0.000479165 — CA Bladder Dyrskjot 79 hsa-mir-508-3p 0.00023817  — CCC Ovarian Hendrix 47 hsa-mir-122 7.65E−06 — RCCC Renal Lenburg 3 hsa-mir-888 0.00018121  — AD Ovarian Welsh 29 hsa-mir-1225-3p 0.000495059 — ML Melanoma Talantov 18 hsa-mir-513a-3p 1.30E−08 — MPM Mesothelioma Gordon 38 hsa-mir-145 8.33E−05 — CA Breast Sorlie 19 hsa-mir-129 8.52E−06 — CA Renal Higgins 10 hsa-mir-483-3p 0.000138161 — MPM Mesothelioma Gordon 42 hsa-mir-539 3.04E−05 — ME Melanoma Hoek 25 hsa-mir-26a 2.11E−05 — GL Brain Rickman 4 hsa-mir-361 3.19E−05 — GLB Brain Sun 28 hsa-mir-323-3p 4.84E−05 — GL Brain Rickman 10 hsa-mir-648 3.05E−06 — AD Lung Beer 33 hsa-mir-379 6.19E−05 — MPC Prostate Dhanasekaran 5 hsa-mir-211 0.000182393 — TU Prostate Lapointe 29 hsa-mir-522 2.97E−11 — END Ovarian Hendrix 13 hsa-mir-23a 6.11E−07 — CA Bladder Dyrskjot 31 hsa-mir-656 1.34E−05 — AD Lung Stearman 25 hsa-mir-519a 8.68E−05 — GL Brain Bredel 77 hsa-mir-744 1.44E−05 — COID Lung Bhattacharjee 16 hsa-mir-376a 0.000262419 — MPM Mesothelioma Gordon 1 hsa-mir-1224 2.48E−05 — RCCC Renal Lenburg 10 hsa-mir-1273 0.000324812 — ILC Breast Radvanyi 3 hsa-mir-383 0.000402616 — ML Melanoma Talantov 12 hsa-mir-324-3p 6.94E−05 — MCA Breast Radvanyi 17 hsa-mir-219 1.57E−07 — B-CLL Leukemia Haslinger 66 hsa-mir-939 3.01E−10 — GL Brain Bredel 27 hsa-mir-181 0.000133619 — B-CLL Leukemia Haslinger 10 hsa-mir-454 1.68E−05 — OD Brain Bredel 52 hsa-mir-411 0.000409711 — MPM Mesothelioma Gordon 16 hsa-mir-590-3p 9.51E−17 — CA Bladder Dyrskjot 45 hsa-mir-608 4.60E−07 — CA Bladder Dyrskjot 59 hsa-mir-374a 8.54E−06 — SQ Lung Bhattacharjee 22 hsa-mir-607 1.71E−06 — MPC Prostate Dhanasekaran 14 hsa-mir-502 0.000300801 — B-CLL Leukemia Haslinger 49 hsa-mir-1227 0.00034531  — B-CLL Leukemia Haslinger 9 hsa-mir-1245 0.000110184 — PPC Prostate Dhanasekaran 19 hsa-mir-144 3.07E−06 — GBM Brain Liang 1 hsa-mir-423 7.21E−07 — CA Bladder Dyrskjot 67 hsa-mir-630 0.000123706 — MPC Prostate Dhanasekaran 35 hsa-mir-203 1.86E−06 — GLB Brain Sun 8 hsa-mir-501 3.42E−06 — MM Myeloma Zhan 0 hsa-mir-1207 3.32E−06 — AC Brain Sun 4 hsa-mir-371-3p 8.52E−05 — CCC Ovarian Hendrix 27 hsa-mir-556 0.000258408 — SQ Lung Bhattacharjee 5 hsa-mir-595 5.58E−05 — COID Lung Bhattacharjee 60 hsa-mir-516a-3p 5.94E−05 — MPC Prostate Dhanasekaran 42 hsa-mir-331 2.97E−05 — COID Lung Bhattacharjee 8 hsa-mir-340 7.24E−07 — MUC Ovarian Hendrix 25 hsa-mir-582 3.54E−06 — AD Lung Bhattacharjee 28 hsa-mir-548a-3p 5.98E−06 — AD Lung Bhattacharjee 64 hsa-mir-765 2.85E−06 — MPM Mesothelioma Gordon 28 hsa-mir-590-3p 0.000287627 — MPM Mesothelioma Gordon 63 hsa-mir-548c-3p 2.51E−09 — B-CLL Leukemia Haslinger 23 hsa-mir-548o 0.000480335 — MPM Mesothelioma Gordon 6 hsa-mir-192 0.000120946 — TU Prostate Lapointe 24 hsa-mir-548g 1.22E−06 — OD Brain Bredel 7 hsa-mir-23b 2.03E−06 — COID Lung Bhattacharjee 68 hsa-mir-1272 0.00018659  — PDC Pancreas Ishikawa 2 hsa-mir-448 8.41E−05 — GLB Brain Sun 62 hsa-mir-495 0.000134046 — MM Myeloma Zhan 40 hsa-mir-612 0.000176116 — CA Breast Richardson 17 hsa-mir-423 2.85E−12 — ML Melanoma Talantov 28 hsa-mir-1207 1.66E−07 — CA Renal Higgins 20 hsa-mir-1261 0.000372363 — ML Melanoma Talantov 4 hsa-mir-146b-3p 0.000174949 — ODGL Brain Sun 17 hsa-mir-548l 1.04E−07 — GLB Brain Sun 10 hsa-mir-409 6.77E−05 — MM Myeloma Zhan 33 hsa-mir-507 4.95E−06 — TU Prostate Lapointe 21 hsa-mir-608 2.73E−06 — RCCC Renal Lenburg 2 hsa-mir-499 4.25E−06 — ME Melanoma Hoek 6 hsa-mir-186 1.22E−05 — SMCL Lung Bhattacharjee 52 hsa-mir-939 8.05E−05 — GLB Brain Sun 63 hsa-mir-939 0.000398514 — MM Myeloma Zhan 32 hsa-mir-379 0.000580382 — AD Lung Stearman 33 hsa-mir-1293 1.13E−05 — CCC Ovarian Hendrix 42 hsa-mir-590-3p 4.63E−06 — GL Brain Bredel 39 hsa-mir-572 0.000290782 — HSCC Head-Neck Chung 2 hsa-mir-944 0.00016901  — ODGL Brain Sun 28 hsa-mir-219-2-3p 0.000579468 — COID Lung Bhattacharjee 19 hsa-mir-615 0.000145391 — SQ Lung Bhattacharjee 0 hsa-mir-662 5.74E−05 — MPM Mesothelioma Gordon 5 hsa-mir-603 0.000121912 — AC Brain Sun 2 hsa-mir-548c-3p 3.42E−07 — GCT Seminoma Korkola 104 hsa-mir-557 0.000174051 — CA Bladder Dyrskjot 43 hsa-mir-939 6.16E−05 — FL Lymphoma Alizadeh 9 hsa-mir-942 0.000136728 — GL Brain Rickman 1 hsa-mir-1283 0.000424966 — PPC Prostate Dhanasekaran 8 hsa-mir-340 0.000508247 — CA Breast Richardson 67 hsa-mir-889 8.08E−06 — HSCC Head-Neck Cromer 2 hsa-mir-374b 9.21E−06 — ODGL Brain Sun 61 hsa-mir-142 0.000296262 — BPH Prostate Dhanasekaran 16 hsa-mir-302f 1.09E−05 — CA Bladder Dyrskjot 27 hsa-mir-129 6.69E−05 — HSCC Head-Neck Cromer 5 hsa-mir-486-3p 4.46E−05 — MM Myeloma Zhan 17 hsa-mir-495 3.10E−07 — ODGL Brain Sun 58 hsa-mir-889 2.02E−06 — COID Lung Bhattacharjee 86 hsa-mir-410 1.85E−06 — HSCC Head-Neck Cromer 13 hsa-mir-622 0.000123772 — COID Lung Bhattacharjee 92 hsa-mir-920 0.000526041 — AD Lung Bhattacharjee 60 hsa-mir-495 2.46E−06 — END Ovarian Hendrix 6 hsa-mir-890 2.65E−06 — SRS Ovarian Hendrix 70 hsa-mir-433 1.13E−06 — SMCL Lung Bhattacharjee 32 hsa-mir-582 1.16E−05 — ILC Breast Radvanyi 15 hsa-mir-518b 0.000273711 — ML Melanoma Talantov 34 hsa-mir-548n 6.91E−09 — AD Lung Bhattacharjee 33 hsa-mir-490 5.05E−05 — CCC Ovarian Hendrix 57 hsa-mir-590 0.000391567 — GCT Seminoma Korkola 4 hsa-mir-376 0.000177892 — MM Myeloma Zhan 6 hsa-mir-600 0.000129022 — GCT Seminoma Korkola 42 hsa-mir-637 0.000565519 — AC Brain Sun 44 hsa-mir-939 4.50E−09 — GL Brain Bredel 38 hsa-mir-486-3p 2.00E−07 — CA Renal Higgins 14 hsa-mir-549 2.84E−05 — CA Breast Richardson 34 hsa-mir-186 1.78E−13 — PPC Prostate Dhanasekaran 22 hsa-mir-561 5.02E−08 — CCC Ovarian Hendrix 11 hsa-mir-602 0.000244248 — AD Lung Bhattacharjee 9 hsa-mir-154 0.000580128 — SRS Ovarian Hendrix 36 hsa-mir-890 0.000614411 — COID Lung Bhattacharjee 7 hsa-mir-608 0.000285439 — AD Lung Beer 44 hsa-mir-452 0.000208474 — AD Lung Beer 46 hsa-mir-606 1.91E−05 — CA Bladder Dyrskjot 28 hsa-mir-296 2.19E−05 — AC Brain Sun 11 hsa-mir-574-3p 6.73E−05 — AD Lung Bhattacharjee 65 hsa-mir-486-3p 0.000152303 — COID Lung Bhattacharjee 36 hsa-mir-890 0.000161298 — GLB Brain Sun 76 hsa-mir-139 3.32E−05 — COID Lung Bhattacharjee 85 hsa-mir-1180 0.000353754 — CA Breast Richardson 38 hsa-mir-103 1.94E−07 — PPC Prostate Dhanasekaran 7 hsa-mir-1202 0.000547775 — GCT Seminoma Korkola 6 hsa-mir-448 5.34E−05 — CA Bladder Dyrskjot 68 hsa-mir-550 0.000398159 — COID Lung Bhattacharjee 18 hsa-mir-663b 0.000354525 — ME Melanoma Hoek 44 hsa-mir-1183 5.26E−08 — DLBCL Lymphoma Alizadeh 4 hsa-mir-297 0.000102804 — SRS Ovarian Hendrix 38 hsa-mir-17 8.61E−05 — GCT Seminoma Korkola 62 hsa-mir-144 9.85E−06 — SMCL Lung Bhattacharjee 36 hsa-mir-296 1.79E−06 — AD Lung Bhattacharjee 16 hsa-mir-361-3p 6.21E−06 — CCC Ovarian Hendrix 29 hsa-mir-636 0.000218326 — AD Lung Bhattacharjee 20 hsa-mir-1245 4.94E−07 — GLB Brain Sun 15 hsa-mir-219-1-3p 6.29E−06 — GLB Brain Sun 57 hsa-mir-921 7.38E−05 — AD Lung Beer 4 hsa-mir-1183 1.54E−05 — GLB Brain Sun 67 hsa-mir-544 3.10E−07 — B-CLL Leukemia Haslinger 61 hsa-mir-588 0.000290466 — COID Lung Bhattacharjee 67 hsa-mir-181d 0.000603461 — MUC Ovarian Hendrix 35 hsa-mir-340 1.91E−08 — CA Colon Graudens 4 hsa-mir-144 2.99E−06 — AD Lung Beer 9 hsa-mir-548k 1.83E−07 — GCT Seminoma Korkola 48 hsa-mir-455 0.000192751 — GCT Seminoma Korkola 14 hsa-mir-340 1.72E−06 — MPC Prostate Dhanasekaran 10 hsa-mir-554 0.000168264 — ODGL Brain Sun 23 hsa-mir-1225 0.000182529 — AC Brain Sun 1 hsa-mir-642 4.72E−05 — MPM Mesothelioma Gordon 21 hsa-mir-548c-3p 5.39E−10 — TU Prostate Lapointe 7 hsa-mir-579 2.35E−09 — CA Breast Richardson 31 hsa-mir-376a 0.000581498 — IDC Breast Radvanyi 51 hsa-mir-548n 2.37E−07 — GLB Brain Sun 60 hsa-mir-548f 3.12E−07 — CA Breast Richardson 7 hsa-mir-590-3p 2.62E−05 — GCT Seminoma Korkola 92 hsa-mir-564 1.88E−05 — MM Myeloma Zhan 38 hsa-mir-652 0.000174084 — OD Brain Bredel 5 hsa-mir-1180 0.000184744 — AD Pancreas Logsdon 4 hsa-mir-22 0.000277647 — PDC Pancreas Ishikawa 1 hsa-mir-106b 0.000224128 — SRS Ovarian Hendrix 69 hsa-mir-29b 5.50E−06 — END Ovarian Hendrix 70 hsa-mir-939 1.49E−07 — CA Bladder Dyrskjot 26 hsa-mir-486 7.83E−07 — GLB Brain Sun 13 hsa-mir-744 0.000603573 — AD Pancreas Logsdon 15 hsa-mir-130b 0.000605398 — AD Ovarian Welsh 14 hsa-mir-338 2.13E−06 — ML Melanoma Talantov 33 hsa-mir-605 1.62E−05 — SRS Ovarian Hendrix 42 hsa-mir-1298 9.78E−06 — GCT Seminoma Korkola 10 hsa-mir-153 0.00019375  — MPM Mesothelioma Gordon 11 hsa-mir-889 9.17E−07 — RCCC Renal Boer 11 hsa-mir-659 0.000194706 — MM Myeloma Zhan 7 hsa-mir-645 0.000256879 — PPC Prostate Dhanasekaran 12 hsa-mir-342-3p 6.39E−05 — GL Brain Bredel 52 hsa-mir-516a-3p 1.62E−06 — CA Breast Richardson 63 hsa-mir-561 7.97E−06 — CA Colon Graudens 36 hsa-mir-512-3p 3.64E−07 — TU Prostate Lapointe 35 hsa-mir-548a 5.28E−05 — SRS Ovarian Hendrix 12 hsa-mir-125a-3p 5.25E−05 — ML Melanoma Talantov 22 hsa-mir-570 1.67E−05 — MM Myeloma Zhan 49 hsa-mir-138 0.000244706 — GBM Brain Liang 16 hsa-mir-663 2.49E−05 — GCT Seminoma Korkola 15 hsa-mir-1323 0.000155769 — SMCL Lung Bhattacharjee 30 hsa-mir-655 4.15E−08 — GCT Seminoma Korkola 110 hsa-mir-1306 3.03E−05 — BPH Prostate Dhanasekaran 5 hsa-mir-1290 4.31E−05 — SQ Lung Bhattacharjee 9 hsa-mir-891a 2.16E−05 — CA Bladder Dyrskjot 8 hsa-mir-331 5.47E−05 — IDC Breast Radvanyi 12 hsa-mir-590-3p 4.83E−05 — SMCL Lung Bhattacharjee 57 hsa-mir-448 1.38E−09 — OD Brain Bredel 50 hsa-mir-1254 0.00026912  — TU Prostate Lapointe 26 hsa-mir-663 6.26E−07 — GCT Seminoma Korkola 26 hsa-mir-374a 2.65E−05 — OD Brain Bredel 36 hsa-mir-326 0.000315988 — GL Brain Rickman 16 hsa-mir-586 4.77E−05 — AC Brain Sun 27 hsa-mir-612 0.000162631 — GCT Seminoma Korkola 2 hsa-mir-661 3.65E−05 — B-CLL Leukemia Haslinger 59 hsa-mir-1228 0.000144933 — MM Myeloma Zhan 41 hsa-mir-339 1.98E−05 — GCT Seminoma Korkola 95 hsa-mir-548c-3p 6.76E−11 — COID Lung Bhattacharjee 61 hsa-mir-34c-3p 2.25E−05 — END Ovarian Hendrix 29 hsa-mir-944 0.000347953 — GLB Brain Sun 42 hsa-mir-602 0.000127309 — CA Breast Sorlie 4 hsa-mir-611 4.29E−05 — GCT Seminoma Korkola 35 hsa-mir-18a 0.000590569 — AD Ovarian Welsh 22 hsa-mir-1207 0.000144063 — B-CLL Leukemia Haslinger 11 hsa-mir-34c-3p 0.000384596 — GCT Seminoma Korkola 45 hsa-mir-183 0.000103017 — DLBCL Lymphoma Alizadeh 9 hsa-mir-1277 0.000225187 — CA Bladder Dyrskjot 19 hsa-mir-331-3p 4.56E−07 — HSCC Head-Neck Cromer 6 hsa-mir-1275 0.000221713 — END Ovarian Hendrix 26 hsa-mir-656 3.57E−08 — B-CLL Leukemia Haslinger 1 hsa-mir-487a 5.33E−09 — RCCC Renal Lenburg 5 hsa-mir-515-3p 9.30E−05 — SMCL Lung Bhattacharjee 43 hsa-mir-671-3p 0.000437915 — GCT Seminoma Korkola 58 hsa-mir-595 1.51E−06 — B-CLL Leukemia Haslinger 50 hsa-mir-296 0.000233149 — TU Prostate Lapointe 6 hsa-mir-876-3p 0.000324998 — MM Myeloma Zhan 24 hsa-mir-1259 0.000330827 — PPC Prostate Dhanasekaran 3 hsa-mir-578 1.16E−05 — AD Lung Bhattacharjee 50 hsa-mir-642 5.69E−05 — AD Lung Bhattacharjee 74 hsa-mir-543 7.59E−05 — GL Brain Rickman 21 hsa-mir-495 3.72E−05 — CLL Lymphoma Alizadeh 10 hsa-mir-590 0.000327927 — IDC Breast Radvanyi 42 hsa-mir-766 0.000456161 — AD Lung Bhattacharjee 69 hsa-mir-522 4.93E−10 — OD Brain Bredel 61 hsa-mir-937 0.000101996 — MM Myeloma Zhan 31 hsa-mir-512-3p 8.13E−05 — IDC Breast Radvanyi 39 hsa-mir-125a-3p 0.000512311 — AD Lung Bhattacharjee 45 hsa-mir-340 6.92E−08 — AD Lung Bhattacharjee 58 hsa-mir-655 7.25E−09 — GCT Seminoma Korkola 93 hsa-mir-640 5.11E−06 — HSCC Head-Neck Cromer 4 hsa-mir-662 0.000280826 — MPM Mesothelioma Gordon 8 hsa-mir-1180 1.21E−06 — AD Lung Stearman 5 hsa-mir-342-3p 1.18E−06 — GL Brain Rickman 3 hsa-mir-182 1.60E−05 — GCT Seminoma Korkola 67 hsa-mir-1266 2.88E−05 — COID Lung Bhattacharjee 39 hsa-mir-608 0.000130832 — GCT Seminoma Korkola 1 hsa-mir-1234 4.72E−05 — GCT Seminoma Korkola 5 hsa-mir-1204 0.000522965 — CA Bladder Dyrskjot 77 hsa-mir-620 0.00055255  — ODGL Brain Sun 29 hsa-mir-509-3 0.000305758 — B-CLL Leukemia Haslinger 12 hsa-mir-1302 0.000390653 — AC Brain Sun 5 hsa-mir-637 0.000149584 — GLB Brain Sun 74 hsa-mir-369-3p 7.86E−05 — COID Lung Bhattacharjee 42 hsa-mir-671 4.57E−05 — CA Bladder Dyrskjot 0 hsa-mir-643 0.000314026 — GLB Brain Sun 2 hsa-mir-577 4.84E−05 — MPC Prostate Dhanasekaran 33 hsa-mir-886 0.000278531 — ODGL Brain Sun 9 hsa-mir-186 3.31E−06 — ODGL Brain Sun 3 hsa-mir-889 6.19E−07 — GCT Seminoma Korkola 20 hsa-mir-495 5.27E−07 — MUC Ovarian Hendrix 47 hsa-mir-654 0.000586378 — CCC Ovarian Hendrix 59 hsa-mir-1258 7.38E−05 — IDC Breast Radvanyi 63 hsa-mir-548h 0.000316845 — GCT Seminoma Korkola 9 hsa-mir-296 4.54E−11 — GLB Brain Sun 24 hsa-mir-494 7.74E−06 — COID Lung Bhattacharjee 79 hsa-mir-508-3p 0.000523991 — GCT Seminoma Korkola 56 hsa-mir-548m 7.53E−06 — MUC Ovarian Hendrix 40 hsa-mir-618 2.30E−05 — TU Prostate Lapointe 37 hsa-mir-509-3p 1.50E−05 — CCC Ovarian Hendrix 35 hsa-mir-607 4.23E−05 — RCCC Renal Boer 5 hsa-mir-374a 0.000225536 — END Ovarian Hendrix 41 hsa-mir-338 3.20E−06 — SMCL Lung Bhattacharjee 59 hsa-mir-340 8.26E−06 — GCT Seminoma Korkola 70 hsa-mir-939 5.97E−09 — CA Breast Richardson 56 hsa-mir-34b 9.69E−06 — MPM Mesothelioma Gordon 48 hsa-mir-606 4.93E−05 — AO Brain Bredel 21 hsa-mir-1203 0.000359483 — COID Lung Bhattacharjee 28 hsa-mir-608 0.000125912 — SRS Ovarian Hendrix 14 hsa-mir-1290 0.000463364 — ML Melanoma Talantov 21 hsa-mir-450b 7.89E−05 — BPH Prostate Dhanasekaran 10 hsa-mir-624 2.78E−05 —

