1. Patent Search
  2. Details

COMPOSITIONS AND METHODS FOR THE STABILIZATION OF MICRO-RNA

20220186313 · 2022-06-16

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to the stabilization of micro-RNA molecules. The compositions and methods described herein can advantageously be used for the provision of internal control and standard microRNAs for inclusion into kits, useful for the normalized, relative or absolute quantification of a microRNA in a biological fluid.

    Claims

    1-20. (canceled)

    21. A diagnostic kit comprising one or more container(s) comprising a complex of a synthetic microRNA (miRNA) and a lipid vector, wherein said synthetic miRNA is at a defined concentration.

    22. The diagnostic kit according to claim 21, wherein the kit comprises more than one container.

    23. The diagnostic kit according to claim 22, wherein each container comprises the same synthetic miRNA, said synthetic miRNA being at a different defined concentration in each different containers.

    24. The diagnostic kit according to claim 23, wherein the kit comprises a first container comprising the synthetic miRNA at a defined concentration, and at least a second container comprising the same synthetic miRNA as the first container, wherein the concentration of the synthetic miRNA in the second container is different from its concentration in the first container.

    25. The diagnostic kit according to claim 24, wherein the kit comprises a further third container comprising the synthetic miRNA, wherein the concentration of the synthetic miRNA in the third container is different from its concentration in the first container and from its concentration in the second container.

    26. The diagnostic kit according to claim 22, wherein the kits comprises: one or more container(s) comprising a first synthetic miRNA; and one or more container(s) comprising a second synthetic miRNA different from the first miRNA.

    27. The diagnostic kit according to claim 26, wherein the kit comprises: a first set of containers containing a first synthetic miRNA, wherein said first synthetic miRNA is at a different concentration in each container of the first set of containers; and a second set of containers containing a second synthetic miRNA, wherein said second synthetic miRNA is at a different concentration in each container of the second set of containers.

    28. The diagnostic kit according to claim 21, wherein at least one of the one or more container(s) comprises hsa-miR-34a-5p, hsa-miR-193b-3p, hsa-miR-452-5p, cel-miR39-3p or cel-miR-40-3p.

    29. The diagnostic kit according to claim 21, wherein the lipid vector is selected from cationic lipids, non-cationic lipids and conjugated lipids, lipids conjugated to amino acids, lipids conjugated to peptides, or lipids conjugated to PEG.

    30. The diagnostic kit according to claim 21, wherein the lipid vector comprises a cationic lipid.

    31. The diagnostic kit according to claim 21, wherein the lipid vector is selected from non-cationic lipids and conjugated lipids, lipids conjugated to amino acids, lipids conjugated to peptides, or lipids conjugated to PEG.

    32. The diagnostic kit according to claim 31, wherein the lipid vector further comprises a neutral lipid.

    33. The diagnostic kit according to claim 31, wherein the lipid vector comprises a lipid conjugated to PEG.

    34.The diagnostic kit according to claim 21, said kit comprising one or more container(s) comprising a complex of a synthetic microRNA (miRNA), a lipid vector, and a matrix wherein said synthetic miRNA is at a defined concentration.

    35. A method for the quantification of a miRNA in a biological fluid of a subject comprising quantifying said miRNA in said biological fluid and the miRNA of the kit of claim 21.

    36. The method according to claim 35, wherein quantification is relative or absolute quantification.

    37. The method according to claim 35, wherein quantification is normalized relative or absolute quantification.

    38. The method according to claim 35, wherein the kit is used to establish a standard concentration curve of the miRNA.

    39. The method according to claim 35, wherein the kit is used to spike-in into the biological sample to be tested a defined amount of the synthetic miRNA comprised in a container of the kit.

    40. The method according to claim 35, wherein the biological sample is blood, serum, plasma, urine, saliva or sperm.

    Description

    EXAMPLES

    Invivofectamine®/miRs Complex Preparation

    [0216] Highly purified miRNAs oligoribonucleotides are custom synthesized from IDT (Integrated DNA Technologies Skokie, Ill. USA).

