SPLIT PHOTOACTIVE YELLOW PROTEIN COMPLEMENTATION SYSTEM AND USES THEREOF

Abstract

A complementation system including two fragments of photoactive yellow protein (PYP), or truncated fragments thereof, and its use with a fluorogenic hydroxybenzylidene rhodanine (HBR) analog for detecting interactions between biological molecules of interest, in particular between proteins of interest. Especially, a complementation system including a first PYP fragment having an amino acid sequence having at least about 70% identity with the amino acid sequence of SEQ ID NO: 23, or a truncated fragment thereof including at least 89 consecutive amino acids from the C-terminal end of the amino acid sequence; and a second PYP fragment having an amino acid sequence having at least about 70% identity with the amino acid sequence of SEQ ID NO: 34, or a truncated fragment thereof including at least 8 consecutive amino acids of the amino acid sequence, preferably 8 consecutive amino acids from the N-terminal end of the amino acid sequence.

Claims

1-15. (canceled)

16. A complementation system comprising a first photoactive yellow protein (PYP) fragment and a second photoactive yellow protein (PYP) fragment, wherein: the first PYP fragment comprises an amino acid sequence as set forth in SEQ ID NO: 23, or a truncated fragment thereof, or an amino acid sequence having at least about 70% identity with the amino acid sequence as set forth in SEQ ID NO: 23, or a truncated fragment thereof, wherein said truncated fragment comprises at least 89 consecutive amino acids from the C-terminal end of the amino acid sequence as set forth in SEQ ID NO: 23 or of an amino acid sequence having at least about 70% identity with SEQ ID NO: 23; and the second PYP fragment comprises an amino acid sequence as set forth in SEQ ID NO: 34, or a truncated fragment thereof, or an amino acid sequence having at least about 70% identity with the amino acid sequence as set forth in SEQ ID NO: 34, or a truncated fragment thereof, wherein said truncated fragment comprises at least 8 consecutive amino acids of the amino acid sequence as set forth in SEQ ID NO: 34 or of an amino acid sequence having at least about 70% identity with SEQ ID NO: 34.

17. The complementation system according to claim 16, wherein the first PYP fragment comprises an amino acid sequence selected from the group consisting of the amino acid sequences as set forth in SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, and SEQ ID NO: 29, and truncated fragments thereof comprising at least 89 consecutive amino acids from the C-terminal end of said amino acid sequences.

18. The complementation system according to claim 16, wherein the second PYP fragment has an amino acid sequence selected from the group consisting of the amino acid sequences as set forth in SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, and SEQ ID NO: 40, and truncated fragments thereof comprising at least 8 consecutive amino acids of said amino acid sequences.

19. The complementation system according to claim 16, wherein the first PYP fragment comprises an amino acid sequence as set forth in SEQ ID NO: 23, or a truncated fragment thereof comprising at least 89 consecutive amino acids from the C-terminal end of said amino acid sequence and the second PYP fragment comprises an amino acid sequence as set forth in SEQ ID NO: 34, SEQ ID NO: 42, SEQ ID NO: 43, or SEQ ID NO: 44.

20. The complementation system according to claim 16, wherein the amino acid sequence of the first PYP fragment, or a truncated fragment thereof comprising at least 89 consecutive amino acids from the C-terminal end of said amino acid sequence, further comprises at least one of the following amino acid substitutions with reference to SEQ ID NO: 23: an asparagine at position 19, a leucine at position 62, a cysteine or a glutamic acid at position 68, an arginine at position 71, a serine at position 73, and/or an isoleucine a position 107; and/or wherein the amino acid sequence of the second PYP fragment, or a truncated fragment thereof comprising at least 8 consecutive amino acids of said amino acid sequence, further comprises the following amino acid substitution with reference to SEQ ID NO: 34: an isoleucine at position 8.

21. The complementation system according to claim 16, further comprising a fluorogenic hydroxybenzylidene rhodanine (HBR) analog of formula (I): ##STR00003## wherein R1, R2, R5 and R6 may be identical or different and each represents H, halo, hydroxyl, aryl, alkyl, cycloalkyl, heteroalkyl or heterocycloalkyl group, saturated or unsaturated, linear or branched, optionally substituted by at least one group selected from halo, hydroxyl, oxo, nitro, amido, carboxy, amino, cyano, haloalkoxy, haloalkyl; R3 represents a non-binding doublet (i.e., a free pair of electrons) or H, halo, hydroxyl, aryl, alkyl, cycloalkyl, heteroalkyl or heterocycloalkyl group, saturated or unsaturated, linear or branched, optionally substituted by at least one group selected from halo, hydroxyl, oxo, nitro, amido, carboxy, amino, cyano, haloalkoxy, haloalkyl; R4 is a single or a double bound, interrupted or terminated by S, O or N atom, optionally substituted by at least one group selected from H, hydroxyl, aryl, alkyl, cycloalkyl, heteroalkyl or heterocycloalkyl group, saturated or unsaturated, linear or branched, optionally substituted by at least one group selected from halo, hydroxyl, oxo, nitro, amido, carboxy, amino, cyano, haloalkoxy, haloalkyl; X is OH, SH, NHR7, or N(R7).sub.2, wherein R7 is H, halo, hydroxyl, aryl, alkyl, cycloalkyl, heteroalkyl or heterocycloalkyl group, saturated or unsaturated, linear or branched, optionally substituted by at least one group selected from halo, hydroxyl, oxo, nitro, amido, carboxy, amino, cyano, haloalkoxy, haloalkyl; and Y is O, NH or S.

22. The complementation system according to claim 21, wherein the fluorogenic hydroxybenzylidene rhodanine (HBR) analog is selected from the group consisting of 4-hydroxy-3-methylbenzylidene rhodanine (HMBR), (Z)-2-(5-(4-hydroxy-3-methoxybenzylidene)-4-oxo-2-thioxothiazolidin-3-yl)acetic acid (HBR-3OM), (Z)-2-(5-(4-hydroxy-3, 5-dimethylbenzylidene)-4-oxo-2-thioxothiazolidin-3-yl) acetic acid (HBR-3,5DM), and (Z)-2-(5-(4-hydroxy-3, 5-dimethoxybenzylidene)-4-oxo-2-thioxothiazolidin-3-yl) acetic acid (HBR-3,5DOM).

23. A kit comprising at least one vector comprising: a first nucleic acid sequence encoding the first photoactive yellow protein (PYP) fragment, or a truncated fragment thereof; and a second nucleic acid sequence encoding the second photoactive yellow protein (PYP) fragment, or a truncated fragment thereof, wherein first photoactive yellow protein (PYP) fragment, or truncated fragment thereof, and the second photoactive yellow protein (PYP) fragment, or truncated fragment thereof, are as defined in claim 16.

24. The kit according to claim 23, wherein the kit comprises two vectors with: the first vector comprising the first nucleic acid sequence encoding the first photoactive yellow protein (PYP) fragment, or a truncated fragment thereof; and the second vector comprising the second nucleic acid sequence encoding the second photoactive yellow protein (PYP) fragment, or a truncated fragment thereof.

25. The kit according to claim 23, further comprising a fluorogenic hydroxybenzylidene rhodanine (HBR) analog of formula (I): ##STR00004## wherein R1, R2, R5 and R6 may be identical or different and each represents H, halo, hydroxyl, aryl, alkyl, cycloalkyl, heteroalkyl or heterocycloalkyl group, saturated or unsaturated, linear or branched, optionally substituted by at least one group selected from halo, hydroxyl, oxo, nitro, amido, carboxy, amino, cyano, haloalkoxy, haloalkyl; R3 represents a non-binding doublet (i.e., a free pair of electrons) or H, halo, hydroxyl, aryl, alkyl, cycloalkyl, heteroalkyl or heterocycloalkyl group, saturated or unsaturated, linear or branched, optionally substituted by at least one group selected from halo, hydroxyl, oxo, nitro, amido, carboxy, amino, cyano, haloalkoxy, haloalkyl; R4 is a single or a double bound, interrupted or terminated by S, O or N atom, optionally substituted by at least one group selected from H, hydroxyl, aryl, alkyl, cycloalkyl, heteroalkyl or heterocycloalkyl group, saturated or unsaturated, linear or branched, optionally substituted by at least one group selected from halo, hydroxyl, oxo, nitro, amido, carboxy, amino, cyano, haloalkoxy, haloalkyl; X is OH, SH, NHR7, or N(R7).sub.2, wherein R7 is H, halo, hydroxyl, aryl, alkyl, cycloalkyl, heteroalkyl or heterocycloalkyl group, saturated or unsaturated, linear or branched, optionally substituted by at least one group selected from halo, hydroxyl, oxo, nitro, amido, carboxy, amino, cyano, haloalkoxy, haloalkyl; and Y is O, NH or S.