    TABLE-US-00007 SUPPLEMENTARY TABLE 7 miRvestigator PITA TargetScan miR2Disease miR2Disease miR2Disease Dataset Signature miRNA Validation miRNA Validation miRNA Validation Overlap GL Brain Rickman 9 hsa-mir-1207-5p hsa-mir-1207-5p 1 CA Bladder Dyrskjot 64 hsa-mir-590-3p hsa-mir-590-3p 1 GLB Brain Sun 67 hsa-mir-544 hsa-mir-544 1 hsa-mir-544b hsa-mir-544b GLB Brain Sun 2 hsa-mir-577 hsa-mir-577 1 CA Breast Richardson 2 hsa-mir-590-3p hsa-mir-590-3p 1 B-CLL Leukemia Haslinger 53 hsa-mir-513a-3p hsa-mir-513a-3p 1 AD Lung Beer 9 hsa-mir-548k hsa-mir-548k 1 AD Lung Beer 31 hsa-mir-29b Causal hsa-mir-29b Causal hsa-mir-29b Causal 1 hsa-mir-29c hsa-mir-29c hsa-mir-29a hsa-mir-29a AD Lung Bhattacharjee 58 hsa-mir-655 hsa-mir-655 1 COID Lung Bhattacharjee 74 hsa-mir-513a-3p hsa-mir-513a-3p 1 SMCL Lung Bhattacharjee 22 hsa-mir-548n hsa-mir-548n 1 AD Lung Stearman 18 hsa-mir-1257 hsa-mir-1257 1 CLL Lymphoma Alizadeh 10 hsa-mir-21 Dysregulated hsa-mir-590-5p 1 hsa-mir-590-5p ME Melanoma Hoek 35 hsa-mir-200b Causal hsa-mir-200b Causal 1 hsa-mir-200c hsa-mir-200a AD Ovarian Welsh 25 hsa-mir-572 Dysregulated hsa-mir-572 Dysregulated 1 CCC Ovarian Hendrix 42 hsa-mir-590-3p hsa-mir-590-3p 1 CCC Ovarian Hendrix 4 hsa-mir-194 hsa-mir-194 1 SRS Ovarian Hendrix 73 hsa-mir-340 hsa-mir-340 1 END Ovarian Hendrix 35 hsa-mir-1276 hsa-mir-1276 1 MPC Prostate Dhanasekaran 35 hsa-mir-203 hsa-mir-203 1 TU Prostate Lapointe 39 hsa-mir-590-3p hsa-mir-656 0 CA Bladder Dyrskjot 56 hsa-mir-335 hsa-mir-1238 0 CA Bladder Dyrskjot 36 hsa-mir-548n hsa-mir-548c-3p 0 CA Bladder Dyrskjot 51 hsa-mir-1276 0 TU Prostate Lapointe 13 hsa-mir-497 Dysregulated 0 CA Bladder Dyrskjot 22 hsa-mir-663b 0 hsa-mir-663 CA Bladder Dyrskjot 45 hsa-mir-608 0 TU Prostate Lapointe 14 hsa-mir-138-1* 0 TU Prostate Lapointe 17 hsa-mir-96 Dysregulated hsa-mir-219-5p 0 TU Prostate Lapointe 33 hsa-mir-802 hsa-mir-548c-3p 0 TU Prostate Lapointe 18 hsa-mir-760 0 TU Prostate Lapointe 31 hsa-mir-631 hsa-mir-339-3p 0 CA Bladder Dyrskjot 53 hsa-mir-1206 hsa-mir-944 0 TU Prostate Lapointe 37 hsa-mir-199b-3p Causal hsa-mir-509-3p 0 hsa-mir-199a-3p hsa-mir-509-3-5p CA Bladder Dyrskjot 67 hsa-mir-630 0 CA Bladder Dyrskjot 82 hsa-mir-519d hsa-mir-656 0 TU Prostate Lapointe 19 hsa-mir-296-5p Dysregulated 0 CA Bladder Dyrskjot 81 hsa-mir-455-3p 0 CA Bladder Dyrskjot 14 hsa-mir-944 0 CA Bladder Dyrskjot 24 hsa-mir-663b 0 hsa-mir-663 CA Bladder Dyrskjot 25 hsa-mir-550b hsa-mir-1204 0 hsa-mir-550a CA Bladder Dyrskjot 26 hsa-mir-194 hsa-mir-1224-5p hsa-mir-486-5p 0 CA Bladder Dyrskjot 27 hsa-mir-365 hsa-mir-129-5p 0 CA Bladder Dyrskjot 21 hsa-mir-590-3p hsa-mir-944 0 CA Bladder Dyrskjot 48 hsa-mir-520b 0 CA Bladder Dyrskjot 49 hsa-mir-432 0 CA Bladder Dyrskjot 46 hsa-mir-342-5p 0 CA Bladder Dyrskjot 47 hsa-mir-331-5p hsa-mir-197 0 CA Bladder Dyrskjot 42 hsa-mir-1183 hsa-mir-362-5p 0 CA Bladder Dyrskjot 28 hsa-mir-296-5p 0 CA Bladder Dyrskjot 43 hsa-mir-939 0 CA Bladder Dyrskjot 40 hsa-mir-548d-3p 0 CA Bladder Dyrskjot 1 hsa-mir-940 hsa-mir-637 0 CA Bladder Dyrskjot 0 hsa-mir-607 hsa-mir-643 0 CA Renal Higgins 10 hsa-mir-875-3p hsa-mir-483-3p 0 CA Renal Higgins 13 hsa-mir-423-5p hsa-mir-663b 0 hsa-mir-663 CA Bladder Dyrskjot 7 hsa-mir-361-5p 0 CA Bladder Dyrskjot 6 hsa-mir-939 0 CA Renal Higgins 14 hsa-mir-140-5p hsa-mir-549 0 CA Bladder Dyrskjot 8 hsa-mir-140-3p hsa-mir-331-5p 0 CA Bladder Dyrskjot 68 hsa-mir-550b 0 hsa-mir-550a CA Bladder Dyrskjot 79 hsa-mir-147 hsa-mir-508-3p 0 hsa-mir-147b RCCC Renal Boer 11 hsa-mir-659 0 CA Bladder Dyrskjot 13 hsa-mir-548k hsa-mir-548c-3p 0 RCCC Renal Boer 13 hsa-mir-200a Causal hsa-mir-1279 0 hsa-mir-141 RCCC Renal Boer 12 hsa-mir-760 0 CA Bladder Dyrskjot 75 hsa-mir-487a hsa-mir-513c 0 hsa-mir-513b hsa-mir-513a-5p RCCC Renal Boer 14 hsa-mir-590-3p 0 CA Bladder Dyrskjot 72 hsa-mir-296-5p 0 CA Bladder Dyrskjot 71 hsa-mir-633 hsa-mir-662 0 RCCC Renal Boer 3 hsa-mir-217 0 CA Bladder Dyrskjot 15 hsa-mir-1323 0 CA Bladder Dyrskjot 32 hsa-mir-320e hsa-mir-1270 0 hsa-mir-320d hsa-mir-320c hsa-mir-320b hsa-mir-320a RCCC Renal Boer 4 hsa-mir-1262 0 RCCC Renal Boer 7 hsa-mir-32 hsa-mir-106b Dysregulated 0 hsa-mir-92a hsa-mir-92b CA Bladder Dyrskjot 10 hsa-mir-597 0 RCCC Renal Boer 9 hsa-mir-1256 hsa-mir-502-3p 0 RCCC Renal Boer 8 hsa-mir-1206 0 CA Bladder Dyrskjot 63 hsa-mir-372 0 CA Bladder Dyrskjot 58 hsa-mir-328 0 CA Bladder Dyrskjot 17 hsa-mir-885-3p 0 CA Bladder Dyrskjot 16 hsa-mir-1205 hsa-mir-939 0 CA Bladder Dyrskjot 19 hsa-mir-659 hsa-mir-331-3p 0 RCCC Renal Lenburg 3 hsa-mir-548f hsa-mir-888 0 hsa-mir-548e hsa-mir-548x RCCC Renal Lenburg 2 hsa-mir-487b hsa-mir-499a-5p 0 hsa-mir-499-5p CA Bladder Dyrskjot 23 hsa-mir-211 0 CA Bladder Dyrskjot 37 hsa-mir-548n 0 CA Bladder Dyrskjot 35 hsa-mir-1469 hsa-mir-486-3p 0 RCCC Renal Lenburg 9 hsa-mir-1238 0 RCCC Renal Lenburg 8 hsa-mir-660 hsa-mir-889 0 CA Bladder Dyrskjot 54 hsa-mir-491-5p 0 GCT Seminoma Korkola 25 hsa-mir-105 hsa-mir-607 0 CA Bladder Dyrskjot 31 hsa-mir-520d-5p hsa-mir-656 0 hsa-mir-524-5p ODGL Brain Sun 0 hsa-mir-637 0 GCT Seminoma Korkola 20 hsa-mir-632 hsa-mir-495 0 GCT Seminoma Korkola 21 hsa-mir-548k hsa-mir-520f 0 GBM Brain Liang 13 hsa-mir-1278 0 GBM Brain Liang 12 hsa-mir-520g 0 hsa-mir-520h GBM Brain Liang 15 hsa-mir-144 0 GBM Brain Liang 14 hsa-mir-496 hsa-mir-125a-3p 0 GBM Brain Liang 17 hsa-mir-361-5p hsa-mir-600 0 GCT Seminoma Korkola 4 hsa-mir-376a 0 hsa-mir-376b hsa-mir-376c GBM Brain Liang 18 hsa-mir-369-5p 0 GBM Brain Liang 1 hsa-mir-423-5p 0 GCT Seminoma Korkola 58 hsa-mir-595 0 GBM Brain Liang 2 hsa-mir-548c-3p 0 TU Prostate Lapointe 35 hsa-mir-758 hsa-mir-548am 0 hsa-mir-548ab hsa-mir-548aa hsa-mir-548ag hsa-mir-548ak hsa-mir-548aj hsa-mir-548ai hsa-mir-548ah hsa-mir-548an hsa-mir-548al hsa-mir-548ae hsa-mir-548ad hsa-mir-548a-5p hsa-mir-548ac GCT Seminoma Korkola 56 hsa-mir-499-3p hsa-mir-548m 0 GBM Brain Liang 7 hsa-mir-323-5p Dysregulated 0 hsa-mir-323b-5p TU Prostate Lapointe 38 hsa-mir-1264 hsa-mir-633 0 GCT Seminoma Korkola 52 hsa-mir-508-5p 0 GCT Seminoma Korkola 88 hsa-mir-129-5p hsa-mir-338-5p 0 GCT Seminoma Korkola 89 hsa-mir-568 hsa-mir-1257 0 GCT Seminoma Korkola 111 hsa-mir-296-5p 0 GCT Seminoma Korkola 110 hsa-mir-18a hsa-mir-1306 0 hsa-mir-18b GCT Seminoma Korkola 112 hsa-mir-590-3p hsa-mir-548n 0 OD Brain Bredel 19 hsa-mir-551a hsa-mir-487a 0 hsa-mir-551b OD Brain Bredel 62 hsa-let-7f 0 GCT Seminoma Korkola 80 hsa-mir-623 hsa-mir-573 0 OD Brain Bredel 52 hsa-mir-325 hsa-mir-411 Dysregulated 0 OD Brain Bredel 24 hsa-mir-193a-3p 0 OD Brain Bredel 25 hsa-mir-512-3p 0 GCT Seminoma Korkola 85 hsa-mir-181d 0 hsa-mir-181a hsa-mir-181b hsa-mir-181c GCT Seminoma Korkola 3 hsa-mir-324-5p hsa-mir-296-5p 0 OD Brain Bredel 21 hsa-mir-369-3p hsa-mir-548c-3p 0 GCT Seminoma Korkola 109 hsa-mir-548p 0 GCT Seminoma Korkola 102 hsa-mir-125b hsa-mir-34a 0 hsa-mir-125a-5p GCT Seminoma Korkola 67 hsa-mir-1266 0 GCT Seminoma Korkola 100 hsa-mir-486-3p 0 GCT Seminoma Korkola 101 hsa-mir-372 Causal 0 OD Brain Bredel 45 hsa-mir-324-5p 0 GCT Seminoma Korkola 107 hsa-mir-199b-3p Causal 0 hsa-mir-199a-3p OD Brain Bredel 43 hsa-mir-412 0 GCT Seminoma Korkola 105 hsa-mir-34a 0 hsa-mir-34c-5p hsa-mir-449a hsa-mir-449b GCT Seminoma Korkola 39 hsa-mir-769-5p hsa-mir-639 0 GCT Seminoma Korkola 38 hsa-mir-370 0 TU Prostate Lapointe 11 hsa-mir-152 0 OD Brain Bredel 3 hsa-mir-615-3p hsa-mir-195 Dysregulated 0 GCT Seminoma Korkola 31 hsa-mir-22 hsa-mir-891a 0 OD Brain Bredel 5 hsa-mir-423-3p hsa-mir-1180 0 GCT Seminoma Korkola 37 hsa-mir-106b hsa-mir-519a 0 hsa-mir-17 hsa-mir-106a hsa-mir-93 hsa-mir-20b hsa-mir-20a GCT Seminoma Korkola 36 hsa-mir-196b 0 hsa-mir-196a GCT Seminoma Korkola 35 hsa-mir-18a 0 OD Brain Bredel 9 hsa-mir-548e 0 OD Brain Bredel 8 hsa-mir-651 0 OD Brain Bredel 56 hsa-mir-126 0 GCT Seminoma Korkola 62 hsa-mir-548m hsa-mir-144 0 GCT Seminoma Korkola 63 hsa-mir-889 0 OD Brain Bredel 12 hsa-mir-588 hsa-mir-200a Causal 0 GCT Seminoma Korkola 66 hsa-mir-532-3p hsa-mir-1291 0 CA Renal Higgins 20 hsa-mir-1261 0 GCT Seminoma Korkola 68 hsa-mir-1182 0 GCT Seminoma Korkola 69 hsa-mir-296-5p 0 GCT Seminoma Korkola 2 hsa-mir-661 0 GCT Seminoma Korkola 6 hsa-mir-34b hsa-mir-448 0 GCT Seminoma Korkola 98 hsa-mir-224 hsa-mir-203 0 GCT Seminoma Korkola 90 hsa-mir-362-5p 0 OD Brain Bredel 16 hsa-mir-1181 0 OD Brain Bredel 33 hsa-mir-1231 0 GCT Seminoma Korkola 95 hsa-mir-1283 hsa-mir-548c-3p 0 OD Brain Bredel 57 hsa-mir-148b hsa-mir-423-5p 0 hsa-mir-152 OD Brain Bredel 37 hsa-mir-29a* 0 TU Prostate Lapointe 10 hsa-mir-32 Dysregulated 0 GCT Seminoma Korkola 10 hsa-mir-153 0 GCT Seminoma Korkola 15 hsa-mir-1323 0 GCT Seminoma Korkola 14 hsa-mir-1323 hsa-mir-340 0 hsa-mir-548o GCT Seminoma Korkola 17 hsa-mir-615-5p 0 GL Brain Bredel 30 hsa-mir-342-5p Dysregulated 0 GL Brain Bredel 54 hsa-mir-582-3p 0 GL Brain Bredel 37 hsa-mir-544 0 hsa-mir-544b GCT Seminoma Korkola 48 hsa-mir-455-5p 0 GCT Seminoma Korkola 47 hsa-mir-485-5p 0 GL Brain Bredel 61 hsa-mir-572 0 GCT Seminoma Korkola 45 hsa-mir-183 0 GCT Seminoma Korkola 42 hsa-mir-1181 hsa-mir-149 hsa-mir-637 0 GCT Seminoma Korkola 40 hsa-mir-577 hsa-mir-548n 0 GL Brain Bredel 66 hsa-mir-223 Dysregulated hsa-mir-27a Dysregulated 0 GCT Seminoma Korkola 1 hsa-mir-1234 0 CA Renal Higgins 1 hsa-mir-590-3p 0 GCT Seminoma Korkola 9 hsa-mir-296-5p 0 GL Brain Bredel 52 hsa-mir-516a-3p 0 GL Brain Bredel 24 hsa-mir-516b hsa-mir-1245b-5p 0 hsa-mir-1245 GCT Seminoma Korkola 75 hsa-mir-25 Dysregulated hsa-mir-664 hsa-mir-708 0 hsa-mir-32 hsa-mir-92a hsa-mir-92b hsa-mir-363 hsa-mir-367 GCT Seminoma Korkola 74 hsa-let-7f 0 hsa-let-7g hsa-let-7a hsa-let-7b hsa-let-7d hsa-let-7i hsa-mir-98 hsa-let-7c hsa-let-7e GL Brain Bredel 27 hsa-mir-181d Dysregulated 0 hsa-mir-181a hsa-mir-181b hsa-mir-181c GL Brain Bredel 20 hsa-mir-487b Dysregulated 0 GL Brain Bredel 21 hsa-mir-633 0 GL Brain Bredel 48 hsa-mir-2277-5p 0 GCT Seminoma Korkola 0 hsa-mir-1251 0 GL Brain Bredel 46 hsa-mir-154 hsa-mir-548l 0 CA Renal Higgins 3 hsa-mir-199a-3p Causal 0 GL Brain Bredel 40 hsa-mir-526b 0 GL Brain Bredel 41 hsa-mir-484 0 GL Brain Bredel 0 hsa-mir-1208 hsa-mir-548i 0 GL Brain Bredel 9 hsa-mir-549 0 GL Brain Bredel 78 hsa-mir-126 hsa-mir-424 Dysregulated 0 CA Renal Higgins 4 hsa-mir-34b 0 GL Brain Bredel 33 hsa-mir-625 0 GL Brain Bredel 39 hsa-mir-363 hsa-mir-572 0 GL Brain Bredel 77 hsa-mir-744 0 GL Brain Bredel 75 hsa-mir-889 0 GL Brain Bredel 72 hsa-mir-760 0 GL Brain Bredel 71 hsa-mir-651 0 GL Brain Bredel 59 hsa-mir-125a-3p 0 GL Brain Bredel 38 hsa-mir-486-3p 0 GL Brain Bredel 79 hsa-mir-340 0 GL Brain Bredel 11 hsa-mir-542-3p 0 CA Breast Richardson 43 hsa-mir-1246 0 GL Brain Bredel 12 hsa-mir-384 0 GL Brain Bredel 15 hsa-mir-126 hsa-mir-654-3p 0 GL Brain Bredel 17 hsa-mir-877 0 GL Brain Bredel 32 hsa-mir-15a Dysregulated 0 GL Brain Bredel 31 hsa-mir-615-3p 0 GL Brain Bredel 36 hsa-mir-661 0 GL Brain Bredel 18 hsa-mir-187 0 GL Brain Bredel 57 hsa-mir-769-3p hsa-mir-193a-3p 0 hsa-mir-450b-3p GL Brain Bredel 65 hsa-mir-532-5p 0 AO Brain Bredel 20 hsa-mir-324-5p 0 AO Brain Bredel 21 hsa-mir-1203 0 AO Brain Bredel 22 hsa-mir-663b 0 hsa-mir-663 AO Brain Bredel 28 hsa-mir-296-5p Causal 0 GCT Seminoma Korkola 83 hsa-mir-1254 0 AO Brain Bredel 1 hsa-mir-181a Causal 0 AO Brain Bredel 0 hsa-mir-635 0 GBM Brain Liang 5 hsa-mir-939 0 AO Brain Bredel 38 hsa-mir-1282 0 AO Brain Bredel 11 hsa-mir-608 0 AO Brain Bredel 10 hsa-mir-4285 0 AO Brain Bredel 13 hsa-mir-506 0 AO Brain Bredel 17 hsa-mir-191 0 CA Renal Higgins 17 hsa-mir-663b 0 hsa-mir-663 AO Brain Bredel 18 hsa-mir-497 0 AO Brain Bredel 30 hsa-mir-1255b 0 hsa-mir-1255a AO Brain Bredel 35 hsa-mir-939 0 AO Brain Bredel 33 hsa-mir-450b-5p 0 AO Brain Bredel 32 hsa-mir-564 0 GL Brain Rickman 26 hsa-mir-1469 0 GL Brain Rickman 27 hsa-mir-182 0 GL Brain Rickman 21 hsa-mir-624 hsa-mir-495 0 GL Brain Rickman 22 hsa-mir-542-3p hsa-mir-374b 0 GL Brain Rickman 23 hsa-mir-490-5p hsa-mir-935 0 GL Brain Rickman 29 hsa-mir-544 hsa-mir-568 0 hsa-mir-544b GL Brain Rickman 1 hsa-mir-493 hsa-mir-1283 0 GL Brain Rickman 3 hsa-mir-182 0 GL Brain Rickman 2 hsa-mir-718 0 GL Brain Rickman 4 hsa-mir-302f hsa-mir-361-5p 0 GL Brain Rickman 8 hsa-mir-634 0 GL Brain Rickman 11 hsa-mir-653 0 GL Brain Rickman 10 hsa-mir-648 0 GL Brain Rickman 13 hsa-mir-486-3p 0 GL Brain Rickman 15 hsa-mir-487a 0 GL Brain Rickman 14 hsa-mir-149 Dysregulated 0 GL Brain Rickman 17 hsa-mir-146b-3p 0 GL Brain Rickman 16 hsa-mir-586 0 GL Brain Rickman 31 hsa-let-7e Dysregulated 0 hsa-let-7f hsa-let-7g hsa-let-7a hsa-let-7b hsa-let-7d hsa-let-7i hsa-mir-98 hsa-let-7c GL Brain Rickman 34 hsa-mir-125a-3p 0 GL Brain Rickman 32 hsa-mir-889 0 ODGL Brain Sun 30 hsa-mir-483-5p 0 RCCC Renal Boer 15 hsa-mir-548k hsa-mir-300 0 ODGL Brain Sun 22 hsa-mir-423-5p 0 ODGL Brain Sun 29 hsa-mir-509-3p 0 hsa-mir-509-3-5p ODGL Brain Sun 60 hsa-mir-556-3p hsa-let-7d 0 ODGL Brain Sun 61 hsa-mir-142-5p 0 ODGL Brain Sun 62 hsa-mir-1294 0 ODGL Brain Sun 63 hsa-mir-410 Dysregulated 0 ODGL Brain Sun 64 hsa-mir-539 0 ODGL Brain Sun 53 hsa-mir-548m hsa-mir-548n 0 ODGL Brain Sun 52 hsa-mir-1270 0 hsa-mir-620 ODGL Brain Sun 23 hsa-mir-1225-5p 0 ODGL Brain Sun 25 hsa-mir-548p hsa-mir-548l 0 ODGL Brain Sun 26 hsa-mir-622 0 ODGL Brain Sun 27 hsa-mir-136 Dysregulated 0 ODGL Brain Sun 20 hsa-mir-570 hsa-mir-548e 0 RCCC Renal Boer 1 hsa-mir-371b-5p 0 hsa-mir-371-5p ODGL Brain Sun 48 hsa-mir-384 0 ODGL Brain Sun 49 hsa-mir-423-5p 0 ODGL Brain Sun 47 hsa-mir-1204 0 ODGL Brain Sun 44 hsa-mir-1276 0 RCCC Renal Boer 0 hsa-mir-140-3p hsa-mir-494 Dysregulated 0 ODGL Brain Sun 28 hsa-mir-219-2-3p 0 ODGL Brain Sun 41 hsa-mir-374b hsa-mir-26b 0 hsa-mir-374a ODGL Brain Sun 1 hsa-mir-647 0 CA Bladder Dyrskjot 70 hsa-mir-502-5p 0 ODGL Brain Sun 3 hsa-mir-889 0 ODGL Brain Sun 2 hsa-mir-939 0 ODGL Brain Sun 7 hsa-mir-548k 0 ODGL Brain Sun 9 hsa-mir-142-3p Dysregulated hsa-mir-186 0 ODGL Brain Sun 50 hsa-mir-548c-3p hsa-mir-217 0 ODGL Brain Sun 58 hsa-mir-181d Causal hsa-mir-889 0 hsa-mir-181b ODGL Brain Sun 11 hsa-mir-219-1-3p 0 ODGL Brain Sun 10 hsa-mir-208a 0 ODGL Brain Sun 39 hsa-mir-218 Dysregulated hsa-mir-1283 0 ODGL Brain Sun 38 hsa-mir-1469 0 ODGL Brain Sun 17 hsa-mir-548l 0 ODGL Brain Sun 33 hsa-mir-335 0 ODGL Brain Sun 57 hsa-mir-296-5p Causal 0 ODGL Brain Sun 36 hsa-mir-361-3p 0 ODGL Brain Sun 37 hsa-mir-126 0 ODGL Brain Sun 32 