ANALYTICAL AND DIAGNOSTIC METHODS UTILIZING SHIGELLA FLEXNERI APYRASE
20170321196 · 2017-11-09
Inventors
Cpc classification
C12Q1/008
CHEMISTRY; METALLURGY
C12Y306/01005
CHEMISTRY; METALLURGY
C12Y306/01
CHEMISTRY; METALLURGY
International classification
Abstract
A method, comprising the steps of providing a sample containing contaminating nucleoside diphosphates and/or nucleoside triphosphates, such as ATP and/or ATP analogues including deoxyribonucleoside triphosphates; reducing the amount of the contaminating nucleoside diphosphates and/or nucleoside triphosphates in the sample with an apyrase enzyme, wherein said apyrase enzyme is a Shigella flexneri apyrase; and performing an analysis of the sample, wherein said analysis comprises an assay that would have been affected by the contaminating nucleoside diphosphates and/or nucleoside triphosphates had they not been reduced in the reduction step.
Claims
1-39. (canceled)
40. A method, comprising: providing a sample containing contaminating nucleoside diphosphates nucleoside triphosphates, or both, such as ATP, ATP analogues, or both including deoxyribonucleoside triphosphates; reducing the amount of the contaminating nucleoside diphosphates, nucleoside triphosphates, or both in the sample with an apyrase enzyme, wherein said apyrase enzyme is a Shigella flexneri apyrase; and performing an analysis of the sample, wherein said analysis comprises an assay that would have been affected by the contaminating nucleoside diphosphates, nucleoside triphosphates, or both had they not been reduced.
41. The method according to claim 40, further comprising determining the amount of ATP in the sample, comprising: reducing the amount of contaminating ATP, ATP analogues, or both in the sample by degradation with an apyrase enzyme, wherein the apyrase enzyme is a Shigella flexneri apyrase; making the ATP to be determined available for determination; and determining the amount of ATP in the sample.
42. The method according to claim 41, wherein the method further comprises determining the amount of ATP present in a first population of cells in the sample, comprising: reducing the amount of contaminating ATP, ATP analogues, or both in the sample by degradation with an apyrase enzyme, wherein the apyrase enzyme is a Shigella flexneri apyrase; liberating the ATP to be determined from the first population of cells; and determining the amount of liberated ATP from the first population of cells.
43. The method according to claim 42, wherein liberating the ATP to be determined from the first population of cells involves lysis of the first population of cells.
44. The method according to claim 42, wherein the first population of cells comprises bacterial cells.
45. The method according to claim 42, wherein the first population of cells comprises mammalian cells.
46. The method according to claim 42, wherein the sample is a biological sample from an animal.
47. The method according to claim 46, wherein the sample is a biological sample from a human.
48. The method according to claim 40, wherein the sample is a blood sample, a plasma sample, a serum sample, a urine sample, a fecal sample, or a swab from a patient.
49. The method according to claim 41, wherein at least a fraction of the contaminating ATP is present in a second population of cells, and reducing the amount of contaminating ATP, ATP analogues, or both in the sample is preceded by selective liberation of ATP from the second population of cells.
50. The method according to claim 49, wherein the second population of cells are host cells from an animal from which the sample is derived.
51. The method according to claim 40, where the method comprises adding an apyrase inhibitor after reducing the amount of the contaminating nucleoside diphosphates, nucleoside triphosphates, or both in the sample.
52. The method according to claim 51, wherein the apyrase inhibitor comprises ortho-vanadate or Mg2+.
53. The method according to claim 52, wherein ortho-vanadate is present at a concentration of at least 0.1 mM.
54. The method according to claim 40, wherein the sample is a cell culture medium sample, food sample, a beverage sample, a pharmaceutical sample, a sewage sample, an environmental sample such as a swab from a surface, or a drinking water sample.
55. The method according to claim 42, further comprising calculating the number or concentration of viable cells of the first population present in the sample from the amount of liberated ATP that is determined.
56. The method according to claim 40, wherein the method is a sequencing-by-synthesis procedure, the contaminating nucleotides comprise excess dNTPs or analogues thereof present after a completed sequencing cycle, and the analysis performed on the sample is a sequence readout.
57. The method according to claim 40, wherein the method further comprises: performing a pyrosequencing reaction comprising adding a nucleoside triphosphate and releasing a pyrophosphate; converting the released pyrophosphate into ATP via an enzymatic reaction; determining the amount of ATP formed; degrading unincorporated nucleoside triphosphate and ATP with an apyrase enzyme, wherein the apyrase enzyme is a Shigella flexneri apyrase; repeating the performing, converting, determining, and degrading steps at least once.
58. The method according to claim 41, wherein determining the amount of formed ATP is performed with a bioluminescent assay.
59. The method according to claim 58, wherein the bioluminescent assay utilizes luciferin and luciferase.
60. The method according to claim 59, wherein the luciferase is provided in a composition comprising an apyrase inhibitor comprising ortho-vanadate.
61. The method according to claim 40, wherein the Shigella flexneri apyrase comprises an amino-acid sequence having at least 80% sequence identity to SEQ ID NO: 10.
62. The method according to claim 40, wherein the Shigella flexneri apyrase comprises an amino-acid sequence according to SEQ ID NO: 4.
63. The method according to claim 40, wherein Shigella flexneri apyrase is in a buffer having a pH in the range of 6-9, and an ionic strength of at least 300 mM.
64. A Shigella flexneri apyrase comprising an amino-acid sequence having at least 97% sequence identity to SEQ ID NO: 4 and having apyrase activity.
