Alginate Lyase and Application thereof

Abstract

The disclosure discloses an alginate lyase and application thereof, and belongs to the technical field of biology. The alginate lyase provided by the disclosure has high degradation activity, and the enzyme activity reaches 65 U/mg; the alginate lyase is stable in nature, and the enzyme activity remains 98% or higher of the initial enzyme activity after storage at 4° C. for 18 months; and the alginate lyase has high product specificity. The disclosure uses E. coli as a host to express the alginate lyase derived from V. natriegens, the obtained recombinant E. coli can produce the alginate lyase secreted extracellularly in a conventional LB medium without adding an induction substrate sodium alginate, so the downstream processing technology of protein is simplified, and the disclosure has great industrial application potential.

Claims

1. A recombinant cell, wherein the recombinant cell expresses the enzyme of an alginate lyase derived from V. natriegens SK42.001, wherein the amino acid sequence of the alginate lyase is set forth in SEQ ID NO: 1.

2. The recombinant cell of claim 1, wherein E. coli is a host.

3. The recombinant cell of claim 2, wherein the host is E. coli BL21.

4. The recombinant cell of claim 3, comprising a recombinant expression vector using pET-28a(+) as an expression vector.

5. The recombinant cell of claim 1, comprising pET-28a(+) as an expression vector and E. coli BL21 as a host to express a gene with a nucleotide sequence set forth in SEQ ID NO: 2.

6. A method for producing an alginate lyase, comprising inoculating a seed solution of the recombinant cell of claim 2 into a medium, and after a period of incubation, adding IPTG to induce expression of the alginate lyase.

7. A method for producing an alginate lyase, comprising inoculating a seed solution of the recombinant cell of claim 5 into a medium, and after a period of incubation, adding IPTG to induce expression of the alginate lyase.

8. The method of claim 6, wherein the seed solution is inoculated into an LB medium at an inoculum amount of 2-5%, and incubated at 35-37° C. and 180-200 rpm until OD.sub.600 is 0.6-0.8, and 0.5-1 mM IPTG is added to induce incubation at 15-18° C. and 180-200 rpm for 45-48 h, and a fermentation broth is obtained.

9. The method of claim 7, wherein the seed solution is inoculated into an LB medium at an inoculum amount of 2-5%, and incubated at 35-37° C. and 180-200 rpm until OD.sub.600 is 0.6-0.8, and 0.5-1 mM IPTG is added to induce incubation at 15-18° C. and 180-200 rpm for 45-48 h, and a fermentation broth is obtained.

10. The method of claim 8, wherein the fermentation broth is centrifuged to remove thallus to obtain a crude enzyme of recombinant alginate lyase, the crude enzyme is subjected to nickel column affinity chromatography and dialysis to obtain a pure enzyme liquid, and the pure enzyme liquid is freeze-dried to obtain an enzyme powder.

11. The method of claim 9, wherein the fermentation broth is centrifuged to remove thallus to obtain a crude enzyme of recombinant alginate lyase, the crude enzyme is subjected to nickel column affinity chromatography and dialyzed to obtain a pure enzyme liquid, and the pure enzyme liquid is freeze-dried to obtain enzyme powder.

12. The method of claim 7, wherein a single colony of the recombinant cell is picked into an LB medium containing kanamycin, and incubated to obtain a seed solution.

13. The method of claim 8, wherein a single colony of the recombinant cell is picked into an LB medium containing kanamycin, and incubated to obtain a seed solution.

Description

BRIEF DESCRIPTION OF FIGURES

[0034] FIG. 1 shows a photo of the morphology of the strain SK42.001 under a microscope (1000×).

[0035] FIG. 2 shows the plate colony morphology of the strain SK42.001.

[0036] FIG. 3 show a photo of the cell morphology of the strain SK42.001 under an electron microscope (20000×).

[0037] FIG. 4 shows the growth curves of V. natriegens SK42.001 and E. coli BL21.

[0038] FIG. 5 shows the recombinant plasmid pAWP89-GFP-Cm.

[0039] FIG. 6 shows expression of GFP by SK42.001 conjugating a recombinant strain.

[0040] FIG. 7 shows a natural plasmid extracted from a SK42.001 wild strain, wherein M is a DL5000 marker; 1 is the natural plasmid extracted from the SK42.001 wild strain; the plasmid in the photo shows a supercoiled structure; and the band is at ½ of the actual size.