hsa-mir-153 0 ODGL Brain Sun 31 hsa-mir-490-3p 0 ODGL Brain Sun 65 hsa-mir-340 hsa-mir-495 0 AC Brain Sun 51 hsa-mir-922 0 AC Brain Sun 34 hsa-mir-223 Dysregulated 0 CA Bladder Dyrskjot 38 hsa-mir-1281 0 AC Brain Sun 27 hsa-mir-612 0 AC Brain Sun 23 hsa-mir-1207-3p 0 AC Brain Sun 46 hsa-mir-548c-3p hsa-mir-590-3p 0 AC Brain Sun 44 hsa-mir-939 0 OD Brain Bredel 54 hsa-mir-1275 0 RCCC Renal Lenburg 10 hsa-mir-1273 0 hsa-mir-1273c hsa-mir-1273d hsa-mir-1273e hsa-mir-1273f hsa-mir-1273g AC Brain Sun 1 hsa-mir-642a 0 hsa-mir-642b AC Brain Sun 3 hsa-mir-1205 0 AC Brain Sun 2 hsa-mir-548c-3p 0 AC Brain Sun 5 hsa-mir-523 hsa-mir-637 0 AC Brain Sun 4 hsa-mir-937 hsa-mir-222 Causal hsa-mir-371-3p 0 AC Brain Sun 7 hsa-mir-582-3p hsa-mir-548l 0 AC Brain Sun 6 hsa-mir-1284 hsa-mir-139-5p Dysregulated 0 AC Brain Sun 8 hsa-mir-196a 0 AC Brain Sun 28 hsa-mir-539 0 AC Brain Sun 12 hsa-mir-485-3p Dysregulated hsa-mir-210 Dysregulated 0 AC Brain Sun 11 hsa-mir-574-3p 0 CA Bladder Dyrskjot 66 hsa-mir-1827 0 AC Brain Sun 39 hsa-mir-1266 0 AC Brain Sun 22 hsa-mir-185 0 AC Brain Sun 17 hsa-mir-487b Dysregulated hsa-mir-617 0 AC Brain Sun 16 hsa-mir-655 0 AC Brain Sun 19 hsa-mir-218 Dysregulated hsa-mir-485-5p 0 AC Brain Sun 18 hsa-mir-1305 0 AC Brain Sun 31 hsa-mir-1280 0 AC Brain Sun 37 hsa-mir-569 0 AC Brain Sun 32 hsa-mir-1266 0 AC Brain Sun 50 hsa-mir-1234 hsa-mir-32 hsa-mir-483-3p 0 GLB Brain Sun 58 hsa-mir-1287 0 RCCC Renal Lenburg 5 hsa-mir-515-3p 0 GLB Brain Sun 36 hsa-mir-423-5p 0 GLB Brain Sun 54 hsa-mir-548m hsa-mir-921 0 GLB Brain Sun 51 hsa-mir-28-3p 0 GLB Brain Sun 43 hsa-mir-331-5p 0 GLB Brain Sun 60 hsa-mir-548f 0 GLB Brain Sun 62 hsa-mir-216a hsa-mir-495 0 GLB Brain Sun 63 hsa-mir-939 0 GLB Brain Sun 64 hsa-let-7e* 0 GLB Brain Sun 68 hsa-mir-888 hsa-mir-299-5p Dysregulated 0 GLB Brain Sun 69 hsa-mir-1288 0 RCCC Renal Lenburg 6 hsa-mir-651 0 GLB Brain Sun 24 hsa-mir-381 Dysregulated hsa-mir-494 0 hsa-mir-300 GLB Brain Sun 25 hsa-mir-600 0 GLB Brain Sun 27 hsa-mir-590-3p hsa-mir-889 0 GLB Brain Sun 20 hsa-mir-556-3p hsa-mir-331-5p 0 GLB Brain Sun 21 hsa-mir-188-5p 0 GLB Brain Sun 49 hsa-mir-340 0 GLB Brain Sun 42 hsa-mir-602 0 GLB Brain Sun 28 hsa-mir-369-3p hsa-mir-323-3p 0 GLB Brain Sun 29 hsa-mir-1181 hsa-mir-1275 0 GLB Brain Sun 41 hsa-mir-760 0 GLB Brain Sun 1 hsa-mir-767-5p hsa-mir-324-5p 0 GLB Brain Sun 0 hsa-mir-637 0 GLB Brain Sun 3 hsa-mir-320a 0 GLB Brain Sun 5 hsa-mir-515-5p 0 GLB Brain Sun 4 hsa-mir-542-5p 0 CA Bladder Dyrskjot 12 hsa-mir-607 hsa-mir-1244 0 GLB Brain Sun 8 hsa-mir-140-3p hsa-mir-501-5p 0 GLB Brain Sun 13 hsa-mir-744 0 GCT Seminoma Korkola 26 hsa-mir-138 hsa-mir-374a 0 GLB Brain Sun 12 hsa-mir-924 0 GLB Brain Sun 73 hsa-mir-187 0 GLB Brain Sun 72 hsa-mir-571 hsa-mir-1294 0 GLB Brain Sun 71 hsa-mir-1182 0 CA Bladder Dyrskjot 65 hsa-mir-888 0 GLB Brain Sun 59 hsa-mir-1252 0 GLB Brain Sun 10 hsa-mir-588 hsa-mir-409-5p 0 GLB Brain Sun 15 hsa-mir-582-3p hsa-mir-219-1-3p 0 GLB Brain Sun 14 hsa-mir-1299 0 GLB Brain Sun 17 hsa-mir-621 0 GLB Brain Sun 31 hsa-mir-936 hsa-mir-501-3p 0 GLB Brain Sun 37 hsa-mir-1256 0 GLB Brain Sun 50 hsa-mir-664 hsa-mir-548c-3p 0 GLB Brain Sun 35 hsa-mir-922 0 CA Colon Graudens 15 hsa-mir-140-5p Causal 0 GLB Brain Sun 55 hsa-mir-32 0 GLB Brain Sun 74 hsa-mir-369-3p 0 GLB Brain Sun 18 hsa-mir-655 hsa-mir-498 0 GLB Brain Sun 57 hsa-mir-921 0 CA Breast Sorlie 24 hsa-mir-1538 0 CA Breast Sorlie 20 hsa-mir-1279 hsa-mir-590-3p 0 GCT Seminoma Korkola 28 hsa-mir-146a 0 CA Breast Sorlie 2 hsa-mir-653 0 CA Breast Sorlie 4 hsa-mir-611 0 CA Breast Sorlie 8 hsa-mir-494 hsa-mir-1255a 0 CA Breast Sorlie 11 hsa-mir-33a 0 CA Breast Sorlie 10 hsa-mir-23b 0 hsa-mir-23a CA Breast Sorlie 12 hsa-mir-548c-3p 0 CA Breast Sorlie 14 hsa-mir-632 0 CA Breast Sorlie 17 hsa-mir-640 0 CA Breast Sorlie 16 hsa-mir-579 0 CA Breast Sorlie 19 hsa-mir-155 Causal hsa-mir-129-5p 0 CA Breast Sorlie 18 hsa-mir-490-3p 0 GCT Seminoma Korkola 34 hsa-mir-136 0 GCT Seminoma Korkola 8 hsa-mir-940 0 CA Breast Richardson 61 hsa-mir-1271 0 CA Breast Richardson 62 hsa-mir-622 0 CA Breast Richardson 63 hsa-mir-561 0 CA Breast Richardson 53 hsa-mir-548m hsa-mir-486-5p 0 CA Breast Richardson 67 hsa-mir-889 0 CA Breast Richardson 68 hsa-mir-663b Dysregulated 0 hsa-mir-663 CA Breast Richardson 34 hsa-mir-410 hsa-mir-186 0 CA Breast Richardson 25 hsa-mir-1252 0 CA Breast Richardson 27 hsa-mir-663b Dysregulated 0 hsa-mir-663 CA Breast Richardson 46 hsa-mir-487b hsa-mir-323-3p hsa-mir-607 0 CA Breast Richardson 45 hsa-mir-181d Dysregulated hsa-mir-513a-3p 0 hsa-mir-181b CA Breast Richardson 29 hsa-mir-1302 0 CA Breast Richardson 3 hsa-mir-578 0 CA Breast Richardson 4 hsa-mir-433 0 CA Breast Richardson 28 hsa-mir-765 0 CA Breast Richardson 56 hsa-mir-146b-5p Causal hsa-mir-34b 0 hsa-mir-146a CA Breast Richardson 7 hsa-mir-590-3p 0 CA Breast Richardson 33 hsa-mir-876-5p hsa-mir-1251 0 CA Breast Richardson 38 hsa-mir-1271 hsa-mir-103b 0 hsa-mir-103a CA Breast Richardson 15 hsa-let-7d* hsa-mir-494 0 CA Breast Richardson 32 hsa-mir-1245b-5p 0 hsa-mir-1245 CA Breast Richardson 58 hsa-mir-889 0 CA Breast Richardson 13 hsa-mir-590-3p 0 CA Breast Richardson 59 hsa-mir-608 0 CA Breast Richardson 17 hsa-mir-566 hsa-mir-423-5p 0 CA Breast Richardson 16 hsa-mir-18a Dysregulated 0 CA Breast Richardson 19 hsa-mir-586 0 CA Breast Richardson 18 hsa-mir-135a 0 CA Breast Richardson 23 hsa-mir-544 0 hsa-mir-544b CA Breast Richardson 51 hsa-mir-633 0 CA Breast Richardson 50 hsa-mir-380 0 CA Breast Richardson 55 hsa-mir-130b hsa-mir-544 0 hsa-mir-301a hsa-mir-544b hsa-mir-301b hsa-mir-130a hsa-mir-454 CA Breast Richardson 54 hsa-mir-361-3p 0 CA Breast Richardson 31 hsa-mir-376a 0 CA Breast Richardson 65 hsa-mir-1254 0 OD Brain Bredel 30 hsa-mir-1306 0 MCA Breast Radvanyi 21 hsa-mir-626 0 MCA Breast Radvanyi 2 hsa-mir-204 Causal 0 MCA Breast Radvanyi 7 hsa-mir-595 hsa-mir-324-3p 0 COID Lung Bhattacharjee 71 hsa-mir-1237 0 MCA Breast Radvanyi 12 hsa-mir-489 0 OD Brain Bredel 36 hsa-mir-326 0 MCA Breast Radvanyi 17 hsa-mir-219-5p 0 MCA Breast Radvanyi 19 hsa-mir-210 Causal 0 MCA Breast Radvanyi 18 hsa-mir-663b Dysregulated 0 hsa-mir-663 ILC Breast Radvanyi 24 hsa-mir-340 0 ILC Breast Radvanyi 26 hsa-mir-486-3p 0 ILC Breast Radvanyi 20 hsa-mir-328 Dysregulated 0 ILC Breast Radvanyi 22 hsa-mir-508-3p 0 GCT Seminoma Korkola 82 hsa-mir-576-5p 0 ILC Breast Radvanyi 3 hsa-mir-383 0 ILC Breast Radvanyi 2 hsa-mir-423-3p 0 ILC Breast Radvanyi 5 hsa-mir-501-5p 0 ILC Breast Radvanyi 4 hsa-mir-122 Dysregulated hsa-mir-548a-3p 0 MM Myeloma Zhan 14 hsa-mir-548l 0 ILC Breast Radvanyi 6 hsa-let-7d* hsa-mir-579 0 ILC Breast Radvanyi 11 hsa-mir-483-5p 0 ILC Breast Radvanyi 10 hsa-mir-548c-3p 0 ILC Breast Radvanyi 15 hsa-mir-518b 0 ILC Breast Radvanyi 19 hsa-mir-663b Dysregulated hsa-mir-338-3p 0 hsa-mir-663 IDC Breast Radvanyi 56 hsa-mir-216b hsa-mir-576-5p 0 IDC Breast Radvanyi 54 hsa-mir-1277 0 IDC Breast Radvanyi 48 hsa-mir-630 0 IDC Breast Radvanyi 43 hsa-mir-1224-5p 0 GCT Seminoma Korkola 87 hsa-mir-1179 hsa-mir-371b-5p Dysregulated 0 hsa-mir-371-5p IDC Breast Radvanyi 63 hsa-mir-548h 0 IDC Breast Radvanyi 65 hsa-mir-802 0 CA Bladder Dyrskjot 80 hsa-mir-616 0 IDC Breast Radvanyi 42 hsa-mir-766 0 IDC Breast Radvanyi 24 hsa-mir-1291 0 IDC Breast Radvanyi 23 hsa-mir-376a* 0 IDC Breast Radvanyi 27 hsa-mir-323-5p 0 hsa-mir-323b-5p GBM Brain Liang 16 hsa-mir-663b 0 hsa-mir-663 IDC Breast Radvanyi 21 hsa-mir-493 0 GCT Seminoma Korkola 29 hsa-mir-548c-3p 0 IDC Breast Radvanyi 47 hsa-mir-760 0 IDC Breast Radvanyi 44 hsa-mir-548a-3p 0 IDC Breast Radvanyi 28 hsa-mir-149 Dysregulated 0 IDC Breast Radvanyi 41 hsa-mir-361-3p hsa-mir-939 0 IDC Breast Radvanyi 2 hsa-mir-513a-3p 0 IDC Breast Radvanyi 4 hsa-mir-661 Causal hsa-mir-608 0 IDC Breast Radvanyi 7 hsa-mir-450b-3p 0 GCT Seminoma Korkola 108 hsa-mir-570 hsa-mir-590-5p 0 IDC Breast Radvanyi 9 hsa-mir-661 Causal 0 IDC Breast Radvanyi 8 hsa-mir-604 hsa-mir-1273 hsa-mir-631 0 hsa-mir-1273c hsa-mir-1273d hsa-mir-1273e hsa-mir-1273f hsa-mir-1273g IDC Breast Radvanyi 15 hsa-mir-182 Causal hsa-mir-205 Causal 0 IDC Breast Radvanyi 14 hsa-mir-590-3p hsa-mir-556-5p hsa-mir-323-3p 0 IDC Breast Radvanyi 39 hsa-mir-125a-3p 0 IDC Breast Radvanyi 12 hsa-mir-590-3p 0 IDC Breast Radvanyi 59 hsa-mir-1469 0 IDC Breast Radvanyi 16 hsa-mir-9 Causal 0 IDC Breast Radvanyi 51 hsa-mir-548l hsa-mir-548n 0 IDC Breast Radvanyi 35 hsa-mir-488 0 IDC Breast Radvanyi 34 hsa-mir-532-5p 0 OD Brain Bredel 47 hsa-mir-219-1-3p 0 IDC Breast Radvanyi 18 hsa-mir-1207-3p 0 IDC Breast Radvanyi 50 hsa-mir-1247 0 CA Colon Graudens 28 hsa-mir-566 hsa-mir-508-5p 0 CA Colon Graudens 29 hsa-mir-337-3p 0 CA Colon Graudens 24 hsa-mir-381 hsa-mir-522 0 hsa-mir-300 CA Colon Graudens 25 hsa-mir-202 0 GCT Seminoma Korkola 106 hsa-mir-513b 0 CA Colon Graudens 40 hsa-mir-507 hsa-mir-369-3p 0 hsa-mir-557 CA Colon Graudens 41 hsa-mir-1243 0 CA Colon Graudens 0 hsa-mir-138 0 CA Colon Graudens 3 hsa-mir-552 0 CA Colon Graudens 2 hsa-mir-551b hsa-mir-451b Causal 0 hsa-mir-551a hsa-mir-451 GCT Seminoma Korkola 104 hsa-mir-557 0 CA Colon Graudens 4 hsa-mir-144 0 CA Colon Graudens 6 hsa-mir-658 0 CA Colon Graudens 9 hsa-mir-338-3p 0 CA Colon Graudens 8 hsa-mir-595 0 CA Colon Graudens 39 hsa-mir-873 0 CA Colon Graudens 11 hsa-mir-523 0 CA Colon Graudens 10 hsa-mir-1225-5p 0 CA Colon Graudens 38 hsa-mir-320e Dysregulated hsa-mir-96 Dysregulated 0 hsa-mir-320d hsa-mir-320c hsa-mir-320b hsa-mir-320a OD Brain Bredel 41 hsa-mir-1276 0 CA Colon Graudens 14 hsa-mir-1244 0 CA Colon Graudens 17 hsa-mir-642a hsa-mir-597 0 hsa-mir-642b RCCC Renal Lenburg 0 hsa-mir-489 Dysregulated 0 CA Colon Graudens 32 hsa-mir-296-5p Dysregulated 0 CA Colon Graudens 31 hsa-mir-548o 0 CA Colon Graudens 30 hsa-mir-125b Dysregulated 0 hsa-mir-125a-5p CA Colon Graudens 37 hsa-mir-32 Dysregulated 0 CA Colon Graudens 36 hsa-mir-576-5p hsa-mir-512-3p 0 CA Colon Graudens 35 hsa-mir-325 0 CA Colon Graudens 19 hsa-mir-148a 0 H5CC Head-Neck Cromer 25 hsa-mir-1264 hsa-mir-495 0 H5CC Head-Neck Cromer 26 hsa-mir-199a-5p Dysregulated hsa-mir-885-5p 0 hsa-mir-199b-5p H5CC Head-Neck Cromer 27 hsa-mir-615-5p 0 HSCC Head-Neck Cromer 20 hsa-mir-543 hsa-mir-567 0 HSCC Head-Neck Cromer 22 hsa-mir-218 hsa-mir-30b Dysregulated 0 HSCC Head-Neck Cromer 23 hsa-mir-380 0 HSCC Head-Neck Cromer 3 hsa-mir-496 0 HSCC Head-Neck Cromer 2 hsa-mir-374b Dysregulated 0 HSCC Head-Neck Cromer 5 hsa-mir-486-3p 0 HSCC Head-Neck Cromer 4 hsa-mir-662 0 GCT Seminoma Korkola 30 hsa-mir-588 0 HSCC Head-Neck Cromer 6 hsa-mir-1275 0 HSCC Head-Neck Cromer 8 hsa-mir-142-5p 0 HSCC Head-Neck Cromer 11 hsa-mir-129-5p 0 HSCC Head-Neck Cromer 10 hsa-mir-520a-5p 0 HSCC Head-Neck Cromer 13 hsa-mir-875-3p hsa-mir-622 0 HSCC Head-Neck Cromer 12 hsa-mir-1297 Dysregulated hsa-mir-513a-3p 0 hsa-mir-26a hsa-mir-26b MM Myeloma Zhan 10 hsa-mir-1305 0 OD Brain Bredel 7 hsa-mir-23b 0 HSCC Head-Neck Cromer 18 hsa-mir-214 Dysregulated hsa-mir-615-3p 0 HSCC Head-Neck Chung 10 hsa-mir-1226 hsa-mir-607 0 HSCC Head-Neck Chung 1 hsa-mir-29b Dysregulated hsa-mir-767-5p hsa-mir-450b-5p 0 hsa-mir-29c hsa-mir-29a IDC Breast Radvanyi 6 hsa-mir-652 0 HSCC Head-Neck Chung 3 hsa-mir-1286 0 HSCC Head-Neck Chung 2 hsa-mir-148a Dysregulated hsa-mir-944 0 hsa-mir-148b hsa-mir-152 HSCC Head-Neck Chung 5 hsa-mir-1202 0 HSCC Head-Neck Chung 4 hsa-mir-548l 0 HSCC Head-Neck Chung 7 hsa-mir-487a hsa-mir-573 0 HSCC Head-Neck Chung 6 hsa-mir-590-3p 0 HSCC Head-Neck Chung 9 hsa-mir-708 0 HSCC Head-Neck Chung 8 hsa-mir-410 0 B-CLL Leukemia Haslinger 30 hsa-mir-654-3p 0 B-CLL Leukemia Haslinger 28 hsa-mir-376a 0 hsa-mir-376b hsa-mir-376c GCT Seminoma Korkola 60 hsa-mir-551a 0 B-CLL Leukemia Haslinger 36 hsa-mir-587 0 B-CLL Leukemia Haslinger 61 hsa-mir-588 0 B-CLL Leukemia Haslinger 62 hsa-mir-515-5p hsa-mir-548c-3p 0 B-CLL Leukemia Haslinger 64 hsa-mir-1278 0 B-CLL Leukemia Haslinger 65 hsa-mir-1247 0 B-CLL Leukemia Haslinger 66 hsa-mir-939 0 B-CLL Leukemia Haslinger 68 hsa-mir-377 hsa-mir-520g 0 B-CLL Leukemia Haslinger 69 hsa-mir-450a hsa-mir-532-5p hsa-mir-146a Dysregulated 0 B-CLL Leukemia Haslinger 52 hsa-mir-323-3p hsa-mir-302a 0 B-CLL Leukemia Haslinger 25 hsa-mir-1237 hsa-mir-548c-3p 0 B-CLL Leukemia Haslinger 27 hsa-mir-760 0 B-CLL Leukemia Haslinger 21 hsa-mir-429 Causal hsa-mir-548c-3p 0 hsa-mir-200b hsa-mir-200c hsa-mir-200a B-CLL Leukemia Haslinger 48 hsa-mir-520d-5p 0 hsa-mir-524-5p B-CLL Leukemia Haslinger 23 hsa-mir-548o 0 B-CLL Leukemia Haslinger 46 hsa-mir-1249 hsa-mir-1247 0 B-CLL Leukemia Haslinger 44 hsa-mir-200b Causal 0 B-CLL Leukemia Haslinger 45 hsa-mir-889 0 B-CLL Leukemia Haslinger 29 hsa-mir-520f hsa-mir-1270 0 B-CLL Leukemia Haslinger 40 hsa-mir-582-3p 0 B-CLL Leukemia Haslinger 41 hsa-mir-483-5p 0 B-CLL Leukemia Haslinger 1 hsa-mir-487a 0 B-CLL Leukemia Haslinger 0 hsa-mir-409-5p 0 B-CLL Leukemia Haslinger 5 hsa-mir-622 0 B-CLL Leukemia Haslinger 9 hsa-mir-1245b-5p 0 hsa-mir-1245 B-CLL Leukemia Haslinger 8 hsa-mir-939 0 B-CLL Leukemia Haslinger 56 hsa-mir-548b-3p 0 B-CLL Leukemia Haslinger 43 hsa-mir-483-3p 0 B-CLL Leukemia Haslinger 35 hsa-mir-1294 hsa-mir-486-3p 0 END Ovarian Hendrix 77 hsa-mir-590-3p 0 B-CLL Leukemia Haslinger 15 hsa-mir-338-5p hsa-mir-654-3p 0 B-CLL Leukemia Haslinger 58 hsa-mir-337-5p 0 B-CLL Leukemia Haslinger 11 hsa-mir-34c-3p 0 B-CLL Leukemia Haslinger 10 hsa-mir-454 0 B-CLL Leukemia Haslinger 13 hsa-mir-892b 0 B-CLL Leukemia Haslinger 38 hsa-mir-548g 0 B-CLL Leukemia Haslinger 59 hsa-mir-636 hsa-mir-1228 0 B-CLL Leukemia Haslinger 17 hsa-mir-590-3p 0 B-CLL Leukemia Haslinger 16 hsa-mir-1285 0 B-CLL Leukemia Haslinger 54 hsa-mir-937 hsa-mir-1321 0 B-CLL Leukemia Haslinger 49 hsa-mir-660 hsa-mir-1227 0 B-CLL Leukemia Haslinger 51 hsa-mir-448 0 B-CLL Leukemia Haslinger 50 hsa-mir-296-5p 0 B-CLL Leukemia Haslinger 34 hsa-mir-492 0 B-CLL Leukemia Haslinger 55 