65. The Shigella flexneri apyrase according to claim 64, comprising an amino-acid sequence according to SEQ ID NO: 4.
66. A composition comprising a Shigella flexneri apyrase in a buffer having a pH in the range of 6-9, and an ionic strength of at least 300 mM.
67. The composition according to claim 66, wherein the ionic strength is 300-1000 mM.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0071]
[0072]
[0073]
[0074] The transformed clone of rSFA bearing apyrase gene with 6x Histidines was sequenced by Sanger's method. The cloned fragment contained 780 homologous bases (
[0075]
[0076] The enzymes, rSFA and STA diluted in 10× in Tris-EDTA Buffer were tested to compare their ATP degradation efficiencies. As can be seen in the figure, rSFA was very efficient in eliminating the ATP, while the commercial STA found to be slower. Even after 60 min of reaction, STA could not eliminate ATP completely, while rSFA eliminated ATP in .sup.˜15 min with a rate constant of 3.87 min.sup.−1. Light was measured in the fully automatic 1251 Luminometer (LKB-Wallac, Turku, Finland).
[0077]
[0078] The effect of the addition of recombinant Shigella flexineri apyrase (rSFA; diamonds), potato apyrase (STA; squares) and ATP on the light emission from the firefly luciferase reaction. The reaction mixture consisted of 0.2 mL ATP Reagent SL and 0.8 mL Tris-EDTA Buffer (BioThema AB, Sweden). The 1.sup.st, 3.sup.rd and 4.sup.th arrows denote ATP addition and the 2.sup.nd arrow apyrase addition. The light was measured every 15 sec except at the additions. Ten μL of 10 μmol/L ATP was added along with 10 μL apyrase. Light was measured in the fully automatic 1251 Luminometer (LKB-Wallac, Turku, Finland).
[0079]
[0080] Comparison of ATP elimination with rSFA and STA. In luminescence analysis with 100% crude serum (
[0081]
[0082] Comparison of three different commercial products of potato apyrase termed STA, A6535 and A6237, to rSFA in buffer. rSFA exhibits superior results.
[0083]
[0084] Comparison of commercial products of potato apyrase like STA, A6535 and A6237 to rSFA in 10% serum. rSFA exhibits superior results.
[0085]
[0086] Comparison of commercial STA to rSFA in urine, rSFA exhibits superior results. Though both the enzymes showed similar initial activities, rate of action of STA was hindered after 3 min, whereas rSFA continued with ATP-elimination. Even after 4 subsequent injections of 10 μL 10 μmol/L ATP, the rSFA showed a complete ATP elimination activity each time in less than 3 min but STA could not digest the ATP even after 20 min.
[0087]
[0088] Elimination of ADP at 10 μL 10 μmol/L and a mixture of ATP and ADP at 10 μL 10 μmol/L were tested in urine samples. The activity of STA was decreased after either by the addition of ADP or in the mixture of ATP and ADP, whereas the activity of rSFA was not affected.
[0089]
[0090] Equal concentration of rSFA was stored in Buffer 1, Buffer 2 and Buffer 3 for about 10 months and the ATP-elimination assays were performed. The activity of the enzyme was checked intermittently and found that the enzyme used with Buffer 3 showed very good activity compared with other two buffers
[0091]
[0092] Among the different inhibitors tested, 100 mM of MgSO.sub.4 and 1 mM of ortho-vanadate in the form of Na.sub.3VO.sub.4 showed inhibitory action against rSFA. The ortho-vanadate at 1 mM did not affect luciferase at all and at the same time, it completely inhibited the activity of rSFA. Magnesium was also able to completely inhibit rSFA at 50 mM, but it also decreased the activity of luciferase.
[0093]
[0094] To compare the rSFA activity on nucleotides to STA, samples of ATP, dATP, dTTP, dGTP and dCTP were incubated with the enzyme for 5 min or 35 min and the products detected using high performance liquid chromatography (HPLC). In all instances rSFA resulted in superior elimination of the nucleotide triphosphates and in particular effectively eliminated nucleotide diphophates, which the STA eliminated rather ineffectively.
DETAILED DESCRIPTION
[0095] The inventors have surprisingly found that Shigella flexneri apyrase (SFA; known as such from WO1994/012211) is more effective in eliminating contaminating or otherwise unwanted nucleoside triphosphates and nucleoside diphosphates, in particular ATP and/or other ATP-analogues, than the commonly used Solanum tuberosum apyrase (STA; potato apyrase).
[0096] Table 1 shows a comparison between recombinant Shigella flexneri apyrase (rSFA) and Solanum tuberosum apyrase (STA; potato apyrase). The amount of STA used was slightly higher in terms of units, and after one minute, the amount of ATP remaining was lower in the
[0097] STA samples compared to rSFA by nearly a factor of 2. However, at the time point 17 minutes, concentration of ATP in the rSFA treated samples was about 20 times lower compared to STA-treated samples. At 91 minutes the difference was yet more pronounced, the rSFA treated samples having about 45-fold lower concentration than STA-treated samples. It is noteworthy that even after 91 minutes of incubation, the amount of residual ATP was higher in the STA samples compared to the rSFA-samples at 17 minutes.
[0098] Without being bound by theory it may be assumed that the greater ability to degrade ATP and its analogues results from one or more of: higher substrate affinity, higher enzyme stability under the assay conditions, lesser inhibition from the reaction end-products. In all ATP-based reactions, presence or accumulation of contaminants or byproducts like ADP, AMP, ATP, dNTP, dNDP, XMP, etc. may interfere with the assay.
