MICROCIN MCCY, AND PREPARATION METHOD AND USE THEREOF

Abstract

The present disclosure discloses a Microcin MccY, and a preparation method and use thereof, wherein the amino acid sequence of the Microcin MccY is GGRGHIAEYFSGPITQVSFYG. Compared with Microcin MccJ25 that only has a bactericidal activity against a small part of serotypes of Salmonella such as Salmonella enteritidis, the Microcin MccY has bacteriostatic/bactericidal effects on Salmonella Pullorum, Salmonella typhimurium, Salmonella kentucky, Salmonella Infantis, Salmonella London, and Shigella sonnei, and can kill other serotypes of Salmonella that MccJ25 cannot kill. Especially, the Microcin MccY has an outstanding bactericidal effect on Salmonella typhimurium and Salmonella Pullorum which are common in livestock and poultry production, and meanwhile it also has bacteriostatic/bactericidal effects on Shigella sonnei. Therefore, the Microcin MccY overcomes the shortcoming of the narrow spectrum of the Microcin, has breakthrough significance, and has the potential as a substitute to antibiotics.

Claims

1. (canceled)

2. A polynucleotide encoding the Microcin MccY, wherein the amino acid sequence of the Microcin MccY is: GGRGHIAEYFSGPITQVSFYG (SEQ ID NO :1); and wherein the sequence of the polynucleotide comprises mcyA (SEQ ID NO:2), mcyB (SEQ ID NO:3), mcyC (SEQ ID NO:4), and mcyD (SEQ ID NO:5).

3-4. (canceled)

5. A plasmid, comprising the polynucleotide according to claim 2.

6. An engineered strain comprising the plasmid according to claim 5.

7. A method for preparing a Microcin MccY, wherein the Microcin MccY is prepared by conducting fermentation with the engineered strain according to claim 6.

8. The preparation method according to claim 7, wherein the engineered strain according to claim 6 is inoculated in a fermentation medium, and subjected to fermentation at 100-300 r/min and 32-40° C. for 11-18 h.

9-10. (canceled)

11. A formulation comprising: the engineered strain according to claim 6.

12-15. (canceled)

16. A formulation, comprising the polynucleotide according to claim 2.

17. (canceled)

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0038] FIG. 1 is a diagram showing the bacteriostatic effects of the composition of MccY and MccJ25 in Example 4 against Salmonella typhimurium, Salmonella Pullorum and Salmonella enteritidis, wherein A, E and I are respectively panels showing the bacteriostatic effects of the filtrate (the Microcin MccY) expressed by pET-28a(+)-MccY-containing BL21(DE3) bacteria obtained in Example 1 against Salmonella typhimurium, Salmonella enteritidis and Salmonella Pullorum; B, F, and J are respectively panels showing the bacteriostatic effects of the filtrate (the Microcin MccJ25) expressed by pET-28a(+)-MccJ25-containing BL21(DE3) bacteria obtained in Example 3 against Salmonella typhimurium, Salmonella enteritidis and Salmonella Pullorum; C, G, and K are respectively panels showing the bacteriostatic effects of the filtrate expressed by pET-28a(+)-containing BL21(DE3) bacteria obtained in Example 2 against Salmonella typhimurium, Salmonella enteritidis and Salmonella Pullorum; and D, H, and L are respectively panels showing the bacteriostatic effects of the composition of MccY and MccJ25 against Salmonella typhimurium, Salmonella enteritidis and Salmonella Pullorum.

[0039] FIG. 2 is a diagram showing the bacteriostatic effects of the composition of MccY and MccJ25 in Example 4 against Salmonella kentucky, Salmonella Infantis and Salmonella London, wherein A, E and I are respectively panels showing the bacteriostatic effects of the filtrate (the Microcin MccY) expressed by pET-28a(+)-MccY-containing BL21(DE3) bacteria obtained in Example 1 against Salmonella kentucky, Salmonella Infantis and Salmonella London; B, F, and J are respectively panels showing the bacteriostatic effects of the filtrate (the Microcin MccJ25) expressed by pET-28a(+)-MccJ25-containing BL21(DE3) bacteria obtained in Example 3 against Salmonella kentucky, Salmonella Infantis and Salmonella London; C, G, and K are respectively panels showing the bacteriostatic effects of the filtrate expressed by pET-28a(+)-containing BL21(DE3) bacteria obtained in Example 2 against Salmonella kentucky, Salmonella Infantis and Salmonella London; and D, H, and L are respectively panels showing the bacteriostatic effects of the composition of MccY and MccJ25 against Salmonella kentucky, Salmonella Infantis and Salmonella London.