hsa-mir-1323 hsa-mir-200b Causal 0 hsa-mir-548o B-CLL Leukemia Haslinger 37 hsa-mir-545 hsa-mir-323-3p 0 B-CLL Leukemia Haslinger 31 hsa-mir-1321 0 AD Lung Beer 51 hsa-mir-1202 0 AD Lung Beer 22 hsa-mir-525-5p 0 AD Lung Beer 34 hsa-mir-193b hsa-mir-646 0 AD Lung Beer 53 hsa-mir-581 hsa-mir-548d-3p 0 AD Lung Beer 24 hsa-mir-770-5p 0 OD Brain Bredel 15 hsa-mir-765 0 AD Lung Beer 27 hsa-mir-320e 0 hsa-mir-320d hsa-mir-320c hsa-mir-320b hsa-mir-320a GLB Brain Sun 76 hsa-mir-561 hsa-mir-139-5p Dysregulated 0 AD Lung Beer 46 hsa-mir-874 hsa-mir-606 0 AD Lung Beer 44 hsa-mir-484 hsa-mir-452 0 AD Lung Beer 42 hsa-mir-651 0 AD Lung Beer 43 hsa-mir-1275 0 AD Lung Beer 40 hsa-mir-320e hsa-mir-561 0 hsa-mir-320d hsa-mir-320c hsa-mir-320b hsa-mir-320a AD Lung Beer 1 hsa-mir-766 0 AD Lung Beer 0 hsa-let-7d Causal 0 AD Lung Beer 3 hsa-mir-338-5p Dysregulated 0 GCT Seminoma Korkola 93 hsa-mir-193a-5p hsa-mir-640 0 AD Lung Beer 5 hsa-mir-1292 0 AD Lung Beer 4 hsa-mir-1183 0 AD Lung Beer 7 hsa-mir-548b-5p 0 hsa-mir-548am hsa-mir-548ab hsa-mir-548aa hsa-mir-548ag hsa-mir-548ak hsa-mir-548aj hsa-mir-548ai hsa-mir-548ah hsa-mir-548an hsa-mir-548al hsa-mir-548ae hsa-mir-548ad hsa-mir-548a-5p hsa-mir-548ac hsa-mir-548d-5p hsa-mir-548i hsa-mir-548j hsa-mir-548c-5p hsa-mir-548h AD Lung Beer 6 hsa-mir-548c-3p 0 AD Lung Beer 8 hsa-mir-939 hsa-mir-637 0 AD Lung Beer 28 hsa-mir-147 hsa-mir-1245b-5p 0 hsa-mir-147b hsa-mir-1245 AD Lung Beer 38 hsa-mir-933 0 AD Lung Beer 29 hsa-mir-661 0 AD Lung Beer 11 hsa-mir-9 Dysregulated 0 OD Brain Bredel 18 hsa-mir-1261 0 AD Lung Beer 12 hsa-mir-1208 hsa-mir-378b 0 hsa-mir-378c hsa-mir-378f hsa-mir-378g hsa-mir-378d hsa-mir-378e hsa-mir-378h hsa-mir-378i hsa-mir-378 AD Lung Beer 15 hsa-mir-586 0 AD Lung Beer 14 hsa-mir-571 hsa-mir-542-5p 0 AD Lung Beer 32 hsa-mir-656 0 MUC Ovarian Hendrix 35 hsa-mir-340 0 AD Lung Beer 35 hsa-mir-222 Causal 0 AD Lung Beer 52 hsa-mir-372 Causal 0 AD Lung Beer 19 hsa-mir-487b 0 AD Lung Beer 18 hsa-mir-876-3p hsa-mir-19a Causal 0 AD Lung Beer 33 hsa-mir-380 hsa-mir-379 0 GCT Seminoma Korkola 96 hsa-mir-29a 0 CA Bladder Dyrskjot 18 hsa-mir-1291 0 AD Lung Bhattacharjee 60 hsa-mir-190b hsa-mir-495 0 hsa-mir-190 AD Lung Bhattacharjee 82 hsa-mir-647 0 AD Lung Bhattacharjee 64 hsa-mir-150 Dysregulated hsa-mir-765 0 AD Lung Bhattacharjee 65 hsa-mir-3177-5p hsa-mir-486-3p 0 AD Lung Bhattacharjee 67 hsa-mir-361-5p 0 AD Lung Bhattacharjee 69 hsa-mir-23b hsa-mir-522 0 hsa-mir-23a AD Lung Bhattacharjee 81 hsa-mir-516b 0 AD Lung Bhattacharjee 24 hsa-mir-608 0 HSCC Head-Neck Cromer 19 hsa-mir-548l 0 AD Lung Bhattacharjee 27 hsa-mir-487b hsa-mir-451b Dysregulated 0 hsa-mir-451 AD Lung Bhattacharjee 20 hsa-mir-599 hsa-mir-1245b-5p 0 hsa-mir-1245 AD Lung Bhattacharjee 22 hsa-mir-875-3p hsa-mir-619 0 AD Lung Bhattacharjee 46 hsa-mir-548a-3p hsa-mir-548c-3p 0 hsa-mir-548e hsa-mir-548f AD Lung Bhattacharjee 47 hsa-mir-409-3p hsa-mir-1245b-5p 0 hsa-mir-1245 AD Lung Bhattacharjee 44 hsa-mir-655 hsa-mir-633 hsa-mir-1284 0 AD Lung Bhattacharjee 45 hsa-mir-340 0 AD Lung Bhattacharjee 42 hsa-mir-760 0 AD Lung Bhattacharjee 41 hsa-mir-296-5p 0 AD Lung Bhattacharjee 0 hsa-mir-338-5p Dysregulated 0 OD Brain Bredel 61 hsa-mir-937 0 AD Lung Bhattacharjee 2 hsa-mir-645 0 AD Lung Bhattacharjee 4 hsa-mir-1321 0 AD Lung Bhattacharjee 7 hsa-mir-570 hsa-mir-1305 0 AD Lung Bhattacharjee 6 hsa-mir-941 hsa-mir-602 0 AD Lung Bhattacharjee 9 hsa-mir-154 0 AD Lung Bhattacharjee 8 hsa-mir-1324 0 AD Lung Bhattacharjee 52 hsa-let-7a Causal 0 AD Lung Bhattacharjee 28 hsa-mir-122 hsa-mir-548a-3p 0 AD Lung Bhattacharjee 49 hsa-mir-567 0 GCT Seminoma Korkola 16 hsa-mir-1183 0 AD Lung Bhattacharjee 39 hsa-mir-525-3p 0 hsa-mir-524-3p AD Lung Bhattacharjee 35 hsa-mir-133a 0 AD Lung Bhattacharjee 76 hsa-mir-371-3p 0 AD Lung Bhattacharjee 75 hsa-mir-1270 hsa-mir-637 0 hsa-mir-620 AD Lung Bhattacharjee 74 hsa-mir-543 0 AD Lung Bhattacharjee 72 hsa-mir-507 0 hsa-mir-557 MPC Prostate Dhanasekaran 36 hsa-mir-942 0 AD Lung Bhattacharjee 10 hsa-mir-1321 0 GL Brain Bredel 22 hsa-mir-657 0 AD Lung Bhattacharjee 59 hsa-mir-29b Causal 0 hsa-mir-29c hsa-mir-29a AD Lung Bhattacharjee 14 hsa-mir-517c hsa-mir-938 0 hsa-mir-517b hsa-mir-517a AD Lung Bhattacharjee 17 hsa-mir-491-5p 0 GCT Seminoma Korkola 50 hsa-mir-376a 0 hsa-mir-376b hsa-mir-376c AD Lung Bhattacharjee 33 hsa-mir-892a hsa-mir-490-5p 0 AD Lung Bhattacharjee 30 hsa-mir-607 hsa-mir-548c-3p 0 AD Lung Bhattacharjee 50 hsa-mir-642a 0 hsa-mir-642b AD Lung Bhattacharjee 53 hsa-mir-146b-5p Dysregulated 0 hsa-mir-146a AD Lung Bhattacharjee 34 hsa-mir-296-5p 0 AD Lung Bhattacharjee 19 hsa-mir-1322 hsa-mir-1247 0 AD Lung Bhattacharjee 55 hsa-mir-1286 0 AD Lung Bhattacharjee 12 hsa-mir-590-3p 0 GL Brain Bredel 60 hsa-mir-513a-5p hsa-mir-25 Dysregulated 0 COID Lung Bhattacharjee 24 hsa-mir-342-5p 0 COID Lung Bhattacharjee 25 hsa-mir-1276 hsa-mir-361-5p 0 COID Lung Bhattacharjee 20 hsa-mir-615-3p 0 COID Lung Bhattacharjee 21 hsa-mir-590-3p hsa-mir-944 0 COID Lung Bhattacharjee 23 hsa-mir-1228 0 COID Lung Bhattacharjee 28 hsa-mir-758 hsa-mir-608 0 COID Lung Bhattacharjee 0 hsa-mir-663b hsa-mir-518d-5p 0 hsa-mir-663 COID Lung Bhattacharjee 8 hsa-mir-607 hsa-mir-340 0 COID Lung Bhattacharjee 58 hsa-mir-23a 0 CA Colon Graudens 5 hsa-mir-548h 0 COID Lung Bhattacharjee 51 hsa-mir-656 0 COID Lung Bhattacharjee 52 hsa-mir-154 0 COID Lung Bhattacharjee 89 hsa-mir-1254 0 COID Lung Bhattacharjee 80 hsa-mir-548l 0 COID Lung Bhattacharjee 81 hsa-mir-369-3p 0 COID Lung Bhattacharjee 86 hsa-mir-580 hsa-mir-410 0 COID Lung Bhattacharjee 87 hsa-mir-1181 0 COID Lung Bhattacharjee 84 hsa-mir-615-5p 0 COID Lung Bhattacharjee 85 hsa-mir-1180 0 COID Lung Bhattacharjee 3 hsa-mir-940 0 COID Lung Bhattacharjee 7 hsa-mir-431 hsa-mir-608 0 COID Lung Bhattacharjee 39 hsa-mir-608 0 COID Lung Bhattacharjee 31 hsa-mir-331-3p 0 COID Lung Bhattacharjee 30 hsa-mir-423-5p Dysregulated 0 CA Bladder Dyrskjot 29 hsa-mir-548c-3p 0 COID Lung Bhattacharjee 36 hsa-mir-890 0 COID Lung Bhattacharjee 60 hsa-mir-505 hsa-mir-516a-3p 0 COID Lung Bhattacharjee 61 hsa-mir-494 hsa-mir-34c-3p 0 GCT Seminoma Korkola 5 hsa-mir-1204 0 COID Lung Bhattacharjee 64 hsa-mir-661 0 COID Lung Bhattacharjee 66 hsa-mir-507 0 COID Lung Bhattacharjee 67 hsa-mir-512-3p hsa-mir-181d 0 COID Lung Bhattacharjee 68 hsa-mir-1272 0 COID Lung Bhattacharjee 69 hsa-mir-765 0 COID Lung Bhattacharjee 2 hsa-mir-548d-3p 0 COID Lung Bhattacharjee 6 hsa-mir-874 0 COID Lung Bhattacharjee 91 hsa-mir-1275 0 COID Lung Bhattacharjee 92 hsa-mir-920 0 COID Lung Bhattacharjee 11 hsa-mir-501-5p hsa-mir-513b 0 COID Lung Bhattacharjee 10 hsa-mir-138-2* hsa-mir-513a-3p hsa-mir-101 Dysregulated 0 COID Lung Bhattacharjee 12 hsa-mir-509-5p hsa-mir-494 0 hsa-mir-509-3p hsa-mir-509-3-5p COID Lung Bhattacharjee 14 hsa-mir-557 0 COID Lung Bhattacharjee 17 hsa-mir-885-3p 0 COID Lung Bhattacharjee 16 hsa-mir-376a 0 COID Lung Bhattacharjee 19 hsa-mir-553 hsa-mir-615-5p 0 COID Lung Bhattacharjee 18 hsa-mir-663b 0 hsa-mir-663 GL Brain Bredel 25 hsa-mir-338-5p Dysregulated hsa-mir-513b 0 COID Lung Bhattacharjee 47 hsa-mir-574-3p 0 COID Lung Bhattacharjee 44 hsa-mir-504 0 COID Lung Bhattacharjee 45 hsa-mir-615-5p 0 COID Lung Bhattacharjee 42 hsa-mir-671-5p 0 COID Lung Bhattacharjee 43 hsa-mir-658 0 COID Lung Bhattacharjee 40 hsa-mir-1181 hsa-mir-93 Causal 0 COID Lung Bhattacharjee 41 hsa-mir-1303 0 COID Lung Bhattacharjee 5 hsa-mir-361-5p hsa-mir-548o 0 COID Lung Bhattacharjee 9 hsa-mir-622 0 GCT Seminoma Korkola 73 hsa-mir-675 0 COID Lung Bhattacharjee 75 hsa-mir-874 0 COID Lung Bhattacharjee 73 hsa-mir-1262 0 COID Lung Bhattacharjee 72 hsa-mir-548n 0 GCT Seminoma Korkola 72 hsa-mir-490-3p hsa-mir-760 0 COID Lung Bhattacharjee 79 hsa-mir-508-3p 0 COID Lung Bhattacharjee 78 hsa-mir-920 hsa-mir-27b Dysregulated 0 SQ Lung Bhattacharjee 41 hsa-mir-885-3p 0 SQ Lung Bhattacharjee 22 hsa-mir-548n hsa-mir-607 0 SQ Lung Bhattacharjee 35 hsa-mir-449c* 0 SQ Lung Bhattacharjee 34 hsa-mir-718 0 SQ Lung Bhattacharjee 23 hsa-mir-586 0 SQ Lung Bhattacharjee 24 hsa-mir-889 0 GCT Seminoma Korkola 70 hsa-mir-939 0 SQ Lung Bhattacharjee 27 hsa-mir-940 0 SQ Lung Bhattacharjee 21 hsa-mir-455-5p 0 SQ Lung Bhattacharjee 49 hsa-mir-34a Causal 0 SQ Lung Bhattacharjee 46 hsa-mir-650 0 SQ Lung Bhattacharjee 44 hsa-mir-4285 hsa-mir-767-5p 0 SQ Lung Bhattacharjee 45 hsa-mir-654-5p 0 SQ Lung Bhattacharjee 28 hsa-mir-616 0 SQ Lung Bhattacharjee 29 hsa-mir-486-3p 0 SQ Lung Bhattacharjee 40 hsa-mir-339-3p 0 SQ Lung Bhattacharjee 42 hsa-mir-637 0 SQ Lung Bhattacharjee 0 hsa-mir-662 0 GL Brain Bredel 47 hsa-mir-1236 0 SQ Lung Bhattacharjee 5 hsa-mir-595 0 SQ Lung Bhattacharjee 4 hsa-mir-423-5p Dysregulated hsa-mir-214 Dysregulated 0 SQ Lung Bhattacharjee 7 hsa-mir-765 0 SQ Lung Bhattacharjee 9 hsa-mir-891a 0 SQ Lung Bhattacharjee 8 hsa-mir-1203 0 SQ Lung Bhattacharjee 43 hsa-mir-597 hsa-mir-635 0 SQ Lung Bhattacharjee 13 hsa-mir-296-5p 0 SQ Lung Bhattacharjee 15 hsa-mir-96 Dysregulated hsa-mir-569 0 SQ Lung Bhattacharjee 14 hsa-mir-486-3p 0 SQ Lung Bhattacharjee 16 hsa-mir-802 0 SQ Lung Bhattacharjee 19 hsa-mir-423-5p Dysregulated hsa-mir-647 0 SQ Lung Bhattacharjee 18 hsa-mir-767-5p hsa-mir-410 0 SQ Lung Bhattacharjee 30 hsa-mir-1233 0 SQ Lung Bhattacharjee 37 hsa-mir-770-5p 0 SQ Lung Bhattacharjee 50 hsa-mir-607 0 SQ Lung Bhattacharjee 52 hsa-mir-411 0 SQ Lung Bhattacharjee 33 hsa-mir-339-5p Dysregulated 0 SQ Lung Bhattacharjee 32 hsa-mir-532-3p hsa-mir-210 Dysregulated 0 SMCL Lung Bhattacharjee 30 hsa-mir-548n hsa-mir-655 0 SMCL Lung Bhattacharjee 36 hsa-mir-296-5p 0 SMCL Lung Bhattacharjee 60 hsa-mir-671-3p 0 SMCL Lung Bhattacharjee 61 hsa-mir-331-3p 0 SMCL Lung Bhattacharjee 35 hsa-mir-212 Dysregulated 0 SMCL Lung Bhattacharjee 32 hsa-mir-582-5p 0 MUC Ovarian Hendrix 13 hsa-mir-1280 0 SMCL Lung Bhattacharjee 25 hsa-mir-101 Dysregulated 0 SMCL Lung Bhattacharjee 20 hsa-mir-423-5p Dysregulated 0 SMCL Lung Bhattacharjee 21 hsa-mir-570 0 SMCL Lung Bhattacharjee 46 hsa-mir-499a-5p hsa-mir-891b 0 hsa-mir-499-5p SMCL Lung Bhattacharjee 23 hsa-mir-3183 0 SMCL Lung Bhattacharjee 45 hsa-mir-432 hsa-mir-125a-5p Causal 0 SMCL Lung Bhattacharjee 28 hsa-mir-744 0 SMCL Lung Bhattacharjee 43 hsa-mir-671-3p 0 SMCL Lung Bhattacharjee 41 hsa-mir-512-3p 0 SMCL Lung Bhattacharjee 1 hsa-mir-1237 0 SMCL Lung Bhattacharjee 2 hsa-mir-1266 hsa-mir-940 0 SMCL Lung Bhattacharjee 5 hsa-mir-1321 0 SMCL Lung Bhattacharjee 7 hsa-mir-615-5p 0 SMCL Lung Bhattacharjee 9 hsa-mir-362-3p 0 hsa-mir-329 SMCL Lung Bhattacharjee 34 hsa-mir-1207-5p 0 SMCL Lung Bhattacharjee 47 hsa-mir-302e 0 SMCL Lung Bhattacharjee 15 hsa-mir-216b Dysregulated 0 SMCL Lung Bhattacharjee 29 hsa-mir-513a-3p hsa-mir-548c-3p 0 SMCL Lung Bhattacharjee 11 hsa-mir-1321 0 SMCL Lung Bhattacharjee 10 hsa-mir-720 0 SMCL Lung Bhattacharjee 59 hsa-mir-340 0 SMCL Lung Bhattacharjee 58 hsa-mir-423-5p Dysregulated 0 SMCL Lung Bhattacharjee 17 hsa-mir-888 0 SMCL Lung Bhattacharjee 55 hsa-mir-590-3p 0 SMCL Lung Bhattacharjee 57 hsa-mir-448 0 SMCL Lung Bhattacharjee 56 hsa-mir-888 0 SMCL Lung Bhattacharjee 51 hsa-mir-1273 0 hsa-mir-1273c hsa-mir-1273d hsa-mir-1273e hsa-mir-1273f hsa-mir-1273g SMCL Lung Bhattacharjee 50 hsa-mir-664 0 SMCL Lung Bhattacharjee 53 hsa-mir-20a Causal 0 SMCL Lung Bhattacharjee 52 hsa-mir-483-3p hsa-mir-939 0 SMCL Lung Bhattacharjee 16 hsa-mir-339-3p 0 SMCL Lung Bhattacharjee 18 hsa-mir-624 hsa-mir-513c 0 hsa-mir-513b hsa-mir-513a-5p SMCL Lung Bhattacharjee 31 hsa-mir-513a-3p 0 AD Lung Stearman 25 hsa-mir-200a Causal hsa-mir-519a 0 hsa-mir-141 AD Lung Stearman 27 hsa-mir-300 0 AD Lung Stearman 29 hsa-mir-598 hsa-mir-425 Dysregulated 0 CA Breast Richardson 37 hsa-mir-1289 0 AD Lung Stearman 0 hsa-mir-518a-5p hsa-mir-369-3p 0 hsa-mir-527 AD Lung Stearman 5 hsa-mir-342-3p 0 AD Lung Stearman 7 hsa-mir-1269b hsa-mir-16 Causal 0 hsa-mir-1269 AD Lung Stearman 6 hsa-mir-380 0 AD Lung Stearman 9 hsa-mir-548g 0 AD Lung Stearman 13 hsa-mir-455-5p hsa-mir-23a 0 AD Lung Stearman 19 hsa-mir-370 0 AD Lung Stearman 36 hsa-mir-1269b 0 hsa-mir-1269 AD Lung Stearman 35 hsa-mir-668 0 AD Lung Stearman 33 hsa-mir-196b hsa-mir-1293 0 hsa-mir-196a AD Lung Stearman 32 hsa-mir-588 0 FL Lymphoma Alizadeh 11 hsa-mir-148a hsa-mir-614 0 hsa-mir-148b hsa-mir-152 FL Lymphoma Alizadeh 0 hsa-mir-92a Dysregulated 0 FL Lymphoma Alizadeh 2 hsa-mir-425* hsa-mir-149 Dysregulated 0 FL Lymphoma Alizadeh 5 hsa-mir-581 0 FL Lymphoma Alizadeh 4 hsa-mir-4261 hsa-mir-1295 0 FL Lymphoma Alizadeh 7 hsa-mir-1282 0 FL Lymphoma Alizadeh 6 hsa-mir-338-5p Dysregulated 0 FL Lymphoma Alizadeh 9 hsa-mir-767-3p hsa-mir-942 0 DLBCL Lymphoma Alizadeh 11 hsa-mir-1203 0 DLBCL Lymphoma Alizadeh 10 hsa-mir-325 0 DLBCL Lymphoma Alizadeh 1 hsa-mir-138 hsa-mir-16 0 DLBCL Lymphoma Alizadeh 3 hsa-mir-744 0 DLBCL Lymphoma Alizadeh 2 hsa-mir-660 0 DLBCL Lymphoma Alizadeh 5 hsa-mir-132* hsa-mir-198 0 DLBCL Lymphoma Alizadeh 4 hsa-mir-297 0 DLBCL Lymphoma Alizadeh 7 hsa-mir-532-3p hsa-mir-1301 0 DLBCL Lymphoma Alizadeh 6 hsa-mir-542-5p hsa-mir-483-3p 0 DLBCL Lymphoma Alizadeh 9 hsa-mir-892b hsa-mir-1277 0 CLL Lymphoma Alizadeh 13 hsa-mir-423-5p 0 CLL Lymphoma Alizadeh 1 hsa-mir-1204 0 CLL Lymphoma Alizadeh 0 hsa-mir-1283 hsa-mir-548j 0 CLL Lymphoma Alizadeh 3 hsa-mir-513b 0 CLL Lymphoma Alizadeh 4 hsa-mir-29b Causal 0 CLL Lymphoma Alizadeh 7 hsa-mir-1263 0 CLL Lymphoma Alizadeh 8 hsa-mir-222 0 ME Melanoma Hoek 25 hsa-mir-26a 0 ME Melanoma Hoek 26 hsa-mir-577 0 ME Melanoma Hoek 20 hsa-mir-331-5p Dysregulated 0 OD Brain Bredel 50 hsa-mir-1254 0 ME Melanoma Hoek 47 hsa-mir-549 0 ME Melanoma Hoek 44 hsa-mir-1299 hsa-mir-1183 0 ME Melanoma Hoek 41 hsa-mir-938 hsa-mir-451b 0 hsa-mir-451 ME Melanoma Hoek 0 hsa-mir-34b Dysregulated hsa-mir-582-5p 0 ME Melanoma Hoek 3 hsa-mir-4285 0 CA Bladder Dyrskjot 9 hsa-mir-452 Dysregulated hsa-mir-548c-3p 0 ME Melanoma