[0041] FIG. 8 shows an SDS-PAGE analysis of the purified Aly01 enzyme.

[0042] FIG. 9 shows the influence of temperature on the Aly01.

[0043] FIG. 10 shows the influence of pH on the Aly01.

[0044] FIG. 11 shows the influence of NaCl on the Aly01.

[0045] FIG. 12 shows analysis of products of sodium alginate degraded by the Aly01, wherein DP2 is polydimannuronate; DP3 is polytriguluronate; 1 is a 4 h reaction solution of the Aly01 enzyme; and 2 is a solution of the substrate sodium alginate.

[0046] FIG. 13 is an SDS-PAGE analysis chart of the purified extracellular recombinant alginate lyase, wherein M is a molecular weight standard; 1 is a crude enzyme before induction; 2 is the crude enzyme after induction; and 3 is a purified enzyme liquid.

DETAILED DESCRIPTION

[0047] Media:

[0048] Liquid medium and screening liquid medium containing: 5 g of sodium alginate, 5 g of (NH.sub.4).sub.2SO.sub.4, 30 g of NaCl, 1 g of MgSO.sub.4.7H.sub.2O, 2 g of K.sub.2HPO.sub.4, 0.01 g of FeSO.sub.4.7H.sub.2O, and 1000 mL of distilled water, with a pH of 7.2.

[0049] Plate medium containing: 5 g of sodium alginate, 5 g of (NH.sub.4).sub.2SO.sub.4, 30 g of NaCl, 1 g of MgSO.sub.4-7H.sub.2O, 2 g of K.sub.2HPO.sub.4, 0.01 g of FeSO.sub.4.7H.sub.2O, 1000 mL of distilled water with a pH of 7.2, and 20 g of agar.

[0050] Enzyme activity measurement: 1 mL of an enzyme reaction solution (50 mM PB buffer with a pH of 7.0) contains 5 mg of sodium alginate, 300 mM NaCl, and 0.84 μg of alginate lyase or fermentation supernatant, and reacts at 35° C. for 30 min, and the supernatant is taken for detecting the enzyme activity by a DNS method. Definition of enzyme activity: The amount of enzyme required to produce 1 μmol of reducing sugar per minute.

Example 1 Production Method of Alginate Lyase Aly01

[0051] A: Screening Method of V. natriegens

[0052] (1) Sea mud was sampled from the vicinity of a kelp breeding plant in Rongcheng, Shandong, and 1 g of the sample was dispersed evenly in 50 mL of sterile water.

[0053] (2) 1 mL of supernatant was inoculated in 50 mL of screening liquid medium and incubated at 28° C. and 200 rpm for 2 days. The culture was diluted by 10-, spread on a screening plate medium and incubated at 28° C. for 2 days, and single colonies of different morphology were picked and streaked on the plate several times to obtain a pure culture.

[0054] (3) The single colonies of different morphology were picked, inoculated into a liquid medium, and incubated at 28° C. and 200 rpm for 2 days. The supernatant was taken to measure the enzyme activity of strains, and the strain with higher enzyme activity was selected and commissioned to be preserved by the China Center for Type Culture Collection, and the morphological characteristics, physiological-biochemical characteristics and 16S rDNA sequence of the strain were analyzed.

[0055] B: Identification of V. natriegens

[0056] (1) Plate Colony Morphology

[0057] The plate colony morphology of V. natriegens SK42.001 was as follows: A colony grew rapidly after streaking on a plate medium. A single colony came out after 24 h of incubation at 28° C. The colony was round and convex, milky white, moist and slightly sticky, with a smooth surface, flat edges, and a diameter of 0.6-0.8 cm.

[0058] (2) Thallus Characteristics Under Electron Microscope

[0059] The thallus characteristics of V. natriegens SK42.001 under an electron microscope were as follows: A thallus is short, obtuse at both ends, curved into an arc, with a size of 0.6-0.8 μm×1.2-1.4 μm.