26. The kit according to claim 25, wherein the fluorogenic hydroxybenzylidene rhodanine (HBR) analog is selected from the group consisting of 4-hydroxy-3-methylbenzylidene rhodanine (HMBR), (Z)-2-(5-(4-hydroxy-3-methoxybenzylidene)-4-oxo-2-thioxothiazolidin-3-yl)acetic acid (HBR-3OM), (Z)-2-(5-(4-hydroxy-3, 5-dimethylbenzylidene)-4-oxo-2-thioxothiazolidin-3-yl) acetic acid (HBR-3,5DM), and (Z)-2-(5-(4-hydroxy-3, 5-dimethoxybenzylidene)-4-oxo-2-thioxothiazolidin-3-yl) acetic acid (HBR-3,5DOM).

27. A method for detecting an interaction between two biological molecules of interest in a sample, comprising the steps of: fusing a first photoactive yellow protein (PYP) fragment, or a truncated fragment thereof, to a first biological molecule of interest, thereby tagging the first biological molecule of interest with said first PYP fragment; fusing a second photoactive yellow protein (PYP) fragment, or a truncated fragment thereof, to a second biological molecule of interest, thereby tagging the second biological molecule of interest with said second PYP fragment; contacting the sample with a fluorogenic hydroxybenzylidene rhodanine (HBR) analog; and detecting a fluorescence resulting from the binding of the fluorogenic HBR analog to the functional PYP, or a functional truncated fragment thereof, reconstituted upon interaction of the two biological molecules of interest; thereby detecting the interaction of the two biological molecules of interest present in the sample through the binding of the fluorogenic HBR analog to the functional PYP, or a functional truncated fragment thereof, reconstituted upon interaction of the two biological molecules of interest, and wherein first photoactive yellow protein (PYP) fragment, or truncated fragment thereof, and the second photoactive yellow protein (PYP) fragment, or truncated fragment thereof, are as defined in claim 16.

28. The method according to claim 27, wherein the two biological molecules of interest are two proteins of interest.

29. The method according to claim 27, for monitoring over time and/or space the association and dissociation of the two biological molecules of interest, through the detection of the interaction between said biological molecules of interest.

30. The method according to claim 29, wherein the two biological molecules of interest are two proteins of interest.

31. A screening method for identifying a new protein-protein interaction between two protein candidates of interest in a sample, comprising the steps of: fusing a first photoactive yellow protein (PYP) fragment, or a truncated fragment thereof, to a first protein candidate of interest, thereby tagging the first protein candidate of interest with said first PYP fragment; fusing a second photoactive yellow protein (PYP) fragment, or a truncated fragment thereof, to a second protein candidate of interest, thereby tagging the second protein candidate of interest with said second PYP fragment; contacting the sample with a fluorogenic hydroxybenzylidene rhodanine (HBR) analog; and detecting a fluorescence resulting from the binding of the fluorogenic HBR analog to the functional PYP, or a functional truncated fragment thereof, reconstituted upon interaction of the two protein candidates of interest; thereby identifying a new protein-protein interaction between the two protein candidates of interest present in the sample, through the binding of the fluorogenic HBR analog to the functional PYP, or a functional truncated fragment thereof, reconstituted upon interaction of the two protein candidates of interest, and wherein first photoactive yellow protein (PYP) fragment, or truncated fragment thereof, and the second photoactive yellow protein (PYP) fragment, or truncated fragment thereof, are as defined in claim 16.

32. An assay relying on the detection of the interaction between two proteins in a sample, said assay comprising the steps of: obtaining a first tagged protein, wherein the protein is tagged with a first photoactive yellow protein (PYP) fragment, or a truncated fragment thereof; obtaining a second tagged protein, wherein the protein is tagged with a second photoactive yellow protein (PYP) fragment, or a truncated fragment thereof; contacting the sample with a fluorogenic hydroxybenzylidene rhodanine (HBR) analog; and detecting a fluorescence resulting from the binding of the fluorogenic HBR analog to the functional PYP, or a functional truncated fragment thereof, reconstituted upon interaction of the two proteins; thereby detecting the interaction of the two proteins present in the sample, through the binding of the fluorogenic HBR analog to the functional PYP, or a functional truncated fragment thereof, reconstituted upon interaction of the two proteins, and wherein first photoactive yellow protein (PYP) fragment, or truncated fragment thereof, and the second photoactive yellow protein (PYP) fragment, or truncated fragment thereof, are as defined in claim 16.

33. The assay according to claim 32, wherein said assay is for assessing the capacity of a molecule of interest to stabilize or to inhibit protein-protein interactions.

34. The assay according to claim 32, wherein said assay is for assessing a signaling pathway of interest, with the interaction of the two proteins depending on the activation of the signaling pathway of interest; or is for assessing the capacity of a molecule of interest to modulate said signaling pathway of interest.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0506] FIGS. 1A-B are a schematic representation of the working principle (FIG. 1A) and design (FIG. 1B) of the fluorescence complementation system of the invention. N and C represent the first and second PYP fragments according to the invention, respectively, able to interact and thus to reconstitute a functional PYP that can reversibly bind a fluorogen and turn on its fluorescence; X and Y represent the potentially interacting protein(s) of interest, to which the PYP fragments are fused. FAST corresponds to the PYP consisting of the amino acid sequence as set forth in SEQ ID NO: 9. NFAST corresponds to the first PYP fragment according to the invention consisting of the amino acid sequence as set forth in SEQ ID NO: 23. CFAST11 corresponds to the second PYP fragment according to the invention consisting of the amino acid sequence as set forth in SEQ ID NO: 34. CFAST10 corresponds to the second PYP fragment according to the invention consisting of the amino acid sequence as set forth in SEQ ID NO: 42. Split-FAST corresponds to the reconstituted functional PYP, i.e., FAST, resulting from the complementation of the two FAST fragments, NFAST and either CFAST11 or CFAST10.

[0507] FIG. 2A-C are a set of graphs showing the normalized excitation and emission spectra of complexes formed of either FAST or split-FAST and the fluorogenic HBR analog HMBR: FAST:HMBR (FIG. 2A), splitFAST11:HMBR (FIG. 2B), and splitFAST10:HMBR (FIG. 2C). split-FAST11 results from the complementation of NFAST and CFAST11; split-FAST10 results from the complementation of NFAST and CFAST10.

[0508] FIG. 3A-D are a set of graphs showing the flow cytometry analysis of E. coli cells expressing the indicated fusion proteins in absence or presence of the fluorogenic HBR analog HMBR: E3-CFAST(65-125)+NFAST(1-64)-K3 (FIG. 3A), E3-CFAST(115-125)+NFAST(1-114)-K3 (FIG. 3B), K3-NFAST(1-64)+CFAST(65-125)-E3 (FIG. 3C), and K3-NFAST(1-114)+CFAST(115-125)-E3 (FIG. 3D). K3 and E3 are two proteins interacting with high affinity.

[0509] FIG. 4A-D are a set of histograms showing the relative in-cell brightness of various split-FAST with different fluorogenic HBR analogs as indicated (FIG. 4A: HMBR, FIG. 4B: HBR-3,5DM, FIG. 4C: HBR-3OM, and FIG. 4D: HBR-3,5DOM) in function of the C-terminal fragment CFASTn (n=11, 10 or 9) and the N-terminal fragment used. The iFAST label indicates when NFAST from iFAST (i.e., the first PYP fragment according to the invention consisting of the amino acid sequence NFAST with an isoleucine at position 107 instead of a valine as set forth in SEQ ID NO: 30) was used. If absent, NFAST from FAST was used (i.e., the first PYP fragment according to the invention consisting of the amino acid sequence as set forth in SEQ ID NO: 23). CFAST11, CFAST10 and CFAST9 correspond to the second PYP fragment according to the invention consisting of the amino acid sequence as set forth in SEQ ID NO: 34, SEQ ID NO: 42 and SEQ ID NO: 43, respectively. NFAST fragments were fused to FRB and CFAST fragments were fused to FKBP. Complementation was induced by addition of rapamycin. Split-FAST fluorescence was normalized by expression level using the fluorescence of co-expressed fluorescent proteins.

[0510] FIG. 5A-G illustrate the detection of rapamycin-induced FRB-FKBP dimerization with the complementation system of the invention. FIG. 5A-B show HEK293T cells co-expressing FKBP-NFAST and FRB-CFASTn (n=10 or 11) which were labeled with 5 μM HMBR (FIG. 5A) or 10 μM HBR-3,5DOM (FIG. 5B) and imaged before and after addition of 100 nM rapamycin. Scale bars 10 μm. FIG. 5C shows the fluorescence fold increase upon FKBP-FRB association (mean±sem, n=84, 83, 107, 112 cells respectively from 3-4 experiments). FIG. 5D shows the temporal evolution of the fluorescence intensity after rapamycin addition in HMBR-treated cells co-expressing FKBP-NFAST and FRB-CFAST11 (n=11 cells). FIG. 5E shows the evolution of the cellular fluorescence of HMBR-labeled HEK293 cells expressing FAST, split-FAST11 (resulting from the complementation of NFAST and CFAST11), and split-FAST10 (resulting from the complementation of NFAST and CFAST10) upon imaging by confocal microscopy. Cells expressing FRB-NFAST and FKBP-CFASTn (n=10 or 11) were treated with rapamycin to form split-FAST11 and split-FAST10. Cells expressing FAST were used as control. HMBR concentration was 10 μM. Excitation at 488 nm at 6.3 kW/cm2. Six cells were analyzed per condition. FIG. 5F shows selected time lapse frames of representative HEK293 cells co-expressing FKBP-NFAST and FRB-CFASTn (n=10 or 11) (labeled with 5 μM HMBR) upon addition of 100 nM rapamycin. Scale bars 20 μm. FIG. 5G shows selected frames of representative HEK293 cells co-expressing FKBP-NFAST and FRB-CFAST11 (labeled with 10 μM HBR-3,5DOM) upon addition of 100 nM rapamycin. Scale bars 20 μm.