[0040] FIG. 3 is a diagram showing the bacteriostatic effect of the Microcin MccY in Example 4 against Shigella, wherein A is a panel showing the bacteriostatic effect of the filtrate (the Microcin MccY) expressed by pET-28a(+)-MccY-containing BL21(DE3) bacteria obtained in Example 1 against Shigella flexneri; B is a panel showing the bacteriostatic effect of the filtrate expressed by pET-28a(+)-containing BL21(DE3) bacteria obtained in Example 2 against Shigella flexneri; C is a panel showing the bacteriostatic effect of methanol against Shigella flexneri; D is a panel showing the bacteriostatic effect of a filtrate (the Microcin MccY) expressed by pET-28a(+)-MccY-containing BL21(DE3) bacteria obtained in Example 1 against Shigella sonnei; E is a panel showing the bacteriostatic effect of the filtrate expressed by pET-28a(+)-containing BL21(DE3) bacteria obtained in Example 2 against Shigella sonnei; and F is a panel showing the bacteriostatic effect of methanol against Shigella sonnei.

[0041] FIG. 4 is a diagram showing a pET-28a(+)-MccY plasmid constructed in Example 1.

[0042] FIG. 5 is a diagram showing a pET-28a(+)-MccJ25 plasmid constructed in Example 3.

DETAILED DESCRIPTION

[0043] The present disclosure will be further explained in detail hereafter by specific examples.

[0044] Unless otherwise specified, the materials and reagents used in this example are commercially available reagents and materials.

[0045] The information of the instruments used in this example is shown in Table 1.

TABLE-US-00002 TABLE 1 Information of used instrument Instrument Name Company ZHJH-C1214C super clean bench Suzhou Purification Equipment Co. Ltd. DK-8D Electro-Thermostatic Shanghai Bluepard Constant-Temperature Water Bath Instruments Co., Ltd. GDS8000PC gel imaging and analysis system UVP ND-1000 spectrophotometer NanoDrop T3000 Thermocycler PCR amplifier Whatman Biometra Micro-adjustable pipette Eppendorf, Germany Power Pac ™ basic electrophoresis meter BIO-RAD Centrifuge Eppendorf, Germany

EXAMPLE 1 CONSTRUCTION AND EXPRESSION OF MccY PLASMID

[0046] A mccy gene fragment (Guangzhou IGE Biotechnology OGY Ltd) was synthesized. The mccy gene had a total length of 4,458 bp, and its sequence was as shown in SEQ ID NO.6, which comprised all four target genes, including mcyA (SEQ ID NO.2), mcyB (SEQ ID NO.3), mcyC (SEQ ID NO.4) and mcyD (SEQ ID NO.5) (by Blast search of mcyA, mcyB, mcyC and mcyD genes respectively, it was found that the amino acid sequence homologies of them with mcjA, mcjB, mcjC and mcjD genes of Escherichia coli. MccJ25 were 51.9%, 54.8%, 52.3% and 70.4%, respectively. The homology of this sequence with MccJ25 is not high, but it has all the basic structural genes of Microcin type I.) The mccy gene fragment was subjected to double enzyme digestion by restriction endonucleases (SalI, BamHI) available from NEB (the enzyme digestion reaction system was shown in Table 2), and then recovered and purified from gel, to obtain a mccy having open cohesive termini. Meanwhile, a vector pET-28a(+) was subjected to double enzyme digestion by the restriction endonucleases (SalI, BamHI) (the enzyme digestion reaction system was shown in Table 2), and then recovered and purified from gel by using a DNA gel recovery kit available from OMEGA to obtain a linearized vector having open cohesive termini. The linearized vector pET-28a(+) was ligated with the mccy having open cohesive termini through a T4 DNA ligase (the ligation system was shown in Table 3, and the reaction condition was: reacting at 16° C. for 3 h). The ligation product was transformed into an Escherichia coli. DH5a strain, and screened for positive monoclones by utilizing the kanamycin resistance of the plasmid. The monoclonal colonies were picked, subjected to PCR amplification by using universal primers T7-F (TAATACGACTCACTATAGGG, SEQ ID NO.7)/T7-R (GCTAGTTATTGCTCAGCGG, SEQ ID NO.8) for a pET-28a(+) plasmid multicloning site region, and the plasmids were extracted for sequencing verification. The target band was about 4,700 bp, and the sequencing was errorless. Successfully-cloned pET-28a(+)-MccY plasmids were obtained (a diagram showing plasmid was shown in FIG. 4). The pET-28a(+)-MccY plasmid was introduced into a BL21(DE3) competent cell by a heat shock chemical transformation method, and the specific process was as follows: mixing the pET-28a(+)-MccY plasmid with the BL21(DE3) competent cell uniformly, putting in a water bath kettle at 42° C. for incubation for 90 s, then quickly transferring onto ice for incubation for 2 min, then adding with 300 μL of SOC medium, culturing at 37° C. and 200 r/min for 1 h, and then spreading onto a plate containing kanamycin (50 μg/mL) , and inverting in a bacterial incubator for culturing overnight. On the next day, the positive monoclonal colonies were picked into and cultured in LB medium containing kanamycin resistance (50 μg/mL), and then subjected to PCR amplification identification by using universal primers T7-F (TAATACGACTCACTATAGGG, SEQ ID No.7)/T7-R (GCTAGTTATTGCTCAGCGG, SEQ ID NO.8) for the multcloning site region. The target band was about 4,700 bp, and the diagram showing the plasmid pET-28a(+)-MccY could be seen in FIG. 4.

