DETECTION METHOD OF MULTIPLE ANALYTES
20220205993 · 2022-06-30
Assignee
Inventors
- Wen-Ting Chiang (Hsinchu County, TW)
- Chien-An Chen (New Taipei City, TW)
- Cheng-Tai Chen (Taoyuan City, TW)
Cpc classification
G01N33/5076
PHYSICS
G01N33/54313
PHYSICS
G01N33/54333
PHYSICS
G01N33/5308
PHYSICS
International classification
Abstract
A detection method of multiple analytes includes the following. A microparticle is provided. The microparticle is coupled with at least one first ligand, and includes a body and a plurality of first protrusions formed on a surface of the body. Next, the microparticle is mixed with a variety of analytes to form a first complex. Thereafter, the first complex is mixed with a variety of second ligands carrying a variety of first labels, such that the variety of second ligands bind to the variety of analytes in the first complex and form a second complex. Lastly, the variety of first labels in the variety of second ligands in the second complex are detected.
Claims
1. A detection method of multiple analytes, comprising: providing a microparticle, wherein the microparticle is coupled with at least one first ligand, and the microparticle comprises: a body; and a plurality of first protrusions formed on a surface of the body; mixing the microparticle with a specimen comprising a variety of analytes to form a first complex; mixing the first complex with a variety of second ligands carrying a variety of first labels, such that the variety of second ligands bind to the variety of analytes in the first complex and form a second complex; and detecting the variety of first labels in the second complex.
2. The method according to claim 1, wherein the microparticle is a knobby particle, and the body of the knobby particle comprises a copolymer core, a polymer layer, and a silicon-based layer from the inside to the outside, a plurality of second protrusions are formed on a surface of the copolymer core, and an average height of the second protrusions is 100 nanometers to 5000 nanometers.
3. The method according to claim 1, wherein the microparticle is a knobby magnetic particle, the body of the knobby magnetic particle comprises a copolymer core, a polymer layer, a magnetic substance layer, and a silicon-based layer from the inside to the outside, a plurality of second protrusions are formed on a surface of the copolymer core, and an average height of the second protrusions is 100 nanometers to 5000 nanometers.
4. The method according to claim 1, wherein a ratio of an average height of the first protrusions to an average diameter of the body is 0.005 to 0.25.
5. The method according to claim 1, wherein a ratio of an average volume of the first protrusions to an average volume of the body is 1×10.sup.−7 to 2×10.sup.−2, and a total volume of the first protrusions to an overall volume of the microparticle is 1×10.sup.−1 to 6×10.sup.−1.
6. The method according to claim 1, wherein an average number of the first protrusions is 5 to 500, and an average diameter of the microparticle is 1 μm to 20 μm.
7. The method according to claim 1, wherein the microparticle is non-spherical.
8. The method according to claim 1, wherein the variety of analytes are located on a surface of the specimen, and the step of forming the first complex comprises performing the at least one first ligand to recognize and directly bind to a target located on the surface of the specimen.
9. The method according to claim 8, wherein the at least one first ligand comprises a first specific antibody, and the first specific antibody comprises an antibody against a surface antigen on the human exosome, an antibody against a surface antigen on the human blood cell, an antibody against a surface antigen on the human immune cell, an antibody against a surface antigen on the human tumor cell, or a combination thereof.
10. The method according to claim 8, wherein the specimen comprises a human exosome, a human blood cell, a human immune cell, a human tumor cell, or a combination thereof, and the variety of analytes comprise a surface antigen on the human exosome, a surface antigen on the human blood cell, a surface antigen on the human immune cell, a surface antigen on the human tumor cell, or a combination thereof.
11. The method according to claim 8, wherein the variety of second ligands comprise a variety of second specific antibodies, and the variety of second specific antibodies comprise an antibody against a surface antigen on the human exosome, an antibody against a surface antigen on the human blood cell, an antibody against a surface antigen on the human immune cell, an antibody against a surface antigen on the human tumor cell, or a combination thereof.
12. The method according to claim 1, wherein the at least one first ligand comprises a variety of first ligands, and the step forming the first complex comprises performing the variety of first ligands to recognize and directly bind to the variety of analytes.