[0060] (3) Physiological-Biochemical Characteristics

[0061] Physiological-biochemical characteristics of V. natriegens SK42.001: V. natriegens was Gram stain-negative; aerobically grows; was negative in an indole reaction; could hydrolyze gelatin and weakly hydrolyze esculin; could not hydrolyze arginine, urea and s-galactoside; could use glucose, sucrose, starch, arabinose and mannose; and could not use fructose, maltose, inulin, xylose, galactose, sorbose and xylitol. In particular, the V. natriegens provided by the disclosure could hydrolyze gelatin and could use starch and maltose.

[0062] The 16S rDNA of V. natriegens SK42.001 (a nucleotide sequence was shown in SEQ ID NO: 4) was compared with data in the NCBI database, and the result showed that V. natriegens SK42.001 has extremely high homology with V. natriegens.

TABLE-US-00001 TABLE 1 Physiological-biochemical characteristics of strain SK42.001-enzyme activity and carbon source oxidation Reaction substrate Test and reaction enzyme result ONPG O-nitrobenzene- β-galactosidase − galactoside ADH Arginine Arginine dihydrolase − LDC Lysine Lysine decarboxylase − ODC Ornithine Ornithase decarboxylation − CIT Sodium citrate Utilization of citric acid + H2S Sodium thiosulfate Generation of H2S − URE Urea Urease − TDA Tryptophan Tryptophan desaminase + IND Tryptophan Production of indole − VP Pyruvate Production of acetylmethyl + carbinol by 3-hydroxybutanone GEL Kohn gelatin Gelatinase + GLU Glucose Fermentation/oxidation (4) + MAN Mannitol Fermentation/oxidation (4) + INO Inositol Fermentation/oxidation (4) − SOR Sorbitol Fermentation/oxidation (4) − RHA Rhamnose Fermentation/oxidation (4) + SAC Sucrose Fermentation/oxidation (4) + MEL Melibiose Fermentation/oxidation (4) − AMY Amygdalin Fermentation/oxidation (4) + ARA Arabinose Fermentation/oxidation (4) + +: positive reaction; −: negative reaction

TABLE-US-00002 TABLE 2 Physiological-biochemical characteristics of strain SK42.001-production of acid using carbon source Reagent strip corresponding Test tube/substrate result  0 control −  1 glycerin −  2 erythritol −  3 D-arabinose +  4 L-arabinose +  5 ribose −  6 D-xylose −  7 L-xylose −  8 adonitol −  9 β-methyl-D-xyloside − 10 galactose − 11 glucose + 12 fructose − 13 mannose + 14 sorbose − 15 rhamnose + 16 dulcitol − 17 inositol − 18 mannitol + 19 sorbitol − 20 α-methyl-D-mannoside − 21 α-methyl-D-glucoside − 22 N-acetyl-glucosamine − 23 amygdalin + 24 arbutin − 25 esculin W 26 salicin − 27 cellobiose − 28 maltose − 29 lactose − 30 melibiose + 31 sucrose + 32 trehalose − 33 inulin − 34 melezitose − 35 raffinose − 36 starch + 37 glycogen − 38 xylitol − 39 geraniol − 40 D-turanose − 41 D-lyxose − 42 D-tagatose − 43 D-fucose − 44 L-fucose − 45 D-arabitol − 46 L-arabitol − 47 gluconate − 48 2-keto-gluconate − 49 5-keto-gluconate + +: positive reaction; −: negative reaction; w: weakly positive reaction

Example 2 Feasibility of V. natriegens as New Model Organism

[0063] (1) Measurement of Growth Rate

[0064] In an LB3 liquid medium (LB medium with a NaCl concentration of 3%), the culture generation time of V. natriegens was 16.2 min, while that of the reference strain E. coli BL21 was 31.4 min. A single colony of SK42.001 grew 5 h after streaking on an LB plate, while E. coli BL21 takes 10 h. Therefore, the SK42.001 had a high growth rate, which was nearly twice that of E. coli.

[0065] (2) Feasibility of SK42.001 to Express Exogenous Genes

[0066] A broad host range plasmid pAWP89 was selected to construct a recombinant plasmid pAWP89-GFP-Cm containing green fluorescent protein (GFP) reporter gene and chloramphenicol (Cm) resistance gene selection markers (FIG. 5). Using a pRK2013 helper plasmid, the pAWP89-GFP-Cm was introduced into SK42.001 through triparental conjugation, and the conjugated SK42.001 recombinant strain emits green fluorescence under blue light excitation (FIG. 6). Therefore, the SK42.001 could be used as a host strain to express exogenous target genes.