Hoek 6 hsa-mir-410 hsa-mir-186 0 ME Melanoma Hoek 9 hsa-mir-106b Dysregulated hsa-mir-494 0 hsa-mir-17 hsa-mir-106a hsa-mir-93 hsa-mir-20b hsa-mir-20a ME Melanoma Hoek 39 hsa-mir-212 hsa-mir-944 0 hsa-mir-132 ME Melanoma Hoek 12 hsa-mir-892a hsa-mir-935 0 ME Melanoma Hoek 15 hsa-mir-217 hsa-mir-1292 0 ME Melanoma Hoek 16 hsa-mir-631 0 ME Melanoma Hoek 33 hsa-mir-1265 0 ME Melanoma Hoek 23 hsa-mir-32 0 ME Melanoma Hoek 37 hsa-mir-380 0 ME Melanoma Hoek 50 hsa-mir-548c-3p 0 GCT Seminoma Korkola 92 hsa-mir-564 0 ML Melanoma Talantov 25 hsa-mir-606 0 ML Melanoma Talantov 26 hsa-mir-607 hsa-mir-664 0 ML Melanoma Talantov 27 hsa-mir-96 Dysregulated 0 ML Melanoma Talantov 21 hsa-mir-450b-5p 0 ML Melanoma Talantov 22 hsa-mir-520d-5p hsa-mir-570 0 hsa-mir-524-5p ML Melanoma Talantov 23 hsa-mir-548p 0 ML Melanoma Talantov 28 hsa-mir-3175 hsa-mir-1207-5p 0 ML Melanoma Talantov 29 hsa-mir-1257 0 ML Melanoma Talantov 40 hsa-mir-296-5p 0 ML Melanoma Talantov 0 hsa-mir-603 0 ML Melanoma Talantov 3 hsa-mir-181a Dysregulated hsa-mir-548n 0 hsa-mir-181d hsa-mir-181b hsa-mir-181c ML Melanoma Talantov 4 hsa-mir-146b-3p 0 ML Melanoma Talantov 7 hsa-mir-125b Dysregulated hsa-mir-296-5p 0 hsa-mir-125a-5p ML Melanoma Talantov 9 hsa-mir-151-3p hsa-mir-493 0 ML Melanoma Talantov 8 hsa-mir-199b-5p Dysregulated 0 ML Melanoma Talantov 13 hsa-mir-337-5p 0 ML Melanoma Talantov 10 hsa-mir-623 hsa-mir-1180 0 ML Melanoma Talantov 12 hsa-mir-125b Dysregulated hsa-mir-324-3p 0 hsa-mir-125a-5p ML Melanoma Talantov 14 hsa-mir-519a hsa-mir-548c-3p 0 hsa-mir-519c-3p hsa-mir-519b-3p ML Melanoma Talantov 19 hsa-mir-302c* hsa-mir-421 hsa-mir-548c-3p 0 ML Melanoma Talantov 18 hsa-mir-513a-3p 0 ML Melanoma Talantov 36 hsa-mir-663b 0 hsa-mir-663 ML Melanoma Talantov 34 hsa-mir-548c-3p hsa-mir-767-3p hsa-mir-548n 0 ML Melanoma Talantov 33 hsa-mir-605 0 MPM Mesothelioma Gordon 56 hsa-mir-595 Dysregulated hsa-mir-590-3p 0 MPM Mesothelioma Gordon 41 hsa-mir-519e hsa-mir-381 0 MPM Mesothelioma Gordon 42 hsa-mir-183 hsa-mir-539 0 MPM Mesothelioma Gordon 29 hsa-mir-1265 0 MPM Mesothelioma Gordon 61 hsa-mir-545 hsa-mir-1287 0 MPM Mesothelioma Gordon 62 hsa-mir-1279 hsa-mir-708 0 MPM Mesothelioma Gordon 36 hsa-mir-487a 0 MPM Mesothelioma Gordon 64 hsa-mir-655 0 MPM Mesothelioma Gordon 65 hsa-mir-590-3p hsa-mir-548n 0 MPM Mesothelioma Gordon 52 hsa-mir-606 0 MPM Mesothelioma Gordon 24 hsa-mir-361-3p 0 MPM Mesothelioma Gordon 27 hsa-mir-1301 hsa-mir-128 0 MPM Mesothelioma Gordon 21 hsa-mir-548c-3p 0 MPM Mesothelioma Gordon 22 hsa-mir-1284 0 MPM Mesothelioma Gordon 44 hsa-mir-338-5p 0 MPM Mesothelioma Gordon 48 hsa-mir-561 hsa-mir-606 0 MPM Mesothelioma Gordon 28 hsa-mir-590-3p 0 MPM Mesothelioma Gordon 40 hsa-mir-3178 0 MPM Mesothelioma Gordon 1 hsa-mir-1224-5p 0 MPM Mesothelioma Gordon 2 hsa-mir-1207-5p 0 MPM Mesothelioma Gordon 5 hsa-mir-603 0 MPM Mesothelioma Gordon 7 hsa-mir-526b 0 MPM Mesothelioma Gordon 6 hsa-mir-192 0 MPM Mesothelioma Gordon 9 hsa-mir-219-5p 0 MPM Mesothelioma Gordon 8 hsa-mir-1180 0 MPM Mesothelioma Gordon 35 hsa-mir-371b-5p 0 hsa-mir-371-5p MPM Mesothelioma Gordon 13 hsa-mir-1250 hsa-mir-585 0 MPM Mesothelioma Gordon 38 hsa-mir-1276 hsa-mir-145 0 MPM Mesothelioma Gordon 59 hsa-mir-423-5p Dysregulated 0 MPM Mesothelioma Gordon 14 hsa-mir-361-3p 0 MPM Mesothelioma Gordon 11 hsa-mir-491-3p hsa-mir-889 0 MPM Mesothelioma Gordon 15 hsa-mir-1229 0 MPM Mesothelioma Gordon 17 hsa-mir-1296 0 MPM Mesothelioma Gordon 16 hsa-mir-548m hsa-mir-590-3p 0 MPM Mesothelioma Gordon 54 hsa-mir-548h 0 MPM Mesothelioma Gordon 51 hsa-mir-605 hsa-mir-376a 0 MPM Mesothelioma Gordon 53 hsa-mir-1182 0 MPM Mesothelioma Gordon 19 hsa-mir-615-5p hsa-mir-423-5p Dysregulated 0 MPM Mesothelioma Gordon 63 hsa-mir-548b-5p hsa-mir-548c-3p 0 hsa-mir-548am hsa-mir-548ab hsa-mir-548aa hsa-mir-548ag hsa-mir-548ak hsa-mir-548aj hsa-mir-548ai hsa-mir-548ah hsa-mir-548an hsa-mir-548al hsa-mir-548ae hsa-mir-548ad hsa-mir-548a-5p hsa-mir-548ac hsa-mir-548d-5p hsa-mir-548i hsa-mir-548j hsa-mir-548c-5p hsa-mir-548h MPM Mesothelioma Gordon 32 hsa-mir-541 0 MPM Mesothelioma Gordon 31 hsa-mir-127-5p Causal 0 MM Myeloma Zhan 45 hsa-mir-595 0 MM Myeloma Zhan 22 hsa-mir-1236 0 MM Myeloma Zhan 36 hsa-mir-1273 0 hsa-mir-1273c hsa-mir-1273d hsa-mir-1273e hsa-mir-1273f hsa-mir-1273g MM Myeloma Zhan 24 hsa-mir-140-3p Dysregulated 0 MM Myeloma Zhan 25 hsa-mir-188-5p 0 MM Myeloma Zhan 26 hsa-mir-1321 0 MM Myeloma Zhan 20 hsa-mir-1226 0 MM Myeloma Zhan 21 hsa-mir-183 0 MM Myeloma Zhan 49 hsa-mir-138 0 MM Myeloma Zhan 46 hsa-mir-425 0 MM Myeloma Zhan 47 hsa-mir-875-3p hsa-mir-662 0 MM Myeloma Zhan 43 hsa-mir-23b hsa-mir-124 Causal 0 hsa-mir-23a MM Myeloma Zhan 40 hsa-mir-382 hsa-mir-612 0 MM Myeloma Zhan 41 hsa-mir-339-5p 0 MM Myeloma Zhan 1 hsa-mir-519e 0 MM Myeloma Zhan 0 hsa-mir-1207-5p 0 MM Myeloma Zhan 3 hsa-mir-590-3p hsa-mir-548c-3p 0 MM Myeloma Zhan 2 hsa-mir-587 0 MM Myeloma Zhan 4 hsa-mir-361-3p hsa-mir-185 0 MM Myeloma Zhan 7 hsa-mir-510 hsa-mir-645 0 MM Myeloma Zhan 6 hsa-mir-516b hsa-mir-600 0 MM Myeloma Zhan 9 hsa-mir-9 hsa-mir-185 0 MM Myeloma Zhan 39 hsa-mir-647 0 MM Myeloma Zhan 38 hsa-mir-652 0 MM Myeloma Zhan 29 hsa-mir-760 0 MM Myeloma Zhan 11 hsa-mir-658 0 AD Lung Beer 10 hsa-mir-600 0 MM Myeloma Zhan 13 hsa-mir-655 hsa-mir-770-5p 0 MM Myeloma Zhan 15 hsa-mir-922 0 CA Bladder Dyrskjot 62 hsa-mir-637 0 MM Myeloma Zhan 17 hsa-mir-320e hsa-mir-495 0 hsa-mir-320d hsa-mir-320c hsa-mir-320b hsa-mir-320a MM Myeloma Zhan 16 hsa-mir-134 0 MM Myeloma Zhan 32 hsa-mir-212 hsa-mir-379 0 hsa-mir-132 MM Myeloma Zhan 31 hsa-mir-597 hsa-mir-512-3p 0 MM Myeloma Zhan 30 hsa-mir-588 0 MM Myeloma Zhan 50 hsa-mir-28-5p 0 MM Myeloma Zhan 35 hsa-mir-650 hsa-mir-129-5p 0 MM Myeloma Zhan 34 hsa-mir-147 0 hsa-mir-147b MM Myeloma Zhan 33 hsa-mir-507 0 AD Ovarian Welsh 24 hsa-mir-1469 0 AD Ovarian Welsh 26 hsa-mir-210 0 AD Ovarian Welsh 20 hsa-mir-767-5p 0 AD Ovarian Welsh 21 hsa-mir-96 hsa-mir-606 0 AD Ovarian Welsh 22 hsa-mir-1207-5p 0 AD Ovarian Welsh 29 hsa-mir-3194-5p hsa-mir-1280 hsa-mir-1225-3p 0 AD Ovarian Welsh 1 hsa-mir-548d-3p 0 AD Ovarian Welsh 0 hsa-mir-510 hsa-mir-200b Causal 0 AD Ovarian Welsh 3 hsa-mir-1283 0 AD Ovarian Welsh 2 hsa-mir-122 0 AD Ovarian Welsh 5 hsa-mir-188-3p hsa-mir-455-5p 0 AD Ovarian Welsh 4 hsa-mir-424 Dysregulated 0 AD Ovarian Welsh 7 hsa-mir-650 0 AD Ovarian Welsh 6 hsa-let-7e* 0 AD Ovarian Welsh 9 hsa-mir-524-5p 0 AD Ovarian Welsh 8 hsa-mir-1260 0 hsa-mir-1260b AD Ovarian Welsh 11 hsa-mir-1323 hsa-mir-1225-5p 0 hsa-mir-548o AD Ovarian Welsh 10 hsa-mir-921 0 AD Ovarian Welsh 13 hsa-mir-3178 0 CA Bladder Dyrskjot 77 hsa-mir-620 0 AD Ovarian Welsh 15 hsa-mir-1282 0 AD Ovarian Welsh 14 hsa-mir-338-5p 0 AD Ovarian Welsh 17 hsa-mir-1321 0 AD Ovarian Welsh 16 hsa-mir-548l 0 AD Ovarian Welsh 31 hsa-mir-380 hsa-mir-548c-3p 0 AD Ovarian Welsh 30 hsa-mir-1207-5p hsa-mir-1204 0 CCC Ovarian Hendrix 56 hsa-mir-409-3p hsa-mir-587 0 CCC Ovarian Hendrix 51 hsa-mir-1279 hsa-mir-499-3p 0 CCC Ovarian Hendrix 60 hsa-mir-105 Dysregulated hsa-mir-1305 0 CCC Ovarian Hendrix 61 hsa-mir-145 Dysregulated 0 CCC Ovarian Hendrix 24 hsa-mir-19b 0 hsa-mir-19a CCC Ovarian Hendrix 25 hsa-mir-183 Dysregulated hsa-mir-744 0 CCC Ovarian Hendrix 27 hsa-mir-556-5p 0 CCC Ovarian Hendrix 20 hsa-mir-495 Causal 0 CCC Ovarian Hendrix 23 hsa-mir-523 hsa-mir-105 Dysregulated 0 CCC Ovarian Hendrix 46 hsa-mir-340 0 CCC Ovarian Hendrix 47 hsa-mir-548p hsa-mir-122 0 CCC Ovarian Hendrix 44 hsa-mir-548m 0 CCC Ovarian Hendrix 45 hsa-mir-382 hsa-mir-1250 0 CCC Ovarian Hendrix 29 hsa-mir-636 0 CCC Ovarian Hendrix 1 hsa-mir-1200 0 CCC Ovarian Hendrix 0 hsa-mir-194 0 CCC Ovarian Hendrix 2 hsa-mir-423-5p 0 CCC Ovarian Hendrix 7 hsa-mir-532-5p hsa-mir-382 0 CCC Ovarian Hendrix 9 hsa-mir-1291 0 CCC Ovarian Hendrix 43 hsa-mir-1247 0 CCC Ovarian Hendrix 14 hsa-mir-1276 0 CCC Ovarian Hendrix 11 hsa-mir-638 hsa-mir-29b Dysregulated hsa-mir-602 0 hsa-mir-29c hsa-mir-29a CCC Ovarian Hendrix 10 hsa-mir-615-5p 0 CCC Ovarian Hendrix 13 hsa-mir-143 Dysregulated hsa-mir-500b 0 hsa-mir-500a CCC Ovarian Hendrix 12 hsa-mir-876-5p hsa-mir-508-3p 0 CCC Ovarian Hendrix 59 hsa-mir-552 hsa-mir-1258 0 CCC Ovarian Hendrix 58 hsa-mir-586 0 CCC Ovarian Hendrix 55 hsa-mir-1471 0 CCC Ovarian Hendrix 30 hsa-mir-590-5p 0 CCC Ovarian Hendrix 37 hsa-mir-1302 hsa-mir-1237 0 CCC Ovarian Hendrix 35 hsa-mir-1283 hsa-mir-607 0 CCC Ovarian Hendrix 33 hsa-mir-127-5p Causal hsa-mir-770-5p 0 CA Breast Sorlie 23 hsa-mir-423-5p 0 CCC Ovarian Hendrix 18 hsa-mir-326 0 CCC Ovarian Hendrix 57 hsa-mir-590-5p 0 MUC Ovarian Hendrix 30 hsa-mir-635 Dysregulated 0 MUC Ovarian Hendrix 54 hsa-mir-921 0 MUC Ovarian Hendrix 28 hsa-mir-296-5p Dysregulated 0 MUC Ovarian Hendrix 45 hsa-mir-765 0 MUC Ovarian Hendrix 60 hsa-mir-369-3p hsa-mir-574-3p 0 MUC Ovarian Hendrix 61 hsa-mir-940 hsa-mir-410 0 B-CLL Leukemia Haslinger 12 hsa-mir-1302 0 MUC Ovarian Hendrix 63 hsa-mir-184 Dysregulated hsa-mir-1247 0 GCT Seminoma Korkola 71 hsa-mir-361-3p 0 MUC Ovarian Hendrix 65 hsa-mir-380 0 MUC Ovarian Hendrix 66 hsa-mir-889 0 MUC Ovarian Hendrix 67 hsa-mir-1224-3p 0 MUC Ovarian Hendrix 68 hsa-mir-606 hsa-mir-1305 0 MUC Ovarian Hendrix 69 hsa-mir-579 0 MUC Ovarian Hendrix 52 hsa-mir-541 0 MUC Ovarian Hendrix 24 hsa-mir-361-3p 0 MUC Ovarian Hendrix 25 hsa-mir-548c-3p hsa-mir-582-5p 0 MUC Ovarian Hendrix 26 hsa-mir-296-5p Dysregulated 0 MUC Ovarian Hendrix 27 hsa-mir-423-5p 0 MUC Ovarian Hendrix 20 hsa-mir-640 0 MUC Ovarian Hendrix 21 hsa-mir-216b hsa-mir-520d-5p 0 MUC Ovarian Hendrix 22 hsa-mir-1293 0 MUC Ovarian Hendrix 23 hsa-mir-486-3p 0 MUC Ovarian Hendrix 47 hsa-mir-654-5p 0 MUC Ovarian Hendrix 44 hsa-mir-217 0 MUC Ovarian Hendrix 48 hsa-mir-608 Dysregulated 0 MUC Ovarian Hendrix 42 hsa-mir-1181 0 MUC Ovarian Hendrix 40 hsa-mir-618 0 MUC Ovarian Hendrix 41 hsa-mir-34a Causal 0 hsa-mir-34c-5p hsa-mir-449a hsa-mir-449b MUC Ovarian Hendrix 0 hsa-mir-556-3p hsa-mir-410 0 MUC Ovarian Hendrix 3 hsa-mir-1205 0 MUC Ovarian Hendrix 2 hsa-mir-22 0 MUC Ovarian Hendrix 7 hsa-mir-607 hsa-mir-590-3p 0 TU Prostate Lapointe 32 hsa-mir-608 0 MUC Ovarian Hendrix 8 hsa-mir-1226 hsa-mir-486-3p 0 MUC Ovarian Hendrix 56 hsa-mir-508-3p hsa-mir-548c-3p 0 MUC Ovarian Hendrix 19 hsa-mir-548g 0 MUC Ovarian Hendrix 76 hsa-mir-144 hsa-mir-573 0 MUC Ovarian Hendrix 75 hsa-mir-512-3p 0 MUC Ovarian Hendrix 74 hsa-mir-27a 0 hsa-mir-27b MUC Ovarian Hendrix 73 hsa-mir-361-3p 0 MUC Ovarian Hendrix 72 hsa-mir-409-5p 0 MUC Ovarian Hendrix 71 hsa-mir-361-3p 0 MUC Ovarian Hendrix 14 hsa-mir-148a Dysregulated 0 hsa-mir-148b hsa-mir-152 AD Pancreas Logsdon 1 hsa-mir-1247 0 MUC Ovarian Hendrix 15 hsa-mir-340 hsa-mir-944 0 MUC Ovarian Hendrix 55 hsa-mir-486-3p 0 MUC Ovarian Hendrix 32 hsa-mir-490-3p 0 MUC Ovarian Hendrix 57 hsa-mir-766 0 MUC Ovarian Hendrix 49 hsa-mir-200b Causal 0 AD Lung Bhattacharjee 16 hsa-mir-361-3p 0 MUC Ovarian Hendrix 34 hsa-mir-1291 0 MUC Ovarian Hendrix 18 hsa-mir-548n hsa-mir-606 0 MUC Ovarian Hendrix 12 hsa-mir-658 0 MUC Ovarian Hendrix 31 hsa-mir-342-5p 0 MUC Ovarian Hendrix 50 hsa-mir-889 0 SRS Ovarian Hendrix 36 hsa-mir-890 0 SRS Ovarian Hendrix 42 hsa-mir-1298 0 SRS Ovarian Hendrix 22 hsa-mir-624 0 SRS Ovarian Hendrix 60 hsa-mir-188-3p hsa-mir-184 Dysregulated 0 SRS Ovarian Hendrix 64 hsa-mir-377 Causal 0 SRS Ovarian Hendrix 66 hsa-mir-892b hsa-mir-548c-3p 0 SRS Ovarian Hendrix 67 hsa-mir-608 Dysregulated 0 SRS Ovarian Hendrix 68 hsa-mir-200b Causal 0 SRS Ovarian Hendrix 83 hsa-mir-637 Dysregulated 0 SRS Ovarian Hendrix 80 hsa-mir-324-5p 0 SRS Ovarian Hendrix 81 hsa-mir-3135b 0 hsa-mir-3135 SRS Ovarian Hendrix 24 hsa-mir-635 Dysregulated 0 SRS Ovarian Hendrix 26 hsa-mir-325 0 SRS Ovarian Hendrix 27 hsa-mir-362-5p 0 SRS Ovarian Hendrix 20 hsa-mir-296-5p Dysregulated 0 SRS Ovarian Hendrix 21 hsa-mir-944 0 SRS Ovarian Hendrix 48 hsa-mir-1278 0 SRS Ovarian Hendrix 44 hsa-mir-584 0 SRS Ovarian Hendrix 45 hsa-mir-146b-3p 0 SRS Ovarian Hendrix 28 hsa-mir-186 0 SRS Ovarian Hendrix 43 hsa-mir-299-3p 0 SRS Ovarian Hendrix 41 hsa-mir-650 0 SRS Ovarian Hendrix 1 hsa-mir-641 hsa-mir-409-3p 0 SRS Ovarian Hendrix 3 hsa-mir-146b-3p 0 SRS Ovarian Hendrix 2 hsa-mir-505 0 SRS Ovarian Hendrix 4 hsa-mir-1250 0 SRS Ovarian Hendrix 6 hsa-mir-185 0 SRS Ovarian Hendrix 9 hsa-mir-1297 0 SRS Ovarian Hendrix 19 hsa-mir-135a 0 SRS Ovarian Hendrix 75 hsa-mir-937 hsa-mir-372 0 OD Brain Bredel 40 hsa-mir-216b 0 SRS Ovarian Hendrix 17 hsa-mir-193b 0 SRS Ovarian Hendrix 70 hsa-mir-641 hsa-mir-433 0 SRS Ovarian Hendrix 15 hsa-mir-1293 hsa-let-7d Causal 0 SRS Ovarian Hendrix 69 hsa-mir-330-3p hsa-mir-29b 0 SRS Ovarian Hendrix 79 hsa-mir-944 0 SRS Ovarian Hendrix 78 hsa-mir-206 Dysregulated 0 SRS Ovarian Hendrix 11 hsa-mir-361-5p Dysregulated hsa-mir-590-3p 0 SRS Ovarian Hendrix 10 hsa-mir-34c-3p 0 SRS Ovarian Hendrix 38 hsa-mir-17 0 SRS Ovarian Hendrix 59 hsa-mir-656 0 SRS Ovarian Hendrix 14 hsa-mir-1290 0 SRS Ovarian Hendrix 61 hsa-mir-1224-3p 0 SRS Ovarian Hendrix 54 hsa-mir-448 0 SRS Ovarian Hendrix 30 hsa-mir-424 Dysregulated hsa-mir-582-5p 0 SRS Ovarian Hendrix 53 hsa-mir-376b Causal hsa-mir-576-5p 0 hsa-mir-376a SRS Ovarian Hendrix 52 hsa-mir-626 0 SRS Ovarian Hendrix 55 hsa-mir-548l hsa-mir-338-5p 0 SRS Ovarian Hendrix 16 hsa-mir-548k 0 SRS Ovarian Hendrix 32 hsa-mir-331-3p 0 SRS Ovarian Hendrix 12 hsa-mir-125a-3p 0 SRS Ovarian Hendrix 57 hsa-mir-561 hsa-mir-548d-3p 0 SRS Ovarian Hendrix 72 hsa-mir-1276 0 END Ovarian Hendrix 37 hsa-mir-125b Dysregulated 0 END Ovarian Hendrix 60 hsa-mir-580 hsa-mir-570 0 END Ovarian Hendrix 62 hsa-mir-571 0 END Ovarian Hendrix 66 hsa-mir-101 Dysregulated 0 END Ovarian Hendrix 82 hsa-let-7d* hsa-mir-505 hsa-mir-320b 0 END Ovarian Hendrix 32 hsa-mir-802 hsa-mir-548d-3p 0 END Ovarian Hendrix 25 hsa-mir-653 0 END Ovarian Hendrix 26 hsa-mir-548c-3p hsa-mir-656 0 END Ovarian Hendrix 20 hsa-mir-663b Dysregulated 