    [0217] Invivofectamine® 3.0 reagent (IVF3001-3005, ThermoFisher Scientific, USA) was used for creating complexes with miRNAs according to manufacturer recommendations (Pub. no. MAN0013651 Rev A.0.pdf). The miRNA/Invivofectamine® (IVF) complex was used without dilution or diluted 6-fold by adding 1 mL PBS (pH 7.4).

    Standards and Internal Controls Preparation

    [0218] To prepare standards miRNAs or internal controls, 5 μL of preparation is added to 1) biological base matrices for standard preparations (i.e. serum or plasma from healthy donors, or other base matrix) or 2) directly to biological samples as internal control.

    [0219] Standards miRNAs, positive controls and internal controls are prepared with synthetic miRNA oligoribonucleotide (i.e. hsa-miR-34a-5p, cel-miR-39-3p, cel-miR-40-3p).

    Small RNA Extraction

    [0220] Samples to be tested are thawed on ice. Vortex gently the biological samples and centrifuge at 6,000×g for 15 minutes.

    [0221] Automated extraction with MagMax mirVana™ on KingFisher™ System (KingFisher™ Flex System, catalog nbr 5400630, ThermoFisher) was carried out according to manufacturers recommendations (KingFisher™_Flex_User_Manual_5400630.pdf, part nbr N07669). MagMax mirVana™ Total RNA Isolation Kit (A27828, ThermoFisher) was used following the user guide (MagMAX mirVana™ Total RNA Isolation Kit (manual extraction) User Guide-Pub. no. MAN0011131-Rev. B.0.pdf).

    Reverse Transcription (RT)

    [0222] Reverse transcription reaction was carried using TaqMan® MicroRNA Reverse Transcription Kit, catalog nbr 4366597 following user manual protocol: TaqMan® Small RNA Assays Protocol (PN 4364031E).pdf, part nbr 4364031 Rev E 01/2011 and Taqman® MicroRNA assay RT primer [60X], catalog nbr 4440888 (large format). Incubations were performed in a Bio-Rad T100 thermo-cycler according to the manufacturer recommendations (Bio-Rad T100 thermal cycler Cat nbr 186-1096.pdf). cDNAs were stored in low binding tubes at −20° C. until further use.

    Quantitative PCR

    [0223] Expression of mature miRNAs was quantified according to the manufacturer's instructions using the Taqman miRNA RT-qPCR Assay 20X and TaqMan Universal Master Mix II, no Uracil-N-Glycosidase (UNG) 2X (Applied Biosystems, Life Technologies, Carlsbad, Calif.) in PCR Plate ThermoFisher 96-well, clear well, semi-skirted, catalog nbr AB-0900. A fixed volume of 5 μL total RNA was used as a template for the qPCR assay using a CFX96TM Real-Time System—C1000—IVD certified according to manufacturer guidelines (Bio-Rad CFX96 Touch_Instruction manual.pdf, part nbr 110021337, Rev E US/EG). The hsa-miR-34a-5p TaqMan assay was used. The RT product from synthetic miRNAs was serially diluted and PCR was performed on all samples (standards and serum-derived RNA). The Cq Determination mode was Regression.

    [0224] The sequences of mature miRNA and Taq Man assay ID are reported in the following table:

    TABLE-US-00005 miRNA ID Sequence miRbase Number Assay ID cel-miR-39-3p UCACCGGGUGUAAAUCAGCUUG MIMAT0000010 000200 (SEQ ID NO: 1) hsa-miR-34a-5p UGGCAGUGUCUUAGCUGGUUGU MIMAT0000255 000426 (SEQ ID NO: 2)

    RESULTS

    A. The Complexation of Invivofectamine® With hsa-miR-34a-5p Protects the Synthetic miRNA From Degradation

    [0225] FIG. 1: invivofectamine® protects the synthetic hsa-miR-34a-5p oligoribonucleotide spiked in serum.