[0511] FIG. 6A-F illustrate the detection of rapamycin-induced dissociation of AP1510-induced FKBP homodimers with the complementation system of the invention. FIG. 6A-B show AP1510-treated HEK293T cells co-expressing FKBP-NFAST and FKBP-CFASTn (n=10 or 11) which were labeled with 5 μM HMBR (FIG. 6A) or 10 μM HBR-3,5DOM (FIG. 6B) and imaged before and after addition of 1 μM rapamycin. Scale bars 10 μm. FIG. 6C shows the fluorescence fold decrease upon FKBP-FKBP dissociation (mean±sem, n=142, 175, 219, 125 cells respectively from 3-4 experiments). FIG. 6D shows the temporal evolution of the fluorescence intensity after rapamycin addition in HMBR-labeled, AP1510-treated cells co-expressing FKBP-NFAST and FKBP-CFAST11 (n=8 cells). FIG. 6E shows selected time lapse frames of representative AP1510-treated HEK293 cells co-expressing FKBP-NFAST and FKBP-CFASTn (n=10 or 11) (labeled with 5 μM HMBR) upon addition of 1 μM rapamycin. Scale bars 20 μm. FIG. 6F shows selected time lapse frames of representative AP1510-treated HEK293 cells co-expressing FKBP-NFAST and FKBP-CFAST11 (labeled with 10 μM HBR-3,5DOM) upon addition of 1 μM rapamycin. Scale bars 20 μm.

[0512] FIG. 7A-D illustrate the detection of the dimerization of FKBP-FKBP homodimer and the dissociation of said FKBP-FKBP homodimer with the complementation system of the invention. FIG. 7A shows HMBR-labeled cells co-expressing FKBP-NFAST and FKBP-CFASTn (n=11 or 10) which were first treated with 100 nM AP1510 for 160 min, then AP1510 was removed, and 1 μM rapamycin was added. Selected frames are shown, scale bars: 30 μm. FIG. 7B shows the temporal evolution of the fluorescence intensity upon sequential treatment of HMBR-labeled cells co-expressing FKBP-NFAST and FKBP-CFAST11 with AP1510 and then rapamycin (n=8 cells). FIG. 7C-D show HMBR-labeled cells co-expressing FKBP-NFAST and FKBP-CFASTn (n=11 (FIG. 7C) or n=10 (FIG. 7D)) which were first treated with 100 nM AP1510 for 160 min (association phase), then AP1510 was removed, and 1 μM rapamycin was added (dissociation phase). Selected frames are shown, scale bars 30 μm.

[0513] FIG. 8A-B illustrate the detection of the interaction between a membrane protein and a cytosolic protein with the complementation system of the invention. FIG. 8A shows HEK293T cells co-expressing Lyn11-FRB-NFAST and FKBP-CFASTn (n=10 or 11) which were labeled with 5 μM HMBR and imaged before and after addition of 100 nM rapamycin. Scale bars 10 μm. FIG. 8B shows the temporal evolution of the fluorescence intensity after rapamycin addition in HMBR-treated cells co-expressing Lyn11-FRB-NFAST and FKBP-CFAST11.

[0514] FIG. 9A-D are a set of images illustrating the use of split-FAST for imaging K-Ras/Raf1 (FIG. 9A), MEK1/ERK2 (FIG. 9B) and ERK2/MKP1 (FIG. 9C) interactions. Representative images of cells co-expressing the indicated constructs were imaged in presence of 10 μM HMBR. Scale bar 20 μm. FIG. 9D shows controls relating to the use of split-FAST for imaging K-Ras/Raf1, MEK1/ERK2 and ERK2/MKP1 interactions. Representative cells co-expressing the indicated constructs were imaged in presence of 10 μM HMBR. Positive and negative controls are shown. Scale bars 10 μm. Split-FAST corresponds to the reconstituted functional PYP, i.e., FAST, resulting from the complementation of the two FAST fragments, NFAST and CFAST10.

[0515] FIG. 10A-B illustrate the use of split-FAST for imaging the evolution of MEK1/ERK2 interaction upon EGF stimulation. HMBR-labeled Hela cells co-expressing MEK1-NFAST and mCherry-ERK2-CFAST10 were imaged after stimulation with EGF. FIG. 10A depicts the experimental design. N and C represent the first and second PYP fragments according to the invention, respectively, able to interact and thus to reconstitute a functional PYP that can reversibly bind a fluorogen and turn on its fluorescence. FIG. 10B shows the temporal evolution of split-FAST fluorescence, cytoplasmic mCherry fluorescence and nuclear mCherry fluorescence intensities (mean±sem, n=6 cells, 5 experiments). Data were synchronized using the beginning of the nuclear import of mCherry-ERK2-CFAST10 as reference.

[0516] FIG. 11A-B illustrate the use of split-FAST for imaging of the Ca.sup.2+-dependent interaction of calmodulin (CaM) and the Ca.sup.2+-CaM-interacting peptide M13. FIG. 11A depicts the experimental design. N and C represent the first and second PYP fragments according to the invention (NFAST and CFAST10, respectively) able to interact and thus to reconstitute a functional PYP that can reversibly bind a fluorogen and turn on its fluorescence. The sensor is composed of M13-NFAST and CFAST10-CaM. FIG. 11B shows the temporal evolution of the intracellular fluorescence intensity for a representative HMBR-treated HeLa cell (n=14 cells from 2 experiments) treated with histamine (histamine addition is shown by the arrow).

[0517] FIG. 12A-B illustrate the use of split-FAST for detecting caspase-3 activity. FIG. 12A depicts the experimental design. N and C represent the first and second PYP fragments according to the invention (NFAST and CFAST11, respectively) able to interact and thus to reconstitute a functional PYP that can reversibly bind a fluorogen and turn on its fluorescence. The sensor consists of bFos-CFAST11 and bJun-NFAST-NLS3-DEVDG-mCherry-NES. FIG. 12B shows the temporal evolution of the nuclear split-FAST fluorescence intensity after treatment with staurosporine in HMBR-treated cells (n=9 cells).

[0518] FIGS. 13A-I are a combination of graphs illustrating the use of complementation systems comprising PYP fragments of FAST or orthologs of FAST for detecting the rapamycin-induced dimerization of FRB and FKBP. Human embryonic kidney (HEK) 293T cells expressing FRB fused to a N-terminal PYP fragment (i.e., first PYP fragment of the invention) and FKBP fused to a C-terminal PYP fragment (i.e., second PYP fragment of the invention) of different complementation systems according to the present invention were incubated with the fluorogen HMBR at the following concentrations: 0, 1, 5, 10, 25, 50 μM. Cell fluorescence was analyzed in absence and in presence of 500 nM rapamycin by flow cytometry. The graphs show the fluorescence mean of split-FAST (with CFAST11) (FIG. 13A), split-FAST (with CFAST10) (FIG. 13B), split-iFAST (FIG. 13C), O.sub.1-splitFAST derived from Halomonas boliviensis LC1 PYP (FIG. 13D), O.sub.2-splitFAST derived from Halomonas sp. GFAJ-1 PYP (FIG. 13E), O.sub.3-splitFAST derived from Rheinheimera sp. A 13L PYP (FIG. 13F), O.sub.4-splitFAST derived from Idiomarina loihiensis PYP (FIG. 13G), O.sub.5-splitFAST derived from Thiorhodospira sibirica ATCC 700588 PYP (FIG. 13H), and O.sub.6-splitFAST derived from Rhodothalassium salexigens PYP (FIG. 13I) at the indicated HMBR concentrations in presence and absence of rapamycin.

EXAMPLES

[0519] The present invention is further illustrated by the following examples.

