Expression of phytase in <i>Aspergillus niger</i>
11339397 · 2022-05-24
Assignee
Inventors
- Aixi Bai (Jiangsu, CN)
- Feng Li (Jiangsu, CN)
- Furong Bian (Jiangsu, CN)
- Jidong Zhu (Jiangsu, CN)
- Yan Sun (Jiangsu, CN)
- Hong Xu (Jiangsu, CN)
Cpc classification
C12N2800/22
CHEMISTRY; METALLURGY
C12N15/67
CHEMISTRY; METALLURGY
International classification
Abstract
Disclosed herein is a method for expressing phytase in a filamentous fungus by using an optimized Escherichia coli phytase gene having a nucleotide sequence as shown in SEQ ID NO. 7 and a signal peptide having a nucleotide sequence as shown in SEQ ID NO. 12.
Claims
1. A signal peptide for enhancing the secretory expression of Escherichia coli phytase in a filamentous fungus, wherein the signal peptide is derived from Aspergillus oryzae TAKA amylase and has the amino acid sequence as shown in SEQ ID NO: 13, wherein the signal peptide is in a fusion protein with an Escherichia coli phytase having the amino acid sequence as shown in SEQ ID NO: 4, and wherein the filamentous fungus is Aspergillus niger.
2. The signal peptide for enhancing the secretory expression of Escherichia coli phytase in a filamentous fungus according to claim 1, wherein the signal peptide is encoded by the nucleotide sequence as shown in SEQ ID NO: 12.
3. A signal peptide for enhancing the secretory expression of Escherichia coli phytase or a mutant thereof in a filamentous fungus, wherein the signal peptide is derived from Aspergillus oryzae TAKA amylase and has the amino acid sequence as shown in SEQ ID NO:13, wherein the signal peptide is in a fusion protein with an Escherichia coli phytase mutant, wherein the mutant of the Escherichia coli phytase has the amino acid sequence as shown in or SEQ ID NO: 17, and wherein the filamentous fungus is Aspergillus niger.
4. The signal peptide for enhancing the secretory expression of Escherichia coli phytase in a filamentous fungus according to claim 1, wherein the Escherichia coli phytase is encoded by the nucleotide sequence as shown in SEQ ID NO: 7; or a nucleotide sequence that is at least 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence as shown in SEQ ID NO: 7, and encodes a protein having the phytase activity.
5. The signal peptide for enhancing the secretory expression of Escherichia coli phytase in a filamentous fungus according to claim 1, wherein the Escherichia coli phytase is encoded by the nucleotide sequence as shown in SEQ ID NO: 8; or a nucleotide sequence that is at least 95%, 96%, 97%, 98% or 99% homologous to the nucleotide sequence as shown in SEQ ID NO: 8, and encodes a protein having the phytase activity.
6. The signal peptide for enhancing the secretory expression of Escherichia coli phytase in a filamentous fungus according to claim 3, wherein the signal peptide is encoded by the nucleotide sequence as shown in SEQ ID NO: 12.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
DETAILED DESCRIPTION
Example 1
Construction of pHphtk Plasmid
(10) The plasmid contains the following three parts, and is constructed by Nanjing Kingsray Biotechnology Co., Ltd., and the mapping of the plasmid is shown in
(11) (1) a 2305 bp fragment obtained by XbaI-PciI double digestion of pUC57 plasmid;
(12) (2) a hph gene expression cassette, having a sequence as shown in SEQ ID NO. 18; and
(13) (3) an HSV-tk expression cassette, having a sequence as shown in SEQ ID NO. 19.
