DETERMINATION OF REGULATORY DNA REGIONS OF ALCOHOL DEHYDROGENASE 3 (ADH3) PROMOTER AND DESIGN OF SYNTHETIC PROMOTERS FOR RECOMBINANT PROTEIN PRODUCTION
20210403931 · 2021-12-30
Assignee
Inventors
- Mehmet Inan (Antalya, TR)
- Mert KARAOGLAN (Merkez, Erzincan, TR)
- Fidan ERDEN KARAOGLAN (Merkez, Erzincan, TR)
Cpc classification
International classification
Abstract
The invention relates to the ADH3 promoter, polynucleotide sequences, vectors and expression cassettes including DNA regions responsible for the regulation of the ADH3 promoter; the host cells, including these vectors and expression cassettes, and, the recombinant proteins performed with the developed cells. In the scope of the invention, deletion analyzes in the ADH3 promoter were performed to identify regions that affect promoter strength and significant data was obtained in the formation of mutant ADH3 promoters. Deletion of the nucleotides between 539 and 638 (−361 to −262) in SEQ ID NO: 1 resulted in a 63% increase in ADH3 promoter activity. Five different synthetic promoters were created using positive regulatory regions identified and approximately 165% to 200% promoter activities were achieved with these promoters.
Claims
1. A mutant ADH3 promoter, characterized by comprising at least one mutation between the following nucleotides in the promoter ADH3 (SEQ ID NO: 1) and positive or negative regulation in ethanol-induced conditions: Nucleotides 0 to 99 (−900 to −801) and/or Nucleotides 77 to 176 (−823 to −724) and/or, Nucleotides 154 to 253 (−746 to −647) and/or, Nucleotides 231 to 330 (−669 to −570) and/or, Nucleotides 308 to 407 (−592 to −493) and/or, Nucleotides 385 to 484 (−515 to −416) and/or, Nucleotides 462 to 561 (−438 to −339) and/or, Nucleotides −539 to 638 (−361 to −262) and/or, Nucleotides 616 to 715 (−284 to −185) and/or, Nucleotides −693 to 792 (−207 to −108) and/or, Nucleotides 770 to 814 (−130 to −86) nucleotides and/or Nucleotides 200 to 500 (−700 to −400).
2. A mutant ADH3 promoter according to claim 1, characterized in that the at least one mutation comprises an addition and/or deletion and/or a substitution or a combination thereof.
3. A single- or multi-copy expression cassette, characterized in that it is formed by a mutant ADH3 promoter according to claim 1 linked to a protein or a functional nucleic acid molecule.
4. A vector, characterized by comprising a mutant ADH3 promoter according to claim 1 and a functional nucleic acid molecule.
5. A host cell, characterized by comprising a vector according to claim 4.
6. (canceled)
7. A host cell according to claim 5, wherein the host cell is a yeast cell.
8. A host cell according to claim 7, wherein the yeast cell is a methylotrophic yeast selected from the group consisting of Pichia, Candida, Hansenula, Torulopsis and in particular Pichia pastoris.
9. An expression method of a recombinant protein, peptide or functional nucleic acid in a cell, characterized by comprising the following steps: Providing ADH3 promoter according to claim 1, and operably linking the promoter with a nucleic acid encoding a protein, peptide or functional nucleic acid, Transformation of the said host cell with the said nucleic acid molecule, Culturing the said host cell in appropriate culture medium and expressing the protein, peptide or functional nucleic acid by induction; and isolating the expressed protein, peptide or functional nucleic acid.
10. A method according to claim 9, wherein the said host cell is a yeast cell, in particular a methylotrophic yeast selected from the group consisting of Pichia, Candida, Hansenula, Torulopsis, and in particular Pichia pastoris.
11. A method according to claim 9, characterized by use of a nucleic acid molecule, a vector according to claim 4 or the host cell according to claim 5 for expression of protein, peptide or functional nucleic acid.
12. A method according to claim 9, wherein the protein, peptide or functional nucleic acid is produced on different carbon sources using the host cell according to claim 5.
13. A method for isolation of super expression clones, characterized by comprising the following steps: Introducing a vector according to claim 4 into a host cell, transferring the resulting host cell to a medium containing an appropriate selective marker, a carbon source, and ethanol, the selective growth of super expression clones under inducing conditions where the mutant ADH3 promoter according to claim 1 is activated, detection and isolation of the clones said.
14. A vector according to claim 4, wherein the expression vector Is pPICZ AXylB/HIS4, pADH3Z A and/or pADH3Z A-XylB/HIS4.
15. A host cell, characterized by comprising a vector according to claim 14.
Description
DESCRIPTION OF FIGURES
[0012] The method and advantages of the invention will be better understood by means of the figures and their descriptions.
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
DESCRIPTION OF THE INVENTION
[0021] The invention relates to the method of expression of a recombinant protein, peptide or functional nucleic acid in a cell, determination of DNA regions responsible for regulation of alcohol dehydrogenase 3 (ADH3) promoter and design of synthetic promoters for recombinant protein production.