Materials and Methods

[0520] Synthetic oligonucleotides used for cloning were purchased from Sigma Aldrich or Integrated DNA Technology. The sequences of the oligonucleotides used in this study are provided in Table 1. Polymerase chain reactions (PCRs) were performed with Q5 polymerase (New England Biolabs) in the buffer provided. PCR products were purified using QIAquick PCR purification kit (Qiagen). The products of restriction enzyme digestions were purified by preparative gel electrophoresis followed by QIAquick gel extraction kit (Qiagen). Restriction endonucleases, T4 ligase, Phusion polymerase, Taq ligase, and Taq exonuclease were purchased from New England Biolabs and used with their accompanying buffers according to manufacturer's protocols. Isothermal assemblies (Gibson assembly) were performed using a homemade mix prepared according to Gibson et al., Nat. Meth. 6, 343-345 (2009). Small-scale isolation of plasmid DNA was done using QIAprep miniprep kit (Qiagen) from 2 mL of overnight culture. Large-scale isolation of plasmid DNA was done using the QlAprep maxiprep kit (Qiagen) from 150 mL of overnight culture. All plasmid sequences were confirmed by Sanger sequencing with appropriate sequencing primers (GATC-Biotech). Table 2 lists the plasmids used in this study. Peptides corresponding to CFAST11-8 were purchased from Clinisciences at 98% purity and are acetylated and amidated at the N and C termini. Rapamycin was purchased from Sigma Aldrich and dissolved in DMSO to a concentration of 3 mM. AP1510 was purchased from Clontech and dissolved in ethanol to a concentration of 0.5 mM. Human recombinant EGF was purchased from Sigma Aldrich and dissolved in 0.1% BSA to a concentration of 100 μg/mL. Staurosporine was purchased from Cell Signaling Technologies and dissolved in ethanol to a concentration of 1 mM. HMBR (4-hydroxy-3-methylbenzylidene rhodanine) and HBR-3,5DOM (4-hydroxy-3,5-dimethoxybenzylidene rhodanine) were provided by The Twinkle Factory under the references .sup.TFLime and .sup.TFCoral (thetwinklefactory.com).

TABLE-US-00001 TABLE 1 list of oligonucleotides. Primer SEQ ID NO: code Sequence SEQ ID NO: 63 ag126 gtggtgctcgagctattaggaaagggctttcttcatgtgc SEQ ID NO: 64 ag176 agagtcgcggccgcctattaggaaagggctttcttcatgtgcac SEQ ID NO: 65 ag175 gcagcggcggagggggatccatggagcatgttgcctttggc SEQ ID NO: 66 ag181 ggactcagatctgccaccatggaacaaaagcttatttctgaagaggacttggaa ttcgagatgtggcatgaaggcctg SEQ ID NO: 67 ag182 ggatccccctccgccgctgccgcctcctccggagacctgctttgagattcgtcg g SEQ ID NO: 68 ag183 ggactcagatctgccaccatggaacaaaagcttatttctgaagaggacttggaa ttcggagtgcaggtggaaaccatc SEQ ID NO: 69 ag184 ggatccccctccgccgctgccgcctcctccggattcttccagttttagaagctcc acatc SEQ ID NO: 70 ag216 ttcgtagctagcatggagcatgttgcctttg SEQ ID NO: 71 ag311 aaagcttatttctgaagaggacttgtaataggcggccgcgactctagatcataat c SEQ ID NO: 72 ag313 ctcaccttgctcctgccgagaaagtatcca SEQ ID NO: 73 ag314 tggatactttctcggcaggagcaaggtgag SEQ ID NO: 74 ag345 ctagagtcgcggccgcctattaccgtttcacaaagacccaatagc SEQ ID NO: 75 ag346 ctagagtcgcggccgcctattatttcacaaagacccaatagctgtcac SEQ ID NO: 76 ag347 taataggcggccgcgactctag SEQ ID NO: 77 ag358 ggtggcagatctgagtccggtag SEQ ID NO: 78 ag412 caagtcctcttcagaaataagcttttgttc SEQ ID NO: 79 ag414 gcttatttctgaagaggacttggtgagcaagggcgaggag SEQ ID NO: 80 ag415 gaattcgaagcttgagctcgagatctgagtccggacttgtacagctcgtccatg c SEQ ID NO: 81 ag416 ctcgagctcaagcttcgaattctg SEQ ID NO: 82 ag417 ccgctgccgcctcctccggaagatctgtatcctggctggaatctag SEQ ID NO: 83 ag418 gcagcggcggagggggatccatgcccaagaagaagccgac SEQ ID NO: 84 ag419 caagtcctcttcagaaataagcttttgttcgacgccagcagcatgg SEQ ID NO: 85 ag455 gactgcgtgacctgtcttattccacttacgacgtgatgagtcgaccatgaattcc aagtcctcttcagaaataagc SEQ ID NO: 86 ag456 ggaataagacaggtcacgcagtcagagctataggtcggctgagctcatccgg aggaggcg SEQ ID NO: 87 ag465 caagtcctcttcagaaataagcttttgttcggatcccttcgctgtcatc SEQ ID NO: 88 ag466 ggaggaggcggcagcggcggagggggatccgaccaattgactgaagagca gatcgcag SEQ ID NO: 89 ag467 gctgccgcctcctccggaccgtttcacaaagacccaatag SEQ ID NO: 90 ag468 caagtccaagggcaaggactccgccgaacaaaagcttatttctgaagaggact tg SEQ ID NO: 91 ag469 ggagtccttgcccttggacttgatgcagcccatggtggcagatctgagtcc SEQ ID NO: 92 ag474 ctaccggactcagatctgccaccagtggtgacagctattgggtctttg SEQ ID NO: 93 ag475 ctagagtcgcggccgcctattacataattacacactagtctttgacttctattc SEQ ID NO: 94 ag535 atccaaaaaagaagagaaaggtagatccaaaaaagaagagaaaggtagatc caaaaaagaagagaaaggtaggtaccgcctccggcgatgaggtggatgg SEQ ID NO: 95 ag539 ccttgaaattagcaggtcttgatatcgggagctaataggcggccgcgactctag SEQ ID NO: 96 ag541 ctagagtcgcggccgcctattacacccgtttcacaaagaccc SEQ ID NO: 97 ag542 ccggactcagatctgccaccatgggtcgtgcgcagtc SEQ ID NO: 98 ag543 ctacctactcacttattggatcggaaagggctttcttcatgtgc SEQ ID NO: 99 ag544 ccggactcagatctgccaccatgaaggcggagaggaagc SEQ ID NO: 100 ag545 ctccggcgatgaggtggatggagtgagcaagggcgaggag SEQ ID NO: 101 ag546 gatatcaagacctgctaatttcaaggctaaggatcccttgtacagctcgtccatg cc SEQ ID NO: 102 ag550 tgctgaagcaggctggagacgtggaggagaaccctggacctgtgagcaagg gcgaggagg SEQ ID NO: 103 ag694 taactcgaggactacaaggacgacg SEQ ID NO: 104 ag695 ctcctcgcccagctcaccatgaattcagcgtaatctggaacatcgtatg SEQ ID NO: 105 ag696 tggacgagctgtacaagtaataggcggccgcgactc SEQ ID NO: 106 ag697 cgtcgtccagtagtcctcgagttaggaaagggctacttcatgtgcac SEQ ID NO: 107 ag698 cgtcgtccagtagtcctcgagttacataattacacactagtctttgacttctattc SEQ ID NO: 108 ag700 cgtcgtccagtagtcctcgagttaccgtttcacaaagacccaatagc SEQ ID NO: 109 ag701 gataatatggccacaaccatgcgatcggtgagcaagggcgaggag