Example 2
Construction of Plasmid Integrated with Escherichia coli Phytase Guided by Various Signal Peptides
(14) An Escherichia coli phytase expression cassette was integrated into the Aspergillus niger glycosylase locus for expression, where the glycosylase promoter and the glycosylase terminator were used. pGla-Phy-Phy, pGla-Gla-Phy, and pGla-Amy-Phy plasmids were constructed respectively. Various signal peptide sequences including the Escherichia coli phytase signal peptide (SEQ ID NO. 5), Aspergillus niger glycosylase signal peptide (SEQ ID NO. 10), and Aspergillus oryzae TAKA amylase signal peptide (SEQ ID NO. 12) were respectively linked to the wide-type Escherichia coli phytase mature peptide encoding DNA sequence Phy (SEQ ID NO. 3), and then used to replace the Aspergillus niger glycosylase gene. The phytase mature peptide encoding DNA sequence Phy (SEQ ID NO. 3) derived from Escherichia coli ATCC 8739 was synthesized by Nanjing Kingsray Biotech Co., Ltd., the Phy signal peptide DNA sequence was synthesized by Nanjing Kingsray Biotech Co., Ltd., the Aspergillus niger glycosylase signal peptide (SEQ ID NO. 10) and the Aspergillus oryzae TAKA amylase signal peptide (SEQ ID NO. 12) were introduced onto the Phy sequence by PCR using primers. The integrated plasmid was constructed as follows. The pHphtk plasmid was linearized by vector-F and vector-R primers. The genome of Aspergillus niger (from China Center of Industrial Culture Collection under Accession No. CICC2462) was used as a template, and the Gla-5′-F and Gla-5′-R and the Gla-3′-F and Gla-3′-R were respectively used to amplify the 5′ and 3′ flanking sequences of the glycosylase gene, where each fragment was 2000 bp long. The wild-type Escherichia coli phytase sequence Phy (SEQ ID NO. 1) was amplified using Phy-Phy-F and Phy-Phy-R. The linearized pHphtk vector, the 5′ and 3′ flanking fragments of the glycosylase gene, and the Phy fragment were recombined by Gibson Assembly® Master Mix Kit (E2611, New England Biolabs) to obtain an integrated plasmid pGla-PepWT, the sequence of which was confirmed by sequencing. Mapping of the plasmid is shown in
(15) Related primer sequences are listed below:
(16) TABLE-US-00001 Primer name Sequence (5′.fwdarw.3′) vector-F gtacagtgaccggtgactctttctggcatg (SEQ ID NO: 30) vector-R gatgcattcgcgaggtaccgagctc (SEQ ID NO: 31) Gla-5′-F aattcgagctcggtacctcgcgaatgcatcctacca atgctctcgaggattgcctgaacattgacattcggc (SEQ ID NO: 32) Gla-5′-R tgctgaggtgtaatgatgctggg (SEQ ID NO: 33) Gla-3′-F acaatcaatccatttcgctatagttaaaggatg (SEQ ID NO: 34) Gla-3′-R catgccagaaagagtcaccggtcactgtacatggc caatgtggtagccgttatcag (SEQ ID NO: 35) Phy-Phy-F cttcatccccagcatcattacacctcagcaatgtc agatatgaaaagcggaaacatatc (SEQ ID NO: 36) Phy-Phy-R cattaactatagcgaaatggattgattgtttacaa actgcacgccggtatgc (SEQ ID NO: 37) Gla-Phy-F cttcatccccagcatcattacacctcagcaatgtc gttccgatctctactcgccctgagcggcctcgtct gcacagggttggcaaatgtgatttccaagcgcgcg cagagtgagccggagctgaagct (SEQ ID NO: 38) Amylase-Phy- cttcatccccagcatcattacacctcagcaatggt F cgcctggtggtccctcttcctctacggtctccagg tcgccgcccccgccctcgccgccacccccgccgac tggcgctcccagagtgagccggagctgaagct (SEQ ID NO: 39)
Example 3
Construction of Codon-Optimized Escherichia coli Phytase Integrated Plasmid