13. The method according to claim 12, wherein the variety of first ligands comprise a variety of nucleic acid probes, and the variety of nucleic acid probes comprise a variety of primers or aptamers, the variety of analytes comprise a variety of nucleic acid sequences carrying a variety of second labels, and the variety of second labels comprise biotin, a variety of antigenic epitopes, or a combination thereof.
14. A detection method of multiple analytes, comprising: providing a microparticle, wherein the microparticle is coupled with a variety of ligands, and the microparticle comprises: a body; and a plurality of protrusions formed on a surface of the body; mixing the microparticle with a specimen comprising a variety of analytes to form a complex, wherein the variety of analytes carry a variety of labels; and detecting the variety of labels in the complex.
15. The method according to claim 14, wherein the variety of ligands comprise a variety of nucleic acid probes, the variety of labels comprise a variety of fluorescent labels, a variety of luminescent labels, or a combination thereof, and the variety of analytes comprise a variety of nucleic acid sequences.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
DETAILED DESCRIPTION
[0046]
[0047] With reference to
[0048] Specifically, with reference to
[0049] As shown in
[0050] In this embodiment, the copolymer core 113 is, for example but not limited to, styrene/divinylbenzene copolymer, methyl methacrylate/triethylene glycol dimethacrylate copolymer, methyl methacrylate/ethylene glycol dimethacrylate copolymer, styrene/triethylene glycol dimethacrylate copolymer, styrene/ethylene glycol dimethacrylate copolymer, or methyl methacrylate/divinylbenzene copolymer. The polymer layer 114 may be a surface of the copolymer core 113 modified with functional groups, and includes at least one functional group (for example but not limited to, a carboxyl group, an amino group, or a combination thereof). The material of the silicon-based layer 115 may include but is not limited to tetramethoxysilane (TMOS), tetraethoxysilane (TEOS), 3-Aminopropyltriethoxysilane (APTES), and 3-Glycidoxypropyltrimethoxysilane (GOPTS). The material of the magnetic substance layer 116 may include but is not limited to paramagnetic materials, superparamagnetic materials, ferromagnetic materials, ferrimagnetic materials, or a combination thereof.
[0051] With further reference to
[0052] With further reference to
[0053] Next, with further reference to
[0054] In this embodiment, the first ligand 120 includes a first specific antibody, which is capable of recognizing and directly binding to the target T. The first specific antibody includes but is not limited to an antibody against a surface antigen on the human exosome (e.g., anti-human CD9, anti-human CD63, anti-human CD29, anti-human CD81, anti-human HER2, anti-human EGFR, and anti-human EpCAM), an antibody against a surface antigen on the human blood cell (e.g., anti-human CD45 and anti-human CD235a), an antibody against a surface antigen on the human immune cell (e.g., anti-human CD3 and anti-human CD19), an antibody against a surface antigen on the human tumor cell (e.g., anti-human CEA, anti-human PD-L1, and anti-human HER2) or a combination thereof.
[0055] In this embodiment, the specimen S includes but is not limited to human exosomes, human blood cells, human immune cells, human tumor cells, or a combination thereof. The analytes 130a, 130b, 130c include but is not limited to a surface antigen on the human exosomes (e.g., CD9, CD63, CD81, HER2, EGFR, and EpCAM), a surface antigen on the human blood cells (e.g., CD45 and CD235a), a surface antigen on the human immune cells (e.g., CD3 and CD19), a surface antigen on the human tumor cells (e.g., CEA, PD-L1, and HER2), or a combination thereof.