TABLE-US-00002 TABLE 2 list of plasmids. Plasmid name Open Reading Frame Extended Description pAG144 CFAST11-FKBP CMV-CFAST11-linker-FRB pAG148 FRB-NFAST CMV-cmyc-FRB-linker-NFAST pAG149 FKBP-NFAST CMV-cmyc-FKBP-linker-NFAST pAG152 FRB-CFAST11 CMV-cmyc-FRB-linker-CFAST(115-125) pAG153 FKBP-CFAST11 CMV-cmyc-FKBP-linker-CFAST-11 pAG179 IAAL-E3-CFAST(65- T7-Histag-TEV-IAAL-E3- 125) + NFAST(1-64)-IAAL-K3 CFAST(65-125)-T7-NFAST(1-64)- IAAL-K3-TEV-Stag pAG180 IAAL-E3-CFAST(115- T7-Histag-TEV-IAAL-E3- 125) + NFAST(1-114)_IAAL-K3 CFAST(115-125)-T7-NFAST(1- 114)-IAAL-K3-TEV-Stag pAG181 IAAL-K3_NFAST(1- T7-Histag-TEV-IAAL-K3- 64) + CFAST(65-125)_IAAL-E3 NFAST(1-64)-T7-CFAST(65-125)- IAAL-E3-TEV-Stag pAG182 IAAL-K3_NFAST(1- T7-Histag-TEV-IAAL-K3- 114) + CFAST(115-125)_IAAL- NFAST(1-114)-T7-CFAST(115- E3 125)-IAAL-E3-TEV-Stag pAG209 Histag-NFAST pET28a-Histag-NFAST(1-114) pAG241 FKBP-CFAST10 CMV-cmyc-FKBP-linker-CFAST-10 pAG296 mCherry-ERK2-CFAST10 CMV-myc-mCherry-ERK-CFAST10 pAG298 NFAST-MEK1 CMV-NFAST-MEK-myc pAG301 NFAST-MKP1 CMV-NFAST-MKP1-myc pAG334 M13-NFAST CMV-myc-M13-NFAST pAG335 CFAST10-CaM CMV-CFAST10-CaM-myc pAG336 lyn11-FRB-NFAST CMV-lyn11-cmyc-FRB-NFAST pAG340 CFAST10-Raf1-mCherry CMV-CFAST10-Raf1-mCherry-myc pAG341 NFAST-KRas CMV-NFAST-myc-KRas pAG384 bFos-CFAST11 CMV-bFos-myc-CFAST11 pAG385 bJun-NFAST-NLS-DEVDG- CMV-bJun-myc-NFAST-NLSx3- mCherry-NES DEVDG-mCherry-NES pAG435 FRB-NFAST-P2A-EGFP CMV-myc-FRB-NFAST-P2A- EGFP-myc pAG436 FRB-NFAST(V107I)-P2A- CMV-myc-FRB-NFAST(V107I)- EGFP P2A-EGFP-myc pAG439 FRB-NFAST-P2A-mCherry CMV-myc-FRB-NFAST-P2A- mCherry-myc pAG440 FRB-NFAST(V107I)-P2A- CMV-myc-FRB-NFAST(V107I)- mCherry P2A-mCherry-myc pAG490 FRB-NFAST-IRES- CMV-cmyc-FRB-NFAST-IRES-HA- mTurquoise2 mTurquoise2 pAG491 lyn11-FRB-NFAST-IRES- CMV-lyn11-cmyc-FRB-NFAST- mTurquoise2 IRES-HA-mTurquoise2 pAG492 NFAST-MEK1-IRES- CMV-NFAST-MEK-myc-IRES-HA- mTurquoise2 mTurquoise2 pAG493 NFAST-MKP1-IRES- CMV-NFAST-MKPl-myc-IRES- mTurquoise2 HA-mTurquoise2 pAG494 NFAST-KRas-IRES- CMV-NFAST-myc-KRas-IRES-HA- mTurquoise2 mTurquoise2 pAG496 FKBP-CFAST10-IRES- CMV-myc-FKBP-cfast10-IRES- mCherry mCherry-myc

Molecular Cloning

[0521] Bacterial Expression Plasmids

[0522] The plasmid pAG209 was obtained by inserting the gene encoding for NFAST (amplified using primers ag126 and ag216) into plasmid pET28a using restriction enzymes Nhe I and Xho I.

[0523] FRB-FKBP Fusion Plasmids for Mammalian Expression

[0524] In general, fusion proteins were constructed by PCR assembly and contain an 11 amino acid linker, SGGGGSGGGGS (SEQ ID NO: 45), between the two proteins. The plasmid pAG148 was obtained by inserting the gene encoding FRB-NFAST (the sequence coding for FRB-NFAST was assembled by PCR from the sequences coding for FKBP-rapamycin binding domain of mTOR (FRB) and NFAST amplified with the primers ag181/ag182 and ag175/ag176) into plasmid pAG1042 using the restriction enzymes, Bgl II and Not I.

[0525] The plasmid pAG149 was generated by inserting the gene encoding FKBP-NFAST (the sequence coding for FKBP-NFAST was assembled by PCR from the sequences coding for FK506 binding protein (FKBP) and NFAST amplified with the primers ag183/ag184 and ag175/ag176) into plasmid pAG104 using the restriction enzymes Bgl II and Not I. The plasmid pAG152 was obtained by inserting the gene encoding FRB-CFAST11 (synthesized by Eurofins Genomics) into pAG104 using restriction enzymes Bgl II and Not I. The plasmid pAG153 was generated by inserting the gene coding for FKBP (amplified using primers ag183 and ag184) into pAG152 using restriction enzymes Bgl II and BspE I.

[0526] The plasmid pAG241 was constructed by Gibson assembly of two fragments obtained by amplification of the plasmid pAG153 with the primers ag345/ag313 and ag347/ag314. The plasmid pAG336 was cloned by Gibson assembly of two fragments obtained by amplification of the plasmid pAG148 with the primers ag468/313 and ag469/314. To determine the photostability of split-FAST in cells, the plasmid pAG439 encoding FRB-NFAST-P2A-mCherry was generated by Gibson assembly of the sequences of FRB-NFAST (amplified from pAG148 with primers ag308 and ag313) and mCherry (amplified from pAG962 with ag412 and ag550) assembled with the plasmid backbone of pAG104 (amplified using primers and ag347 and ag314). The plasmid pAG496 encoding FKBP-CFAST10-IRES-mCherry was cloned from the plasmid pAG241 (amplified using ag700 and ag313), mCherry (amplified using ag701 and ag314), and the IRES sequence amplified from the plasmid pIRES (using primers ag694 and ag695) via Gibson assembly. The plasmid pAG490 encoding FRB-NFAST-IRES-mTurquoise2 was cloned from the plasmid pAG148 (amplified using ag697 and ag313), the IRES sequence amplified from the plasmid pIRES (using ag694 and ag695), and a g-block encoding mTurquoise2 (IDT). The plasmid pAG491 encoding lyn11-FRB-NFAST-IRES-mTurquoise2 was cloned from the plasmid pAG336 (amplified using ag697 and ag313), the IRES sequence amplified from the plasmid pIRES (using ag694 and ag695), and a g-block encoding mTurquoise2 (IDT).

[0527] Signaling Pathway Plasmids

[0528] The genes coding for NFAST-MKP1 (MKP1 GenBank accession number: NM_004417.3), NFAST-KRas (K-Ras GenBank accession number: NM_004985.4), and CFAST10-Raf1-mCherry (Raf1 GenBank accession number: NM_001354689.1) were synthesized by Eurofins genomics. The plasmids pAG301, pAG341 and pAG340 were generated via Gibson assembly of the sequences of NFAST-MKP1 (amplified using ag357/ag412), NFAST-KRas (amplified using ag357/ag475), and CFAST10-Raf1-mCherry (amplified using ag474/ag412), and the backbone of pAG104 amplified in two fragments using primers ag311/ag314 and ag358/ag313. The genes coding for MEK1, ERK2, and mCherry were amplified using primers ag418/419, ag416/417, and ag414/415, respectively, and assembled via Gibson assembly with the corresponding fragments of NFAST (amplified with primers 374/313) and CFAST10 (amplified with primers 413/314) to generate the plasmids pAG298 and pAG296 encoding NFAST-MEK1 and mCherry-ERK2-CFAST10, respectively. The plasmids pAG492, pAG493 and pAG494 were constructed by Gibson assembly from the initial plasmid encoding the signaling pathway partner pAG298, pAG301, pAG341 (amplified with primers 697/313, 696/314, 699/313, 698/313), the IRES sequence (amplified from the plasmid pIRES using ag694 and ag695), and a g-block encoding mTurquoise2 (IDT).

[0529] Sensor Construction

[0530] The plasmid pAG334 was generated from the plasmid pAG148 by Gibson assembly by amplifying NFAST using primers ag455/ag456 with M13 encoded, and the backbone of pAG148 with primers ag313/ag314. The plasmid pAG335 was generated by Gibson assembly by amplification of calmodulin using primers ag465 and ag466, and inserted into the plasmid pAG144 by amplifying CFAST10 with primers ag467 and ag313 and assembling with plasmid amplified with ag311 and ag314. The genes encoding bJun-NFAST (bJun GenBank accession number: NM_021835.3) and bFos-CFAST11 (bFos GenBank accession number: M34001.1) were synthesized by Eurofins genomics. The plasmid pAG384 was cloned by Gibson assembly by amplification of the gene encoding bFos-CFAST11 (using primers ag541/542), and the backbone of pAG104 (using primers ag358/ag313 and ag347/314). The plasmid pAG385 was generated by amplifying the gene coding for bJun-NFAST using primers ag543/544, followed by a Gibson assembly with the sequence of mCherry amplified with ag545/546, the primer ag535 for NLSx3 and the backbone of pAG104 amplified using the primers ag358/313 and ag539/ag314.