[0022] Within the scope of the invention, ADH3 promoter region was determined as the shortest DNA sequence in which ADH3 promoter activity was maintained at 100% and 5′ end- and internal deletion analyzes were performed on this region determined. The results showed the effects of these regions on promoter activity. Also, synthetic promoters were constructed using the DNA regions known to be effective on promoter activity. It is also possible to form new synthetic promoters of different strengths using the data presented in the present invention.
[0023] The general method of expression of a recombinant protein, peptide or functional nucleic acid in the cell is as follows; determination of ADH3 promoter to be selected, operably linking promoter to nucleic acid molecule encoding of a protein, peptide or functional nucleic acid and transforming the host cell with vector or the nucleic acid molecule, growth of the transformed host cell under suitable culture conditions, inducing expression of this protein, peptide or functional nucleic acid, and isolation of this protein, peptide or functional nucleic acid.
[0024] In the following description for the method according to the invention, the (negative) numbers shown in brackets indicate their position relative to the translation initiation codon of the promoter.
[0025] 1. Determination of the ADH3 Promoter
[0026] In order to determine the regions involved in the regulation of the ADH3 promoter (e.g., regulatory regions and transcription factor binding sites), it is first necessary to determine the promoter region of the ADH3. [0027] To determine the ADH3 promoter, the 2000 bp DNA region at the 5′ end of the ADH3 gene was examined and divided into four regions. [0028] The shortest DNA region in which ADH3 promoter activity maintained at 100% was determined. [0029] In order to identify the promoter region precisely, 5′ end-deletion analyzes were performed on the shortest DNA region determined in the previous stage. [0030] The results of 5′ end-deletion analysis, the increases and decreases observed in the promoter activity, can provide clues about the regulatory regions.
[0031] In the first step of the method for obtaining the mutant promoters of the invention, to identify the ADH3 promoter; The 2000 bp DNA region at the 5′end of the ADH3 gene was examined as the regions of 2000 (Nucleotide −2000 to 0), 1500 (Nucleotide −1500 to 0), 1000 (Nucleotides −1000 to 0) and 500 (Nucleotide −500 to 0) bp. The shortest DNA region in which the activity of the ADH3 promoter was maintained at 100% was determined to be 1000 bp (Nucleotide −1000 to 0). Then, in order to identify the promoter region precisely, 5′ end-deletion analysis was applied to 1000 bp promoter region and it was serially truncated 100 bp from the 5′ upstream region.
[0032] 5′ end-deletion analysis: To determine the exact length of the ADH3 promoter, the 1000 bp promoter was serially truncated 100 bp from the 5′ end. The promoter regions thus obtained were the DNA regions between −900 to 0, −800 to 0, −700 to 0, −600 to 0, −25 to 500 to 0, −400 to 0, −300 to 0, −200 to 0, −100 to 0 nucleotides. Among the obtained promoters, the shortest DNA region in which activity was unchanged, i.e. the exact promoter region, was determined to be 900 bp (Nucleotide −900 to 0) and this region was identified as ADH3 promoter (SEQ ID NO:1). The promoter activities obtained by 5′ end-deletion analysis were given graphically in
[0033] 2. Determination of Regulatory DNA Regions in the ADH3 Promoter
[0034] To more accurately identify the DNA regions responsible for regulation in the ADH3 promoter, Internal deletion analysis was performed on 900 bp promoter (Sequence ID NO: 1).
[0035] The regions deleted were the nucleotides between 0 to 99 (−900 to −801), 77 to 176 (−823 to −724), 154 to 253 (−746 to −647), 231 to 330 (−669 to −570), 308 to 407 (−592 to −493), 385 to 484 (−515 to −416), 462 to 561 (−438 to −339), 539 to 638 (−361 to −262), 616 to 715 (−284 to −185), 693 to 792 (−207 to −108), 770 to 814 (−130 to −86) and 200 to 500 (−700 to −400).
[0036] The promoter activities obtained by internal deletion analysis were given graphically in
[0037] According to the present invention, the mutations between the nucleotides 0 to 99 (−900 to −801), 462 to 561 (−438 to −339), 539 to 638 (−361 to −262), 616 to 715 (−284 to −185), 693 to 792 (−207 to −108) and 770 to 814 (−130 to −86) on SEQ ID NO:1 were determined to be effective in the regulation of the ADH3 promoter in terms of positive or negative regulation under the ethanol-induced conditions.
[0038] Also, it was determined that the mutations between 77 to 176 (−823 to −724), 154 to 253 (−746 to −647), 231 to 330 (−669 to −570), 308 to 407 (−592 to −493), 385 to 484 (−515 to −416) and 200 to 500 (−700 to −400) nucleotides on SEQ ID NO: 1 and the combinations of these mutations had no significant effect on the promoter activity.