TABLE-US-00003 TABLE 2 Enzyme digestion reaction system Reagent Volume (μL) FD buffer 5 Endonuclease SalI/BgIII 2.5 Endonuclease BamHI/HindIII 2.5 mccy gene fragment/mccj25 gene fragment 10 (vector) ultrapure water 30 In total 50

TABLE-US-00004 TABLE 3 Ligation reaction system Reagent Volume (μL) Reaction buffer 1 inserted fragment 1.5 linear plasmid 4 T4 DNA ligase 0.5 ultrapure water 3 In total 10

[0047] The pET-28a(+)-MccY-containing BL21(DE3) bacteria were resuscitated in a LB plate with a kanamycin concentration of 30 μg/mL, and cultured to grow fresh bacterial lawns. A loop of the bacteria was taken and inoculated into a 250 ml Erlenmeyer flask containing 100 mL nutrient broth (the M9 medium), and then kanamycin, isopropyl-β-D-thiogalactoside (IPTG) (with the final concentration of kanamycin being 30 μg/mL and the final concentration of IPTG being 0.1M) were added into the Erlenmeyer flask. The Erlenmeyer flask was placed and cultured in a shaker (with the culture conditions being: 200 r/min, 37° C. and 14 h). The bacteria solution after the expression was collected, and centrifuged at 5,000 r/min for 20 min, and then the supernatant after the centrifugation was collected and filtered with a 0.22 μm filter membrane to obtain the Microcin MccY. Since the Microcin had a stable structure, could resist high temperature and could be frozen and thawed repeatedly, it was cryopreserved in a refrigerator at −20° C. for later use.

EXAMPLE 2 CONSTRUCTION AND EXPRESSION OF ENGINEERED STRAIN CONTAINING AN EMPTY PLASMID

[0048] A vector pET-28a(+) was introduced into a BL21(DE3) competent cell (the method was the same as that of Example 1) to obtain pET-28a(+)-containing BL21(DE3) bacteria. The pET-28a(+)-containing BL21(DE3) bacteria were resuscitated in a LB plate with a kanamycin concentration of 30 μg/mL, and cultured to grow fresh bacterial lawns. A loop of the bacteria was taken and inoculated into a 250 ml Erlenmeyer flask containing 100 mL of M9 basic salt medium, and then kanamycin, isopropyl-β-D-thiogalactoside (IPTG) (with the final concentration of kanamycin being 30 μg/mL and the final concentration of IPTG being 0.1M) were added into the Erlenmeyer flask. The Erlenmeyer flask was placed and cultured in a shaker (with the culture conditions being: 200 r/min, 37° C. and 14 h). The bacteria solution after the expression was collected, and centrifuged at 5,000 r/min for 20 min, and then the supernatant after the centrifugation was collected and filtered with a 0.22 μm filter membrane to obtain the filtrate.