Protein Expression and Purification

[0531] Expression vectors were transformed in Rosetta (DE3) pLysS E. coli (New England Biolabs). Cells were grown at 37° C. in LB medium complemented with 50 μg/mL kanamycin and 34 μg/mL chloramphenicol to OD.sub.600 nm 0.6. Expression was induced for 4 hours by adding isopropyl 0-D-1-thiogalactopyranoside (IPTG) to a final concentration of 1 mM. Cells were harvested by centrifugation (4,000×g for 20 mM at 4° C.) and frozen. The cell pellet was resuspended in lysis buffer (phosphate buffer 50 mM, NaCl 150 mM, MgCl2 2.5 mM, protease inhibitor, DNase, pH 7.4) and sonicated (5 mM at 20% of amplitude, 3 sec on, 1 sec off). The lysate was incubated for 2 hours at 4° C. to allow DNA digestion by DNase. Cellular fragments were removed by centrifugation (9200×g for 1 hour at 4° C.). The supernatant was incubated overnight at 4° C. under gentle agitation with Ni-NTA agarose beads in phosphate buffered saline (PBS) (sodium phosphate 50 mM, NaCl 150 mM, pH 7.4) complemented with 10 mM imidazole. Beads were washed with 20 volumes of PBS containing 20 mM imidazole, and with 5 volumes of PBS complemented with 40 mM imidazole. His-tagged proteins were eluted with 5 volumes of PBS complemented with 0.5 M imidazole. The buffer was exchanged to PBS (50 mM phosphate, 150 mM NaCl, pH 7.4) using PD-10 desalting columns.

Physico-Chemical Measurements

[0532] Steady state UV-Vis absorption spectra were recorded using a Cary 300 UV-Vis spectrometer (Agilent Technologies), equipped with a Versa20 Peltier-based temperature-controlled cuvette chamber (Quantum Northwest) and fluorescence data were recorded using a LPS 220 spectrofluorometer (PTI, Monmouth Junction, NJ), equipped with a TLC50TM Legacy/PTI Peltier-based temperature-controlled cuvette chamber (Quantum Northwest).

[0533] Thermodynamic dissociation constants for NFAST:CFASTn (n=8 to 11) couples were determined using peptides synthesized for CFASTn (n=8 to 11) and recombinantly purified NFAST. The affinity for NFAST:CFAST11 in the presence of 10 μM HMBR was determined independently from a minimum of three different purifications of NFAST. NFAST:CFAST11 was then run in parallel as an internal control for the determination of the other NFAST-CFAST combinations, which were all performed on the same day with the same preparation of NFAST. Thermodynamic dissociation constants were determined with a Spark 10M plate reader (Tecan) and fit in Prism 6 to a one-site specific binding model.

Mammalian Cell Culture

[0534] HEK 293T cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with phenol red, Glutamax I, and 10% (vol/vol) fetal calf serum (FCS), at 37° C. in a 5% CO2 atmosphere. HeLa cells were cultured in Modified Eagle Medium (MEM) supplemented with phenol red, 1× non-essential amino acids, 1× sodium pyruvate, and 10% (vol/vol) fetal calf serum at 37° C. in a 5% CO2 atmosphere. For imaging, cells were seeded in μDish IBIDI (Biovalley) coated with poly-L-lysine. Cells were transiently transfected using Genejuice (Merck) or Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol for 24 hours prior to imaging.

Fluorescence Microscopy

[0535] Confocal micrographs were acquired on a Zeiss LSM 710 Laser Scanning Microscope equipped with a Plan Apochromat 63×/1.4 NA oil DIC M27 immersion objective, heated stage, and XL-LSM 710 S1 incubation chamber for temperature and CO2 control. Images were acquired using ZEN software and processed in Fiji (ImageJ).

[0536] Photobleaching measurements for HMBR were carried out at 10 μM fluorogen at 488 nm excitation (4.6 kW/cm2, 1.27 μsec pixel dwell); FAST was used as a control. Samples were imaged continuously for 1000 images at a 1 frame per second frequency.

[0537] To image the rapamycin-mediated interaction between FRB and FKBP, the cells were imaged in DMEM without phenol red supplemented with 5 μM HMBR or 10 μM HBR-3,5DOM. Tile images were taken before rapamycin addition. A solution of rapamycin, prepared in fluorogen-containing DMEM in order to maintain fluorogen concentration constant, was added to obtain a final rapamycin concentration of 100 nM and images were taken every minute. A final tile image was taken after fluorescence saturation.

[0538] To image the AP1510-mediated interaction, AP1510 was added to a final concentration of 100 nM to the cells for 2 hours before imaging. The cells were rinsed and the media was replaced with DMEM without phenol red, supplemented with 5 μM HMBR or 10 μM HBR-3,5DOM. Tile images were taken before rapamycin addition. A solution of rapamycin (prepared in DMEM supplemented with fluorogen in order to maintain fluorogen concentration constant) was added to obtain a final rapamycin concentration of 1 μM and images were taken every 30 seconds. A final tile image was taken after fluorescence ceased changing.

[0539] To image the association and dissociation of FKBP-FKBP in the same sample, optiMEM (Gibco) was supplemented with 5 μM HMBR and AP1510 was added to a final concentration of 100 nM just before the beginning of imaging. The cells were maintained at 37° C. and 5% CO2 over the duration of the experiment. Images were taken every 5 minutes until the fluorescence signal saturated. The acquisition was then paused and the sample was washed with 1×DPBS (supplemented with HMBR in order to maintain fluorogen concentration constant) and the imaging solution was replaced. The acquisition frequency was reduced to 2 images per minute and 7-10 images were acquired before a solution of rapamycin, prepared in optiMEM (supplemented with HMBR in order to maintain fluorogen concentration constant), was added to obtain a final rapamycin concentration of 1 μM.

[0540] To image interactions in the Raf-MEK-ERK pathway, the cells were serum-starved for 24 hours before imaging after transfection. The cells were imaged in DMEM without phenol red supplemented with 10 μM HMBR. For time course experiments, the pathway was activated using purified EGF added to a final concentration of 200 ng/mL.

[0541] Calcium imaging was performed in HHBSS (HEPES-Buffered Hanks Balanced Salt Solution) supplemented with 5 μM HMBR. Calcium oscillations were triggered using 50 μM histamine in HHBSS (supplemented with HMBR in order to maintain fluorogen concentration constant) and images were acquired every 500 ms.

[0542] To image caspase activity, the cells were imaged at 37° C. in 5% CO2 in optiMEM supplemented with 5 μM HMBR. Just before the start of acquisition, staurosporine was added to a final concentration of 2 μM Images were acquired every 5 minutes over 3 hours.

Influence of the Length of CFAST on In-Cell Brightness of Complexes

[0543] HEK 293T cells were seeded in ibidi μDish microscopy dishes and 24 hours prior to imaging were co-transfected with plasmids encoding CMV-FRB-NFAST (or NFAST(V107I))-P2A-mCherry (or EGFP)) and CMV-FKBP-CFASTn (n=11, 10 or 9). The cells were imaged before and after addition of 500 nM rapamycin.

Evaluation of Split Site Efficiency in E. coli

[0544] The de novo designed peptides IAAL-E3 and IAAL-K3 form antiparallel alpha helical coiled coils that interact constitutively with an affinity of 70 nM. The interacting system was expressed in a bis-cistronic vector with two T7 promoters for simultaneous expression in E. coli. The genes encoding IAAL-E3-CFAST(65-125)-T7p-NFAST(1-64)-IAAL-K3, IAAL-K3_NFAST(1-64)-T7p-CFAST(65-125)-IAAL-E3, IAAL-E3-CFAST(115-125)-T7p-NFAST(1-114)-IAAL-K3, IAAL-K3_NFAST(1-114)-T7p-CFAST(115-125)-IAAL-E3 were purchased (Eurofins genomics) and inserted using the restriction enzymes Nco I and Xho I into the plasmid, pET28a.

[0545] The resulting plasmids were transformed into E. coli BL21 Rosetta cells. Overnight pre-cultures were used into inoculate 5 mL cultures, which were then grown to OD ˜0.6 and induced with 1 mM IPTG for two hours. The cytometry samples were prepared using 1.5 mL of culture that was pelleted and then washed in 1×PBS+BSA (1 g/L). The samples were then resuspended in 1.5 mL PBS+BSA with HMBR and 50,000 events were analyzed on a BD Accuri c6 cytometer.

Example 1: Generation of the Split-FAST Fluorescence Complementation System

[0546] The complementation system split-FAST (FIG. 1A) was engineered from the PYP-derived Fluorescence-Activating and absorption Shifting Tag (FAST—amino acid sequence SEQ ID NO: 9), a small protein of 14 kDa that specifically and reversibly binds fluorogenic hydroxybenzylidene rhodanine (HBR) analogs displaying various spectral properties. Fluorogenic HBR analogs are weakly fluorescent in solution but strongly fluoresce when immobilized in the binding cavity of FAST. The design is based on the splitting of FAST in two fragments between amino acids 114 and 115 (FIG. 1B). The two fragments 1-114 (hereafter called NFAST—SEQ ID NO: 23) and 115-125 (hereafter called CFAST11—SEQ ID NO: 34) showed modest affinity in presence of HMBR (which provides green-yellow fluorescence) or HBR-3,5DOM (which provides orange-red fluorescence). The apparent affinity of the two fragments could be further decreased by the successive removal of residues at the C terminus of CFAST11, resulting in CFAST10—SEQ ID NO: 42; CFAST9—SEQ ID NO: 43 and CFAST8—SEQ ID NO: 44 (Table 3).