[0039] The protein expression yield of the synthetic promoter sequences may vary depending on the number of expression cassettes integrated into the host cell genome. In particular, there was an increase in promoter activity in strains containing more than one copy expression cassette. The clone in which the expression cassette, containing the DNA region from 500 to 900 (−400 to 0) nucleotides on ADH3 promoter (SEQ ID NO:1) as a promoter, was integrated in 2 copies, showed an increase in protein production relative to the single copy clone.
[0040] 3. Design of Synthetic Promoters Using the Promoter Regions that Affect the Strength of the ADH3 Promoter
[0041] The data on promoter regions that affect the strength of the ADH3 promoter can be used to design promoters with different characteristics. The promoters obtained according to the preferred embodiment of the present invention are used in a yeast cell, preferably a methylotrophic yeast cell. These methylotrophic yeast cells can be Pichia, especially P. pastoris, Candida, Hansenula and Torulopsis cells. As in an example, previous studies have shown that the oxygen-regulated ADH promoter of P. stipitis was regulated in the same manner in P. pastoris yeast (Chien and Lee, 2005).
[0042] 3a. Construction of Expression Vectors (Cassettes)
[0043] The construction steps of expression cassettes were shown in
[0044] The construction steps of expression vector pPICZαA-XylB/HIS4 were schematized by line A (A1, A2-1, A2-2 and A3).
[0045] The construction steps of expression vector pADH3ZαA were schematized by line B (B1 and B2).
[0046] The expression vector obtained from line A, pPICZαA-XylB/HIS4 and the expression vector obtained from line B, pADH3ZαA were combined and the expression vector pADH3ZαA-XylB/HIS4 schematized by line C was obtained.
[0047] The native ADH3 promoter regions of different lengths were amplified by PCR using the forward primer containing BamHI restriction site and the reverse primer containing AsuII restriction. PCR analyzes were performed using KOD Hot Start DNA Polymerase Kit according to the manufacturer's instructions. Mutant ADH3 promoter regions were obtained using overlap PCR method. The primers used in PCR reactions and the ADH3 promoter regions obtained were given in Table 2.
TABLE-US-00002 TABLE 2 Primer list (Macrogen Inc., Seoul, South Korea) SEQ. ID Melting Temperature No Name Sequence [° C.] 2 1000p-F 5′-aaaggatcccgattgcccctctacaggcataag 75.0 3 900p-F 5′-aaaggatccatgcccggaggagacttgcc 74.7 4 800p-F 5′-aaaggatccggggggtgattcggccg 74.2 5 700p-F 5′-aaaggatccaccccaaatcttattctcaa 66.2 6 600p-F 5′-aaaggatccaaatttcttagaaggggccc 69.0 7 500p-F 5′-cccggatccatagcgagacttttttgatttcg 72.0 8 400p-F 5′-aaaggatccaatttcgttgattcccaccc 69.0 9 300p-F 5′-aaaggatcctccgaaaagatctgtgtagt 67.6 10 200p-F 5′-aaaggatcctcaccctgcctattgtagac 70.4 11 100p-F 5′-aaaggatccattcacaattcacctcacta 66.2 12 ADH3-R 5′-tttcgaaagtaaataagataaaagctagtag 63.0 13 ADH3F -801 5′-aaaggatccaggggggtgattcggccg 74.4 14 ADH3R -823 5′-cggtgatactgatttgtctatgtggggtctctacag 75.5 15 ADH3F -724 5′-ctgtagagaccccacatagacaaatcagtatcaccg 75.5 16 ADH3R -746 5′-accaatgctaactgccatgcattgttcaccccccta 76.6 17 ADH3F -647 5′-taggggggtgaacaatgcatggcagttagcattggt 76.6 18 ADH3R -669 5′-ggaatttttcacccctcgatgagggaccgttgagaa 76.6 19 ADH3F -570 5′-ttctcaacggtccctcatcgaggggtgaaaaattcc 76.6 20 ADH3R -592 5′-tgcgaaatcaaaaaagtcagaaatttgggtttaagg 69.8 21 ADH3F -493 5′-ccttaaacccaaatttctgacttttttgatttcgca 69.8 22 ADH3R -515 5′-ttagcagattcatgggcattaagcagcaacttacgg 74.4 23 ADH3F -416 5′-ccgtaagttgctgcttaatgcccatgaatctgctaa 74.4 24 ADH3R -438 5′-gacatgcagattctcccaggtgagaattgcaatcga 75.5 25 ADH3F -339 5′-tcgattgcaattctcacctgggagaatctgcatgtc 75.5 26 ADH3R -361 5′-gttttcaaacagcgggggtttgtggagttggaaagg 76.6 27 ADH3F -262 5′-cctttccaactccacaaacccccgctgtttgaaaac 76.6 28 ADH3R -284 5′-gatgcgggttgacgtctacacagatcttttcggaca 76.6 29 ADH3F -185 5′-tgtccgaaaagatctgtgtagacgtcaacccgcatc 76.6 30 ADH3R -207 5′-aattgtgaatattagagatgggcacgaattcgcacc 73.2 31 ADH3F -108 5′-ggtgcgaattcgtgcccatctctaatattcacaatt 73.2 32 ADH3R -130 5′-caggggtatttatagtgattggtgtgatcattgggg 74.4 33 ADH3F -86 5′-ccccaatgatcacaccaatcactataaatacccctg 74.4 34 ADH3R -700 5′-gtgggaatcaacgaaattgttaatcggtgatactga 72.1 35 ADH3F -400 5′-tcagtatcaccgattaacaatttcgttgattcccac 72.1 [0048] The construction steps (A1, A2-1, A2-2 and A3) of expression vector pPICZαA-XylB/HIS4 given in line A;
[0049] Plasmid A1 shown in
[0051] B1, the commercial pPICZαA, was digested with BglII-AsuII to excise the AOX1 promoter. The new promoterless construct was ligated to the PCR products of different ADH3 promoters digested with BamHI-AsuII and B2 was obtained. The plasmid B2 is named pADH3ZαA.