0 hsa-mir-663 END Ovarian Hendrix 48 hsa-mir-125a-3p hsa-mir-1304 0 END Ovarian Hendrix 23 hsa-mir-22 0 END Ovarian Hendrix 47 hsa-mir-1471 0 END Ovarian Hendrix 45 hsa-mir-1471 0 END Ovarian Hendrix 43 hsa-mir-590-3p 0 END Ovarian Hendrix 40 hsa-mir-944 0 END Ovarian Hendrix 41 hsa-mir-338-5p 0 IDC Breast Radvanyi 46 hsa-mir-675 0 END Ovarian Hendrix 0 hsa-mir-598 0 END Ovarian Hendrix 3 hsa-mir-510 hsa-mir-1279 0 END Ovarian Hendrix 4 hsa-mir-608 Dysregulated hsa-mir-612 0 END Ovarian Hendrix 7 hsa-mir-1302 0 END Ovarian Hendrix 6 hsa-mir-29b Dysregulated hsa-mir-890 0 hsa-mir-29c hsa-mir-29a END Ovarian Hendrix 9 hsa-mir-486-3p 0 END Ovarian Hendrix 8 hsa-mir-200a Causal 0 hsa-mir-141 END Ovarian Hendrix 52 hsa-mir-1538 0 END Ovarian Hendrix 28 hsa-mir-495 Causal 0 END Ovarian Hendrix 78 hsa-mir-125a-5p Causal 0 END Ovarian Hendrix 19 hsa-mir-3195 0 END Ovarian Hendrix 39 hsa-mir-508-5p Dysregulated 0 CA Bladder Dyrskjot 39 hsa-mir-486-3p 0 END Ovarian Hendrix 76 hsa-mir-888 0 END Ovarian Hendrix 75 hsa-mir-489 0 END Ovarian Hendrix 72 hsa-mir-548d-3p 0 END Ovarian Hendrix 70 hsa-mir-939 0 END Ovarian Hendrix 15 hsa-mir-542-3p Dysregulated 0 END Ovarian Hendrix 69 hsa-mir-607 hsa-mir-186 0 END Ovarian Hendrix 29 hsa-mir-944 0 END Ovarian Hendrix 58 hsa-mir-621 0 END Ovarian Hendrix 11 hsa-mir-940 0 END Ovarian Hendrix 13 hsa-mir-1276 hsa-mir-23a 0 END Ovarian Hendrix 38 hsa-mir-944 hsa-mir-944 0 END Ovarian Hendrix 22 hsa-mir-15b Dysregulated hsa-mir-944 0 hsa-mir-15a hsa-mir-16 hsa-mir-497 hsa-mir-195 END Ovarian Hendrix 17 hsa-mir-30e Dysregulated 0 END Ovarian Hendrix 61 hsa-mir-342-5p 0 END Ovarian Hendrix 31 hsa-mir-1253 0 END Ovarian Hendrix 49 hsa-mir-145 Dysregulated 0 END Ovarian Hendrix 51 hsa-mir-130b 0 hsa-mir-301a hsa-mir-301b hsa-mir-130a hsa-mir-454 END Ovarian Hendrix 50 hsa-mir-539 hsa-mir-548c-3p 0 END Ovarian Hendrix 16 hsa-mir-588 0 END Ovarian Hendrix 18 hsa-mir-487b Dysregulated hsa-mir-890 0 END Ovarian Hendrix 65 hsa-mir-331-3p 0 PDC Pancreas Ishikawa 1 hsa-mir-106b 0 PDC Pancreas Ishikawa 3 hsa-mir-369-5p 0 PDC Pancreas Ishikawa 2 hsa-mir-448 0 AD Pancreas Logsdon 10 hsa-mir-1273 0 hsa-mir-1273c hsa-mir-1273d hsa-mir-1273e hsa-mir-1273f hsa-mir-1273g AD Pancreas Logsdon 13 hsa-mir-486-5p 0 AD Pancreas Logsdon 12 hsa-let-7d Dysregulated hsa-mir-933 0 hsa-let-7f hsa-mir-98 hsa-let-7b hsa-let-7c hsa-let-7a hsa-let-7g hsa-let-7e hsa-let-7i AD Pancreas Logsdon 15 hsa-mir-556-3p hsa-mir-130b 0 AD Pancreas Logsdon 14 hsa-mir-517c 0 hsa-mir-517b hsa-mir-517a AD Pancreas Logsdon 16 hsa-mir-561 0 CA Bladder Dyrskjot 59 hsa-mir-374a 0 AD Pancreas Logsdon 18 hsa-mir-939 0 RCCC Renal Boer 5 hsa-mir-374a 0 AD Pancreas Logsdon 3 hsa-mir-3178 0 AD Pancreas Logsdon 4 hsa-mir-22 0 MPC Prostate Dhanasekaran 30 hsa-mir-659 0 MPC Prostate Dhanasekaran 29 hsa-mir-663b 0 hsa-mir-663 MPC Prostate Dhanasekaran 26 hsa-mir-935 hsa-mir-548j 0 MPC Prostate Dhanasekaran 27 hsa-mir-1271 0 MPC Prostate Dhanasekaran 21 hsa-mir-498 Dysregulated 0 MPC Prostate Dhanasekaran 48 hsa-mir-625 0 MPC Prostate Dhanasekaran 44 hsa-mir-1323 hsa-mir-576-3p 0 hsa-mir-548o MPC Prostate Dhanasekaran 45 hsa-mir-490-3p 0 MPC Prostate Dhanasekaran 42 hsa-mir-582-3p hsa-mir-331-5p 0 MPC Prostate Dhanasekaran 0 hsa-mir-3074-5p hsa-mir-1323 hsa-mir-200b Causal 0 hsa-mir-548o MPC Prostate Dhanasekaran 2 hsa-mir-548c-3p 0 MPC Prostate Dhanasekaran 5 hsa-mir-211 0 MPC Prostate Dhanasekaran 7 hsa-mir-330-5p Causal hsa-mir-296-5p Dysregulated 0 hsa-mir-326 MPC Prostate Dhanasekaran 9 hsa-mir-190b 0 hsa-mir-190 MPC Prostate Dhanasekaran 8 hsa-mir-219-1-3p 0 MPC Prostate Dhanasekaran 13 hsa-mir-1257 0 MPC Prostate Dhanasekaran 12 hsa-mir-139-5p hsa-mir-340 0 MPC Prostate Dhanasekaran 14 hsa-mir-133b hsa-mir-502-5p 0 hsa-mir-133a MPC Prostate Dhanasekaran 11 hsa-mir-34a Causal 0 MPC Prostate Dhanasekaran 10 hsa-mir-554 0 MPC Prostate Dhanasekaran 22 hsa-mir-105 hsa-mir-382 0 MPC Prostate Dhanasekaran 17 hsa-mir-1266 0 MPC Prostate Dhanasekaran 16 hsa-mir-944 hsa-mir-101 Causal 0 MPC Prostate Dhanasekaran 19 hsa-mir-661 0 MPC Prostate Dhanasekaran 23 hsa-mir-302f 0 GCT Seminoma Korkola 32 hsa-mir-608 0 MPC Prostate Dhanasekaran 34 hsa-mir-544 hsa-mir-1279 0 hsa-mir-544b MPC Prostate Dhanasekaran 18 hsa-mir-1263 0 PPC Prostate Dhanasekaran 29 hsa-mir-509-3p 0 hsa-mir-509-3-5p PPC Prostate Dhanasekaran 27 hsa-mir-654-3p hsa-mir-1279 0 PPC Prostate Dhanasekaran 20 hsa-mir-1207-5p 0 PPC Prostate Dhanasekaran 22 hsa-mir-802 hsa-mir-561 0 PPC Prostate Dhanasekaran 23 hsa-mir-376a hsa-mir-518a-5p 0 hsa-mir-376b hsa-mir-376c PPC Prostate Dhanasekaran 28 hsa-mir-544 hsa-mir-944 0 hsa-mir-544b PPC Prostate Dhanasekaran 41 hsa-mir-18a hsa-mir-369-3p 0 hsa-mir-18b PPC Prostate Dhanasekaran 1 hsa-mir-520d-5p hsa-mir-561 0 hsa-mir-524-5p PPC Prostate Dhanasekaran 0 hsa-mir-558 0 PPC Prostate Dhanasekaran 3 hsa-mir-624 hsa-mir-578 0 PPC Prostate Dhanasekaran 2 hsa-mir-217 hsa-mir-641 0 PPC Prostate Dhanasekaran 4 hsa-mir-760 hsa-mir-939 0 PPC Prostate Dhanasekaran 7 hsa-mir-1202 0 PPC Prostate Dhanasekaran 9 hsa-mir-153 hsa-mir-661 0 PPC Prostate Dhanasekaran 8 hsa-mir-340 0 PPC Prostate Dhanasekaran 12 hsa-mir-342-3p 0 PPC Prostate Dhanasekaran 11 hsa-mir-628-3p 0 PPC Prostate Dhanasekaran 10 hsa-mir-421 hsa-mir-889 0 PPC Prostate Dhanasekaran 39 hsa-mir-139-3p 0 PPC Prostate Dhanasekaran 38 hsa-mir-607 0 PPC Prostate Dhanasekaran 14 hsa-mir-34a Causal hsa-mir-1202 0 hsa-mir-34c-5p hsa-mir-449a hsa-mir-449b PPC Prostate Dhanasekaran 17 hsa-mir-34a Causal 0 PPC Prostate Dhanasekaran 19 hsa-mir-101* hsa-mir-548e hsa-mir-144 0 PPC Prostate Dhanasekaran 31 hsa-mir-515-3p 0 PPC Prostate Dhanasekaran 37 hsa-mir-553 0 PPC Prostate Dhanasekaran 35 hsa-mir-663b 0 hsa-mir-663 PPC Prostate Dhanasekaran 34 hsa-mir-149 Dysregulated 0 PPC Prostate Dhanasekaran 33 hsa-mir-548e 0 PPC Prostate Dhanasekaran 32 hsa-mir-296-5p Dysregulated 0 BPH Prostate Dhanasekaran 20 hsa-mir-1224-3p 0 BPH Prostate Dhanasekaran 1 hsa-mir-579 0 BPH Prostate Dhanasekaran 5 hsa-mir-1283 hsa-mir-1290 0 BPH Prostate Dhanasekaran 4 hsa-mir-543 hsa-mir-1278 0 BPH Prostate Dhanasekaran 7 hsa-mir-508-5p hsa-mir-380 0 BPH Prostate Dhanasekaran 6 hsa-mir-648 0 BPH Prostate Dhanasekaran 9 hsa-mir-574-5p 0 BPH Prostate Dhanasekaran 8 hsa-mir-891b hsa-mir-1246 0 BPH Prostate Dhanasekaran 11 hsa-mir-520d-5p hsa-mir-369-3p 0 hsa-mir-524-5p BPH Prostate Dhanasekaran 10 hsa-mir-1290 hsa-mir-624 0 BPH Prostate Dhanasekaran 13 hsa-mir-423-3p hsa-mir-922 0 BPH Prostate Dhanasekaran 12 hsa-mir-33b hsa-mir-939 0 hsa-mir-33a BPH Prostate Dhanasekaran 15 hsa-mir-770-5p 0 BPH Prostate Dhanasekaran 16 hsa-mir-548e hsa-mir-302f 0 BPH Prostate Dhanasekaran 18 hsa-mir-513a-3p 0 TU Prostate Lapointe 24 hsa-mir-487b hsa-mir-496 hsa-mir-548g 0 TU Prostate Lapointe 25 hsa-mir-130a 0 TU Prostate Lapointe 26 hsa-mir-566 hsa-mir-663b 0 hsa-mir-663 TU Prostate Lapointe 21 hsa-mir-608 0 TU Prostate Lapointe 23 hsa-mir-25 Dysregulated 0 TU Prostate Lapointe 29 hsa-mir-522 0 TU Prostate Lapointe 40 hsa-mir-369-5p 0 TU Prostate Lapointe 1 hsa-mir-1297 Dysregulated hsa-mir-590-3p 0 hsa-mir-26a hsa-mir-26b TU Prostate Lapointe 0 hsa-mir-874 hsa-mir-219-2-3p 0 OD Brain Bredel 14 hsa-mir-296-5p Causal 0 TU Prostate Lapointe 4 hsa-mir-532-3p hsa-mir-185 0 TU Prostate Lapointe 7 hsa-mir-579 0 TU Prostate Lapointe 6 hsa-mir-876-3p 0 TU Prostate Lapointe 9 hsa-mir-208a 0 hsa-mir-208b

    TABLE-US-00008 SUPPLEMENTARY TABLE 9 GO Terms Mapping to the Hallmarks of Cancer Self Sufficiency in Growth Signals GO:0009967 Positive regulation of signal transduction GO:0030307 Positive regulation of cell growth GO:0008284 Positive regulation of cell proliferation GO:0045787 Positivie regulation of cell cycle GO:0007165 Signal transduction Insensitivity to Antigrowth Signals GO:0009968 Negative regulation of signal transduction GO:0030308 Negative regulation of cell growth GO:0008285 Negative regulation of cell proliferation GO:0045786 Negative regulation of cell cycle GO:0007165 Signal transduction Evading Apoptosis GO:0043069 Negative regulation of apoptosis GO:0043066 Positive regulation of anti-apoptosis GO:0045768 Negative regualtion of programmed cell death Limitless Replicative Potential GO:0001302 Replicative cell aging GO:0032206 Positive regualtion of telomere maintenance GO:0090398 Cellular senescence Sustained Angiogenesis GO:0045765 Positive regulation of angiogenesis GO:0045766 Regulation of angiogenesis GO:0030949 Positive regulation of vascular endothelial growth factor receptor signaling pathway GO:0001570 Vasculogenesis Tissue Invasion and Metastasis GO:0042060 Wound healing GO:0007162 Negative regulation of cell adhesion GO:0033631 Cell-cell adhesion mediated by integrin GO:0044331 Cell-cell adhesion mediated by cadherin GO:0001837 Epithelial to mesenchymal transition GO:0016477 Cell migration GO:0048870 Cell motility GO:0007155 Cell adhesion Genome Instability and Mutation GO:0051276 Chromosome organization GO:0045005 Maintenance of fidelity involved in DNA-dependent DNA replication GO:0006281 DNA repair Tumor Promoting Inflammation GO:0002419 T-cell mediated cytotoxicity directed against tumor cell target GO:0002420 Natural killer cell mediated cytotoxicity directed against tumor cell target GO:0002857 Positive regualtion of natural killer cell mediated immune response to tumor cell GO:0002842 Positive regualtion of T-cell mediated immune response to tumor cell GO:0002367 Cytokine production involved in immune response GO:0050776 Regulation of immune response Reprogramming Energy Metabolism GO:0006096 Glycolysis GO:0071456 Cellular response to hypoxia Evading Immune Detection GO:0002837 Regulation of immune response to tumor cell GO:0002418 Immune response to tumor cells GO:0002367 Cytokine production involved in immune response GO:0050776 Regulation of immune response

    TABLE-US-00009 SUPPLEMENTARY TABLE 10 miRvestiagtor PITA TargetScan Co-Expression Signature miRvestigator miRNA Validation PITA miRNA Validation miRNA GL Brain Rickman.31 NA NA hsa-let-7e_hsa-let-7f_hsa-let-7g_hsa- dysregulated NA let-7a_hsa-let-7b_hsa-let-7d_hsa-let- 7i_hsa-mir-98_hsa-let-7c B-CLL Leukemia Haslinger.9 NA NA NA NA hsa-mir-1245b- 5p_hsa- mir-1245 SRS Ovarian Hendrix.14 NA NA NA NA hsa-mir-1290 IDC Breast Radvanyi.24 NA NA NA NA hsa-mir-1291 TU Prostate Lapointe.37 NA NA hsa-mir-199b-3p_hsa-mir-199a-3p causal hsa-mir-509- 3p_hsa- mir-509-3-5p AD Ovarian Welsh.26 NA NA hsa-mir-210 NA NA AD Lung Beer.35 NA NA hsa-mir-222 causal NA AD Lung Bhattacharjee.41 NA NA NA NA hsa-mir-296-5p SMCL Lung Bhattacharjee.36 NA NA NA NA hsa-mir-296-5p SQ Lung 8hattacharjee.13 NA NA NA NA hsa-mir-296-5p AD Lung Bhattacharjee.59 NA NA hsa-mir-29b_hsa-mir-29c_hsa-mir-29a causal NA END Ovarian Hendrix.6 NA NA hsa-mir-29b_hsa-mir-29c_hsa-mir-29a dysregulated hsa-mir-890 CCC Ovarian Hendrix.11 hsa-mir-638 NA hsa-mir-29b_hsa-mir-29c_hsa-mir-29a dysregulated hsa-mir-602 AD Lung Beer.31 hsa-mir-29b_hsa-mir- causal hsa-mir-29b_hsa-mir-29c_hsa-mir-29a causal hsa-mir-29b 29c_hsa-mir-29a CA Colon Graudens.35 NA NA hsa-mir-325 NA NA SMCL Lung Bhattacharjee.61 NA NA NA NA hsa-mir-331-3p COID Lung Bhattacharjee.24 NA NA NA NA hsa-mir-342-5p AD Lung Stearman.19 NA NA NA NA hsa-mir-370 GCT Seminoma Korkola.4 NA NA NA NA hsa-mir- 376a_hsa-mir- 376b_hsa-mir-376c CA Breast Sorlie.23 NA NA NA NA hsa-mir-423-5p HSCC Head-Neck Chung.1 hsa-mir-29b_hsa-mir- dysregulated hsa-mir-767-5p NA hsa-mir-450b-5p 29c_hsa-mir-29a CA Breast Richardson.55 NA NA hsa-mir-130b_hsa-mir-301a_hsa-mir- NA hsa-mir- 301b_hsa-mir-130a_hsa-mir-454 544_hsa- mir-544b MM Myeloma Zhan.33 NA NA NA NA hsa-mir-507 CA Bladder Dyrskjot.82 NA NA hsa-mir-519d NA hsa-mir-656 ME Melanoma Hoek.50 NA NA hsa-mir-548c-3p NA NA AD Ovarian Welsh.1 NA NA NA NA hsa-mir-548d-3p AD Ovarian Welsh.16 NA NA NA NA hsa-mir-548I CA Colon Graudens.40 NA NA hsa-mir-507_hsa-mir-557 NA hsa-mir-369-3p SQ Lung Bhattacharjee.23 NA NA NA NA hsa-mir-586 END Ovarian Hendrix.58 hsa-mir-621 NA NA NA NA GL Brain Rickman.8 NA NA NA NA hsa-mir-634 AC Brain Sun.5 hsa-mir-523 NA NA NA hsa-mir-637 AD Lung Beer.32 NA NA hsa-mir-656 NA NA GL Brain Rickman.2 hsa-mir-718 NA NA NA NA B-CLL Leukemia Haslinger.27 NA NA hsa-mir-760 NA NA AD Ovarian Welsh.20 NA NA hsa-mir-767-5p NA NA SQ Lung Bhattacharjee.44 hsa-mir-4285 NA hsa-mir-767-5p NA NA COID Lung Bhattacharjee.92 NA NA NA NA hsa-mir-920 END Ovarian Hendrix.22 NA NA hsa-mir-15b_hsa-mir-15a_hsa-mir- dysregulated hsa-mir-944 16_hsa-mir-497_hsa-mir-195 Co-Expression Signature TargetScan Validation GO and miRNA Overlap GL Brain Rickman.31 NA hsa-let-7c_GO: 0001501; hsa-let-7c_GO: 0001503; hsa-let-7c_GO: 0001934; hsa-let- 7c_GO: 0001944; hsa-let-7c_GO: 0001957; hsa-let-7c_GO: 0005979; hsa-let- 7c_GO: 0006928; hsa-let-7c_GO: 0007275; hsa-let-7c_GO: 0007530; hsa-let- 7c_GO: 0008284; hsa-let-7c_GO: 0008544; hsa-let-7c_GO: 0008645; hsa-let- 7c_GO: 0009653; hsa-let-7c_GO: 0009887; hsa-let-7c_GO: 0009888; hsa-let- 7c_GO: 0015749; hsa-let-7c_GO: 0015758; hsa-let-7c_GO: 0016477; hsa-let- 7c_GO: 0030154; hsa-let-7c_GO: 0030198; hsa-let-7c_GO: 0030199; hsa-let- 7c_GO: 0030238; hsa-let-7c_GO: 0031017; hsa-let-7c_GO: 0032501; hsa-let- 7c_GO: 0032502; hsa-let-7c_GO: 0032879; hsa-let-7c_GO: 0032885; hsa-let- 7c_GO: 0032963; hsa-let-7c_GO: 0032964; hsa-let-7c_GO: 0033273; hsa-let- 7c_GO: 0043062; hsa-let-7c_GO: 0043491; hsa-let-7c_GO: 0043588; hsa-let- 7c_GO: 0044236; hsa-let-7c_GO: 0044259; hsa-let-7c_GO: 0048468; hsa-let- 7c_GO: 0048513; hsa-let-7c_GO: 0048731; hsa-let-7c_GO: 0048856; hsa-let- 7c_GO: 0048869; hsa-let-7c_GO: 0051291; hsa-let-7c_GO: 0060324; hsa-let- 7c_GO: 0060343; hsa-let-7c_GO: 0060346; hsa-let-7c_GO: 0065008; hsa-let- 7c_GO: 0070208 B-CLL Leukemia Haslinger.9 NA hsa-mir-1245_GO: 0042035; hsa-mir-1245_GO: 