[0056] In this embodiment, the target T may include but is not limited to at least one of the surface antigens on the human exosome, at least one of the surface antigens on the human blood cell, at least one of the surface antigens on the human immune cell, at least one of the surface antigens on the human tumor cell, or a combination thereof. The target T may be identical or different to any one of the analytes 130a, 130b, 130c. For example, in an embodiment, the target T is, for example, the surface antigen CD9 on the human exosomes, and the analytes are, for example, the surface antigens CD9, CD63, and CD81 on the human exosomes. In another embodiment, the target T is, for example, the surface antigen HER2 on the human exosomes, and the analytes are, for example, the surface antigens CD9, CD63, and CD81 on the human exosomes. Nonetheless, the disclosure is not limited thereto. Notably, even if the target T and the analyte are the same kind of surface antigens, the target T and the analyte 130a are not the same surface antigen. For example, as shown in
[0057] Then, step S30 is performed, in which the first complex 140 is mixed with a variety of second ligands 150a, 150b, 150c carrying a variety of first labels 151a, 151b, 151c, such that the second ligands 150a, 150b, 150c bind to the analytes 130a, 130b, 130c in the first complex 140 and form a second complex 160. For the sake of clarity, only one specimen S binding to one second ligand (150a, 150b, or 150c) is shown in
[0058] In this embodiment, the second ligands 150a, 150b, 150c are, for example, a variety of second specific antibodies. In this embodiment, the second specific antibodies include an antibody against a surface antigen on the human exosome, an antibody against a surface antigen on the human blood cell, an antibody against a surface antigen on the human immune cell, an antibody against a surface antigen on the human tumor cell, or a combination thereof. The second specific antibodies may be identical or different to the first specific antibodies. The first labels 151a, 151b, 151c include but are not limited to a variety of different fluorescent labels or luminescent labels. The fluorescent labels may include but are not limited to FITC, Alexa (e.g., AF-488, AF-594, AF-647, and AF-700), PE (e.g., PE, PE-Cyanine5, PE-Cyanine7, and PE-Dazzle594), PerCP (e.g., PerCP and PerCP-Cyanine5.5), BV (Brilliant Violet, e.g., BV421, BV450, BV510, BV570, BV605, BV650, BV711, BV750, and BV785), APC (e.g., APC and APC-Cyanine7), Pacific Blue, or a combination thereof. The luminescent labels include but are not limited to luciferase. Those having common knowledge in the technical field may select the first ligand, the first label, and the second ligand depending on actual needs (e.g., the source of specimens or the number of analytes), which is not limited by the disclosure.
[0059] Lastly, step S40 is performed, in which the first labels 151a, 151b, 151c of the second ligands 150a, 150b, 150c in the second complex 160 are detected. The detection result may represent the relative contents (or expressions) of the analytes 130a, 130b, 130c on the surface S1 of the specimen S. In this embodiment, the detection is performed by using, for example, a flow cytometry analyzer, but is not limited thereto. So far, the performing of the detection method of multiple analytes of this embodiment has been substantially completed.
[0060] In this embodiment, compared to a general spherical microparticle, in the microparticle 110 of this embodiment, by disposing the first protrusions having irregular shapes on the surface of the body, the surface area of the microparticle 110 (i.e., the sum of the surface area of the body and the surface area of the first protrusions) is thus increased. Accordingly, the microparticle 110 of this embodiment may be coupled with more first ligands 120 to recognize and bind to more targets T, thereby increasing the strength of detection signals to improve the detection sensitivity.
[0061] Besides, in this embodiment, since the surface of the magnetic substance layer 140 of the knobby magnetic particle 110b is a rough surface (or has small protrusions), the surface of the knobby magnetic particle 110b (i.e., the surface 111a of the body 111 and the surface of the first protrusions 112) is also a rough surface. Next, compared to the knobby particle 110a, since the surface of the knobby magnetic particle 110b is a rough surface, the knobby magnetic particle 110b is of a greater surface area. Accordingly, the knobby magnetic particle 110b is coupled with more first ligands 120, and recognizes and binds to more targets T. In addition, more analytes 130a, 130b, 130c are detected, and the strength of detection signals can be increased and the detection sensitivity can be improved. Moreover, since the knobby magnetic particle 110b is magnetic, the detection time can be reduced, and the efficiency and convenience of detection can be improved.
[0062] Hereinafter, other embodiments will be described. Note that, the reference numerals and part of the contents of the foregoing embodiments will remain to be used in the following embodiments, where the same reference numerals are used to denote the same or similar elements, and the description of the same technical contents is omitted. Reference may be made to the foregoing embodiments for the description of the omitted part, which will not be repeated in the following embodiments.
[0063]
[0064] Specifically, with reference to
[0065] Besides, in some other embodiments, the second labels 132a, 132b, 132c may also be the first labels 150a, 150b, 150c. Accordingly, after the first ligands 120a, 120b, 120c bind to the parts of sequence 131a, 131b, and 131c of the analytes 130a, 130b, 130c, the formed first complex 140 carries a variety of fluorescent labels or a variety of luminescent labels. Therefore, the detection may be performed directly without adding the second ligand to form the second complex. So far, the performing of the detection method of multiple analytes of this embodiment has been substantially completed.