[0099] Commercial apyrase preparations often contain a mixture of isoenzymes with different relative affinities for ATP, ADP, xMP like tetra- or penta-phosphates, etc. Moreover, the apyrase enzyme activity of different commercial suppliers varies with regard to initial activity and different lots of the same product may show substantially variable ATP-hydrolyzing activities. These variations may be significant obstacles for the development of a robust and sensitive analytical method for analyzing various biological samples.
[0100] In this regard, it can be concluded that SFA is much more effective in eliminating traces of above said contaminating ATP and its analogues (or other nucleotides) in a sample that generally hinder the activity and sensitivity of STA. This translates in practical terms that assays for determining the amount of ATP in a sample, where there is or may be contaminating ATP present can achieve greater sensitivity due to better elimination of most of the ATP-analogues, when SFA is used as an apyrase (see Examples 6, 7, 8, and 9). Additionally, in certain circumstances the use of SFA provides for a faster assay by sufficiently eliminating the contaminating ATP in a shorter time. The better elimination of dNTPs (Example 11) also provides for improved sequencing-by-synthesis methods using SFA.
[0101] The inventors have also shown that the SFA is not only stable in the reaction conditions but also tolerates freeze-thaw-cycles and storage in solution at refrigerator temperatures, even in crude form, without the addition of stabilizers. The fact that enzyme remains to be active even in high concentrations of EDTA indicates that it does not require any divalent metal ions for its activity, unlike STA. The SFA exhibits very good activity between pH 7.0-7.5, while it remains active between pH 5.0 and 9.5. Therefore the invention provides an opportunity to apply SFA on different biological samples and analytical experiments with a wide range of pH-values. The stability presents a substantial practical advantage, in particular for field laboratories with limited equipment where ATP measurements are performed at times.
[0102] Thus, in a first aspect, the present invention relates to a method for reducing the amount of contaminating nucleoside diphosphates and/or nucleoside triphosphates, comprising the steps of [0103] a. providing a sample containing contaminating nucleoside diphosphates and/or nucleoside triphosphates, such as ATP and/or ATP analogues; [0104] b. reducing the amount of the contaminating nucleoside diphosphates and/or nucleoside triphosphates in the sample with an apyrase enzyme, wherein said apyrase enzyme is a Shigella flexneri apyrase; and [0105] c. optionally, performing an analysis of the sample, wherein said analysis comprises an assay that would have been affected by the contaminating nucleoside diphosphates and/or nucleoside triphosphates had they not been reduced in step b.
[0106] The assay may involve be determination of the amount or concentration of ATP in the sample. By “would have been affected” is meant that the assay is of such character that contaminating nucleoside diphosphates and triphosphates may potentially have an interfering effect. The recitation is not intended to imply that the reduction in step (b) necessarily results in complete elimination of any and all interference. Rather, even less than complete reduction, including partial reduction, substantial reduction, near complete reduction of interference is encompassed.
[0107] The contaminating nucleoside triphosphates may comprise deoxyribonucleoside triphosphates (dATP, dTTP, dGTP, dCTP or analogues thereof), and the analysis may be a sequencing-by-synthesis-assay, such as a pyrosequencing reaction.
[0108] By “reducing” is meant that the amount is significantly reduced for practical purposes such that the contaminating nucleoside triphosphates or nucleoside diphosphates do not jeopardize the accuracy of the determination in subsequent steps. Preferably, the reduction results in substantial elimination of the contaminating nucleotide to a level of less than 0.01% of the original amount, more preferably to less than 0.001% of the original amount, most preferably to less than 0.0001% of the original amount.
[0109] Methods for Determining ATP in a Sample
[0110] The method of the first aspect may be a method for determining the amount of ATP in a sample, comprising the steps of: [0111] a. reducing the amount of contaminating ATP and/or ATP analogues and its analogues in the sample by degradation with an apyrase enzyme; [0112] b. making the ATP to be determined available for determination; and [0113] c. determining the amount of ATP to be measured in the sample, wherein the apyrase enzyme is a Shigella flexneri apyrase.
[0114] By “reducing” in the context of ATP determination meant that the amount is significantly reduced for practical purposes such that the contaminating ATP or ATP analogue does not jeopardize the accuracy of the determination in subsequent steps. Preferably, the reduction results in substantial elimination of the contaminating ATP or ATP analogue to a level of less than 0.01% of the original amount, more preferably to less than 0.001% of the original amount, most preferably to less than 0.0001% of the original amount.
[0115] The step (b) of making the ATP to be determined available for determination may involve lysis of cells in which the ATP to be determined may be contained, e.g. by heat, denaturing agents, detergents or a combination thereof. The manner of lysis does not matter, as long as the manner used is compatible with the technique used in the determination in step (c).
[0116] Alternatively, the ATP may be made available by synthesizing it in the sample, e.g. by way of enzymatic conversion of a different chemical species to ATP.
[0117] Methods for Determining the Amount of ATP Present in Cells
[0118] The method of the first aspect may be a method for determining the amount of ATP present in first population of cells in a sample, comprising the steps of: [0119] (a) reducing the amount of contaminating ATP and/or ATP analogues in the sample by degradation with an apyrase enzyme; [0120] (b) liberating the ATP to be determined from the first population of cells; and [0121] (c) determining the amount of liberated ATP; [0122] wherein the apyrase enzyme in step (a) is a Shigella flexneri apyrase.
[0123] By “liberating” is meant that the ATP is made accessible for the determination in step (c).
[0124] The liberation step (b) may involve lysis of the first population of cells, e.g. by heat, denaturing agents, detergents or a combination thereof. The manner of lysis does not matter, as long as the manner used is compatible with the technique used in the determination in step (c).