    [0226] hsa-miR-34a-5p expression levels in the absence (A) or the presence (B) of Invivofectamine®. Black box: pool of serum from healthy donors with very low levels of hsa-miR-34a used as a biological base matrix, Grey Box: base matrix spiked with synthetic hsa-miR-34a-5p without invivofectamine® (IVF) before or after denaturation. White box: base matrix spiked with synthetic hsa-miR-34a-5p encapsulated in IVF.

    [0227] hsa-miR-34a-5p is detected in healthy patients (Matrix) at very low levels (33.6 Cq). The addition of a synthetic hsa-miR-34a-5p used as spike-in after addition of denaturating buffer in serum results in an induction (23.3 Cq). The synthetic miRNA is degraded if the addition occurs before the treatment of serum with the denaturating buffer (Matrix+hsa-miR-34a-5p). Interestingly, the combination of invivofectamine® with hsa-miR-34a-5p before the 1:6 dilution restores the miRNA level detected when the spike-in miRNA is added after denaturating buffer. The complex miRNA/invivofectamine® may be used with the 1/6 diluted complex (FIG. 1).

    [0228] FIG. 2: miRNA/invivofectamine complex stability at 4° C. up to 4 hrs.

    [0229] Two miRNA/invivofectamine® complex preparation conditions were tested: temperature 4° C. (black boxes) versus room temperature (RT, white boxes) and time between complex preparation and its use (0, 1 and 4 hours). Matrix: pool of serum from healthy donors (Etablissement Français du Sang: EFS) with very low levels of hsa-miR-34a-5p.

    [0230] At room temperature, the hsa-miR-34a-5p levels decrease in matrix and in matrix with spike in hsa-miR-34a-5p. The levels remain constant at 4° C. This result suggests that spike-in procedure in blood derived samples may be delayed at 4° C. after miRNA/invivofectamine® complex preparation (FIG. 2).

    [0231] FIG. 3: Invivofectamine® protects the synthetic hsa-miR-34a-5p oligoribonucleotide spiked in serum at 4° C. up to 4 weeks.

    [0232] The hsa-miR-34a-5p levels are stable in the spiked serum with the hsa-miR-34a-5p/invivofectamine® complex up to 4 weeks at 4° C. (FIG. 3).

    [0233] FIG. 4: Synthetic miRNA stability in serum when combined with invivofectamine® after repetitive freeze-thaw cycles at −20° C.

    [0234] 5 freeze/thaw cycles were tested. Hsa-miR-34a-5p levels are not affected by repetitive freeze/thaw cycles at −20° C. when the synthetic miRNA is combined with invivofectamine®.

    B. Robustness of the hsa-miR-34a-5p Assay Using miRs/IVF Complexes

    [0235]

    TABLE-US-00006 TABLE 1 Intra- and inter-assay variabilities of hsa-miR-34a-5p measured using the standard positive control (n = 12 for each test condition) and cel-miR-39-3p/IVF complex as an internal control (spiked in each sample). Intra-Assay Variability Inter-Assay Variability Experiment #1 Experiment #2 Experiment #1 + 2 Cel-miR- hsa-miR- Cel-miR- hsa-miR- Cel-miR- hsa-miR- 39-3p 34a-5p 39-3p 34a-5p 39-3p 34a-5p 4° C. −80° C. 4° C. −80° C. 4° C. −80° C. 4° C. −80° C. 4° C. −80° C. 4° C. −80° C. Mean 28.30 28.13 31.40 31.25 28.34 28.07 31.38 31.17 28.32 28.10 31.39 31.21 (Cq) SD (Cq) 0.12 0.08 0.28 0.26 0.19 0.12 0.42 0.24 0.15 0.10 0.35 0.25 CV (%) 0.41 0.28 0.89 0.84 0.66 0.41 1.33 0.78 0.54 0.36 1.11 0.81 Mean 1.01 1.12 1.02 1.17 1.02 1.15 (fold) SD (fold) 0.16 0.17 0.23 0.16 0.2 0.17 CV (%) 16.01 15.47 22.37 13.92 19.31 14.41 Samples were incubated at 4° C. for 4 h or direct freezing at −80° C. Data are expressed as mean of Cq +/− SD or as fold hsa-miR-34a-p level expression using the following formula: hsa-miR-34a-p levels = 2.sup.−ΔΔCq Where: ΔΔCq = ΔCq.sub.sample − ΔCq.sub.Standard ΔCq.sub.sample = Cq.sub.hsa-miR-34a-5p of the sample − Cq.sub.cel-miR-39-3p spiked in the samples ΔCq.sub.standard = Cq.sub.hsa-miR-34a-5p of the positive standard − Cq.sub.cel-miR-39-3p spiked in the positive standard

    [0236] Positive standards are pooled serum from NASH patients, n=12.