(17) Plasmids pGla-Phy-PhyOPT, pGla-Gla-PhyOPT, and pGla-Amy-PhyOPT were constructed respectively. Various signal peptide sequences including the Escherichia coli phytase signal peptide, Aspergillus niger glycosylase signal peptide, and Aspergillus oryzae TAKA amylase signal peptide were respectively linked to the codon-optimized Escherichia coli phytase sequence PhyOPT (SEQ ID NO. 8), and then used to replace the Aspergillus niger glycosylase gene. The phytase sequence derived from Escherichia coli ATCC 8739 was codon optimized to have a sequence as shown in SEQ ID NO. 8, which was synthesized by Nanjing Kingsray Biotechnology Co., Ltd. Similarly, the Phy signal peptide was optimized to have a sequence as shown in SEQ ID NO. 9. The integrated plasmid was constructed as follows. The pHphtk plasmid was linearized by vector-F and vector-R primers. The genome of Aspergillus niger (available from China Center of Industrial Culture Collection under Accession No. CICC2462) eras used as a template, and the Gla-5′-F and Gla-5′-R and the Gla-3′-F and Gla-3′-R were respectively used to amplify the 5′ and 3′ flanking sequences of the glycosylase gene, where each fragment was 2000 bp long. Optimized Escherichia coli phytase sequence PhyOPT was amplified using Phy-PhyOPT-F and Phy-PhyOPT-R, in which optimized Phy signal peptide sequence was introduced on the primer. The linearized pHphtk vector, the 5′ and 3′ flanking fragments of the glycosylase gene, and the Phy fragment were recombined by Gibson Assembly® Master Mix Kit (E2611 New England Biolabs) to obtain an integrated plasmid pGla-Phy-PhyOPT, the sequence of which was confirmed by sequencing. Mapping of the plasmid is shown in
(18) Related primer sequences are listed below:
(19) TABLE-US-00002 Primer name Sequence (5′.fwdarw.3′) vector-F Gtacagtgaccggtgactctactggcatg (SEQ ID NO: 30) vector-R gatgcattcgcgaggtaccgagctc (SEQ ID NO: 31) Gla-5′-F aattcgagctcggtacctcgcgaatgcatcctacca atgctctcgaggattgcctgaacattgacattcggc (SEQ ID NO: 32) Gla-5′-R tgctgaggtgtaatgatgctggg (SEQ ID NO: 33) Gla-3′-F acaatcaatccatttcgctatagttaaaggatg (SEQ ID NO: 34) Gla-3′-R catgccagaaagagtcaccggtcactgtacatggcc aatgtggtagccgttatcag (SEQ ID NO: 35) Phy-PhyOPT- cttcatccccagcatcattacacctcagcaatgtcc F gacatgaagtccggtaacatctccatgaaggccatc ctgatccccttcctgtccctgctgatccccctgacc ccccagtccgccttcgcccagtccgaacccgagctg aagc (SEQ ID NO: 40) Phy-PhyOPT- cctttaactatagcgaaatggattgattgtttagag R ggagcaggcggggatgc (SEQ ID NO: 41) Gla-PhyOPT- cacatccccagcatcattacacctcagcaatgtcga F ccgatctctactcgccctgagcggcctcgtctgcac agggaggcaaatgtgataccaagcgcgcgcagtccg agcccgagctcaagc (SEQ ID NO: 42) Amylase-Phy- cttcatccccagcatcattacacctcagcaatggtc OPT-F gcctggtggtccctcttcctctacggtctccagatc gccgcccccgccctcgccgccacccccgccgactgg cgacccagtccgagcccgagctcaagc (SEQ ID NO: 43)
Example 4
Construction of Codon-Optimized Escherichia coli Phytase Mutant Integrated Plasmid
(20) U.S. Pat. No. 7,432,098 describes the Escherichia coli phytase mutant NOV9X, which has better heat resistance and is more suitable for use in the area of feed. NOV9X has 9 amino acid mutations compared to the Escherichia coli phytase in the present invention. In order to verify whether NOV9X can be efficiently expressed under the guidance of Aspergillus oryzae TAKA amylase signal, 17 base mutations were introduced to PhyOPT to obtain the DNA sequence of NOV9X, as shown in SEQ ID NO. 14. NOV9X has 98.6% sequence identity to the codon optimized Escherichia coli phytase mature peptide DNA sequence (SEQ ID NO. 8). NOV9X is synthesized by Nanjing Kingsray Biotechnology Co., Ltd., and the mature peptide sequence encoded thereby is shown in SEQ ID NO. 15. 