[0066] Hereinafter, some embodiments of the disclosure accompanied with the drawings will be described. However, the following embodiments and accompanying drawings only serve for aiding the description, instead of limiting the disclosure.
EMBODIMENTS
Embodiment 1: Specification Analysis of Knobby Particles
[0067] In this embodiment, specifications of general spherical microparticles or knobby particles are analyzed by using a scanning electron microscope (SEM) and a multisizer. The analysis results are shown in
[0068] According to the analysis results of
[0069] Next, further analysis of the specifications of the knobby particles of
[0070] In
[0071] In
[0072] In particular, in the knobby particles, the ratio of the average height (or average volume) of the first protrusions to the average diameter (or average volume) of the bodies may be related to the surface morphology (ie, overall appearance). For example, in the knobby particles of
Embodiment 2: Assay for the Number of Grafted Specific Antibodies
[0073] In this embodiment, the first specific antibody (anti-human CD9, anti-human CD63, or anti-human HER2) was firstly coupled to a general spherical microparticle and a microparticle (a knobby particle or a knobby magnetic particle) of this disclosure. Next, assays and comparisons of the number of grafted specific antibodies were performed on the spherical microparticle coupled with the first specific antibody, the knobby particle coupled with the first specific antibody, and the knobby magnetic particle coupled with the first specific antibody. The classes and diameters of the microparticles used in this embodiment are shown in Table 1.
TABLE-US-00001 TABLE 1 the classes and diameters of the microparticles Diameter of the microparticles Class of the microparticle (μm) Example 1 knobby particle 8.5 Example 2 knobby magnetic particle 8.5 Example 3 knobby particle 2.5 Example 4 knobby particle 4.5 Comparative Example 1 spherical microparticle 8.5 Comparative Example 2 spherical microparticle 2.5 Comparative Example 3 spherical microparticle 4.5
[0074] In this embodiment, the step in which anti-human CD9 (or anti-human CD63 or anti-human HER2) was coupled to the spherical microparticle, the knobby particle, and the knobby magnetic particle is generally as follows: (1) 1×10.sup.6 particles (i.e., the spherical microparticles of Comparative Examples 1 to 3, the knobby particles of Examples 1 and 3 to 4, or the knobby magnetic particles of Examples 2) surface-modified with amine groups were washed with 200 μL of a MES buffer solution three times. Next, 20 mg of EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride), 20 mg of NHS (N-Hydroxysulfosuccinimide sodium salt), and 4 mg of PAA (15 kDa poly acrylic acid) were dissolved in 400 μL of a MES buffer solution, and were mixed with the washed particles. Next, at room temperature, the mixing was performed with a vortex mixer at a rotation speed of 1000 rpm for reaction for 30 minutes. Next, the particles were collected. The spherical microparticles and the knobby particles were collected by centrifugation at a rotation speed of 10000 rpm for 3 minutes, and the knobby magnetic particles were collected with a magnet, in which the magnet was performed to stay thereon for at least 1 minute. After the reaction solution was removed, the particles were washed with 200 μL of a MES buffer solution three times and added with 20 μL of anti-human CD9 (or anti-human CD63 or anti-human HER2) into a pH3 citric acid-PBS solution (0.625M citric acid dissolved in PBS solution, pH3.0) for reaction overnight at 4° C., such that anti-human CD9 (or anti-human CD63 or anti-human HER2) was coupled on the surface of the particles. Then, the mixture was added into 200 μL of a bovine serum albumin solution (10 mg/mL BSA dissolved in a MES solution) for perform reaction overnight at 4° C. to cover the rest of the surface of the particles that has not been coupled with anti-human CD9 (or anti-human CD63 or anti-human HER2). (2) After the reaction was completed, the particles were collected. The spherical microparticles and the knobby particles were collected by centrifugation at a rotation speed of 10000 rpm for 3 minutes. The knobby magnetic particles were collected by a magnet and the magnet was performed to stay thereon for at least 1 minute each time. The reaction solution was removed. The particles were washed with a PBS solution (0.1% BSA and 0.01% sodium azide dissolved in PBS) three times. Lastly, the particles coupled with anti-human CD9 (or anti-human CD63 or anti-human HER2) were dispersed in 100 μL of a PBS solution. (3) The concentration of particles was calculated by using an automated cell counter, and particles coupled with anti-human CD9 (or anti-human CD63 or anti-human HER2) on the surface with a concentration of about 3 to 8×10.sup.6/mL were obtained.