[0052] Ligation of pPICZαA-XylB/HIS4 Obtained from Line a and pADH3Zαa Obtained from Line B to Obtain pADH3ZαA-XylB/HIS4 Shown in Line C
[0053] pPICZαA-XylB/HIS4 (A3) and pADH3ZαA (B2) plasmids were ligated from the XhoI-SmaI restriction site. The ligated fragments are the portion containing ADH3 promoter in pADH3ZαA and the portion containing the XylB and HIS4 genes in pPICZαA-XylB/HIS4 plasmids that were obtained by XhoI-SmaI digestion reactions of both plasmids. The final plasmid was named pADH3ZαA-XylB/HIS4.
[0054] 3b. Transformation (integration) of expression vectors into host cell genome All ADH3 expression plasmids of the invention were generated by the same strategy. Plasmids were linearized with Kpn2I and Integrated into the Host Cell Genome from the His4 Locus. P. pastoris GS115 was used as the host cell.
[0055] The integrated host cells were grown in appropriate culture conditions to produce xylanase enzyme (reporter protein) under the control of promoters constructed within the scope of the invention.
[0056] It is possible to carry out different protein productions in different yeast cells using mutant ADH3 promoters and novel mutant promoters which can be formed as addition, deletion, substitution and inversion of the promoter regions of ADH3.
[0057] An example of the use of the invention in methylotrophic yeast cells is given in Example 1 for use in the P. pastoris cell.
Example 1
[0058] Material and Methods
[0059] Strains, Plasmids and Media
[0060] P. pastoris strains used in studies were X33 (Wild-type) and GS115 (his4, Invitrogen). The media used for P. pastoris: YPD (1% yeast extract, 2% peptone, 2% glucose), MG (1.34% YNB, 4×10.sup.−5% biotin and 2% glycerol) and ME (1.34% YNB, 4×10.sup.−5%). biotin and 1% ethanol), BMGY (2% peptone, 1% yeast extract, 1.34% YNB, 4×10.sup.−5% biotin and 2% glycerol) and BMEY (2% peptone, 1% yeast extract, 1.34% YNB, 4×10%.sup.−5 biotin and 1% ethanol).
[0061] As the expression vector for the recombinant protein production, pADH3ZαA-XylB/HIS4, the plasmid containing the native and mutant ADH3 promoters, constructed in accordance with the invention was used. Aspergillus niger xylanase gene (XylB) was used as the reporter gene. Escherichia coli XL1-Blue strain was used for cloning and propagation of plasmids. LB medium (0.5% yeast extract, 1% peptone and 1% NaCl) was prepared with appropriate antibiotic additions to grow E. coli cells.
[0062] General Molecular Biology Techniques
[0063] The restriction endonucleases and their buffer solutions were obtained from Fermentas (MD, USA). DNAMAN 7.0 (Lynnon Corporation) was used for all primer designs and DNA analyzes. Primers were obtained from Macrogen Inc. (Seoul, South Korea). The National Biotechnology Information Center Network Service (Bethesda, Md., USA; http//www.ncbi.nlm.nih.gov) was used for screening of gene and protein sequences. Molecular cloning techniques were performed in accordance with Sambrook and Russel (2001) and kit protocols. Southern blot method was used for the confirmation of the integration of the expression cassette into the genome and the determination of clones containing a single copy expression cassette. In the Southern blot analysis, 527 bp HIS4 fragment which was amplified by PCR from plasmid pPIC3.5K and labeled with digoxigenin (DIG) was used as probe.