0042089; hsa-mir-1245_GO: 0042107; hsa- mir-1245_GO: 0042108; hsa-mir-1245_GO: 0045086 SRS Ovarian Hendrix.14 NA hsa-mir-1290_GO: 0030193; hsa-mir-1290_GO: 0050818; hsa-mir-1290_GO: 0051917; hsa- mir-1290_GO: 0051918 IDC Breast Radvanyi.24 NA hsa-mir-1291_GO: 0001775; hsa-mir-1291_GO: 0002252; hsa-mir-1291_GO: 0002694; hsa- mir-1291_GO: 0002696; hsa-mir-1291_GO: 0002831; hsa-mir-1291_GO: 0006950; hsa-mir- 1291_GO: 0007596; hsa-mir-1291_GO: 0007599; hsa-mir-1291_GO: 0009615; hsa-mir- 1291_GO: 0019932; hsa-mir-1291_GO: 0031294; hsa-mir-1291_GO: 0031295; hsa-mir- 1291_GO: 0050688; hsa-mir-1291_GO: 0050690; hsa-mir-1291_GO: 0050817; hsa-mir- 1291_GO: 0050848; hsa-mir-1291_GO: 0050849; hsa-mir-1291_GO: 0050863; hsa-mir- 1291_GO: 0050865; hsa-mir-1291_GO: 0050867; hsa-mir-1291_GO: 0050870; hsa-mir- 1291_GO: 0050878; hsa-mir-1291_GO: 0051249; hsa-mir-1291_GO: 0051251; hsa-mir- 1291_GO: 0051346; hsa-mir-1291_GO: 0051707 TU Prostate Lapointe.37 NA hsa-mir-199a-3p_GO: 0040012 AD Ovarian Welsh.26 NA hsa-mir-210_GO: 0002521; hsa-mir-210_GO: 0006917; hsa-mir-210_GO: 0006928; hsa-mir- 210_GO: 0012502; hsa-mir-210_GO: 0016477; hsa-mir-210_GO: 0032943; hsa-mir- 210_GO: 0032944; hsa-mir-210_GO: 0040012; hsa-mir-210_GO: 0040017; hsa-mir- 210_GO: 0043065; hsa-mir-210_GO: 0043068; hsa-mir-210_GO: 0045321; hsa-mir- 210_GO: 0045672; hsa-mir-210_GO: 0048518; hsa-mir-210_GO: 0048870; hsa-mir- 210_GO: 0050789; hsa-mir-210_GO: 0050794; hsa-mir-210_GO: 0051674; hsa-mir- 210_GO: 0065007 AD Lung Beer.35 NA hsa-mir-222_GO: 0007155; hsa-mir-222_GO: 0022610; hsa-mir-222_GO: 0030029 AD Lung Bhattacharjee.41 NA hsa-mir-296-5p_GO: 0003007; hsa-mir-296-5p_GO: 0006928; hsa-mir-296- 5p_GO: 0009653; hsa-mir-296-5p_GO: 0016043; hsa-mir-296-5p_GO: 0016477; hsa-mir- 296-5p_GO: 0040011; hsa-mir-296-5p_GO: 0048518; hsa-mir-296-5p_GO: 0048870; hsa- mir-296-5p_GO: 0051674 SMCL Lung Bhattacharjee.36 NA hsa-mir-296-5p_GO: 0007517; hsa-mir-296-5p_GO: 0009653; hsa-mir-296- 5p_GO: 0009887; hsa-mir-296-5p_GO: 0010269; hsa-mir-296-5p_GO: 0010562; hsa-mir- 296-5p_GO: 0030509; hsa-mir-296-5p_GO: 0031960; hsa-mir-296-5p_GO: 0042127; hsa- mir-296-5p_GO: 0045937; hsa-mir-296-5p_GO: 0051384 SQ Lung 8hattacharjee.13 NA hsa-mir-296-5p_GO: 0010884; hsa-mir-296-5p_GO: 0016043; hsa-mir-296- 5p_GO: 0032879 AD Lung Bhattacharjee.59 NA hsa-mir-29a_GO: 0000904; hsa-mir-29a_GO: 0001501; hsa-mir-29a_GO: 0001568; hsa-mir- 29a_GO: 0001944; hsa-mir-29a_GO: 0007229; hsa-mir-29a_GO: 0007275; hsa-mir- 29a_GO: 0007409; hsa-mir-29a_GO: 0007411; hsa-mir-29a_GO: 0009611; hsa-mir- 29a_GO: 0009653; hsa-mir-29a_GO: 0016477; hsa-mir-29a_GO: 0022008; hsa-mir- 29a_GO: 0030199; hsa-mir-29a_GO: 0032501; hsa-mir-29a_GO: 0032502; hsa-mir- 29a_GO: 0032990; hsa-mir-29a_GO: 0042060; hsa-mir-29a_GO: 0048667; hsa-mir- 29a_GO: 0048812; hsa-mir-29a_GO: 0048858 END Ovarian Hendrix.6 NA hsa-mir-29a_GO: 0001501; hsa-mir-29a_GO: 0001568; hsa-mir-29a_GO: 0001944; hsa-mir- 29a_GO: 0007167; hsa-mir-29a_GO: 0007178; hsa-mir-29a_GO: 0007179; hsa-mir- 29a_GO: 0007275; hsa-mir-29a_GO: 0009653; hsa-mir-29a_GO: 0030154; hsa-mir- 29a_GO: 0030198; hsa-mir-29a_GO: 0030199; hsa-mir-29a_GO: 0032501; hsa-mir- 29a_GO: 0032502; hsa-mir-29a_GO: 0043062; hsa-mir-29a_GO: 0048513; hsa-mir- 29a_GO: 0048731; hsa-mir-29a_GO: 0048856; hsa-mir-29a_GO: 0051674 CCC Ovarian Hendrix.11 NA hsa-mir-29a_GO: 0007409; hsa-mir-29a_GO: 0007411; hsa-mir-29a_GO: 0009887; hsa-mir- 29a_GO: 0030198; hsa-mir-29a_GO: 0031175; hsa-mir-29a_GO: 0032990; hsa-mir- 29a_GO: 0048513; hsa-mir-29a_GO: 0048667; hsa-mir-29a_GO: 0048812; hsa-mir- 29a_GO: 0048858 AD Lung Beer.31 causal hsa-mir-29b_GO: 0009404; hsa-mir-29b_GO: 0030199; hsa-mir-29b_GO: 0032963; hsa-mir- 29b_GO: 0032964; hsa-mir-29b_GO: 0044236; hsa-mir-29b_GO: 0044259 CA Colon Graudens.35 NA hsa-mir-325_GO: 0006520; hsa-mir-325_GO: 0051186 SMCL Lung Bhattacharjee.61 NA hsa-mir-331-3p_GO: 0000902; hsa-mir-331-3p_GO: 0000904; hsa-mir-331- 3p_GO: 0001775; hsa-mir-331-3p_GO: 0002376; hsa-mir-331-3p_GO: 0002520; hsa-mir- 331-3p_GO: 0002682; hsa-mir-331-3p_GO: 0002684; hsa-mir-331-3p_GO: 0002694; hsa- mir-331-3p_GO: 0002695; hsa-mir-331-3p_GO: 0002696; hsa-mir-331- 3p_GO: 0006464; hsa-mir-331-3p_GO: 0006468; hsa-mir-331-3p_GO: 0006935; hsa-mir- 331-3p_GO: 0007154; hsa-mir-331-3p_GO: 0007155; hsa-mir-331-3p_GO: 0007166; hsa- mir-331-3p_GO: 0007167; hsa-mir-331-3p_GO: 0007169; hsa-mir-331- 3p_GO: 0007264; hsa-mir-331-3p_GO: 0007265; hsa-mir-331-3p_GO: 0007267; hsa-mir- 331-3p_GO: 0007268; hsa-mir-331-3p_GO: 0007399; hsa-mir-331-3p_GO: 0007507; hsa- mir-331-3p_GO: 0007596; hsa-mir-331-3p_GO: 0007599; hsa-mir-331- 3p_GO: 0009605; hsa-mir-331-3p_GO: 0009653; hsa-mir-331-3p_GO: 0009719; hsa-mir- 331-3p_GO: 0009725; hsa-mir-331-3p_GO: 0009887; hsa-mir-331-3p_GO: 0010518; hsa- mir-331-3p_GO: 0010863; hsa-mir-331-3p_GO: 0016310; hsa-mir-331- 3p_GO: 0019226; hsa-mir-331-3p_GO: 0021700; hsa-mir-331-3p_GO: 0022008; hsa-mir- 331-3p_GO: 0022610; hsa-mir-331-3p_GO: 0030029; hsa-mir-331-3p_GO: 0030097; hsa- mir-331-3p_GO: 0030154; hsa-mir-331-3p_GO: 0030182; hsa-mir-331- 3p_GO: 0030323; hsa-mir-331-3p_GO: 0030324; hsa-mir-331-3p_GO: 0031100; hsa-mir- 331-3p_GO: 0031589; hsa-mir-331-3p_GO: 0032989; hsa-mir-331-3p_GO: 0040011; hsa- mir-331-3p_GO: 0042060; hsa-mir-331-3p_GO: 0042110; hsa-mir-331- 3p_GO: 0042330; hsa-mir-331-3p_GO: 0043412; hsa-mir-331-3p_GO: 0043434; hsa-mir- 331-3p_GO: 0045321; hsa-mir-331-3p_GO: 0046578; hsa-mir-331-3p_GO: 0046649; hsa- mir-331-3p_GO: 0048468; hsa-mir-331-3p_GO: 0048534; hsa-mir-331- 3p_GO: 0048699; hsa-mir-331-3p_GO: 0048731; hsa-mir-331-3p_GO: 0048869; hsa-mir- 331-3p_GO: 0050817; hsa-mir-331-3p_GO: 0050863; hsa-mir-331-3p_GO: 0050865; hsa- mir-331-3p_GO: 0050866; hsa-mir-331-3p_GO: 0050867; hsa-mir-331- 3p_GO: 0050870; hsa-mir-331-3p_GO: 0050878; hsa-mir-331-3p_GO: 0051249; hsa-mir- 331-3p_GO: 0051251 COID Lung Bhattacharjee.24 NA hsa-mir-342-5p_GO: 0007584; hsa-mir-342-5p_GO: 0009991; hsa-mir-342- 5p_GO: 0010269; hsa-mir-342-5p_GO: 0030198; hsa-mir-342-5p_GO: 0031667; hsa-mir- 342-5p_GO: 0031960; hsa-mir-342-5p_GO: 0043062; hsa-mir-342-5p_GO: 0050900; hsa- mir-342-5p_GO: 0051384 AD Lung Stearman.19 NA hsa-mir-370_GO: 0001570 GCT Seminoma Korkola.4 NA hsa-mir-376c_GO: 0007157; hsa-mir-376c_GO: 0007166; hsa-mir-376c_GO: 0009605; hsa- mir-376c_GO: 0016477; hsa-mir-376c_GO: 0030595; hsa-mir-376c_GO: 0032102; hsa-mir- 376c_GO: 0032501; hsa-mir-376c_GO: 0032879; hsa-mir-376c_GO: 0040011; hsa-mir- 376c_GO: 0040012; hsa-mir-376c_GO: 0045123; hsa-mir-376c_GO: 0048870; hsa-mir- 376c_GO: 0050900; hsa-mir-376c_GO: 0050901; hsa-mir-376c_GO: 0051270; hsa-mir- 376c_GO: 0051674 CA Breast Sorlie.23 NA hsa-mir-423-5p_GO: 0000165; hsa-mir-423-5p_GO: 0006928; hsa-mir-423- 5p_GO: 0007165; hsa-mir-423-5p_GO: 0007166; hsa-mir-423-5p_GO: 0007167; hsa-mir- 423-5p_GO: 0007169; hsa-mir-423-5p_GO: 0007243; hsa-mir-423-5p_GO: 0007266; hsa- mir-423-5p_GO: 0008283; hsa-mir-423-5p_GO: 0008284; hsa-mir-423- 5p_GO: 0016043; hsa-mir-423-5p_GO: 0016192; hsa-mir-423-5p_GO: 0030334; hsa-mir- 423-5p_GO: 0032570; hsa-mir-423-5p_GO: 0032879; hsa-mir-423-5p_GO: 0040011; hsa- mir-423-5p_GO: 0040012; hsa-mir-423-5p_GO: 0042127; hsa-mir-423- 5p_GO: 0043491; hsa-mir-423-5p_GO: 0045807; hsa-mir-423-5p_GO: 0048518; hsa-mir- 423-5p_GO: 0048522; hsa-mir-423-5p_GO: 0048583; hsa-mir-423-5p_GO: 0051050; hsa- mir-423-5p_GO: 0051270; hsa-mir-423-5p_GO: 0051272; hsa-mir-423-5p_GO: 0065007 HSCC Head-Neck Chung.1 NA hsa-mir-450b-5p_GO: 0001503; hsa-mir-450b-5p_GO: 0001934; hsa-mir-450b- 5p_GO: 0030154; hsa-mir-450b-5p_GO: 0030510; hsa-mir-450b-5p_GO: 0030514; hsa-mir- 450b-5p_GO: 0033138; hsa-mir-450b-5p_GO: 0048869 CA Breast Richardson.55 NA hsa-mir-454_GO: 0001701; hsa-mir-454_GO: 0009653; hsa-mir-454_GO: 0009790; hsa-mir- 454_GO: 0048514 MM Myeloma Zhan.33 NA hsa-mir-507_GO: 0006350; hsa-mir-507_GO: 0010556; hsa-mir-507_GO: 0031326; hsa-mir- 507_GO: 0044237; hsa-mir-507_GO: 0044238; hsa-mir-507_GO: 0045449 CA Bladder Dyrskjot.82 NA hsa-mir-519d_GO: 0030514; hsa-mir-519d_GO: 0046631; hsa-mir-519d_GO: 0048518; hsa- mir-519d_GO: 0048583; hsa-mir-519d_GO: 0050789; hsa-mir-519d_GO: 0065007 ME Melanoma Hoek.50 NA hsa-mir-548c-3p_GO: 0000902; hsa-mir-548c-3p_GO: 0000904; hsa-mir-548c- 3p_GO: 0001525; hsa-mir-548c-3p_GO: 0001568; hsa-mir-548c-3p_GO: 0001944; hsa-mir- 548c-3p_GO: 0006357; hsa-mir-548c-3p_GO: 0006366; hsa-mir-548c-3p_GO: 0006464; hsa- mir-548c-3p_GO: 0006886; hsa-mir-548c-3p_GO: 0006913; hsa-mir-548c- 3p_GO: 0006928; hsa-mir-548c-3p_GO: 0007154; hsa-mir-548c-3p_GO: 0007167; hsa-mir- 548c-3p_GO: 0007169; hsa-mir-548c-3p_GO: 0007275; hsa-mir-548c-3p_GO: 0007389; hsa- mir-548c-3p_GO: 0007399; hsa-mir-548c-3p_GO: 0007409; hsa-mir-548c- 3p_GO: 0007411; hsa-mir-548c-3p_GO: 0007417; hsa-mir-548c-3p_GO: 0007611; hsa-mir- 548c-3p_GO: 0008104; hsa-mir-548c-3p_GO: 0008283; hsa-mir-548c-3p_GO: 0008285; hsa- mir-548c-3p_GO: 0009653; hsa-mir-548c-3p_GO: 0009790; hsa-mir-548c- 3p_GO: 0009887; hsa-mir-548c-3p_GO: 0009888; hsa-mir-548c-3p_GO: 0009891; hsa-mir- 548c-3p_GO: 0009893; hsa-mir-548c-3p_GO: 0009987; hsa-mir-548c-3p_GO: 0010001; hsa- mir-548c-3p_GO: 0010557; hsa-mir-548c-3p_GO: 0010604; hsa-mir-548c- 3p_GO: 0010628; hsa-mir-548c-3p_GO: 0014812; hsa-mir-548c-3p_GO: 0015031; hsa-mir- 548c-3p_GO: 0016477; hsa-mir-548c-3p_GO: 0019538; hsa-mir-548c-3p_GO: 0022008; hsa- mir-548c-3p_GO: 0030154; hsa-mir-548c-3p_GO: 0030182; hsa-mir-548c- 3p_GO: 0030326; hsa-mir-548c-3p_GO: 0030334; hsa-mir-548c-3p_GO: 0031325; hsa-mir- 548c-3p_GO: 0031328; hsa-mir-548c-3p_GO: 0032501; hsa-mir-548c-3p_GO: 0032502; hsa- mir-548c-3p_GO: 0032990; hsa-mir-548c-3p_GO: 0033036; hsa-mir-548c- 3p_GO: 0034613; hsa-mir-548c-3p_GO: 0035107; hsa-mir-548c-3p_GO: 0035108; hsa-mir- 548c-3p_GO: 0035113; hsa-mir-548c-3p_GO: 0035295; hsa-mir-548c-3p_GO: 0040011; hsa- mir-548c-3p_GO: 0040012; hsa-mir-548c-3p_GO: 0042063; hsa-mir-548c- 3p_GO: 0042127; hsa-mir-548c-3p_GO: 0042733; hsa-mir-548c-3p_GO: 0043412; hsa-mir- 548c-3p_GO: 0044238; hsa-mir-548c-3p_GO: 0044267; hsa-mir-548c-3p_GO: 0045184; hsa- mir-548c-3p_GO: 0045595; hsa-mir-548c-3p_GO: 0045596; hsa-mir-548c- 3p_GO: 0045597; hsa-mir-548c-3p_GO: 0045778; hsa-mir-548c-3p_GO: 0045893; hsa-mir- 548c-3p_GO: 0045935; hsa-mir-548c-3p_GO: 0045941; hsa-mir-548c-3p_GO: 0045944; hsa- mir-548c-3p_GO: 0046907; hsa-mir-548c-3p_GO: 0048468; hsa-mir-548c- 3p_GO: 0048513; hsa-mir-548c-3p_GO: 0048514; hsa-mir-548c-3p_GO: 0048518; hsa-mir- 548c-3p_GO: 0048519; hsa-mir-548c-3p_GO: 0048522; hsa-mir-548c-3p_GO: 0048523; hsa- mir-548c-3p_GO: 0048598; hsa-mir-548c-3p_GO: 0048646; hsa-mir-548c- 3p_GO: 0048667; hsa-mir-548c-3p_GO: 0048699; hsa-mir-548c-3p_GO: 0048705; hsa-mir- 548c-3p_GO: 0048731; hsa-mir-548c-3p_GO: 0048736; hsa-mir-548c-3p_GO: 0048812; hsa- mir-548c-3p_GO: 0048846; hsa-mir-548c-3p_GO: 0048856; hsa-mir-548c- 3p_GO: 0048858; hsa-mir-548c-3p_GO: 0048869; hsa-mir-548c-3p_GO: 0048870; hsa-mir- 548c-3p_GO: 0050789; hsa-mir-548c-3p_GO: 0050793; hsa-mir-548c-3p_GO: 0050794; hsa- mir-548c-3p_GO: 0051093; hsa-mir-548c-3p_GO: 0051094; hsa-mir-548c- 3p_GO: 0051101; hsa-mir-548c-3p_GO: 0051169; hsa-mir-548c-3p_GO: 0051239; hsa-mir- 548c-3p_GO: 0051254; hsa-mir-548c-3p_GO: 0051270; hsa-mir-548c-3p_GO: 0051641; hsa- mir-548c-3p_GO: 0051649; hsa-mir-548c-3p_GO: 0051674; hsa-mir-548c- 3p_GO: 0060070; hsa-mir-548c-3p_GO: 0060173; hsa-mir-548c-3p_GO: 0060284; hsa-mir- 548c-3p_GO: 0065007 AD Ovarian Welsh.1 NA hsa-mir-548d-3p_GO: 0006950; hsa-mir-548d-3p_GO: 0007611; hsa-mir-548d- 3p_GO: 0009605; hsa-mir-548d-3p_GO: 0009719; hsa-mir-548d-3p_GO: 0009725; hsa-mir- 548d-3p_GO: 0009889; hsa-mir-548d-3p_GO: 0010468; hsa-mir-548d- 3p_GO: 0010604; hsa-mir-548d-3p_GO: 0019219; hsa-mir-548d-3p_GO: 0019222; hsa-mir- 548d-3p_GO: 0031323; hsa-mir-548d-3p_GO: 0031326; hsa-mir-548d- 3p_GO: 0031440; hsa-mir-548d-3p_GO: 0031442; hsa-mir-548d-3p_GO: 0043066; hsa-mir- 548d-3p_GO: 0043069; hsa-mir-548d-3p_GO: 0048168; hsa-mir-548d- 3p_GO: 0050685; hsa-mir-548d-3p_GO: 0051252; hsa-mir-548d-3p_GO: 0060211; hsa-mir- 548d-3p_GO: 0060213; hsa-mir-548d-3p_GO: 0060255 AD Ovarian Welsh.16 NA hsa-mir-548I_GO: 0006066; hsa-mir-548I_GO: 0008202; hsa-mir-548I_GO: 0055114 CA Colon Graudens.40 NA hsa-mir-557_GO: 0048519; hsa-mir-557_GO: 0048523 SQ Lung Bhattacharjee.23 NA hsa-mir-586_GO: 0001910; hsa-mir-586_GO: 0001912; hsa-mir-586_GO: 0031343; hsa-mir- 586_GO: 0042492; hsa-mir-586_GO: 0045577; hsa-mir-586_GO: 0045586; hsa-mir- 586_GO: 0045588; hsa-mir-586_GO: 0046629; hsa-mir-586_GO: 0046643; hsa-mir- 586_GO: 0046645 END Ovarian Hendrix.58 NA hsa-mir-621_GO: 0006952; hsa-mir-621_GO: 0006954; hsa-mir-621_GO: 0009611 GL Brain Rickman.8 NA hsa-mir-634_GO: 0001661; hsa-mir-634_GO: 0007611; hsa-mir-634_GO: 0007613; hsa-mir- 634_GO: 0014070; hsa-mir-634_GO: 0031646; hsa-mir-634_GO: 0032225; hsa-mir- 634_GO: 0050806; hsa-mir-634_GO: 0051971 AC Brain Sun.5 NA hsa-mir-637_GO: 0002292; hsa-mir-637_GO: 0002293; hsa-mir-637_GO: 0002294; hsa-mir- 637_GO: 0042093 AD Lung Beer.32 NA hsa-mir-656_GO: 0001525; hsa-mir-656_GO: 0001568; hsa-mir-656_GO: 0001570; hsa-mir- 656_GO: 0001944; hsa-mir-656_GO: 0003013; hsa-mir-656_GO: 0006928; hsa-mir- 656_GO: 0007166; hsa-mir-656_GO: 0007275; hsa-mir-656_GO: 0007599; hsa-mir- 656_GO: 0008015; hsa-mir-656_GO: 0008283; hsa-mir-656_GO: 0009653; hsa-mir- 656_GO: 0016477; hsa-mir-656_GO: 0030154; hsa-mir-656_GO: 0030334; hsa-mir- 656_GO: 0030335; hsa-mir-656_GO: 0032501; hsa-mir-656_GO: 0032502; hsa-mir- 656_GO: 0032879; hsa-mir-656_GO: 0040011; hsa-mir-656_GO: 0040012; hsa-mir- 656_GO: 0042060; hsa-mir-656_GO: 0042127; hsa-mir-656_GO: 0048514; hsa-mir- 656_GO: 0048522; hsa-mir-656_GO: 0048583; hsa-mir-656_GO: 0048646; hsa-mir- 656_GO: 0048731; hsa-mir-656_GO: 0048856; hsa-mir-656_GO: 0048870; hsa-mir- 656_GO: 0050878; hsa-mir-656_GO: 0050900; hsa-mir-656_GO: 0051150; hsa-mir- 656_GO: 0051270; hsa-mir-656_GO: 0051272; hsa-mir-656_GO: 0051385; hsa-mir- 656_GO: 0051412; hsa-mir-656_GO: 0051674; hsa-mir-656_GO: 0070374 GL Brain Rickman.2 NA hsa-mir-718_GO: 0002699; hsa-mir-718_GO: 0002703; hsa-mir-718_GO: 0006957; hsa-mir- 718_GO: 0010886; hsa-mir-718_GO: 0019060; hsa-mir-718_GO: 0030581; hsa-mir- 718_GO: 0046719; hsa-mir-718_GO: 0046967; hsa-mir-718_GO: 0051708 B-CLL Leukemia NA hsa-mir-760_GO: 0006323; hsa-mir-760_GO: 0006333; hsa-mir-760_GO: 0006334; hsa-mir- Haslinger.27 760_GO: 0031497; hsa-mir-760_GO: 0034728; hsa-mir-760_GO: 0065004 AD Ovarian Welsh.20 NA hsa-mir-767-5p_GO: 0000902; hsa-mir-767-5p_GO: 0000904; hsa-mir-767- 5p_GO: 0001501; hsa-mir-767-5p_GO: 0001944; hsa-mir-767-5p_GO: 0007229; hsa-mir- 767-5p_GO: 0007409; hsa-mir-767-5p_GO: 0007411; hsa-mir-767-5p_GO: 0009605; hsa- mir-767-5p_GO: 0009888; hsa-mir-767-5p_GO: 0016043; hsa-mir-767- 5p_GO: 0022008; hsa-mir-767-5p_GO: 0030030; hsa-mir-767-5p_GO: 0030198; hsa-mir- 767-5p_GO: 0030199; hsa-mir-767-5p_GO: 0031175; hsa-mir-767-5p_GO: 0032501; hsa- mir-767-5p_GO: 0032989; hsa-mir-767-5p_GO: 0032990; hsa-mir-767- 5p_GO: 0040011; hsa-mir-767-5p_GO: 0042246; hsa-mir-767-5p_GO: 0043062; hsa-mir- 767-5p_GO: 0043588; hsa-mir-767-5p_GO: 0048468; hsa-mir-767-5p_GO: 0048666; hsa- mir-767-5p_GO: 0048667; hsa-mir-767-5p_GO: 0048731; hsa-mir-767- 5p_GO: 0048812; hsa-mir-767-5p_GO: 0048856; hsa-mir-767-5p_GO: 0048858 SQ Lung Bhattacharjee.44 NA hsa-mir-767-5p_GO: 0008544; hsa-mir-767-5p_GO: 0009888; hsa-mir-767- 5p_GO: 0030198; hsa-mir-767-5p_GO: 0030199; hsa-mir-767-5p_GO: 0043062; hsa-mir- 767-5p_GO: 0043588 COID Lung Bhattacharjee.92 NA hsa-mir-920_GO: 0007154; hsa-mir-920_GO: 0030336; hsa-mir-920_GO: 0050865; hsa-mir- 920_GO: 0051271 END Ovarian Hendrix.22 NA hsa-mir-944_GO: 0010817