EXAMPLE 3 CONSTRUCTION AND EXPRESSION OF MccJ25 PLASMID

[0049] A mccj25 gene fragment (Guangzhou IGE Biotechnology OGY Ltd) was synthesized. The mccj25 gene had a total length of 4,495 bp, and its sequence was as shown in SEQ ID NO.9. The mccj25 gene fragment was subjected to double enzyme digestion by restriction endonucleases (BgIII, HindIII) available from NEB (the enzyme digestion reaction system was shown in Table 2), and recovered and purified from gel, to obtain a mccj25 having open cohesive termini. Meanwhile, a vector pET-28a(+) was subjected to double enzyme digestion by the restriction endonucleases (BgIII, HindIII) (the enzyme digestion reaction system was shown in Table 2), and then recovered and purified from gel by using a DNA gel recovery kit available from OMEGA to obtain a linearized vector having open cohesive termini. The linearized vector pET-28a(+) was ligated with the mccj25 having open cohesive termini through a T4 DNA ligase (the ligation system was shown in Table 3, and the reaction condition was: reacting at 16° C. for 3 h). The ligation product was transformed into an Escherichia coli. DH5a strain, and screened for positive monoclones by utilizing the kanamycin resistance of the plasmid. The monoclonal colonies were picked, subjected to PCR amplification by using universal primers T7-F (TAATACGACTCACTATAGGG, SEQ ID NO.7)/T7-R (GCTAGTTATTGCTCAGCGG, SEQ ID NO.8) for a pET-28a(+) plasmid multicloning site region, and the plasmids were extracted for sequencing verification. The target band was about 4,500 bp, and the sequencing was errorless. Successfully-cloned pET-28a(+)-MccJ25 plasmids were obtained (a diagram showing the plasmid was shown in FIG. 5). The pET-28a(+)-MccJ25 plasmid was introduced into a BL21(DE3) competent cell by a heat shock chemical transformation method, and the specific process was as follows: mixing the pET-28a(+)-MccJ25 plasmid with the BL21(DE3) competent cell uniformly, putting in a water bath kettle at 42° C. for incubation for 90 s, then quickly transferring onto ice for incubation for 2 min, then adding with 300 μL of SOC medium, culturing at 37° C. and 200 r/min for 1 h, and then spreading onto a plate containing kanamycin (50 μg/mL), and inverting in a bacterial incubator for culturing overnight. On the next day, the positive monoclonal colonies were picked into and cultured in LB medium containing kanamycin resistance (50 μg/mL), and then subjected to PCR amplification identification by using universal primers T7-F (TAATACGACTCACTATAGGG, SEQ ID No.7)/T7-R (GCTAGTTATTGCTCAGCGG, SEQ ID NO.8) for the multicloning site region. The target band was about 4,700 bp, and the diagram showing the plasmid pET-28a(+)-MccJ25 could be seen in FIG. 5.

[0050] The pET-28a(+)-MccJ25-containing BL21(DE3) bacteria were resuscitated in a LB plate with a kanamycin concentration of 30 μg/mL, and cultured to grow fresh bacterial lawns. A loop of the bacteria was taken and inoculated into a 250 ml Erlenmeyer flask containing 100 mL nutrient broth (the M9 medium), and then kanamycin, isopropyl-β-D-thiogalactoside (IPTG) (with the final concentration of kanamycin being 30 μg/mL and the final concentration of IPTG being 0.1M) were added into the Erlenmeyer flask. The Erlenmeyer flask was placed and cultured in a shaker (with the culture conditions being: 200 r/min, 37° C. and 14 h). The bacteria solution after expression was collected, and centrifuged at 5,000 r/min for 20 min, and then the supernatant after centrifugation was collected and filtered with a 0.22 μm filter membrane to obtain the Microcin MccJ25 (SEQ ID NO.10). Since the Microcin MccJ25 had a stable structure, could resist high temperature and could be frozen and thawed repeatedly, it was cryopreserved in a refrigerator at −20° C. for later use.

EXAMPLE 4 TEST OF BACTERIOSTATIC ACTIVITIES OF MccY AND MccJ25

[0051] 1. Bacteriostatic effects of MccY, MccJ25 and the composition of MccY and MccJ25 against different serotypes of Salmonella

[0052] Salmonella Pullorum (strain name: CVCC1800), Salmonella enteritidis (strain name: CVCC3377) and Salmonella typhimurium (strain name: ATCC14028) were respectively resuscitated in a LB agar plate (with the formula as shown in Table 4) (cultured in a 5% CO.sub.2 incubator at 37° C. for 16 h). Single colonies were picked and subjected to shaking culture until OD600=0.8. The bacterial solution was inoculated into a soft agar medium containing 5% LB (with the formula as shown in Table 5) at about 42° C. in a proportion of 1:1,000, and then spread onto a LB agar plate to form an upper and lower double-layer agar medium. 30 min later, after the soft agar was cooled and solidified, a mixed solution of 50 μL of the filtrate obtained in Example 1 (the Microcin MccY), 50 μL of the filtrate obtained in Example 2, 50 μL of the filtrate obtained in Example 3 (the Microcin MccJ25), 25 μL of the filtrate obtained in Example 1 (the Microcin MccY) and 25 μL of the filtrate obtained in Example 3 (the Microcin MccJ25) was taken and added into the upper and lower double-layer agar medium containing Salmonella Pullorum, Salmonella enteritidis and Salmonella typhimurium. The upper and lower double-layer agar medium was then placed into a 5% CO.sub.2 bacterial incubator at 37° C. for static culture for 18 h, and then observed for a bacteriostatic ring. The results were shown in FIG. 1: the Microcin MccY had inhibitory effects on Salmonella Pullorum and Salmonella typhimurium, the Microcin MccJ25 had an inhibitory effect on Salmonella enteritis, and the combined use of MccY and MccJ25 had inhibitory effects on Salmonella Pullorum, Salmonella enteritidis and Salmonella typhimurium.