[0125] The first population of cells may comprise bacterial cells. For instance, it may be of interest to determine the number of bacteria present in a clinical sample. Thus, the sample may a biological sample from an animal, such as a human, a canine, a feline, a bovine, an avian or the like. Preferably, the sample is from a human.
[0126] The biological sample may for example be a blood sample, a plasma sample, a serum sample, a urine sample or a fecal sample. The sample may be in the form of a swab from a subject, e.g. from skin or a mucous membrane.
[0127] The method of the first aspect may comprise the step of adding an apyrase inhibitor after the reduction step. The apyrase inhibitor added may comprise ortho-vanadate. In the context of the present invention, ortho-vanadate is advantageous since it is able to inhibit Shigella flexneri-apyrase at a concentration which does not inhibit luciferase. Ortho-vanadate as apyrase inhibitor may be present at a concentration of at least 0.1 mM, preferably 0.2-25 mM, more preferably 0.5-20 mM, most preferably about 1 mM in the sample, Alternatively, magnesium can be used as an apyrase inhibitor. Mg.sup.2+ may be present at a concentration of at least 25 mM, preferably 30-200 mM, more preferably 30-150 mM in the sample.
[0128] In the present methods, it may be desirable to inhibit apyrase activity after the contaminating nucleotides have been eliminated, so that the subsequent analysis of the sample is not detrimentally affected by the apyrase. For instance, the apyrase may be inhibited before the liberation of ATP from the first population of cells discussed above, so that the apyrase does not interfere with the determination of the liberated ATP by eliminating some of it.
[0129] At least a fraction of the contaminating ATP (or ATP analogues) may be present in a second population of cells, and the reduction step (a) may be preceded by a step of selective liberation of ATP from the second population of cells. In cases where the second population of cells comprises animal cells and the first population comprises bacterial cells, the animal cells can normally be selectively lysed in much milder conditions than the most types of relevant bacterial cells. For instance, a mild detergent such as Triton X-100 may be used to selectively lyse animal cells in the presence of bacterial cells. See for example U.S. Pat. No. 4,303,752.
[0130] The second population of cells may be host cells from the animal from which the biological sample is derived.
[0131] The method according to the first aspect may also be applied to non-biological samples, such as cell culture medium, food, beverages, pharmaceuticals, sewage, environmental samples such as swabs from environmental surfaces, drinking water and the like.
[0132] The method for determining the amount of ATP present in first population of cells in a sample may additionally comprise step (d) of calculating the number or concentration of viable cells of the first population present in the sample from the amount of ATP determined in step (c). Since the ATP concentration in a cell is fairly constant, the number of cells may be estimated from the amount of ATP determined, e.g. by comparing the reading to a standard curve obtained from a similar type of cell.
[0133] Methods for Doing Sequencing-By-Synthesis, Such as Pyrosequencing
[0134] In general terms, any sequencing-by-synthesis procedure involves sequential addition of a known deoxynucleotide (or an analogue thereof) to a reaction mixture where DNA synthesis will occur dependent on the sequence of the DNA to be sequenced. The addition is followed by determining whether DNA synthesis actually occurred (allowing determination of the sequence), followed by elimination of excess added nucleotide before the next cycle is initiated. It is of importance that the elimination is complete and no intermediate products such as deoxynucleotide diphosphates accumulate, as this would interfere with the subsequent sequencing cycles. The elimination of nucleotides may according to the present disclosure advantageously be performed with SFA, since it exhibits better properties in nucleotide elimination (deoxynucleoside di- and triphosphates) than the commonly used STA (see Example 11). Thus, the method of the first aspect may be a sequencing-by-synthesis procedure, the contaminating nucleotides consist of or comprise excess dNTPs or analogues thereof present after a completed sequencing cycle, and the analysis performed on the sample is a sequence readout.
[0135] Pyrosequencing is a well-established DNA sequencing method of the sequencing by synthesis-type, based on the detection of pyrophosphate (PPi) released during DNA synthesis. Briefly, the steps of a typical pyrosequencing protocol can be outlined as follows: [0136] 1. A sequencing primer is hybridized to a single stranded DNA template to be sequenced, and incubated with the following enzymes: a DNA polymerase, an ATP sulfurylase, a luciferase and an apyrase, and the following substrates: adenosine 5′ phosphosulfate (APS) and luciferin. [0137] 2. The first of four deoxynucleotide triphosphates (dNTP) is added to the reaction. It should be noted that deoxyadenosine alpha-thio triphosphate (dATPaS) is used as a substitute for the natural deoxyadenosine triphosphate (dATP) since it is efficiently used by the DNA polymerase, but not recognized by the luciferase. The DNA polymerase then catalyzes the incorporation of the deoxynucleotide triphosphate into the DNA strand, if it is complementary to the base in the template strand. Each incorporation event is accompanied by release of pyrophosphate (PPi) in a quantity equimolar to the amount of incorporated nucleotide. [0138] 3. ATP sulfurylase quantitatively converts the PPi to ATP in the presence of adenosine 5′ phosphosulfate. The produced ATP drives the luciferase-mediated conversion of luciferin to oxyluciferin that generates visible light in amounts that are proportional to the amount of ATP. The light produced in the luciferase-catalyzed reaction is detected by a detector (such as a CCD-camera). Each light signal is proportional to the number of nucleotides incorporated. [0139] 4. Apyrase continuously degrades any unincorporated dNTPs and excess ATP. When degradation is complete, another dNTP can be added to continue with the next cycle in sequencing. Addition of dNTPs is performed one at a time. As the process continues, the complementary DNA strand is built up and the nucleotide sequence can be determined from a graph showing light output over time in relation to the time points of addition of the dNTPs.