[0067] The above result indicated that the V. natriegens SK42.001 strain had development value and application potential as a new model organism.

Example 3 Gene Characteristics of V. natriegens

[0068] V. natriegens SK42.001 was 100% consistent with V. natriegens CCUG16374, which was one of strains used by Daniel Gibson's research group of Synthetic Genomics in California. V. natriegens SK42.001 was 99% consistent with the strain V. natriegens ATCC14048 (or DSM759) shared by the George Church group of Harvard University and Gibson. However, the whole genomes of V. natriegens SK42.001 and V. natriegens CCUG16374 were not exactly same.

[0069] (1) SK42.001 contained some coding genes that CCUG16374 did not have, for example:

[0070] I: SK42.001 contained a gene (SEQ ID NO: 2) encoding the alginate lyase.

[0071] II: SK42.001 contained a gene (SEQ ID NO: 3) encoding the oligo-alginate lyase.

[0072] (2) SK42.001 and CCUG16374 had some protein coding genes that were different, for example:

[0073] I: A gene of SK42.001 encoding a xanthan lyase and a gene of CCUG16374 encoding the xanthan lyase had a similarity of 98%, and had 69 different bases and 18 Gaps.

[0074] II: Some pilin related to the formation of bacterial pili were quite different.

[0075] a: The similarity of pili assembly protein TadC was 77%, with 201 different bases and 6 Gaps.

[0076] b: The similarity of pili synthetic protein TadE was 82%, with 79 different bases and 6 Gaps.

[0077] c: The similarity of pili Flp type assembly protein CpaB was 79%, with 154 different bases and 10 Gaps.

[0078] (3) V. natriegens SK42.001 had its own natural plasmids, but other V. natriegens strains that had been reported did not have natural plasmids.

[0079] A single colony of V. natriegens SK42.001 was picked and inoculated into 50 mL of liquid medium, and incubated at 28° C. and 200 rpm for 2 days. The plasmids of a SK42.001 wild strain were extracted by using a SanPrep column plasmid DNA small volume extraction kit, and detected by 1% agarose gel electrophoresis (FIG. 7). It was found that the SK42.001 wild strain contains its own natural plasmids, which were about 3000 bp in size. The plasmid in the figure shows a supercoiled structure, and the band was at ½ of the actual size.

Example 4 Preparation of Alginate Lyase

[0080] The V. natriegens SK42.001 screened in Example 1 was subjected to three-stage culture and production including slant culture, seed culture and fermentation culture. The components of media were counted in g/L:

[0081] a: Slant culture: A slant medium contains 5 of sodium alginate, 5 of (NH.sub.4).sub.2SO.sub.4, 30 of NaCl, 1 of MgSO.sub.4.7H.sub.2O, 2 of K.sub.2HPO.sub.4, 0.01 of FeSO.sub.4.7H.sub.2O, and 15-20 of agar, had a natural pH, was prepared with deionized water, and was sterilized at 121° C. for 20 min. Slant culture conditions were a culture temperature 25-30° C. and a culture time 1-3 days.

[0082] b: Seed culture: A seed medium contained 5 of sodium alginate, 5 of (NH.sub.4).sub.2SO.sub.4, 30 of NaCl, 1 of MgSO.sub.4.7H.sub.2O, 2 of K.sub.2HPO.sub.4, and 0.01 of FeSO.sub.4.7H.sub.2O, had a natural pH, was prepared with deionized water, and was sterilized at 121° C. for 20 min. Seed culture conditions were 28° C. and 200 rpm on a shaking table for 12 h.

[0083] c: Fermentation culture: A fermentation medium contained 8 of sodium alginate, 5 of NH.sub.4Cl, 30 of NaCl, 1 of MgSO.sub.4.7H.sub.2O, 2 of K.sub.2HPO.sub.4, and 0.01 of FeSO.sub.4.7H.sub.2O, had a natural pH, was prepared with deionized water, and was sterilized at 121° C. for 20 min. Fermentation conditions were an inoculum amount of 5%, a temperature of 28° C., a rotation speed of 200 rpm, and fermentation on a shaker for 36 h to obtain a fermentation broth containing the alginate lyase. The enzyme activity of the fermentation broth measured was 4.5 U/mL. The enzyme activity of fermentation supernatant was detected by the DNS method by using 50 mM PB buffer with a pH of 7.0 as the buffer system, sodium alginate as a substrate, and 300 mM NaCl as a stabilizer at 35° C. for 30 min. Definition of enzyme activity: The amount of enzyme required to produce 1 μmol of reducing sugar per minute.