    [0237] The spike-in miRNA is a non-human miRNA: cel-miR-39-3p at Cq=28. Invivofectamine® is used at ratio of cel-miR-39-3p/IVF=100/100.

    [0238] After preparation, the complex IVF/cel-miR-39 is incubated at 4° C. for 4 h or directly freezed at −80° C. CV are not significantly different between conditions. The normalized quantification of hsa-miR-34a-5p remains stable and reproducible between conditions.

    [0239] The internal control production is robust.

    TABLE-US-00007 TABLE 2 Comparison of hsa-miR-34a-5p measurement variability using the standard positive control (n = 12 for each test condition) and cel-miR-39-3p/IVF or Cel-miR-40-3p/IVF complex as internal controls (spiked in each sample). Data are expressed as mean of Cq +/− SD or as fold hsa-miR- 34a-5p level. Internal Control = Cel-miR-39-3p in IVF hsa-miR-34a-5p (Cq) Cel-miR-39-3p (Cq) hsa-miR-34a-5p (fold = 2.sup.−ΔΔCq) Mean 31.43 28.24 1.01 Sd  0.61  0.54 0.15 CV 1.93% 1.91% 14.60% Internal Control = Cel-miR-40-3p in IVF hsa-miR-34a-5p (Cq) Cel-miR-40-3p (Cq) hsa-miR-34a-5p (fold = 2.sup.−ΔΔCq) Mean 31.37 28.23 1.01 Sd  0.84  0.81 0.11 CV 2.69% 2.87% 10.90%

    C. Performances of the hsa-miR-34a-5p Assay

    [0240] Standard and internal controls were used to evaluate the performances of the hsa-miR-34a-5p assay in NASH patients.

    [0241] FIG. 5: ROC curve of hsa-miR-34a-5p with internal control (A) or without internal control (B) in clinical cohort with NASH diseased patients (n=562 patients, NTBT=271 patients and TBT=291 patients). Target condition to be classified as TBT was NAS≥4+F≥2.

    [0242] The serum of 562 patients of the RESOLVE-IT study with corresponding liver biopsy was processed for the validation of the assay with an internal control. Serum samples from all patients were used to evaluate the performances of hsa miR-34a-5p assay using internal control (Cel-miR-40-3p) complexed to IVF and then compared of the test to the hsa-miR-34a-5p assay without the use of internal control. Patients were divided into 2 groups: group#1: Not To be Treated (NTBT) patients, with NAS score <4 and fibrosis <2 and group#2: To be Treated Patients (TBT), with NAS score ≥4 and fibrosis ≥2. Patients with NAS score 4 to 6 and fibrosis grade from 1 to 3 were the more representative of this clinical cohort. Patients with target condition (TBT: NAS≥4+F≥2) represent 51.8% of total cohort population.

    TABLE-US-00008 TABLE 3 Area under the curve characteristics to diagnose TBT patients with NAS ≥4 and F ≥2. With Internal Without Internal Condition Control Control Area 0.8108 0.7838 Std. Error 0.01813 0.01935 95% confidence interval 0.7753 to 0.8463 0.7458 to 0.8217 P value <0.0001 <0.0001 Data Controls (NTBT2) 271 271 Patients (TBT2) 291 291 Missing Controls 0 0 Missing Patients 0 0

    [0243] The AUROC for hsa-miR-34a-5p assay using the internal control was 0.81 (95% CI 0.77-0.85) and the AUROC for hsa-miR-34a-5p assay where the internal control was not used represents only 0.78 (95% CI 0.74-0.82) indicating that hsa-miR-34a-5p assay using the internal control performs significantly better than the assay without internal control (FIG. 5). Taken together all these data indicates that the hsa-miR-34a-5p assay is more specific and sensitive when Cel-miR-40-3p/IVF complex is used to quantify hsa-miR-34a-5p as a marker for the NASH disease.