[0140] Since the commercially available enzymes show batch-to-batch variations in their quality and activity, the applicability of pyrosequencing reaction is limited for sequencing longer oligonucleotides. However, the present invention provides that Shigella flexneri apyrase can be used as the apyrase in a pyrosequencing reaction with improved results, since it is more efficient in eliminating deoxynucleoside di- and triphosphates (see Example 11).
[0141] Thus, the present invention provides a method of the first aspect, being a method for performing pyrosequencing, and comprising the steps of: [0142] a. performing a pyrosequencing reaction comprising addition of a nucleoside triphosphate; [0143] b. converting the pyrophosphate released in step (a) into ATP via an enzymatic reaction; [0144] c. determining of the amount of ATP formed in step (b); [0145] d. degrading unincorporated nucleoside triphosphate from step (a) and ATP formed in step (b) with an apyrase enzyme; [0146] e. repeating the steps a-d at least once; [0147] wherein the apyrase enzyme is a Shigella flexneri apyrase.
[0148] General Aspects of the Methods
[0149] In all of the methods above, the determination of ATP may be performed with a bioluminescent assay. Preferably, the determination of ATP is performed with a bioluminescent assay utilizing luciferin and luciferase. Luciferase may be provided in a composition according to the eigth aspect, to enable inhibition of apyrase concomitant to luciferase addition.
[0150] The Shigella flexneri apyrase in the methods mentioned above may comprise an amino-acid sequence having sequence identity of 80%, more preferably 85%, even more preferably 90%, yet more preferably 95%, still more preferably 97% to the sequence according to SEQ ID NO: 10. Importantly, only such sequence deviations from the native Shigella flexneri apyrase according to SEQ ID NO: 10 that retain the apyrase activity are encompassed in the invention. Most preferably, the Shigella flexneri apyrase in the methods above comprises or consists of an amino-acid sequence according to SEQ ID NO: 4. Shigella flexneri apyrase may be provided in a composition according to the seventh aspect of the invention.
[0151] Apyrase Reagents and Their Production
[0152] In a second aspect, the present invention relates to a Shigella flexneri apyrase comprising an amino-acid sequence with at least 95%, more preferably 96%, yet more preferably 97%, still more preferably 98% identity, even more preferably 99% sequence identity to the sequence according to SEQ ID NO: 4. Importantly, only such sequence deviations from the Shigella flexneri apyrase according to SEQ ID NO: 4 that retain the apyrase activity are encompassed in the invention. Most preferably, the Shigella flexneri apyrase of the second aspect comprises or consists of an amino-acid sequence according to SEQ ID NO: 4.
[0153] In a third aspect, the present invention relates to a polynucleotide encoding an apyrase according to second aspect.
[0154] In a fourth aspect, the present invention relates to a vector comprising a polynucleotide of the third aspect operably linked to a promoter capable of inducing expression of the polynucleotide, preferably via arabinose induction.
[0155] In a fifth aspect, the present invention relates to a host cell comprising a polynucleotide of the third aspect operably linked to a promoter capable of inducing expression of the polynucleotide, or a vector of the fourth aspect.
[0156] In a sixth aspect, the present invention relates to a method of producing a recombinant apyrase according the second aspect, comprising the steps of: [0157] culturing host cells according to the fifth aspect in conditions inducing the expression of the polynucleotide; and [0158] recovering the produced recombinant apyrase from the culture.
[0159] In a seventh aspect, the present invention provides a composition comprising a Shigella flexneri-apyrase having a pH in the range of 6-9, preferably 7-8, and an ionic strength of at least 300 mM. Preferably, the pH is about 7.5. The buffer may be a HEPES buffer. The ionic strength may be 300-1000 mM, preferably 400-800 mM, more preferably 500-800 mM. The buffer may comprise 400-600 mM NaCI and 20-30 mM MgSO.sub.4. As shown in Example 10, the buffer of the seventh aspect is particularly advantageous in terms of enzyme stability.
[0160] In an eighth aspect, the present invention provides a composition comprising a luciferase and an apyrase inhibitor comprising ortho-vanadate. The advantages of ortho-vanadate are discussed in the context of the first aspect of the present invention. It is advantageous to combine the apyrase inhibitor with the luciferase in a single composition, enabling both to be added in a single action. The concentration of ortho-vanadate should chosen such that the final concentration of ortho-vanadate in the sample after addition of the composition to a reaction mixture being used in a luciferase-based assay is sufficient to inhibit SFA. The concentration of ortho-vanadate may be at least 0.2 mM, preferably at least 1 mM, more preferably 1-3000 mM, most preferably 2-200 mM. The amount of luciferase activity should be sufficient for a luciferase-based assay after addition of the composition to a reaction mixture.
[0161] Uses of SFA Apyrase
[0162] In a ninth aspect, the present invention relates to a use of a Shigella flexneri apyrase for degrading contaminating nucleotides (nucleotide triphosphates and/or nucleotide diphosphates) in an analytical method. The contaminating nucleotides may be ATP and/or ATP analogues, and the analytical method may be an assay for measuring ATP. The assay for measuring ATP may be a bioluminescent assay.
[0163] In an tenth aspect, the present invention relates to a use of a Shigella flexneri apyrase in a DNA sequencing reaction, preferably a sequencing-by-synthesis reactions, most preferably a pyrosequencing method.