TABLE-US-00005 TABLE 4 Formula of LB agar medium Reagent Reagent concentration Agar 15 NaCl 5 Yeast powder 10 Tripton 5 In total 35

TABLE-US-00006 TABLE 5 Formula of soft agar medium containing 5% LB Reagent Reagent concentration Agar 5 NaCl 5 Yeast powder 5 Tripton 10 In total 25

[0053] 2. Bacteriostatic effects of MccY, MccJ25 and the composition of MccY and MccJ25 against different serotypes of Salmonella

[0054] Salmonella kentucky (strain name: BNCC239114), Salmonella Infantis (strain name: CMCC50041) and Salmonella London (strain name: CVCC2206) were respectively resuscitated in a LB agar plate (with the formula as shown in Table 4) (cultured in a 5% CO.sub.2 incubator at 37° C. for 16 h). Single colonies were picked and subjected to shaking culture until OD600=0.8. The bacterial solution was inoculated into a soft agar medium containing 5% LB (with the formula as shown in Table 5) at about 42° C. in a proportion of 1:1,000, and then spread onto a LB agar plate to form an upper and lower double-layer agar medium. 30 min later, after the soft agar was cooled and solidified, a mixed solution of 50 μL of the filtrate obtained in Example 1 (the Microcin MccY), 50 μL of the filtrate obtained in Example 2, 50 μL of the filtrate obtained in Example 3 (the Microcin MccJ25), 25 μL of the filtrate obtained in Example 1 (the Microcin MccY) and 25 μL of the filtrate obtained in Example 3 (the Microcin MccJ25) was taken and added into the upper and lower double-layer agar medium containing Salmonella Pullorum, Salmonella enteritidis and Salmonella typhimurium. The upper and lower double-layer agar medium was then placed into a 5% CO.sub.2 bacterial incubator at 37° C. for static culture for 18 h, and then observed for a bacteriostatic ring. The results were shown in FIG. 2: the Microcin MccY had inhibitory effects on all of Salmonella kentucky, Salmonella Infantis and Salmonella London, the Microcin MccJ25 had no inhibitory effect on all of Salmonella kentucky, Salmonella Infantis and Salmonella London, and the combined use of MccY and MccJ25 had efficient inhibitory effects on Salmonella kentucky, Salmonella Infantis and Salmonella London.

[0055] 3. Bacteriostatic effect of MccY against Shigella

[0056] Shigella flexneri (strain name: CMCC51572) and Shigella sonnei (strain name: CMCC51592) were respectively resuscitated in a LB agar plate (with the formula as shown in Table 4) (cultured in a 5% CO.sub.2 incubator at 37° C. for 16 h). Single colonies were picked and subjected to shaking culture until OD.sub.600=0.8. The bacterial solution was inoculated into a soft agar medium containing 5% LB (with the formula as shown in Table 5) at about 42° C. in a proportion of 1:1,000, and then spread onto a LB agar plate to form an upper and lower double-layer agar medium. 30 min later, after the soft agar was cooled and solidified, each 50 μL of the filtrate obtained in Example 1 (the Microcin MccY) and methanol were respectively taken and added into the upper and lower double-layer agar medium containing Shigella flexneri and Shigella sonnei (the control group was added with the same amount of the filtrate obtained in Example 2). The upper and lower double-layer agar medium was then placed into a 5% CO.sub.2 bacterial incubator at 37° C. for static culture for 18 h, and then observed for a bacteriostatic ring. The results were shown in FIG. 3: Shigella flexneri was not sensitive to MccY, while Shigella sonnei was sensitive to MccY, namely, MccY had a bacteriostatic effect on Shigella sonnei.

[0057] The above examples are preferred examples of the present disclosure. However, the implementation of the present disclosure is not limited by the above examples. Any other change, modification, substitution, combination, and simplification made without departing from the spiritual essence and principle of the present disclosure should be an equivalent replacement manner, and all are included in a claimed scope of the present disclosure.