[0064] Determination of Xylanase Enzyme Activity
[0065] Xylanase activity was determined by measuring the reducing sugar released from the xylan (Miller 1959). The supernatant sample (0.1 mL) was added to 0.9 mL of 0.05 M sodium citric acid buffer (pH 5.00) containing 1% (w/v) beechwood xylan. The reaction mixture was incubated at 50° C. for 5 minutes. At the end of the incubation period, 100 μl of the reaction mixture was added into the 900 μl of DNSA to stop the reaction. The mixture was incubated at boiling water bath for 5 minutes and after cooling, absorbance values were recorded spectrophotometrically at a wavelength of 540 nm. The amount of reducing sugar was determined by the dinitrosalicylic acid (DNSA) method. The blank samples were prepared by stopping the reaction with DNSA solution immediately after the enzyme was added to the substrate. One unit of xylanase activity was defined as the amount of enzyme needed to produce 1 μmol of reducing sugar (equivalent to glucose) under experimental conditions at 1 minute. The standard curve was plotted with 1-10 μmol xylose.
[0066] Results
[0067] Determination of ADH3 Promoter Region
[0068] Expression vectors containing the DNA regions of the 2000, 1500, 1000 and 500 bp in the 5′ upstream portion of the ADH3 gene as promoters were integrated into the genome of the P. pastoris GS115 strain from his4 locus. Transformants containing a single copy expression cassette were selected and their copy number confirmed by Southern blot analysis (result not shown here). The transformants were inoculated into the medium containing glycerol and grown at 28° C. on a shaker for about 16 hours. The grown cells were transferred to the ethanol medium at the equal optical densities, and the supernatants were collected at the 8th hour of incubation. Activities of different length promoters were determined indirectly by measuring xylanase activity in supernatants. The results were determined relatively by normalizing the promoter activities to that of 2000 bp promoter defined as 100%. There was no difference in the tendency of promoter activities between minimal and rich media. The shortest DNA region in which the ADH3 promoter activity maintained unchanged was determined to be 1000 bp between the promoters 2000, 1500, 1000 and 500 bp (data not shown).
[0069] For a more accurate analysis of the promoter region, 1000 bp DNA region of the ADH3 promoter was serially truncated 100 bp from the 5′ end and deletion analysis was continued to 100 bp DNA region. The results showed that the shortest DNA region in which the ADH3 promoter activity was 100% continued to be 900 bp and the ADH3 promoter region for further studies was determined as 900 bp (SEQ ID No: 1). The deletion of the region of −900 to −800 on the SEQ ID No: 1 caused a 30% reduction in promoter activity. This result can be expressed as the maintenance of 70% of the promoter activity with 800 bp promoter (Nucleotides −800 to 0). The promoter activity was maintained at about 70% in the DNA regions of 700 (nucleotide −700 to 0), 600 (nucleotide −600 to 0), 500 (nucleotide −500 to 0) and 400 (nucleotide −400 to 0). This means that 5′ end-deletion analysis between −800 and −400 did not have an effect of increasing or decreasing the promoter activity. The promoter activity was approximately 130% with a 300 bp promoter (Nucleotide −300 to 0), and approximately 95% with a 200 bp promoter (Nucleotide −200 to 0) and about 6% with a 100 bp promoter (Nucleotide −100 to 0). Deletion of the repressor region results in an increase in promoter activity, while deletion of the activator region causes a decrease in promoter activity. The results showed that the promoter activity is 70% with 400 bp promoter and 130% with 300 bp promoter showed that there may have been a repressor region between −400 and −300 nucleotides. Promoter activity of the 200 bp region (Nucleotide −200 to 0) was obtained 95%, but this was a significant decrease in activity relative to the 300 bp promoter. This indicated that the activator sites could be located in a region between the nucleotides −300 and −200. Increases and decreases in promoter activity during 5′ end-deletion can give some idea about regulator regions, but internal deletion analysis is required to obtain more accurate results.
[0070] Mutant ADH3 Promoters
[0071] Internal deletion analyzes (SEQ ID No: 1) were performed by overlap PCR method. The resulting mutant ADH3 promoters were ligated to expression vectors. The linearized plasmids were then integrated into the P. pastoris GS115 his4 locus. Transformants containing a single copy expression cassette were selected and their copy number was confirmed by Southern blot analysis (data not shown).
[0072] In the expression studies, the transformants were inoculated into the medium containing glycerol and grown at 28° C. for about 16 hours in the shaker. The grown cells were transferred to medium containing ethanol with equal optical density. The supernatants were collected at the 8th hour of incubation. Activities of the mutant ADH3 promoters were determined by measuring xylanase activity in the supernatants. The results were determined relatively by normalizing the promoter activities to that of 900 bp promoter defined as 100%.
[0073] Deleted regions in ADH3 promoter structures was given in Table 3. Deleted regions: Nucleotides 0 to 99 (−900 to −801), 77 to 176 (−823 to −724), 154 to 253 (−746 to −647), 231 to 330 (−669 to −570), 308 to 407 (−592 to −493), 385 to 484 (−515 to −416), 462 to 561 (−438 to −339), 539 to 638 (−361 to −262), 616 to 715 (−284 to −185), 693 to 792 (−207 to −108), 770 to 814 (−130 to −86) and 200 to 500 (−700 to −400).