43 base mutations were further introduced in NOV9X to form NOV9XM, as shown in SEQ ID NO. 16, which has 95.9% sequence identity to the codon-optimized Escherichia coli phytase mature peptide coding DNA sequence (SEQ ID NO. 8). NOV9X is synthesized by Nanjing Kingsray Biotechnology Co., Ltd., and the mature peptide sequence encoded thereby is shown in SEQ ID NO. 17. Plasmids pGla-Amy-PhyM1 and pGla-Amy-PhyM2 were constructed to integrate Amy-NOV9X and Amy-NOV9XM into Aspergillus niger glycosylase locus, respectively. The integrated plasmid was constructed as follows. The pHphtk plasmid was linearized by vector-F and vector-R primers. The genome of Aspergillus niger (from China Center of Industrial Culture Collection under Accession No. CICC2462) was used as a template, and the Gla-5′-F and Gla-5′-R and the Gla-3′-F and Gla-3′-R were respectively used to amplify the 5′ and 3′ flanking sequences of the glycosylase gene, where each fragment was 2000 bp long. Amylase-PhyOPT-F and Phy-PhyOPT-R were used as primers and the NOV9X and NOV9XM fragments were respectively used as a template to obtain Amylase-PhyM1 and Amylase-PhyM2 fragments by PCR amplification. In the two fragments, the Aspergillus oryzae TAKA amylase signal peptide sequence was introduced. The linearized pHphtk vector, the 5′ and 3′ flanking fragments of the glycosylase gene, and the Amylase-PhyM1 fragment were recombined by Gibson Assembly® Master Mix Kit to obtain an integrated plasmid pGla-Amylase-PhyM1, the sequence of which was confirmed by sequencing. Mapping of the plasmid is shown in
(21) Related primer sequences are listed below:
(22) TABLE-US-00003 Primer name Sequence (5′.fwdarw.3′) vector-F gtacagtgaccgatgactctttctggcatg (SEQ ID NO: 30) vector-R gatgcattcgcgaggtaccgagctc (SEQ ID NO: 31) Gla-5′-F aattcgagctcggtacctcgcgaatgcatcct accaatgctctcgaggattgcctgaacattga cattcggc (SEQ ID NO: 32) Gla-5′-R tgctgaggtgtaatgatgctggg (SEQ ID NO: 33) Gla-3′-F acaatcaatccatttcgctatagttaaaggat g (SEQ ID NO: 34) Gla-3′-R catgccagaaagagtcaccggtcactgtacat ggccaatgtggtagccgttatcag (SEQ ID NO: 35) Amylase-PhyOPT- Cttcatccccagcatcattacacctcagcaa F tggtcgcctggtggtccctcttcctctacgc cgagcccgagctcaagc (SEQ ID NO: 43) Phy-PhyOPT-R cctttaactatagcgaaatggattgattgttt acagggagcaggcggggatgc (SEQ ID NO: 44)
Example 5
Integration of Each Expression Cassette into Aspergillus niger
(23) The starting strain in this Example was AND4L, which was obtained by knocking out the glycosylase gene, the fungal amylase gene and the acid amylase gene from the CICC2462 strain. The Aspergillus niger gene knockout/knockin method could be implemented by referring to the technical method disclosed in the examples in CN 103937766A or CN 104962594A. The integration of PhyPhyOPT and PhyM into the glycosylasee locus in this example was achieved in the same manner as that in the example of CN 104962594A, i.e., by the method described by Delmas et al. (Appl Environ Microbiol. 2014, 80(11): 3484-7). Specifically, a circular DNA vector is used, comprising gla 5′ and 3′ flanking sequences, a selectable marker, a reverse selectable marker (or a negative selectable marker), and an Escherichia coli replication sequence, i.e. the plasmid as described in Examples 1 to 4. The circular vector was transferred into Aspergillus niger, and the recombinant strain was obtained by forward selection, and the knockout/knock-in strain was obtained by the reverse selectable marker.