[0075] Next, the step in which assays of the number of grafted specific antibodies were performed on the particles coupled with anti-human CD9 (or anti-human CD63 or anti-human HER2) is generally as follows: (1) 50 μL (1250 counts) of the particles coupled with anti-human CD9 (or anti-human CD63 or anti-human HER2) on the surface were added into 5 μL of Anti-mouse IgG-FITC, and then were added into a PBS solution until the total reaction volume was 200 μL. At room temperature, the mixing was performed with a vortex mixer at a rotation speed of 1500 rpm for reaction for 30 minutes. After the reaction was completed, the particles were collected. The spherical microparticles and knobby particles were collected by centrifugation at a rotation speed of 10000 rpm for 3 minutes. The knobby magnetic particles were collected with a magnet and stayed on the magnet for at least 1 minute. (2) The reaction solution was removed, and the collected particles were washed with 200 μL of a PBS solution two times. (3) After washing, the particles were added into 100 μL of a PBS solution, and fluorescence signal analysis was performed on the particles with a flow cytometry analyzer to measure the number of grafted anti-human CD9 (or anti-human CD63 or anti-human HER2) (represented by average fluorescence intensity, i.e., as the average fluorescence intensity increases, the number of grafts increases). (4) Statistical analysis was performed, and the test results were expressed in multiples of fluorescence intensity. In Table 2, comparisons of the grafting number of spherical microparticles (Comparative Example 1), knobby particles (Example 1) and knobby magnetic particles (Example 2) with the same diameter (8.5 μm) is illustrated. Table 3 shows comparisons of the grafting number of spherical microparticles (Comparative Examples 1 to 3) and knobby particles (Examples 1, 3 to 4) with different diameters (i.e., 2.5, 4.5, 8.5 μm). Table 4 shows comparisons of the grafting number of spherical microparticles (Comparative Examples 1 to 3) and knobby particles (Examples 1, 3 to 4) with the same diameter (i.e., 2.5, 4.5, 8.5 μm).
TABLE-US-00002 TABLE 2 comparison of the number of grafted first specific antibodies (anti-human CD9, anti-human CD63 or Anti-Human Her2) in Comparative Example 1, Example 1 and Example 2 Multiples of fluorescence intensity Example 1/ Example 2/ First specific Comparative Example 1 Example 1 antibody (diameter: 8.5 μm) (diameter: 8.5 μm) Anti-Human CD9 ~1.71 ~2.24 Anti-Human CD63 ~4.55 — Anti-Human Her2 — ~3.81
[0076] According to the results in Table 2, when the first specific antibody is anti-human CD9, the number of grafts in Example 1 is about 1.71 times that in Comparative Example 1. When the first specific antibody is anti-human CD63, the number of grafts in Example 1 is about 4.55 times that in Comparative Example 1. That is, whether the first specific antibody is anti-human CD9 or anti-human CD63, the number of grafts in Example 1 is greater than the number of grafts in Comparative Example 1. Therefore, compared with a general spherical microparticle, the knobby particle of this disclosure is significantly coupled with more first specific antibodies.
[0077] In addition, when the first specific antibody is anti-human CD9, the number of grafts in Example 2 is about 2.24 times that in Example 1. When the first specific antibody is anti-human HER2, the number of grafts in Example 2 is about 3.81 times that in Example 1. That is, whether the first specific antibody is anti-human CD9 or anti-human HER2, the number of grafts in Example 2 is greater than the number of grafts in Example 1. Therefore, compared with the knobby particle of this disclosure, the knobby magnetic particle of this disclosure is significantly coupled with more first specific antibodies.