TABLE-US-00003 TABLE 3 Deleted sequences in ADH3 promoter structures Position* SEQ. Construct 5′ 3′ Deleted DNA Sequence ID No ΔA -900 -801 atgcccggagg agacttgcccc ctaatttcgcg 36 gcgtcgtcccg gatcgcagggt gagactgtaga gaccccacata gtgacaatgat tatgtaagaag ΔB -823 -724 gtgacaatgat tatgtaagaag aggggggtgat 37 tcggccggcta tcgaactctaa caactaggggg gtgaacaatgc ccagcagtcct ccccactcttt ΔC -746 -647 ccagcagtcct ccccactcttt gacaaatcagt 38 atcaccgatta acaccccaaat cttattctcaa cggtccctcat ccttgcacccc tctttggacaa ΔD -669 -570 ccttgcacccc tctttggacaa atggcagttag 39 cattggtgcac tgactgactgc ccaaccttaaa cccaaatttct tagaaggggcc catctagttag ΔE -592 -493 tagaaggggcc catctagttag cgaggggtgaa 40 aaattcctcca tcggagatgta ttgaccgtaag ttgctgcttaa aaaaaatcagt tcagatagcga ΔF -515 -416 aaaaaatcagt tcagatagcga gacttttttga 41 tttcgcaacgg gagtgcctgtt ccattcgattg caattctcacc ccttctgccca gtcctgccaat ΔG -438 -339 ccttctgccca gtcctgccaat tgcccatgaat 42 ctgctaatttc gttgattccca cccccctttcc aactccacaaa ttgtccaatct cgttttccatt ΔH -361 -262 ttgtccaatct cgttttccatt tgggagaatct 43 gcatgtcgact acataaagcga ccggtgtccga aaagatctgtg tagttttcaac attttgtgctc ΔI -284 -185 tagttttcaac attttgtgctc cccccgctgtt 44 tgaaaacgggg gtgagcgctct ccggggtgcga attcgtgccca attcctttcac cctgcctattg ΔJ -207 -108 attcctttcac cctgcctattg tagacgtcaac 45 ccgcatctggt gcgaatatagc gcacccccaat gatcacaccaa caattggtcca cccctccccaa ΔK -130 -86 caattggtcca cccctccccaa tctctaatatt 46 cacaattcacc Δ700-400 -700 -400 accccaaatc ttattctcaa cggtccctca 47 tccttgcacc cctctttgga caaatggcag ttagcattgg tgcactgact gactgcccaa ccttaaaccc aaatttctta gaaggggccc atctagttag cgaggggtga aaaattcctc catcggagat gtattgaccg taagttgctg cttaaaaaaa atcagttcag atagcgagac ttttttgatt tcgcaacggg agtgcctgtt ccattcgatt gcaattctca ccccttctgc ccagtcctgc caattgccca tgaatctgct *The positions were given according to SEQ ID No: 1.
[0074] According to the present invention, mutations between the nucleotides from 0 to 99 (−900 to −801), 462 to 561 (−438 to −339), 539 to 638 (−361 to −262), 616 to 715 (−284 to −185), 693 to 792 (−207 to −108) and 770 to 814 (−130 to −86) on SEQ ID NO: 1 have been found to be effective in the regulation of the ADH3 promoter activity.
[0075] The results showed that the deletion between the 0 to 99 (−900 to −801) nucleotides resulted in a decrease of about 30%/a in the promoter activity, while the deletion between the nucleotides 462 to 561 (−438 to −339) was about 20% in the promoter activity; deletion of the region 616 to 715 (−284 to −185) is about 70%; deletion of the region 693 to 792 (−207 to −108) is about 70%; deletion of the region 770 to 814 (−130 to −86) resulted in a decrease of about 30%. These regions, which cause a decrease in the promotor activity as a result of internal deletion analyzes, are the regions responsible for the positive regulation in the promoter activity (UAS, Upstream Activator Site).
[0076] Internal deletion between 539 to 638 (−361 to −262) nucleotides on SEQ ID NO: 1 caused a 63% increase in ADH3 promoter activity. This region in which deletion analysis results in increased promoter activity, is a region responsible for negative regulation in promoter activity (URS, Upstream Repressor Site).
[0077] Comparison of internal deletion analysis and 5′ end-deletion analysis showed that internal deletion between 539 and 638 (−361 to −262) nucleotides resulted in a 63% increase in ADH3 promoter activity and 5′ end-deletion analysis between −400 and −300 in the resulted in a 60% increase in the promoter activity, from about 70% to 130%.
[0078] No significant difference in activity was observed between 5′ end-deletion analyzes between the 700 (−700 to 0), 600 (−600 to 0), 500 (−500 to 0), and 400 (−400 to 0) bp ADH3 promoters. The results indicated that there were no regulatory sequences in these regions responsible from promoter activity. Also, in internal deletion assays, when the DNA region between 200 and 500 (−700 to −400) in SEQ ID NO: 1 was deleted, the promoter activity was maintained at 94%. It has also been identified that mutations between the nucleotides 77 to 176 (−823 to −724), 154 to 253 (−746 to −647), 231 to 330 (−669 to −570), 308 to 407 (−592 to −493), 385 to 484 (−515 to −416) do not have a significant effect on promoter activity.