TABLE-US-00003 TABLE 3 affinities of the split fragments in the presence of fluorogens K.sub.D of NFAST-CFASTn K.sub.D of NFAST-CFASTn CFASTn 10 μM HMBR 10 μM HBR-3,5-DOM CFAST11 0.21 ± 0.05 1.4 ± 0.2 CFAST10 0.95 ± 0.08 6.2 ± 0.5 CFAST9  5.7 ± 0.06 25 ± 1  CFAST8 21 ± 4  Not determined

[0547] As shown in FIG. 2, the excitation and emission spectra of the complemented split-FAST:fluorogen assembly (resulting from the complementation of NFAST and CFAST11 (FIG. 2B), and of NFAST and CFAST10 (FIG. 2C)) were identical to those of the regular FAST:fluorogen complex (FIG. 2A).

[0548] The results of FIG. 2 thus demonstrate that, once complemented, the complementation system of the invention behaves as the full-length FAST in terms of binding of fluorogenic HBR analogs, induction of fluorescence following said binding and photophysical properties. The complementation system of the invention thus allows the reconstitution of a functional PYP (e.g., split-FAST11), or a functional truncated fragment thereof (e.g., split-FAST10).

[0549] The design of the fluorescence complementation system of the invention was validated by comparing the fluorescence intensity obtained in E. coli cells when a pair of proteins interacting with high affinity (i.e., E3 and K3) were fused to different fragments of the PYP-derived FAST (FIG. 3). A first PYP fragment, i.e., NFAST, was fused to K3 and a second PYP fragment, i.e., CFAST, was fused to E3. FAST was split in two fragments between amino acids 114 and 115 and the resulting fragments FAST1-114 (i.e., NFAST) and FAST115-125 (i.e., CFAST11) were fused to K3 and E3, respectively (either NFAST-K3 or K3-NFAST, and E3-CFAST or CFAST-E3). The combinations of either NFAST-K3 and E3-CFAST11 (FIG. 3B) or K3-NFAST and CFAST11-E3 (FIG. 3D) led to an increase in fluorescence intensity in the presence of HMBR compared to the fluorescence intensity obtained without HMBR. By contrast, when FAST was split in two fragments between amino acids 64 and 65 and the resulting fragments FAST1-64 and FAST65-125 were fused to K3 or E3, no such increase was observed for any of the combinations tested (FIGS. 3A & 3C).

[0550] An alternative N-terminal fragment was also developed using a variant of FAST (referred to as improved FAST or iFAST—amino acid sequence SEQ ID NO: 16), wherein the valine at position 107 is replaced by an isoleucine. Using different fluorogenic HBR analogs, the relative in-cell brightness of various split-FAST was assessed (FIG. 4).

[0551] As shown in FIG. 4, with any of the fluorogenic HBR analogs tested: HMBR (FIG. 4A), HBR-3,5DM (FIG. 4B), HBR-3OM (FIG. 4C) and HBR-3,5DOM (FIG. 4D), the fluorescence observed was highest with CFAST11, lower with CFAST10 and lowest with CFAST9. The lower affinity between the two fragments (see Table 3 above) coincides with a lower in-cell brightness.

[0552] As shown in FIG. 4, the fluorescence observed with a system comprising NFAST (SEQ ID NO: 23) and CFAST is similar to that observed with a system comprising the corresponding Nter fragment of iFAST (SEQ ID NO: 30) and CFAST. These data thus demonstrate the suitability of iFAST in a complementation system according to the invention.

Example 2: Split-FAST Allows the Characterization of Dynamic and Reversible Protein Interactions

[0553] To test the ability of split-FAST to detect protein interactions in mammalian cells (pretreated with fluorogenic HBR analogs), NFAST and CFASTn (n=10 or 11) were fused to the FK506 binding protein (FKBP) and to the FKBP-rapamycin binding domain of mTOR (FRB), respectively. FKBP and FRB interact together in the presence of rapamycin.

[0554] As shown in FIG. 5, rapamycin-induced FRB-FKBP dimerization led to a large fluorescence increase, in accordance with interaction-dependent complementation of split-FAST. The use of either HMBR or HBR-3,5DOM gave similar results (FIG. 5A-C), demonstrating that the color of split-FAST can be tuned by changing the nature of the fluorogen added.

[0555] Time lapse imaging after rapamycin addition showed fluorescence saturation within a few minutes, in agreement with the rapid formation of the FRB-FKBP-rapamycin complex (FIGS. 5D, F and G). These results thus demonstrate that split-FAST can monitor protein complex formation in real-time. In cells, split-FAST:fluorogen assemblies (with either CFAST11 or CFAST10) were furthermore shown to be as photostable as the regular FAST:fluorogen complex (FIG. 5E).

[0556] The ability of rapamycin to dissociate AP1510-induced FKBP homodimers was used to test the reversibility of split-FAST. Cells co-expressing FKBP-NFAST and FKBP-CFASTn (n=10 or 11) were incubated with AP1510 for two hours to pre-form FKBP homodimers and treated with HMBR. Addition of rapamycin led to a significant loss of split-FAST:fluorogen fluorescence in agreement with FKBP homodimer dissociation (FIG. 6A-C). These results thus demonstrate that the split-FAST:fluorogen assembly is reversible. Rapid loss of fluorescence within a few minutes was observed after rapamycin addition, demonstrating the rapid disassembly of split-FAST when two proteins dissociate (FIGS. 6D, E and F). The ability of split-FAST to image dynamic and reversible protein interactions was further demonstrated by monitoring in a single experiment, first, the association of FKBP-NFAST and FKBP-CFASTn (n=11 or 10) upon addition of AP1510, and then, the dissociation of the FKBP-FKBP homodimer by removal of AP1510 and addition of rapamycin (FIG. 7A-D).

[0557] In conclusion, the data presented hereinabove demonstrate that split-FAST is a reversible complementation system that allows the real-time monitoring of both the association and the dissociation of proteins of interest. Moreover, the NFAST and CFAST fragments are characterized by a low affinity, resulting in a limited self-assembly and thus in a low unspecific fluorescence background.

Example 3: Split-FAST Allows the Detection of the Interaction Between a Membrane Protein and a Cytosolic Protein

[0558] As many protein interactions occur at the plasma membrane, the use of split-FAST to detect the interaction between a membrane protein and a cytosolic protein was next tested. FKBP-CFASTn (n=11 or 10) was expressed in the cytosol and FRB-NFAST at the plasma membrane using a Lyn11 membrane-anchoring sequence (Lyn11-FRB-NFAST). Addition of rapamycin led to the rapid formation of fluorescent split-FAST:fluorogen assemblies at the plasma membrane in HMBR-treated cells (FIG. 8A-B), demonstrating the ability of split-FAST to detect proteins interactions at the plasma membrane in real-time.

Example 4: Split-FAST Enables the Observation of Dynamic Protein Interactions in a Signaling Pathway in Real Time

[0559] Split-FAST was then benchmarked with known, physiologically relevant protein interactions from the mitogen-activated protein kinase (MAPK) signaling pathway. NFAST was fused to K-Ras, a small GTPase downstream of growth factor receptors, and CFAST10 was fused to an mCherry fusion of Raft, known to be recruited to the membrane by interaction with K-Ras. The fluorescence of split-FAST:HMBR was colocalized with that of mCherry and concentrated at the membrane, in agreement with a specific recruitment of Raf1 at the plasma membrane by K-Ras (FIG. 9A). Next, the interaction between the MAP kinase kinase MEK1, and the downstream extracellular signal-regulated protein kinase ERK2, one of the central interactions in the Raf/MEK/ERK signaling pathway was assessed using split-FAST. When MEK1 was fused to NFAST (MEK1-NFAST) and a mCherry fusion of ERK2 was fused to CFAST10 (mCherry-ERK2-CFAST10), a specific, cytosolic split-FAST:HMBR fluorescence was observed in accordance with MEK1 anchoring ERK2 in the cytosol (FIG. 9B). Finally, split-FAST allowed to detect the nuclear interaction between ERK2 and MKP1 (DUSP1), which is a phosphatase localized in the nucleus responsible for deactivating ERK2 after its activation and subsequent translocation to the nucleus (FIG. 9C). Controls relating to the use of split-FAST for imaging the K-Ras/Raf1, MEK1/ERK2 and ERK2/MKP1 interactions are shown in FIG. 9D.