TABLE-US-00003 TABLE 3 comparison of the number of grafted first specific antibodies (anti-human CD9 or Anti-Human CD63) in Comparative Examples 1 to 3 and Examples 1 and 3 to 4 Multiples of fluorescence intensity Comparative Comparative Example 3/ Example 1/ Example 1/ Example 4/ Example 1/ First specific Comparative Comparative Comparative Comparative Comparative antibody Example 2 Example 2 Example 2 Example 2 Example 2 Anti-Human CD9 ~4.71 ~5.62 ~0.90 ~6.05 ~9.59 Anti-Human CD63 ~1.96 ~1.98 ~0.63 ~3.16 ~9.00
TABLE-US-00004 TABLE 4 comparison of the number of grafted first specific antibodies (anti-human CD9 or Anti-Human CD63) in Comparative Examples 1 to 3 and Examples 1 and 3 to 4 Multiples of fluorescence intensity Example 3/ Example 4/ Example 1/ Comparative Comparative Comparative Example 2 Example 3 Example 1 First specific (diameter: (diameter: (diameter: antibody 2.5 μm) 4.5 μm) 8.5 μm) Anti-Human CD9 ~0.90 ~1.28 ~1.71 Anti-Human CD63 ~0.63 ~1.61 ~4.55
[0078] According to the results in Table 3, whether it is spherical microparticles or knobby particles, when the particle size is larger, the surface area that can be coupled to the first specific antibody increases accordingly, so the grafting number of the first specific antibody can be increased. According to the results in Table 4, compared with spherical microparticles (Comparative Example 3 or Comparative Example 1), knobby particles with similar particle sizes (Example 4 or Example 1) can couple significantly more first-specific antibodies. Compared with the spherical microparticles (Comparative Example 2) with a diameter of about 2.5 μm, the knobby particles (Example 3) with a diameter of about 2.5 μm may be due to uneven surface morphology (please refer to
Embodiment 3: Detection of Surface Antigens on Exosomes of Breast Cancer Cell Lines SKBr3
[0079] In this embodiment, the expression of exosome surface antigens on the surface of exosomes was detected by using a spherical microparticle (Comparative Examples 1, 2 and 3), a knobby particle (Examples 1, 3 and 4), and a knobby magnetic particle (Example 2) coupled with a first specific antibody (anti-human CD9 or anti-human CD63), and using a second specific antibody (anti-human CD9-Alexa488 or anti-human CD81-APC) carrying fluorescent labels. Comparative Example 1 is taken as an example for description. Specifically, Comparative Example 1 coupled with anti-human CD9 (or anti-human CD63) was first mixed with exosomes carrying a variety of exosome surface antigens to allow anti-human CD9 (or anti-human CD63) to recognize and directly bind to CD9 (or CD63) located on the surface of the exosomes to form a first complex. Next, the first complex was mixed with anti-human CD9-Alexa488 (or anti-human CD81-APC) to allow anti-human CD9-Alexa488 (or anti-human CD81-APC) to bind to CD9 (or CD81) on the exosome surface in the first complex and form a second complex. Then, fluorescence signal analysis of the second complex was performed with a flow cytometry analyzer to detect the expression of exosome surface antigens. The exosomes were exosomes purified from breast cancer cell lines (SKBr3). The above-mentioned spherical microparticles included spherical microparticles having an average diameter of about 2.5 μm (Comparative Example 2), spherical microparticles having an average diameter of about 4.5 μm (Comparative Example 3), and spherical microparticles having an average diameter of about 8.5 μm (Comparative Example 1). The above-mentioned knobby particles included knobby particles having an average diameter of about 2.5 μm (Example 3), knobby particles having an average diameter of about 4.5 μm (Example 4), and knobby particles having an average diameter of about 8.5 μm (Example 1). The above-mentioned knobby magnetic particles included knobby magnetic particles having an average diameter of about 8.5 μm (Example 2).