[0079] The present invention provides important data on the positive or negative regulatory regions on the ADH3 promoter. This data obtained by 5′ end- and internal deletion analysis has been summarized in
[0080] Construction of Synthetic ADH3 Promoters
[0081] The results of the deletion assays identified nucleotides from 0 to 99 (−900 to −801) as UAS1; nucleotides 616 to 792 (−284 to −108) as UAS2; nucleotides 539 to 638 (−361 to −262) as URS1 on SEQ NO:1. Five different synthetic promoters were constructed using activator (UAS1 and UAS2) regions defined. All synthetic promoters created had a region of nucleotide 792 to 900 (−108 to 0) containing the ADH3 promoter TATA box. The ADH3-SNT5 promoter further comprises the fragment comprising the nucleotides from 100 to 538 (−800 to −362).
[0082] Enzyme recognition sites were used for combining the regions used in the construction of synthetic promoters. The regions included in the synthetic promoters and the endonuclease enzyme recognition sites used to combine these regions are shown schematically in
[0083] The regions used in the construction of the synthetic promoters were amplified by PCR method and the PCR products were digested with the enzymes of recognition regions shown in
TABLE-US-00004 TABLE 4 The DNA sequences of the synthetic promoters Promoter DNA sequence ADH3-SNT1 atgcccggagg agacttgcccc ctaatttcgcg gcgtcgtcccg gatcgcagggt gagactgtaga gaccccacata gtgacaatgat tatgtaagaag tctagatagtt ttcaacatttt gtgctcccccc gctgtttgaaa acgggggtgag cgctctccggg gtgcgaattcg tgcccaattcc tttcaccctgc ctattgtagac gtcaacccgca tctggtgcgaa tatagcgcacc cccaatgatca caccaacaatt ggtccacccct ccccaatctct aatattcacaa ttcacctcact ataaatacccc tgtcctgctcc caaattctttt ttccttcttcc atcagctacta gcttttatctt atttactttac gaaa ADH3-SNT2 tagttttcaac attttgtgctc cccccgctgtt tgaaaacgggg gtgagcgctct ccggggtgcga attcgtgccca attcctttcac cctgcctattg tagacgtcaac ccgcatctggt gcgaatatagc gcacccccaat gatcacaccaa caattggtcca cccctccccaa aagctttagtt ttcaacatttt gtgctcccccc gctgtttgaaa acgggggtgag cgctctccggg gtgcgaattcg tgcccaattcc tttcaccctgc ctattgtagac gtcaacccgca tctggtgcgaa tatagcgcacc cccaatgatca caccaacaatt ggtccacccct ccccaatctct aatattcacaa ttcacctcact ataaatacccc tgtcctgctcc caaattctttt ttccttcttcc atcagctacta gcttttatctt atttactttac gaaa ADH3-SNT3 atgcccggagg agacttgcccc ctaatttcgcggcgtcgtcccg gatcgcagggt gagactgtaga gaccccacata gtgacaatgat tatgtaagaag tctagatagtt ttcaacatttt gtgctcccccc gctgtttgaaa acgggggtgag cgctctccggg gtgcgaattcg tgcccaattcc tttcaccctgc ctattgtagac gtcaacccgca tctggtgcgaa tatagcgcacc cccaatgatca caccaacaatt ggtccacccct ccccaaaagct ttagttttcaa cattttgtgct ccccccgctgt ttgaaaacggg ggtgagcgctc tccggggtgcg aattcgtgccc aattcctttca ccctgcctatt gtagacgtcaa cccgcatctgg tgcgaatatag cgcacccccaa tgatcacacca acaattggtcc acccctcccca atctctaatat tcacaattcac ctcactataaa tacccctgtcc tgctcccaaat tcttttttcct tcttccatcag ctactagcttt tatcttattta ctttacgaaa ADH3-SNT4 atgcccggagg agacttgcccc ctaatttcgcg gcgtcgtcccg gatcgcagggt gagactgtaga gaccccacata gtgacaatgat tatgtaagaag tctagatagtt ttcaacatttt gtgctcccccc gctgtttgaaa acgggggtgag cgctctccggg gtgcgaattcg tgcccaattcc tttcaccctgc ctattgtagac gtcaacccgca tctggtgcgaa tatagcgcacc cccaatgatca caccaacaatt ggtccacccct ccccaagagct ctagttttcaa cattttgtgct ccccccgctgt ttgaaaacggg ggtgagcgctc tccggggtgcg aattcgtgccc aattcctttca ccctgcctatt gtagacgtcaa cccgcatctgg tgcgaatatag cgcacccccaa tgatcacacca acaattggtcc acccctcccca aaagctttagt tttcaacattt tgtgctccccc cgctgtttgaa aacgggggtga gcgctctccgg ggtgcgaattc gtgcccaattc ctttcaccctg cctattgtaga cgtcaacccgc atctggtgcga atatagcgcac ccccaatgatc acaccaacaat tggtccacccc tccccaatctc taatattcaca