[0164] The apyrase in the ninth or the tenth aspects may comprise an amino-acid sequence having sequence identity of 80%, more preferably 85%, even more preferably 90%, yet more preferably 95%, still more preferably 97% to the sequence according to SEQ ID NO: 10. Importantly, only such sequence deviations from the native Shigella flexneri apyrase according to SEQ ID NO: 10 that retain the apyrase activity are encompassed in the invention. More preferably, the apyrase in the ninth and the tenth aspects may be an apyrase according to the second aspect.
[0165] All references cited herein are hereby incorporated by reference. The arrangement of the present disclosure into sections with headings and subheadings is merely to improve legibility and is not to be interpreted limiting in any way, in particular, the division does not in any way preclude or limit combining features under different headings and subheadings with each other.
[0166] The following examples are not to be construed as limiting of the invention.
EXAMPLES
[0167] For experimental details concerning the examples below, the reader is directed to a separate section titled Materials and Methods.
Example 1
Production and Colorimetric Evaluation of Recombinant Shigella flexneri Apyrase (SFA)
[0168] The SFA was produced and purified as described in the materials and methods section. The purified enzyme fraction was examined using a colorimetric assay to identify the presence of bacterial apyrase. As can be seen in
[0169] As shown in
Example 2
Sequence Analysis Between rSFA and STA
[0170] Once the protein expression was confirmed by gel electrophoresis and colorimetric assay, the rSFA gene product was sequenced to identify the nucleotide sequence in order to compare with the reference sequence WP_010921592.1 obtained from the NCBI database (
Example 3
rSFA is More Efficient in ATP-Degradation Compared to STA and is Stable
[0171] The measurements of the decay of the light emission from the firefly luciferase reaction (
[0172] The rSFA samples were kept at 4° C., then frozen and freeze-thawed to check its stability. An effort was made to see if the rSFA could be used to prepare a reagent for the depletion of extraneous ATP in biological samples.
TABLE-US-00001 TABLE 1 ATP-degradation activity comparison between recombinant Shigella flexneri apyrase and commercially available potato apyrase procured from Sigma-Aldrich Initial activity Remaining ATP activity (Units/mg after after Type of apyrase protein) after 1 min 17 min 91 min Potato apyrase (STA) 4.12 1.1876% 0.0367% 0.0228% Recombinant Shigella 3.39 2.6953% 0.0019% 0.0005% apyrase (rSFA)* Recombinant Shigella 3.58 2.1855% 0.0019% 0.0004% apyrase (rSFA)** *Stored frozen before experiment **Stored in refrigerator before experiment
[0173] Furthermore the remaining ATP was much lower after longer incubation times as shown in the Table 1. This indicates that the SFA, is more sensitive and efficient than STA in ATP depletion, as ADP accumulates in the reaction mixture and so hinders the reaction efficiency of the latter.
Example 4
Demonstration of Extracellular ATP and its Analogues in Serum
[0174] Considering the advantages of rSFA from the above experiments, we checked its efficiency removing extracellular ATP in serum samples. In the first experiment (
TABLE-US-00002 TABLE 2 The effect of serum on ATP depletion rate in crude and diluted serum No serum Undiluted serum 10% (Negative control) (100% crude serum) Diluted serum potato apyrase 3.52 0.55355219 2.42904382 recombinant 3.98 1.81641444 1.77443406 apyrase
Example 5
Improved Method for Pyrosequencing
[0175] Since the commercially available enzymes show batch-to-batch variations in its quality and activity and inability to hydrolyze excess of ATP and its analogues, it decreases the efficiency and limits the applicability of pyrosequencing reaction to read long sequences. This can be addressed using rSFA because it shows better quality and efficiency compared to STA. See also Example 11.
Example 6
rSFA is Superior to STA in an ATP Bioluminescent Assay, In Buffer
[0176] The time course of activities, including initial and end-point activities of three commercial products of potato apyrase termed STA, A6535 and A6237 were compared with rSFA in a bioluminescent ATP assay. The enzymes were diluted in a buffer, so no sample interference should be present and the results represent an ideal scenario. The measurement was light output from a luciferase, and the desired result is as fast and complete as possible elimination of ATP by the apyrase.
[0177] As shown in
Example 7
rSFA is Superior to STA in an ATP Bioluminescent Assay, in 10% Serum
[0178] An experiment similar to Example 8, but with 10% serum present in the assay mixture was undertaken to test utility of rSFA in samples containing serum, such as blood samples.
[0179] As depicted in
Example 8
rSFA is Superior to STA in an ATP Bioluminescent Assay, In Urine
[0180] Considering the complications due to contaminants in urine, the inventors tested the ATP-elimination activities of STA and rSFA for 60 min in an urine sample. Though both the enzymes showed similar initial activities, rate of action of STA was hindered after 3 min, whereas rSFA continued with ATP-elimination. Even after 4 subsequent injections of 10 μL 10 μmol/L ATP, the rSFA showed a complete ATP elimination activity each time in less than 3 min but STA could not digest the ATP even after 20 min (
Example 9
Effect of ATP-Analogues on the Activities STA and rSFA
[0181] Hydrolysis of ATP, ADP and their mixtures in urine was tested with STA and rSFA.
Example 10
Optimization of Buffer System to Improve the Activity of rSFA
[0182] Selection and optimization of a correct buffer system is an important aspect of enzyme stability. The inventors have developed three buffer systems to optimize the stability of rSFA. Equal concentration of rSFA was stored in Buffer 1, Buffer 2 and Buffer 3 for about 10 months at +4° C. and the bioluminescent ATP-elimination assays were performed. The activity of the enzyme was assayed and it was found that the enzyme used with Buffer 3 showed particularly good activity compared with other two buffers (
Example 11
Activity of rSFA on ATP, dATP, dTTP, dGTP and dCTP
[0183] To compare rSFA activity on nucleotides to that of STA, ATP, dATP, dTTP, dGTP and dCTP were incubated with the enzymes (same initial activity) for 5 min and 35 min and the resulting products were detected using high performance liquid chromatography (HPLC).