(24) Protoplast transformation was used to introduce pGla-Phy-Phy, pGla-Gla-Phy, pGla-Amy-Phy, pGla-Phy-PhyOPT, pGla-Gla-PhyOPT, pGla-Amy-PhyOPT, pGla-Amy-PhyM1 and pGla-Amy-PhyM2 separately. The specific steps were as follows.
(25) Preparation of protoplasts: Aspergillus niger mycelium was cultured in a TZ liquid medium with rich nutrients (containing 0.8% of beef extract powder; 0.2% of yeast extract; 0.5% of peptone; 0.2% of NaCl; and 3% of sucrose; pH 5.8). The mycelium was filtered from the liquid culture by mira-cloth (Calbiochem) and washed with 0.7 M NaCl (pH 5.8). The mycelium was drained and transferred to an enzymatic hydrolyzing buffer (pH 5.8) containing 1% of cellulase (Sigma), 1% of helicase (Sigma) and 0.2% of lywallzyme (Sigma), and enzymatically hydrolyzed at 30° C. and 65 rpm for 3 hrs. Then, the enzymatic hydrolyzing buffer containing the protoplast was placed on ice and filtered through four layers of lens paper. The obtained filtrate was mildly centrifuged at 3000 rpm for 10 minutes at 4° C., and the supernatant was discarded. The protoplast attached to the tube wall was washed once with an STC buffer (containing 1 M D-Sorbitol, 50 mM CaCl.sub.2, 10 mM Tris, pH 7.5), and finally resuspended in an appropriate amount of the STC buffer.
(26) 10 μl (concentration: 100 ng/μl) of the circular plasmids pGla-Phy-Phy, pGla-Gla-Phy, pGla-Amy-Phy, pGla-Phy-PhyOPT, pGla-Gla-PhyOPT, pGla-Amy-PhyOPT, pGla-Amy-PhyM 1 and pGla-Amy-PhyM2 were respectively added to 100 μl of the protoplast suspension, mixed until uniform, and then stood for 25 min at room temperature. Then a total of 900 μl of a PEG solution was added in 3 times, mixed until uniform and allowed to stand for 25 min at room temperature. The solution was centrifuged at room temperature for 10 min at 3000 rpm. The supernatant was discarded and the protoplast attached to the wall of the tube was resuspended in 1 ml of the STC buffer. The suspension was mixed with a TB3 medium (containing 0.3% of yeast extract, 0.3% of acidically hydrolyzed casein, 20% of sucrose, and 0.7% of agar) previously cooled to about 45° C. and plated. After solidification, the plate was placed and cultured in an incubator at 34° C. After 24 hrs, a layer of TB3 solid medium (containing 1% of agar, the remaining components being the same as above) containing 300 ng/μl of hygromycin was further plated on the plate, and the plate was further incubated in an incubator at 34° C. for 4-5 days. The transformants that grew out of the upper medium were the integrated transformants. Several integrated transformants were randomly picked and passaged respectively on TB3 solid medium containing 300 ng/μl hygromycin. After incubation at a constant temperature of 34° C. for 3 days, the mycelium was collected, frozen in liquid nitrogen, and then ground. Subsequently, the genomic DNA of the integrated transformant was extracted with a fungal genome extraction kit (Hangzhou Bori Technology Co., Ltd.). Finally, the genomic DNA of the integrated transformant was identified by PCR, in which the primers for identification were Pep-5test-F and Pep-5test-R, and Pep-3test-F and Pep-3test-R. The PCR product was sequenced and confirmed to be integrated into glycosylase locus.