attcacctcac tataaataccc ctgtcctgctc ccaaattcttt tttccttcttc catcagctact agcttttatct tatttacttta cgaaa ADH3-SNT5 atgcccggagg agacttgcccc ctaatttcgcg gcgtcgtcccg gatcgcagggt gagactgtaga gaccccacata gtgacaatgat tatgtaagaag aggggggtgat tcggccggcta tcgaactctaa caactaggggg gtgaacaatgc ccagcagtcct ccccactcttt gacaaatcagt atcaccgatta acaccccaaat cttattctcaa cggtccctcat ccttgcacccc tctttggacaa atggcagttag cattggtgcac tgactgactgc ccaaccttaaa cccaaatttct tagaaggggcc catctagttag cgaggggtgaa aaattcctcca tcggagatgta ttgaccgtaag ttgctgcttaa aaaaaatcagt tcagatagcga gacttttttga tttcgcaacgg gagtgcctgtt ccattcgattg caattctcacc ccttctgccca gtcctgccaat tgcccatgaat ctgctaatttc gttgattccca cccccctttcc aactccacaaa tctagatagtt ttcaacatttt gtgctcccccc gctgtttgaaa acgggggtgag cgctctccggg gtgcgaattcg tgcccaattcc tttcaccctgc ctattgtagac gtcaacccgca tctggtgcgaa tatagcgcacc cccaatgatca caccaacaatt ggtccacccct ccccaaaagct ttagttttcaa cattttgtgct ccccccgctgt ttgaaaacggg ggtgagcgctc tccggggtgcg aattcgtgccc aattcctttca ccctgcctatt gtagacgtcaa cccgcatctgg tgcgaatatag cgcacccccaa tgatcacacca acaattggtcc acccctcccca atctctaatat tcacaattcac ctcactataaa tacccctgtcc tgctcccaaat tcttttttcct tcttccatcag ctactagcttt tatcttattta ctttacgaaa
[0084] The resulting synthetic promoters were ligated to the expression vector by the strategy used in the deletion analysis (
[0085] In the protein expression studies, the transformants were cultured in glycerol-containing medium at 28° C. for about 16 hours in shaking incubator. The grown cells were transferred to the ethanol medium in equal their optical densities and the supernatants were collected at the 8th hour of incubation. The activity of synthetic promoters was determined by measuring xylanase activity in supernatants. The results were calculated relatively by normalizing the promoter activities to that of 900 bp promoter defined as 100%.
[0086] The results showed that the promoter activities of ADH3-SNT1, ADH3-SNT2, ADH3-SNT3, ADH3-SNT4 and ADH3-SNT5 were 164%, 167%, 173%, 197% and 201%, respectively.
REFERENCES
Patents
[0087] U.S. Pat. No. 6,699,691 B2 03/2004 Inan et al. [0088] U.S. Pat. No. 9,012,175 B2 04/2015 Hartner et al. [0089] U.S. Pat. No. 8,222,386 B2 07/2012 Cregg et al.
Others
[0090] Chien, L. J., Lee, C. K. 2005. “Expression of bacterial hemoglobin in the yeast, Pichia pastoris, with a low O2-induced promoter”, Biotechnology Letters, 27 (19), 1491-1497. [0091] De Schutter, K., Lin Y. C., Tiels P., Van Hecke A., Glinka S., Weber-Lehmann J., Rouze P., Peer Y., Van D. E. and Callewaert N. 2009. “Genome sequence of the recombinant 15 protein production host Pichiapastoris”, Nature Biotechnology, 27, 6, 561-566. [0092] Karaoglan, M., Karaoglan, F. E., Inan, M. 2016a. “Comparison of ADH3 promoter with commonly used promoters for recombinant protein production in Pichiapastoris”, Protein Expression and Purification, 121, 112-117. [0093] Karaoglan, M., Karaoglan, F. E., Inan, M. 2016b. “Functional analysis of alcohol dehydrogenase (ADR) genes in Pichiapastoris”, Biotechnology Letters, 38, 463-469. [0094] Mattanovich, D., Graf, A., Stadlmann, J., Dragosits, M., Reda, A., Maurer, M., Kleinheinz, M., Sauer, M., Altmann, F., and Gasser B. 2009. “Genome, secretome and glucose transport highlight unique features of the protein production host Pichia pastoris”, Microbial Cell Factories, June 2; 8:29. [0095] Sambrook, J., and Russel D. 2001. Molecular Cloning: A Laboratory Manual. NY: Cold Spring Harbor Laboratory Press: Cold Spring Harbor. [0096] Vogl, T. and Glieder A. 2013. “Regulation of Pichia pastoris promoters and its consequences for protein production”, New Biotechnology, 30, 4, 385-404.