[0184] As a starting point, chromatographic analysis of ATP (
[0185]
[0186] Similarly, dTTP was converted in to TDP and TMP in 35 min by STA, whereas rSFA fully converted dTTP it into TMP in less than 5 min (
[0187] Similar results were observed with dGTP (
[0188] However, as can been in
[0189] The above results indicate that SFA is superior to STA for eliminating dNTPs and dNDPs, which is in particular relevant for use in a sequencing-by-synthesis method (such as pyrosequencing), since the accumulation of dNTP and/or dNDPs interfere with subsequent sequencing cycles.
Example 12
rSFA Can Be Inhibited by Ortho-Vanadate Without Interferering with Luciferase Activity
[0190] The activity of rSFA may in some cases need to be stopped in order to measure the intracellular concentration of ATP. Among the different inhibitors tested, 100 mM of MgSO.sub.4 and 1 mM of ortho-vanadate in the form of Na.sub.3VO.sub.4, where only the former affected the activity of luciferase (
[0191] Materials and Methods
[0192] Cloning, Sequencing and Production of Shigella apyrase
[0193] The pRSETB plasmid bearing Shigella flexneri 2a apy gene in E. coli GJ1158 strain (Bhandari and Gowrishankar J Bacteriol. 1997 Jul;179(13):4403-6) was obtained from Sankaran, Centre for Biotechnology, Anna University, India. Since the GJ1158 construct was not stable, the native apy gene was excised and amplified (using apy 3 and apy 4 primers; Table 3), which was further purified by PCR gel purification Kit (Fermentas). The purified DNA template was introduced with two-endonuclease restrictase sites for NdeI and BsiWI to replace natural stop codon by 6-Histidine-coding region using the primers Apyr-6His-BsiWI and Apyr-5-NdeI (Table 2) and transformed in E. coli TOP10 (Invitrogen) according to the manufacturer's instructions with minor modifications. Transformants were grown on agar plates and the positive pBL-Apyrase-6His clones were selected by NheI hydrolysis and size verification of restriction fragments on agarose gels, followed by sequence verification at Karolinska Institute's sequencing facility, Stockholm. Identified sequences of pBL-Apyrase-6His constructs were compared with Shigella flexneri 2a apyrase (GeneBank accession: U04539) to find out the integrity of cloning sites, Apyrase-6His coding sequence and replacement of the stop codon by 6-His tag. After sequence confirmation, the plasmid of pBL-Apyrase-6His clone (SEQ ID NO: 3) was transformed in E. coli BL21-A1 for the protein expression. The amino-acid sequence encoded by the plasmid is shown in SEQ ID NO: 4.
TABLE-US-00003 TABLE 3 List of oligonucleotides used Name Oligonucleotide sequence (5′.fwdarw.3′) SEQ ID NO Native apyrase CGCGGATCCCTGAAGGCAGAAGGTTTTC SEQ. ID NO: 5 primer1 Native apyrase CCCAAGCTTTTATGGGGTCAGTTCATT SEQ. ID NO: 6 primer2 Apyr-6His- GAACATCGTACGTTAGTGGTGATGGTGATGATG SEQ. ID NO: 7 BsiWI TGGGGTCAGTTCATTGGTAG Apyr-5-Ndel GATATACATATGAAAACCAAAAACTTTC SEQ. ID NO: 8
[0194] Large-Scale Production of Pure Shigella Apyrase
[0195] Preliminary evaluation using Ni-NTA magnetic beads: About 1.3 ml of bacterial culture was pelleted at 13,000 rpm and 300 μl of extraction buffer (1 mM PMSF, 1 mg/ml lysozyme and 0.05% Triton X-100 in 20 mM Tris-HCl, pH 8.0) to prepare cell lysates. After 30 min, 30 μl of equilibrated Ni-NTA magnetic beads were added and kept on mild agitation to facilitate the binding of His-tagged protein to the beads. Supernatant containing the soluble proteins was sampled and the beads were washed with 300 μl of washing buffer (300 mM NaCl, 20 mM imidazole, 8% glycerol and 0.2% Triton X-100 in 10 mM KP, pH 7.8). After rinsing the beads with PBS for 10 min, they were boiled for 3 min with 12 ul of SDS to elute pure recombinant protein. The protein profiles of cell lysates, soluble proteins and pure protein fractions were resolved on 12% SDS-PA gels at 30 mA using Tris-glycine (25 mM Tris-HCl, 0.1% w/v SDS, pH 8.3). After confirmation, apyrase production was scaled-up to large scales up to 2 L.
[0196] Large-scale purification by metal affinity chromatography: The apy gene (SFA) bearing E. coli BL21-A1 strain containing pBL-Apyrase-6His was cultured in 2 L of LB medium and induced at OD 0.7. Cells were harvested by centrifuging at 4000 rpm after 4 h of growth and after a saline wash they were lysed by French press. The 6-histidine-tagged SFA was purified by metal affinity (IMAC) (HisTrap FF, GE-Healthcare, Sweden) using a buffer (20 mM Hepes, 500 mM NaCl, 10% glycerol, 20 mM imidazole, pH 7.5) and after washing with a wash buffer containing 50 mM imidazole, the enzyme was eluted with elution buffer containing 350 mM imidazole. The buffer was exchanged with buffer containing 25 mM MgSO.sub.4, 5% BSA and the protein sample was concentrated using an ultrafiltration device with a 10 kDa cut-off semi-permeable membrane (Vivaspin Turbo, Sartorius).