(27) Related primer sequences are listed below:
(28) TABLE-US-00004 Primer name Sequence (5′.fwdarw.3′) Phy-5test-F aatcgtgtccgcagatgtacttcac (SEQ ID NO: 45) Phy-5test-R ataatcatccactgcacctcagagc (SEQ ID NO: 46) Phy-3test-F tttcccagtcacgacgttgtaaaac (SEQ ID NO: 47) Phy-3test-R aactcgaacagtgtaggtgcaatgtc (SEQ ID NO: 48)
(29) A suitable amount of the ground mycelium of the confirmed positive transformant was picked up into a centrifuge tube containing 1 ml of sterile water, and vortexed to form a mycelium suspension. 100 μl was taken and coated onto a TB3 solid plate containing 10 μM 5-F2dU (5-fluoro-2-deoxyuridine, manufacturer: Sigma), and incubated at a constant temperature of 34° C. for 4-5 days. Knockout transformants were grown. The transformant should be unable to grow on 300 ng/μl hygromycin-containing plates after two generations on 10 μM 5-F2dU plates (to prevent impure transformants). Then the genomic DNA of the knockout transformant was identified by PCR, in which the primer sequences and the genome extraction method were the same as above. PCR identification using Pep-5test-F and Pep-3test-R showed that the positive transformant product is 5.5 kb and the negative transformant is 6.3 kb. The positive transformants were confirmed by sequencing the PCR products to obtain strains AND4L-Phy-Phy, AND4L-Gla-Phy, AND4L-Amy-Phy, AND4L-Phy-PhyOPT, AND4L-Gla-PhyOPT, AND4L-Amy-PhyOPT, AND4L-Amy-PhyM1 and AND4L-Amy-PhyM2.
Example 6
Shake Flask Fermentation of Strains
(30) The strains AND4L-Phy-Phy, AND4L-Gla-Phy, AND4L-Amy-Phy, AND4L-Phy-PhyOPT, AND4L-Gla-PhyOPT, AND4L-Amy-PhyOPT, AND4L-Amy-PhyM1 and AND4L-Amy-PhyM2 obtained in Example 5 were inoculated into a shake flask containing 50 ml of YPG medium (containing 2 g/L yeast extract, 2 g/L peptone, and 10% glucose) respectively, and cultured at 34° C. and 220 rpm for six days. The supernatant was subjected to denaturing, polyacrylamide gel electrophoresis (SDS-PAGE). For the expression of each strain, see Table 1 for details.
(31) TABLE-US-00005 TABLE 1 Expression of strains Whether the sequence is Strain Signal peptide optimized Expression AND4L-Phy- Escherichia coli Not optimized No expression Phy phytase AND4L-Gla- Aspergillus niger Not optimized No expression Phy glycosylase AND4L-Amy- Aspergillus oryzae Not optimized Low Phy TAKA amylase expression AND4L-Phy- Escherichia coli Optimized No expression PhyOPT phytase AND4L-Gla- Aspergillus niger Optimized No expression PhyOPT glycosylase AND4L-Amy- Aspergillus oryzae Optimized High PhyOPT TAKA amylase expression AND4L-Amy- Aspergillus oryzae Optimized High PhyM1 TAKA amylase expression AND4L-Amy- Aspergillus oryzae Optimized High PhyM2 TAKA amylase expression
(32) As can be seen from Table 1, after the DNA encoding Escherichia coli phytase or a mutant thereof is codon optimized, the expression level in the supernatant is good under the guidance of Aspergillus oryzae TAKA amylase signal peptide, and no protein expression occurs in the presence of other signal peptide sequences. For the non-optimized sequence, the expression level is also very low under the guidance of Aspergillus oryzae TAKA amylase signal peptide, which proves that the optimization of the DNA sequence is also critical for the expression. Good expression can also be achieved after 17 and 50 mutations were introduced into the optimized sequence, respectively.