[0084] The fermentation broth was centrifuged to remove bacteria to obtain an alginate lyase crude enzyme. After separation and precipitation of target protein by 20%-80% ammonium sulfate, buffer dialysis, DEAE-FF 16/10 ion exchange chromatography, and Superdex 75 gel filtration chromatography were performed, finally, a purified Aly01 pure enzyme liquid (FIG. 8) was freeze-dried to obtain enzyme powder. The purification multiple was 7.63-8.17 times, and the final yield was 56.5-61.3%.

Example 5 Sequence Alignment

[0085] After amino acid sequencing of the enzyme, a primer was designed to amplify the gene encoding the alginate lyase from the V. natriegens SK42.001 genome. The nucleotide sequence of the gene was shown in SEQ ID NO: 2. The DNA sequence BLAST result was as follows: the alginate lyase provided by the disclosure had the closest DNA sequence homology to the alginate lyase derived from Vibrio alginolyticus FDAARGOS, but the similarity was only 85%, with 231 different bases and 8 Gaps.

[0086] The amino acid sequence BLAST result was as follows: the alginate lyase provided by the disclosure had the closest amino acid sequence homology to an alginate lyase derived from a Vibrio genus in the NCBI database, with a similarity of 93%, 39 different amino acids, and 0 Gap.

Example 6 Study on Enzymatic Properties of Alginate Lyase

[0087] (1) Influence of temperature on enzyme activity: 1 mL of an enzyme reaction solution (50 mM PB buffer with a pH of 7.0) contained 5 mg of sodium alginate, 300 mM NaCl and 0.84 μg of alginate lyase. The enzyme reaction solution was placed in a water bath at 4° C., 20° C., 30° C., 35° C., 40° C., 50° C., 60° C. and 70° C. for 30 min respectively, and the enzyme activity of the alginate lyase at each temperature was measured. As shown in FIG. 9, the optimal reaction temperature was 35° C.

[0088] (2) Influence of pH on enzyme activity: 1 mL of enzyme reaction solution contained 5 mg of sodium alginate, 300 mM of NaCl, and 0.84 μg of alginate lyase. Buffers (50 mM) with different pH values were used, including acetic acid-sodium acetate buffers (pH 3.5, 4.0, 4.5, 5.0), citrate buffers (pH 5.0, 5.5, 6.0, 6.5), phosphate buffers (pH 6.0, 6.5, 7.0, 7.5, 8.0), Tris-hydrochloric acid buffers (pH 7.5, 8.0, 8.5), and glycine-NaOH buffers (pH 8.5, 9.0, 9.5, 10, 10.5, 11). The enzyme reaction solution was reacted at 35° C. for 30 min to measure the enzyme activity at each pH. As shown in FIG. 10, the alginate lyase showed high pH adaptability and could maintain 90% or higher of activity in a pH range of 6.5-9.

[0089] (3) Influence of NaCl on enzyme activity: 1 mL of enzyme reaction solution (50 mM PB buffer with a pH of 7.0) contained 5 mg of sodium alginate and 0.84 μg of alginate lyase. NaCl with a final concentration of 0, 50, 80, 100, 200, 250, 300, 400, 500 and 1000 mM was added respectively. The enzyme reaction solution was reacted at 35° C. for 30 min to measure the enzyme activity at different concentration of NaCl. The alginate lyase had high dependence on NaCl, and had obvious degradation activity only when the concentration of NaCl was greater than or equal to 100 mM (FIG. 11).