[0197] Colorimetric Evaluation of Apyrase Activity
[0198] The enzyme activity was evaluated by calorimetrically, as described by Sankaran et al. (Diagn Microbiol Infect Dis. 2009 March;63(3):243-50) with minor modifications. The colorimetric reaction was performed by mixing equal volumes of assay reagent (6M sodium pyrophosphate and 40 mM EDTA; pH 7.5) and a color reagent (5% w/v acidic ammonium molybdate and 1% w/v ferrous ammonium sulfate) in the presence of apyrase enzyme (test sample) to produce colorimetric signals, which are proportional to the concentration of enzyme present in the test sample. Principally, the assay uses inorganic pyrophosphate as a substrate for the enzyme, while EDTA acts both as a buffer and a metal chelator to suppress the other contaminating phosphatase and pyrophosphatase activities. The released phosphate is measured in the presence of pyrophosphate using acidic ammonium molybdate and the color was measured at 695 nm in a multi-mode microplate reader (SpectraMax® M5, Molecular Devices, LLC, USA).
[0199] Sensitivity Tests by Luminescent Experiments
[0200] Cuvettes contained 100 μL sample in a total volume of 1 mL containing ATP Reagent SL (BioThema AB, Sweden) in 0.07 mol/L Tris- EDTA Buffer and the reaction was started by injection of 10 μL 10 μmol/L ATP Standard. The initial apyrase activity was determined as described by Lundin and coworkers (Analytical Biochemistry 75, 611-620 (1976) and Methods in Enzymology vol 305, 346-370 (2000)) with some modifications. Bioluminescence was measured at every 10 s during 1 min, in the fully automatic 1251 Luminometer (LKB-Wallac, Turku, Finland). To this, 10 μl of 10 μmol/L ATP was added to determine the background ground luminescence. The temperature control was set to 25° C. and bioluminescence was measured from several cuvettes in parallel during 30 or 60 minutes and compared to residual ATP after various incubation times using rSFA and STA. This was repeated with rSFA and STA and a graph was plotted by keeping the ATP-degradation rate as internal control to determine the ATP-degradation efficiency of both of the enzyme sources.
[0201] Bioinformatic Analysis of Different Apyrases (ATP-diphosphohydrolase)
[0202] The DNA sequence of Shigella flexneri 2a apyrase (GI 532975) (SEQ ID NO: 2) and of the translated potato apyrase (Translated Gene ID 1025774 of Solanum tuberosum ATP-diphosphohydrolase NM_008XM_004845) (SEQ ID NO: 1) sequences were obtained from the NCBI nucleotide database. These nucleotides were analyzed using online tools indicated above for the homology search, multiple gene alignments and their translations to protein sequences.
[0203] Optimization of Buffer System
[0204] Equal concentration of rSFA was stored in Buffer 1(20 mM Tris, 1 mM EDTA, 1% BSA, 25 mM MgSO.sub.4, pH 7.5), Buffer 2 (20 mM Tris, 25 mM MgSO4, 2.5% BSA, pH 7.5) and Buffer 3 (20 mM HEPES, 500 mM NaCl, 25 mM MgSO.sub.4, pH 7.5) for about 10 months at 4° C. Bioluminescence activity assay was performed as described below to detect the activity of rSFA after storage.
[0205] Inhibitor Development
[0206] After checking the rSFA inhibitory activity in buffer, it was verified with urine, where 10 μl were added with 80 μl of cell lysate reagent and 10 μmol/L of ATP. About 100 mM of MgSO.sub.4 and 1 mM of Na.sub.3VO.sub.4 were added in separate tubes and incubated for 10 min before measuring the light emission using firefly luciferase.
[0207] Bioluminescence Assay
[0208] Light emission from the firefly-luciferase reaction was measured at 25° C. in a 1251 Luminometer (LKB-Wallac; Finland) using the ATP Kit SL (BioThema AB, Sweden) according to the manufacture's instruction (in buffer experiment) or adding concentrated luciferase (in serum/urine experiments). Initially luciferase reaction follows first-order kinetics and the ATP Reagent SL in this kit produces light intensity proportional to the ATP concentration. A plot of the natural logarithm of the light intensity versus time yields a straight line with the slope representing the rate constant of the reaction. Starting concentration of STA, A6535, A6237 (Sigma-Aldrich) was adjusted similar to rSFA. BL-reaction was started automatically upon addition of 0.2 μmol/L ATP, and the light intensity was measured every 10 second for 10 minutes (in buffer experiment) or 30 minutes (in serum and urine experiments), in the reaction volume of 0.5 mL.
[0209] High performance liquid chromatography (HPLC) analysis of nucleosides/nucleotides
[0210] The dNTP Standard preparation was prepared to contain final concentration of 0.1 mM enzyme. Nucleosides ATP/dATP/dCTP/dGTP/dTTP were suspended in Tris-EDTA buffer and diluted 10 times with the mobile phase (70% acetonitrile, 30% ammonium acetate pH 5.35). The above-prepared nucleosides were individually incubated with equal amounts of rSFA and STA for 35 min at pH 7.75 and 5 μl of the mixture was injected into HPLC instrument (SeQuant ZIC®-pHILIC column, Merck Millipore) at a flow rate of 0.7 mL/min using a pump (Jasco PU-2089 Plus). Peaks were detected at 254 nm by UV-2075 Plus detector and the chromatographic separation was achieved using isocratic elution. Analysis was performed using Chrompass software, where each nucleotide/nucleoside was identified by comparison with retention time of the respective standards.