[0080] In this embodiment, the step in which Comparative Examples 1 to 3, Examples 1 and 3 to 4, or Example 2 coupled with anti-human CD9 (or anti-human CD63) was mixed with the exosomes of SKBr3, such that anti-human CD9 (or anti-human CD63) recognized and directly bound to CD9 (or CD63) on the surface of the exosomes to form the first complex is generally as follows: 50 μL (1250 counts) of Comparative Examples 1 to 3, Examples 1 and 3 to 4, or Example 2 was reacted with exosomes of SKBr3 with a volume of 20 to 50 μL, then added into a PBS solution until the total reaction volume was 200 μL, and then mixed and reacted at room temperature for 90 minutes. After the reaction was completed, the first complex containing Comparative Examples 1 to 3 or the first complex of Examples 1 and 3 to 4 was collected by centrifugation at a rotation speed of 10000 rpm for 3 minutes, and the first complex containing Example 2 was collected with a magnet and stayed on the magnet for at least 1 minute. The reaction solution was removed and the first complex was repetitively washed with 200 μL of a PBS solution two times.
[0081] In this embodiment, the step in which the first complex was mixed with anti-human CD9-Alexa488 (or anti-human CD81-APC), such that anti-human CD9-Alexa488 (or anti-human CD81-APC) bound to CD9 (or CD81) on the surface of the exosomes in the first complex and formed the second complex is generally as follows: 100 μL of anti-human CD9-Alexa488 (or anti-human CD81-APC) was added into the first complex. Then, at room temperature, the mixing was performed with a vortex mixer at a rotation speed of 1500 rpm for reaction for 30 minutes to form the second complex. After the reaction was completed, the second complex containing Comparative Examples 1 to 3 or the second complex containing Examples 1 and 3 to 4 was collected by centrifugation at a rotation speed of 10000 rpm for 3 minutes, and the second complex containing Example 2 was collected with a magnet and stayed on the magnet for at least 1 minute. The reaction solution was removed and the second complex was repetitively washed with 200 μL of a PBS solution two times.
[0082] In this embodiment, the step in which fluorescence signal analysis was performed on the second complex to detect the expression of exosome surface antigens is generally as follows: 100 μL of a PBS solution is added to the washed second complex (i.e., the second complex containing Comparative Example 1, the second complex containing Example 1, or the second complex containing Example 2), and fluorescence signal analysis was performed with a flow cytometry analyzer to detect the expression (i.e., average fluorescence intensity) of exosome surface antigens. The results are as shown in
[0083]
[0084]
[0085] It should be noted that according to
[0086]
[0087] According to the results of
[0088]
[0089] According to the results of
Embodiment 4: Detection of the Exosome Surface Antigen on Breast Cancer Cell Lines SKBr3
[0090] , the CD63 expression of the exosomes is represented by the symbol ◯, and the CD81 expression of the exosomes is represented by the symbol Δ.
[0091] According to the results of
[0092] , the CD63 expression of the exosomes is represented by the symbol ◯, and the CD81 expression of the exosomes is represented by the symbol Δ.
[0093] According to the results of
[0094] Besides, according to the comparisons of the results of
[0095] In addition, according to the combined results of
Embodiment 5: Detection of Exosome Surface Antigens on Clinical Specimens
[0096]
[0097] According to the results of
Embodiment 6: Nucleic Acid Detection
Method of Probe Coupling
[0098] In this embodiment, a probe (avian influenza virus (AIV) probe) was first coupled to the knobby magnetic particle of this disclosure. Next, a biotin-labeled nucleic acid sequence (AB nucleic acid to be analyzed or AIV nucleic acid to be analyzed) was added for analysis.
[0099] In this embodiment, the AIV probe has a nucleic acid sequence of sequence identification number: 1, the AB nucleic acid to be analyzed has a nucleic acid sequence of sequence identification number: 2, and the AIV nucleic acid to be analyzed has a nucleic acid sequence of sequence identification number: 3. The sequences are shown in detail in the table below.