    C) Comparison Invivofectamine®/Lipofectamine

    [0244] a- Invivofectamine® or Lipofectamine/miRs complex preparation

    [0245] Highly purified miRs mimic oligoribonucleotides are custom synthesized from IDT (Integrated DNA Technologies Skokie, Ill. USA). For in vitro testing as standards or internal controls, 100 μL of miRs mimic solution is prepared by mixing 50 μL miRs in RNase-free water (ref 733-2573, VWR) with 50 μL of complexation buffer (Invivofectamine® 3.0 reagent (IVF3001-3005, ThermoFisher Scientific). For example, use miR at 12.5 fmol/ml to prepare Control 28 Cqs, miR at 2.5 fmol/ml to prepare Control 30 Cqs and miR at 0.5 fmol/ml to prepare 33 Cqs. Afterwards, diluted miRs are immediately added to 20 μL of invivofectamine® 3.0 or Lipofectamine (life Technologies Carlsbad, Calif., USA) previously brought to room temperature. Invivofectamine® (or Lipofectamine) and diluted miRs are then vortexed for 3 seconds to ensure miRs-IVF 3.0 (or miRs-Lipofectamine) complex formation. Next, the invivofectamine® (or Lipofectamine)-miRs mixture is incubated for 30 min at 50° C. and finally, the complex is diluted 6-fold by adding 1 mL PBS (pH 7.4) to obtain a final concentration respectively of 0.52 fmol/ml, 104 amol/and 20.8 amol/ml for Control 28 Cqs, 30 Cqs and 33 Cqs. The preparation is conserved frozen at −20° C. in aliquots.

    [0246] To prepare standards miRs or internal controls, 5 μL of preparation are added to 1) biological base matrices for standard preparations (i.e. serum or plasma from healthy donors, or commercially available base matrices) or 2) directly to biological samples as internal control.

    Comparison Invivofectamine®/Lipofectamine Complex Conditions

    [0247] Several Invivofectamine®/hsa-miR-34-a-5p or Lipofectamine /hsa-miR-34-a-5p complex preparation conditions were tested: temperature; (4° C. versus room temperature) and time between complex preparation and its use (0, 1 and 4 hours). The matrix is a pool of serum from healthy donors with very low levels of hsa-miR-34a-5p. The standard RNA is a pool of RNA with a known hsa-miR-34a-5p levels. All Data are expressed as mean qPCR amplification cycles (Cq) +/−SD with n=3. ND: Not detectable.

    [0248] FIG. 6: Invivofectamine® (IVF)/hsa-miR-34-a-5p complex condition preparations.

    [0249] Temperature; 4° C. (black boxes), room temperature (RT, white boxes). Time between complex preparation and its use was also tested (0, 1 and 4 hours).

    [0250] NRT: No Reverse Transcriptase control, NTC: No Template Control, Negative Control: PCR blank. All Data are expressed as mean qPCR amplification cycles (Cq) +/−SD with n=3. ND: Not detectable.

    [0251] FIG. 7: Lipofectamine/hsa-miR-34-a-5p complex condition preparations.

    [0252] Temperature ; 4° C. (black boxes), room temperature (RT, Grey boxes). Time between complex preparation and its use (0, 1 and 4 hours).

    [0253] NRT: No Reverse Transcriptase control, NTC: No Template Control, Negative Control: PCR blank. All Data are expressed as mean qPCR amplification cycles (Cq) +/−SD with n=3. ND: Not detectable.

    [0254] Conclusion: In all conditions (temperature and time), no protection of miR-34a-5p was observed with Lipofectamine. On the contrary, the use of Invivofectamine® protects the complex matrix+hsa-miR34a-5p.