    TABLE-US-00010 SUPPLEMENTARY TABLE 11 Co-Expresston Cluster Gene Ontology (GO) Num- PubMed miRNA ID Term Tissue Dataset ber Full Cancer Name ID hsa-miR-9 GO:0034641 Cellular nitrogen compound metabolic process Breast IDC Breast Radvanyl 16 Invasive Ductal Carcinoma (Radvanyl et al., 2005) 16043716 Lung AD Lung Beer 11 Adenocarcinoma (Beer et al., 2002) 12118244 hsa-miR-23a/b GO:0016071 mRNA metabolic process Lung AD Lung Bhattacharjee 69 Adenocarcinoma (Bhattacharjee et al., 2001) 11707567 Myeloma MM Myeloma Zhan 43 Multiple Myeloma (Zhan et al., 2002) 11861292 hsa-miR-29a/b/c GO:0006928 Cellular component movement Head & Neck HSCC Head-Neck Chung 1 Head-Neck Squamous Cell Carcinoma (Chung et al., 15144956 2004) GO:0030198 Extracellular matrix organization Lung AD Lung Beer 31 Adenocarcinoma (Beer et al., 2002) 12118244 Lung AD Lung Bhattacharjee 59 Adenocarcinoma (Bhattacharjee et al., 2001) 11707567 Ovarian CCC Ovarian HENDrix 11 Clear Cell Carcinoma (HENDrix et al., 2006) 16452189 Ovarian END Ovarian HENDrix 6 ENDometrioid Adenocarcinoma (HENDrix et al., 2006) 16452189 hsa-miR-130a GO:0009611 Response to wounding Breast CA Breast Richardson 55 Carcinoma (Richardson et al., 2006) 16473279 Prostate TU Prostate Lapointe 25 Primary Tumor (Lapointe et al., 2004) 14711987 hsa-miR-183 GO:0001501 Skeletal system development Myeloma MM Myeloma Zhan 21 Multiple Myeloma (Zhan et al., 7002) 11861292 GO:0001503 Ossification Germ Cell GCT Seminoma Korkola 45 Germ Cell Tumor (Korkola et al., 2006) 16424014 GO:0060348 Bone development hsa-miR-296-5p GO:0006928 Cellular component movement Germ Cell GCT Seminoma Korkola 69 Germ Cell Tumor (Korkola et al., 2006) 16424014 GO:0007155 Cell adhesion Lung AD Lung Bhattacharjee 41 Adenocarcinoma (Bhattacharjee et al., 2001) 11707567 GO:0009653 Anatomical structure morphogenesis Lung SMCL Lung Bhattacharjee 36 Small Cell Lung Cancer (Bhattacharjee et al., 2001) 11707567 GO:0030036 Actin cytoskeleton organization Lung SQ Lung Bhattacharjee 13 Squamous Cell Lung Carcinoma (Bhattacharjee et al., 11707567 2001) GO:0042127 Regulation of cell proliferation GO:0051384 Response to glucocorticoid stimulus hsa-miR-338-5p GO:0000075 Cell cycle checkpoint Germ Cell GCT Seminoma Korkola 88 Germ Cell Tumor (Korkola et al., 2006) 16424014 GO:0000278 Mitotic cell cycle Lung AD Lung Bhattacharjee 0 Adenocarcinoma (Bhattacharjee et al., 2001) 11707567 GO:0006974 Response to DNA damage stimulus Mesothelioma MPM Mesothelioma Gordon 44 Malignant Mesothelioma (Gordon et al., 2005) 15920167 GO:0008152 Metabolic process Ovarian AD Ovarian Welsh 14 Adenocarcinoma (Welsh et al., 2001) 11158614 hsa-miR-369-5p GO:0008152 Metabolic process Brain GBM Brain Liang 18 Glioblastoma Multiforme (Liang et al., 2005) 15827123 GO:0019538 Protein metabolic process Prostate TU Prostate Lapointe 40 Primary Tumor (Lapointe et al., 2004) 14711987 GO:0009987 Cellular process GO:0044237 Cellular metabolic process hsa-miR-487b GO:0031018 ENDocrine pancreas development Ovarian END Ovarian HENDrix 18 ENDometrioid Adenocarcinoma (HENDrix et al., 2006) 16452189 GO:0019083 Viral transcription Renal RCCC Renal Lenburg 2 Clear Cell Renal Cell Carcinoma (Lenburg et al., 2003) 14641932 GO:0019058 Viral infectious cycle GO:0006415 Translational termination GO:0006414 Translational elongation hsa-miR-495 GO:0006397 mRNA procossing Head & Neck HSCC Head-Neck Cromer 25 Head-Neck Squamous Cell Carcinoma(Cromer et al., 14676830 2004) GO:0016071 mRNA metabolic process Lung AD Lung Bhattacharjee 60 Adenocarcinoma (Bhattacharjee et al., 2001) 11707567 Myeloma MM Myeloma Zhan 17 Multiple Myeloma (Zhan et al., 2002) 11861292 hsa-miR-548c-3p GO:0008152 Metabolic process Bladder CA Bladder Dyrskjot 9 Bladder Carcinoma (Dyrskjot et al., 2004) 15173019 GO:0010467 Gene expression Bladder CA Bladder Dyrskjot 13 Bladder Carcinoma (Dyrskjot et al., 2004) 15173019 GO:0016070 RNA metabolic process Bladder CA Bladder Dyrskjot 29 Bladder Carcinoma (Dyrskjot et al., 2004) 15173019 Brain GLB Brain Sun 50 Glioblastoma (Sun et al., 2006) 16616334 Brain OD Brain Bredel 21 OligodENDroglioma (Bredel et al., 2005) 16204036 Brain ODGL Brain Sun 50 OligodENDroglioma (Sun et al., 2006) 16616334 Breast CA Breast Sorlie 12 Carcinoma (Sorlie et al., 2001) 11553815 Germ Cell GCT Seminoma Korkola 95 Germ Cell Tumor (Korkola el al., 2005) 16424014 Leukemia B-CLL Leukemia Haslinger 62 Chronic Lymphocytic Leukemia (Haslinger et al., 2004) 15459216 Lung AD Lung Beer 6 Adenocarcinoma (Beer et al., 2002) 12118244 Lung AD Lung Bhattacharjee 30 Adenocarcinoma (Bhattacharjee et al., 2001) 11707567 Melanoma ME Melanoma Hoek 50 Cutaneous melanoma (Hoek et al., 2006) 16827748 Mesothelioma MPM Mesothelioma Gordon 63 Malignant Mesothelioma (Gordon et al., 2005) 15920167 Myeloma MM Myeloma Zhan 3 Multiple Myeloma (Zhan et al., 2002) 11861292 hsa-miR-548n GO:0010467 Gene expression Bladder CA Bladder Dyrskjot 37 Bladder Carcinoma (Dyrskjot et al., 2004) 15173019 Germ Cell GCT Seminoma Korkola 40 Germ Cell Tumor (Korkola et al., 2006) 16424014 Germ Cell GCT Seminoma Korkola 112 Germ Cell Tumor (Korkola et al., 2006) 16424014 Lung SMCL Lung Bhattacharjee 22 Small Cell Lung Cancer (Bhattacharjee et at., 2001) 11707567 Lung SQ Lung Bhattacharjee 22 Squamous Cell Lung Carcinoma (Bhattacharjee et al., 11707567 2001) Melanoma ML Melanoma Talantov 3 Melanoma (Talantov et al., 2005) 16825504 hsa-miR-590-3p GO:0044237 Cellular metabolic process Leukemia B-CLL Leukemia Haslinger 17 Chronic Lymphocytic Leukemia (Haslinger et al., 2004) 15459216 Bladder CA Bladder Dyrskjot 64 Bladder Carcinoma (Dyrskjot el al., 2004) 15173019 Ovarian CCC Ovarian HENDrix 42 Clear Cell Carcinoma (HENDrix el al., 2006) 16452189 Germ Cell GCT Seminoma Korkola 112 Germ Cell Tumor (Korkola et al., 2006) 16424014 Brain GLB Brain Sun 27 Glioblastoma (Sun et al., 2006) 16616334 Head & Neck HSCC Head-Neck Chung 6 Head-Neck Squamous Cell Carcinoma (Chung et al., 15144956 2004) Myeloma MM Myeloma Zhan 3 Multiple Myeloma (Zhan et al., 2002) 11861292 Mesothelioma MPM Mesothelioma Gordon 16 Malignant Mesothelioma (Gordon et al., 2005) 15920167 Mesothelioma MPM Mesothelioma Gordon 28 Malignant Mesothelioma (Gordon et al., 2005) 15920167 Prostate TU Prostate Lapointe 1 Primary Tumor (Lapointe et al., 2004) 14711987 hsa-miR-607 GO:0000398 Nuclear mRNA splicing, via spliceosome Bladder CA Bladder Dyrskjot 0 Bladder Carcinoma (Dyrskjot et al., 2004) 15173019 Lung SQ Lung Bhattacharjee 22 Squamous Cell Lung Carcinoma (Bhattacharjee et al., 11707567 2001) hsa-miR-656 GO:0001525 Angiogenesis Bladder CA Bladder Dyrskjot 82 Bladder Carcinoma (Dyrskjot et al., 2004) 15173019 GO:0001568 Blood vessel development Lung AD Lung Beer 32 Adenocarcinoma (Beer et al., 2002) 12118244 GO:0001816 Cytokine production GO:0006928 Cellular component movement GO:0006935 Chemotaxis GO:0006952 Defense response GO:0006954 Inflammatory response GO:0006955 Immune response GO:0007166 Cell surface receptor linked signaling pathway GO:0008283 Cell proliferation GO:0009611 Response to wounding GO:0009653 Anatomical structure morphogenesis GO:0009887 Organ morphogenesis GO:0016477 Cell migration GO:0030334 Regulation of cell migration GO:0030335 Positive regulation of cell migration GO:0042060 Wound healing GO:0042127 Regulation of cell proliferation GO:0048514 Blood vessel morphogenesis GO:0048870 Cell motility GO:0050900 Leukocyte migration GO:0051272 Positive regulation of cellular component movement hsa-miR-760 GO:0006334 Nucleosome assembly Brain GLB Brain Sun 41 Glioblastoma (Sun et al., 2006) 16616334 Leukemia B-CLL Leukemia Haslinger 27 Chronic Lymphocytic Leukemia (Haslinger et al., 2004) 15459216 Lung AD Lung Bhattacharjee 42 Adenocarcinoma (Bhattacharjee et al., 2001) 11707567 Myeloma MM Myeloma Zhan 29 Multiple Myeloma (Zhan et al., 2002) 11861292 hsa-miR-767-5p GO:0006928 Cellular component movement Head & Neck HSCC Head-Neck Chung 1 Head-Neck Squamous Cell Carcinoma (Chung et al., 15144956 2004) GO:0030198 Extracellular matrix organization Lung SQ Lung Bhattacharjee 18 Squamous Cell Lung Carcinoma (Bhattacharjee et al., 11707567 2001) GO:0030199 Collagen fibril organization Lung SQ lung Bhattacharjee 44 Squamous Cell Lung Carcinoma (Bhattacharjee et al., 11707567 2001) Ovarian AD Ovarian Welsh 20 Adenocarcinoma (Walsh et al., 2001) 11158614 hsa-miR-890 GO:0001568 Blood vessel development Lung COID Lung Bhattacharjee 36 Carcinoid (Bhattacharjee et al., 2001) 11707567 GO:0001822 Kidney development Ovarian END Ovarian HENDrix 6 ENDometrioid Adenocarcinoma (HENDrix et al., 2006) 16452189 GO:0007155 Cell adhesion GO:0007275 Multicellular organismal development GO:0017015 Regulation of transforming growth factor beta receptor signaling pathway hsa-miR-939 GO:0007267 Cell-cell signaling Brain AC Brain Sun 44 Astrocytoma (Sun et al., 2006) 16616334 GO:0007268 Synaptic transmission Brain ODGL Brain Sun 2 OligodENDroglioma (Sun et al., 2006) 16616334 GO:0050877 Neurological system process hsa-miR-944 GO:0003676 Nucleic acid binding Ovarian END Ovarian HENDrix 38 ENDometrioid Adenocarcinoma (HENDrix et al., 2006) 16452189 GO:0006139 Nucleobase, nucleoside, nucleotide and nucleic acid Ovarian MUC Ovarian HENDrix 15 Mucinous Adenocarcinoma (HENDrix el al., 2006) 16452189 metabolic process GO:0010467 Gene expression hsa-miR-1207-5p GO:0006370 mRNA capping Brain GL Brain Rickman 9 Glioma (Rickman el al., 2001) 11559565 Lung SMCL Lung Bhattacharjee 34 Small Cell Lung Cancer (Bhattacharjee et al., 2001) 11707567 hsa-miR-1275 GO:0007186 G-protein coupled receptor protein signaling Brain GLB Brain Sun 29 Glioblastoma (Sun et al., 2006) :6616334 pathway GO:0007267 Cell-cell signaling Lung AD Lung Beer 43 Adenocarcinoma (Beer et al., 2002) 12118244 hsa-miR-1276 GO:0006334 Nucleosome assembly Bladder CA Bladder Dyrskjot 51 Bladder Carcinoma (Dyrskjot et al., 2004) 15173019 Ovarian END Ovarian HENDrix 35 ENDometrioid Adenocarcinoma (HENDrix et al., 2006) 16452189 Ovarian SRS Ovarian HENDrix 72 Serous Adenocarcinoma (HENDrix et al., 2006) 16452189 hsa-miR-1291 GO:0007154 Cell communication Bladder CA Bladder Dyrskjot 18 Bladder Carcinoma (Dyrskjot et al., 2004) 15173019 Breast IDC Breast Radvanyl 24 Invasive Ductal Carcinoma (Radvanyl et al., 2005) 16043716

    TABLE-US-00011 SUPPLEMENTARY TABLE 12 miRNA PCR Binding Fragment Site in Gene Forward Primer Reverse Primer Size Chr Start Stop Amplicon COL3A1 TCCATATGTGTTCCTCTTGTTCT TTATGGGTGTCTGTAAGGAAAAA 912 2 189584785 189585696 Y SEQ ID NO: 318 SEQ ID NO: 319 COL4A1 CCTGACTCAGCTAATGTCACAA GCAGCTTGTGCAGTAAGTTTCTT 1366 13 109599362 109600565 Y SEQ ID NO: 320 SEQ ID NO: 321 COL4A2 GGCCATTTTGGTGCTTATTC CAGAACCAAGTTTTATTTTGTAGTCG 805 13 109962559 109963363 Y SEQ ID NO: 322 SEQ ID NO: 323 COL5A2 CAATGAGCACCACCATCAAT TTGGAAGTCAAACAAAACTCACA 2000 2 189604886 189607040 Y SEQ ID NO: 324 SEQ ID NO: 325 COL10A1 TCTAAATCTTGTGCTAGAAAAAGCA CTTTGAACAATGAAAAGCCTTG 1107 6 116546778 116547928 Y SEQ ID NO: 326 SEQ ID NO: 327 FBN1 TCACCATCCAGAGACCAAATA CAAAGTGATTTTGGCTGAGTAAA 2593 15 46487885 46490477 Y SEQ ID NO: 328 SEQ ID NO: 329 LOX ATAAATCAGTGCCTGGTGTTCTG ATGAGAATGCAAAGAGGAACA 3450 5 121426789 121430336 Y SEQ ID NO: 330 SEQ ID NO: 331 MMP2 CCTCTCCACTGCCTTCGATA CCTCGAACAGATGCCACAAT 1017 16 54096882 54097898 Y SEQ ID NO: 332 SEQ ID NO: 333 PDGFRB TTTCTGCTCCTGACGTGTTG TGAGTGAGAAGCACCAGGTTT 1797 5 149473597 149475393 Y SEQ ID NO: 334 SEQ ID NO: 335 SERPINH1 CTCAGGGTGCACACAGGAT CACGCTCCAACAAAATGTCA 712 11 74960780 74961491 Y SEQ ID NO: 336 SEQ ID NO: 337 SPARC CTCTTTAACCCTCCCCTTCG GAGGGGAAATGACATCTGGA 2039 15 151021258 151023296 Y SEQ ID NO: 338 SEQ ID NO: 339 Recombinant PCR Primers MMP2_recomb_F GCCACACTTCAGGCTCTTCTC (SEQ ID NO: 340) MMP2_bubble_del_R GAGAAGAGCCTGAAGTGTGGCcgacaacGGGCAGCCCAAAGCAGGGCTG (SEQ ID NO: 341) SPARC_recomb_del_F CATAGATTTAAGTGAATACATTAACatgcggtAAAATGAAAATTCTAACCC (SEQ ID NO: 342) SPARC_recomb_del_R TGTATTCACTTAAATCTATGTaccgcatTTGTCTCCAGGCAGAACAAC (SEQ ID NO: 343)