[0560] To explore the applicability of split-FAST to study dynamic protein interactions, interaction between MEK1 and ERK2 upon activation of the MAPK signaling pathway was followed. Upon cell stimulation, MEK1 phosphorylates ERK2, which detaches from MEK1 and translocates to the nucleus, where it regulates the activity of transcription factors. Dephosphorylation by nuclear phosphatases deactivates ERK2, returning it to the cytoplasm. In resting HMBR-treated cells expressing MEK1-NFAST and mCherry-ERK2-CFAST10, mCherry and split-FAST:HMBR fluorescence were cytoplasmic, in agreement with MEK1 anchoring ERK2 in the cytoplasm. Upon cell stimulation with epidermal growth factor (EGF), mCherry-ERK2-CFAST10 dissociated from MEK1-NFAST and translocated to the nucleus, as shown by the simultaneous loss of split-FAST:HMBR fluorescence and the nuclear accumulation of mCherry fluorescence. The nuclear accumulation of mCherry-ERK2-CFAST10 was transitory: desensitized mCherry-ERK2-CFAST10 returned to the cytoplasm and re-assembled with MEK1-NFAST, as revealed by the simultaneous increase of split-FAST:HMBR fluorescence and cytosolic mCherry fluorescence (FIG. 10A-B). This experiment illustrates how split-FAST can be used to observe dynamic protein interactions in signaling pathways in real-time.

Example 5: Split-FAST Enables the Observation of Transient and Short-Lived Interactions

[0561] To further demonstrate the use of split-FAST for the detection of rapid and transient interactions, the Ca.sup.2+-dependent interaction between calmodulin (CaM) and the Ca.sup.2+-CaM-interacting peptide M13 was monitored. In HMBR-treated HeLa cells expressing CFAST10-CaM and M13-NFAST, addition of histamine led to a large increase of split-FAST-HMBR fluorescence followed by rapid oscillations of the fluorescence signals and eventually desensitization (FIG. 11A-B). This response was in agreement with the known change in Ca.sup.2+ concentration in mammalian cells upon histamine stimulation, and demonstrated the ability of split-FAST to image transient, short-lived interactions.

Example 6: Split-FAST Enables the Generation of Cellular Sensors

[0562] To examine the utility of split-FAST for imaging other signaling processes, a caspase biosensor was created. The transcriptional regulator bFos was fused to CFAST (bFos-CFAST11), and a gene encoding bJun-NFAST-NLS3-DEVDG-mCherry-NES was constructed, where NES is a genetically fused nuclear export signal, DEVD is the caspase-3 substrate sequence Asp-Glu-Val-Asp, NLS is a nuclear localization signal, and bJun is a peptide known to form a heterodimer with bFos (FIG. 12A). Induction of apoptosis (and thus caspase-3 activity) by treatment with staurosporine released bJun-NFAST from mCherry-NES, resulting in the translocation of bJun-NFAST to the nucleus, and the subsequent complementation of split-FAST by interaction of bJun and bFos. Approximately 1-2 hour(s) after the induction of apoptosis, the red fluorescence of mCherry was segregated in the cytoplasm and the bright green fluorescence of complemented split-FAST:HMBR appeared in the nucleus (FIG. 12B). Beyond further demonstrating the potential of split-FAST to monitor protein interactions formation in real-time, this experiment showed the great potential of split-FAST for the design of cellular sensors.

[0563] To conclude, the data presented hereinabove demonstrate that split-FAST, a split reporter displaying rapid and reversible complementation, allows one to observe transient protein interactions in real-time. Split-FAST:fluorogen fluoresces green-yellow or orange-red light depending on the fluorogen used, thus providing a system adaptable to multi-color imaging. Split-FAST allows the observation of protein interactions in various cellular compartments (cytosol, nucleus, plasma membrane) and, in contrast to traditional BiFC systems, allows the monitoring of both the formation and dissociation of protein assembly in real-time. This unprecedented behavior can be exploited to study the role and function of protein interactions in various cellular processes and dissect complex interaction networks.

Example 7: Complementation Systems with Orthologs of FAST

[0564] FAST, iFAST and 6 functional PYP deriving from the orthologs O.sub.n (n=1-6) were split into two complementary fragments in their last loop between residues 114 and 115 as indicated above. The 6 functional PYP deriving from the orthologs 01-6 have an amino acid sequence with at least 70% identity with the amino acid sequence of FAST (SEQ ID NO: 9).

[0565] As used hereinafter: [0566] O.sub.1 refers to a functional PYP deriving from Halomonas boliviensis LC1 PYP and having the sequence set forth in SEQ ID NO: 10; [0567] O.sub.2 refers to a functional PYP deriving from Halomonas sp. GFAJ-1 PYP and having the amino acid sequence set forth in SEQ ID NO: 11; [0568] O.sub.3 refers to a functional PYP deriving from Rheinheimera sp. A 13L PYP and having the amino acid sequence set forth in SEQ ID NO: 12; [0569] O.sub.4 refers to a functional PYP deriving from Idiomarina loihiensis PYP and having the amino acid sequence set forth in SEQ ID NO: 13; [0570] O.sub.5 refers to a functional PYP deriving from Thiorhodospira sibirica ATCC 700588 PYP and having the amino acid sequence set forth in SEQ ID NO: 14; and [0571] O.sub.6 refers to a functional PYP deriving from Rhodothalassium salexigens PYP and having the amino acid sequence set forth in SEQ ID NO: 15.

[0572] The N-terminal fragments (corresponding to residues 1-114) obtained from FAST, iFAST and the 6 orthologs O.sub.1-6 were called NFAST, N-iFAST and O.sub.1-6 NFAST, respectively. As previously indicated, the NFAST and N-iFAST fragments have the amino acid sequences as set forth in SEQ ID NO: 23 and SEQ ID NO: 30, respectively. O.sub.1-6NFAST have the amino acid sequences as set forth in SEQ ID NO:24 (O.sub.1NFAST), SEQ ID NO: 25 (O.sub.2NFAST), SEQ ID NO: 26 (O.sub.3NFAST), SEQ ID NO: 27 (O.sub.4NFAST), SEQ ID NO: 28 (O.sub.5NFAST) and SEQ ID NO: 29 (O.sub.6NFAST).

[0573] The C-terminal fragments (corresponding to residues 115-125) obtained from FAST and iFAST were identical and called CFAST11, the C-terminal fragments (corresponding to residues 115-125) obtained from the 6 orthologs O.sub.1-6 were called O.sub.1-6CFAST. For split-FAST, a truncated C-terminal fragment (residues 115-124, named CFAST10) was also tested. As previously indicated, the CFAST11 and CFAST10 fragments have the amino acid sequences as set forth in SEQ ID NO: 34 and SEQ ID NO: 42, respectively. O.sub.1-6 CFAST have the amino acid sequences as set forth in SEQ ID NO:35 (O.sub.1CFAST), SEQ ID NO: 36 (O.sub.2CFAST), SEQ ID NO: 37 (O.sub.3CFAST), SEQ ID NO: 38 (O.sub.4CFAST), SEQ ID NO: 39 (O.sub.5CFAST) and SEQ ID NO: 40 (O.sub.6CFAST).

[0574] To test the ability of the split-FAST, split-iFAST and split-O.sub.1-6 FAST complementation systems to detect protein-protein interactions in mammalian cells, their N-terminal fragment (i.e., first PYP fragment according to the present invention) was fused to the C-terminus of the FKBP-rapamycin-binding domain of mammalian target of rapamycin (FRB) and their C-terminal fragment (i.e., second PYP fragment according to the present invention) was fused at the C-terminus of the FK506-binding protein (FKBP). FKBP and FRB are known to interact together upon the addition of rapamycin. Addition of rapamycin is thus expected to induce the complementation of the split-FAST, split-iFAST and split-O.sub.1-6FAST systems.

[0575] The following transfection reporters were used to easily detect doubly transfected cells: mTurquoise2 (which provides cyan fluorescence) and iRFP670 (which provides far-red fluorescence). Internal ribosome entry site (IRES)-containing bi-cistronic vectors were generated, allowing the simultaneous expression of FKBP fusions and iRFP670 separately from a single RNA transcript. Internal ribosome entry site (IRES)-containing bi-cistronic vectors were generated, allowing the simultaneous expression of FRB fusions and mTurquoise2 separately from a single RNA transcript.

[0576] Human embryonic kidney (HEK) 293T cells were transfected with the two bi-cistronic vectors. The transfected cells were incubated with the fluorogen HMBR at the following concentrations: 0, 1, 5, 10, 25, and 50 μM. Cell fluorescence was analyzed in absence and in presence of 500 nM rapamycin by flow cytometry. The mean fluorescence of doubly transfected cells was extracted for the different conditions.

[0577] As shown on FIG. 13, at a given HMBR concentration, with each of the complementation system tested, an increase of the mean cell fluorescence was observed upon addition of rapamycin, in accordance with an interaction-dependent complementation of the PYP fragments. The data thus demonstrate that the split-FAST (FIG. 13A-B), split-iFAST (FIG. 13C) and split-O.sub.1-6FAST (FIG. 13D-I) complementation systems can be successfully used to detect protein-protein interactions. FIG. 13 also shows that increasing HMBR concentration increased the self-assembly of the PYP fragments (i.e., fluorescence detected in the absence of rapamycin). However, the self-assembly of the PYP fragments remained low and little fluorescence was detected in the absence of rapamycin at lower concentration of HMBR, notably at HMBR concentrations of 25 μM or less, and in particular at HMBR concentrations of 10 μM or less.