TABLE-US-00005 AIV probe 5′-gtctacgctgcagtcctcgctcactgggca (SEQ ID NO: 1) AB nucleic acid to be 5′-aaaaaaaaaaaaaatcctggagctaagtccgta analyzed (SEQ ID NO: 2) AIV nucleic acid to be 5′-caagaccaatcctgtcacctctgactaaggggattttagggtttgtgttcacgctc analyzed accgtgcccagtgagcgaggactgcagcgtagac (SEQ ID NO: 3)
[0100] In this embodiment, the step in which the AIV probe was coupled to the knobby magnetic particle is as follows: (1) 1×10.sup.6 counts of knobby magnetic particles surface-modified with amine groups were washed with 200 μL of a MES buffer solution three times. Next, 20 mg of EDC, 20 mg of NHS, and 4 mg of PAA were dissolved in 400 μL of a MES buffer solution and mixed with the washed knobby magnetic particles. Then, at room temperature, the mixing was performed with a vortex mixer at a rotation speed of 1000 rpm for reaction for 30 minutes. Next, the knobby magnetic particles were collected with a magnet and stayed on the magnet for at least 1 minute. The reaction solution was removed and the knobby magnetic particles were repetitively washed with 200 μL of a MES buffer solution three times, then added with 20 μL of AIV probes into 80 μL of a PBS solution, and then reacted at room temperature at a rotation speed of 1000 rpm for 2 hours. (2) After the reaction was completed, the knobby magnetic particles were collected with a magnet and stayed on the magnet for at least 1 minute. The reaction solution was removed, the knobby magnetic particles were washed with a Tris solution (25 mM of Tris, pH 7.4) three times for at least 1 minute each time. Lastly, the knobby magnetic particles coupled with the AIV probe are dispersed in 1004 of a Tris solution. (3) The concentration of the knobby magnetic particles was calculated by using an automated cell counter, and knobby magnetic particles coupled with AIV probes on the surface with a concentration of about 3 to 8×10.sup.6/mL were obtained.
Nucleic Acid Detection Performed With Knobby Magnetic Particles Coupled With Probes
[0101] In this embodiment, the step in which the AB nucleic acid to be analyzed or the AIV nucleic acid to be analyzed, carrying biotin, was detected by using the knobby magnetic particles coupled with the AIV probe is generally as follows: (1) 30 μL of a hybridization solution (TEGO hybridization solution) was mixed with 30 μL of a solution of AB nucleic acids to be analyzed or AIV nucleic acids to be analyzed, carrying biotin, with different concentrations (0.05 μm, 0.1 μm, 0.5 μm, 5μM, 10 μm). Next, 50 μL (1250 counts) of the knobby magnetic particles coupled with the AIV probe on the surface were added, and mixing was performed at 60° C. with a vortex mixer at a rotation speed of 1000 rpm for reaction for 30 minutes. Matching and binding with specificity were performed between the AIV nucleic acid to be analyzed carrying biotin and the AIV probe in the knobby magnetic particles coupled with the AIV probe to form the first complex. After the reaction was completed, the knobby magnetic particles were collected with a magnet, and then, after the reaction solution was removed, were washed with 200 μL of a PBS solution two times. (2) 100 μL of an anti-biotin antibody (anti-biotin PE) carrying fluorescent labels were added to the knobby magnetic particles, and mixing was performed for reaction at room temperature for 30 minutes. The anti-biotin antibody carrying fluorescent labels bound to the biotin in the first complex to form the second complex. After the reaction was completed, the knobby magnetic particles were collected with a magnet, and, after the reaction solution was removed, were repetitively washed with 200 μL of a PBS buffer solution (PBS solution, pH 7.4) two times. (3) After washing, 150 μL of a PBS buffer solution was added and fluorescence signal analysis was performed with a flow cytometry analyzer. The results are shown in
[0102] As shown in
[0103] As shown in
[0104] In summary of the foregoing, in the microparticle of the disclosure, by disposing the first protrusions having irregular shapes on the surface of the body, the surface area of the microparticle (i.e., the sum of the surface area of the body and the surface area of the first protrusions) is increased. Accordingly, the microparticle of the disclosure can be coupled with more first ligands to recognize and bind to more targets, and the strength of detection signal can be increased and the detection sensitivity can be improved.
[0105] Besides, in the disclosure, compared to the knobby particle, since the surface of the magnetic substance layer of the knobby magnetic particle is a rough surface (or has small protrusions), the surface (i.e., the surface of the body and the surface of the first protrusions) of the knobby magnetic particle is also a rough surface. As a result, the knobby magnetic particle has a greater surface area. Further, the knobby magnetic particle can be coupled with more first ligands, and recognize and bind to more targets to increase the strength of detection signal and improve the detection sensitivity. Moreover, since the knobby magnetic particle is magnetic, the detection time can be reduced, and the efficiency and convenience of detection can be improved.