[0090] (4) Product Specificity:

[0091] 1 mL of enzyme reaction system contained 300 mM NaCl, 0.84 μg of alginate lyase and 10 mg of sodium alginate, was constant volume with 50 mM PB buffer with a pH of 7.0, and was reacted at 35° C. for 12 h. The reaction solution was detected by thin layer chromatography (TLC). The specific method was: a silica gel plate of a certain size was made; a line parallel to the bottom side was drawn with a pencil on the bottom side, and several equidistant points were marked on the line with a pencil; 1 μL of disaccharide (DP2) (1 mg/mL), 1 μL of trisaccharide (DP3) standard (1 mg/mL), 1 μL of reaction solution, and 1 μL of sodium alginate substrate (10 mg/mL) were respectively placed on the marked points; the silica gel plate was placed ventilated to dry completely; and then put in a saturate tank containing a developing agent to start chromatography until the liquid reaches the top of the silica gel plate; and after the chromatography, the silica gel plate was completely dried with a blower, then placed in a color developing solution for 15 s, dried in air, and baked in an oven at 120° C. until the color develops.

[0092] Product analysis: As shown in FIG. 12, when the alginate lyase provided by the disclosure enzymatically degrades the substrate sodium alginate, the degradation rate of the sodium alginate was 100%, and almost all of the sodium alginate was degraded into trisaccharide. The oligosaccharide degraded by the alginate lyase could generate unsaturated double bonds, and compared with the saturated trisaccharide standard, the molecular weight had a difference of the molecular weight of water. Alginate lyases that could specifically degrade the substrate sodium alginate to produce specific alginate oligosaccharide (for example trisaccharide) had not been reported yet.

Example 7

[0093] (1) Construction of E. coli Engineered Strain E. coli BL21-Aly01

[0094] The sequence of a gene encoding alginate lyase in the V. natriegens SK42.001 genome was shown in SEQ ID NO: 2 (wherein 1-78 bp encode a signal peptide). Using the genome DNA of V. natriegens SK42.001 as a template, and using a upstream primer: CGCGGATCCATGAAGCATATTTTCTTCAAAAGC (BamH 1), a downstream primer: CCTCGAGGCCTTGGTACTTACCA (Xho 1), PCR amplification was performed on the gene encoding the alginate lyase; the gene fragment encoding the alginate lyase was ligated to a vector pET-28a(+); and an expression vector pET28a-aly was constructed and transformed into E. coli BL21 competent cells to construct the E. coli engineered strain E. coli BL21-aly01 that produces the alginate lyase.

[0095] (2) Extracellular Production Method of Recombinant Alginate Lyase

[0096] Seed solution culture: A single colony of E. coli engineered strain E. coli BL21-aly01 was picked into 5 mL of an LB medium containing 50 μg/mL kanamycin, and incubated at 37° C. and 200 rpm on a shaker overnight.

[0097] Fermentation induction: The above seed solution was inoculated into 200 mL of LB medium at an inoculum amount of 2%, and incubated on a shaker at 37° C. and 200 rpm until OD.sub.600 was 0.6-0.8, and 1 mM IPTG was added to induce incubation at 18° C. and 200 rpm for 48 h. The fermentation supernatant was collected by centrifugation as a crude enzyme. After measurement, the enzyme activity of the crude enzyme was 4.5 U/mL.

[0098] The fermentation broth was centrifuged to remove bacteria to obtain an alginate lyase crude enzyme, which was purified by ÄKTA nickel column affinity chromatography. After overnight dialysis in 50 mM phosphate buffer with a pH of 7.0, an Aly01 pure enzyme liquid was obtained and freeze-dried to obtain enzyme powder. The purification multiple was 2.62-3.17 times, and the final yield was 65.3-75.9%.

[0099] The expression vector pET28a-aly in the E. coli engineered strain E. coli BL21-aly01 constructed contained the full length of the gene encoding the extracellular alginate lyase derived from V. natriegens SK42.001, and included a signal peptide, a carbohydrate binding domain and a catalytic activity domain. The engineered host strain E. coli BL21 could recognize a signal peptide derived from V. natriegens SK42.001, and further could fermentatively produce the alginate lyase and secrete the alginate lyase extracellularly. Most of E. coli engineered strains producing the alginate lyase in the prior art produce intracellular recombinase, and the signal peptide part needed to be cut off or only an expression vector containing the catalytic activity domain was constructed.

[0100] Although the disclosure has been disclosed as above in preferred examples, it is not intended to limit the disclosure. Anyone familiar with the technology can make various variations and modifications without departing from the spirit and scope of the disclosure. Therefore, the protection scope of the disclosure should be defined by the claims.