CRISPR EFFECTOR SYSTEM BASED MULTIPLEX DIAGNOSTICS
20220154258 · 2022-05-19
Assignee
- The Broad Institute, Inc. (Cambridge, MA)
- Massachusetts Institute Of Technology (Cambridge, MA)
- President And Fellows Of Harvard College (Cambridge, MA)
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
G01N21/6428
PHYSICS
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12Q2565/625
CHEMISTRY; METALLURGY
C12N2320/11
CHEMISTRY; METALLURGY
B01L3/5023
PERFORMING OPERATIONS; TRANSPORTING
C12Q2565/625
CHEMISTRY; METALLURGY
International classification
B01L3/00
PERFORMING OPERATIONS; TRANSPORTING
C12N15/11
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
Abstract
Systems and methods for rapid diagnostics related to the use of CRISPR effector systems and optimized guide sequences, including multiplex lateral flow diagnostic devices and methods of use, are provided.
Claims
1. A lateral flow device comprising a substrate comprising a first end and a second end, a. the first end comprising a sample loading portion, a first region comprising a detectable ligand, two or more CRISPR effector systems, two or more detection constructs, and one or more first capture regions, each comprising a first binding agent; and b. the substrate comprising two or more second capture regions between the first region of the first end and the second end, each second capture region comprising a different binding agent; wherein each of the two or more CRISPR effector systems comprises a CRISPR effector protein or polynucleotide encoding a CRISPR effector protein and one or more guide sequences, each guide sequence configured to bind one or more target molecules.
2. The lateral flow device of claim 1, wherein the first end comprises two detection constructs, wherein each of the two detection constructs comprises an RNA or DNA oligonucleotide, comprising a first molecule on a first end and a second molecule on a second end.
3. The lateral flow device of claim 2, wherein the first molecule on the first end of the first detection construct is FAM and the second molecule on the second end of the first detection construct is biotin or vice versa; and the first molecule on the first end of the second detection construct is FAM and the second molecule on the second end of the second detection construct is Digoxigenin (DIG) or vice versa.
4. The lateral flow device of any of claims 1 to 3, wherein the CRISPR effector protein is an RNA-targeting effector protein, DNA-targeting effector, or both.
5. The lateral flow device of claim 4, wherein the RNA-targeting effector protein is a Class 2 Type VI Cas protein and the DNA-targeting effector protein is Class 2, Type V Cas protein.
6. The lateral flow device of claim 4, wherein the RNA-targeting effector protein is Cas13a, Cas13b, Cas13c, or Cas13d.
7. The lateral flow device of claim 1, wherein the first end comprises three detection constructs, wherein each of the three detection constructs comprises an RNA or DNA oligonucleotide, comprising a first molecule on a first end and a second molecule on a second end.
8. The lateral flow device of claim 7, wherein the first and second molecules on the detection constructs comprise Tye 665 and Alexa 488; Tye 665 and FAM; and Tye 665 and Digoxigenin (DIG).
9. The lateral flow device of claim 1, wherein a polynucleotide encoding a CRISPR effector protein and the one or more guide RNAs are provided as a multiplexing polynucleotide, the multiplexing polynucleotide configured to comprise two or more guide sequences.
10. A method for detecting a target nucleic acid in a sample, comprising contacting a sample with the first end of the lateral flow device of claim 1 comprising the sample loading portion, wherein the sample flows from the sample loading portion of the substrate towards the first and second capture regions and generates a detectable signal.
11. The method of claim 10, wherein the lateral flow device is capable of detecting two different target nucleic acid sequences.
12. The method of claim 10 or 11, wherein when the target nucleic acid sequences are absent from the sample, a fluorescent signal is generated at each capture region.
13. The method of claim 11, wherein the detectable signal appears at the first and second capture regions.
14. The method of claim 10, wherein the lateral flow device is capable of detecting three different target nucleic acid sequences.
15. The method of claim 14, wherein when the target nucleic acid sequences are absent from the sample, a fluorescent signal is generated at each capture region.
16. The method of claim 15, wherein the fluorescent signal appears at the first, second, and third capture regions.
17. The method of claim 13, wherein when the sample contains one or more target nucleic acid sequences, a fluorescent signal is absent at the capture region for the corresponding target nucleic acid sequence.
18. A nucleic acid detection system comprising two or more CRISPR systems, each CRISPR system comprising an effector protein and a guide RNA designed to bind to a corresponding target molecule; a set of detection constructs, each detection construct comprising a cutting motif sequence that is preferentially cut by one of the activated CRISPR effector proteins; and reagents for helicase dependent nucleic acid amplification (HDA).
19. A method for quantifying target nucleic acids in samples comprising distributing a sample or set of samples into one or more individual discrete volumes comprising two or more CRISPR systems according to claim 18, amplifying one or more target molecules in the sample or set of samples by HDA; incubating the sample or set of samples under conditions sufficient to allow binding of the guide RNAs to one or more target molecules; activating the CRISPR effector protein via binding of the guide RNAs to the one or more target molecules, wherein activating the CRISPR effector protein results in modification of the detection construct such that a detectable positive signal is generated; detecting the one or more detectable positive signal, wherein detection of the one or more detectable positive signal indicates a presence of one or more target molecules in the sample; and comparing the intensity of the one or more signals to a control to quantify the nucleic acid in the sample; wherein the steps of amplifying, incubating, activating, and detecting are all performed in the same individual discrete volume.
20. The method of claim 19, wherein the detectable positive signal is a loss of fluorescent signal.
21. The method of claim 19, wherein the detectable positive signal is detected on a lateral flow device.
22. The method of claim 19, wherein the HDA reagents comprise a helicase super mutant, selected from WP_003870487.1 Thermoanaerobacter ethanolicus comprising mutations D403A/D404, WP_049660019.1 Bacillus sp. FJAT-27231 comprising mutations D407A/D408A, WP_034654680.1 Bacillus megaterium comprising mutations D415A/D416A, WP_095390358.1, Bacillus simplex comprising mutations D407A/D408A, and WP_055343022.1 Paeniclostridium sordellii comprising mutations D402A/D403A.
23. A method for designing guide RNAs for use in the detection systems of the preceding claims, the method comprising: a. designing putative guide RNAs tiled across a target molecule of interest; b. incubating putative guide RNAs with a Cas effector protein and the target molecule and measuring cleavage activity of the each putative guide RNA c. creating a training model based on the cleavage activity results of incubating the putative guide RNAs with the Cas effector protein and the target molecule; d. predicting highly active guide RNAs for the target molecule, wherein the predicting comprises optimizing the nucleotide at each base position in the guide RNA based on the training model; and e. validating the predicted highly active guide RNAs by incubating the guide RNAs with the Cas effector protein and the target molecule.
24. The method of claim 23, wherein the Cas effector protein is a Cas12 or Cas13 protein.
25. The method of claim 24, wherein the Cas protein is a Cas13a or Cas13b protein.
26. The method of claim 25, wherein the Cas protein is LwaCas13a or CcaCas13b.
27. The method of claim 23, wherein the training model comprises one or more input features selected from guide sequence, flanking target sequence, normalized positions of the guide in the target and guide GC content.
28. The method of claim 26, wherein the guide sequence and/or flanking sequence input comprises one hit encoding mono-nucleotide and/or dinucleotide based identities across a guide length and flanking sequence in the target.
29. The method of claim 27, wherein the training model comprises applying logistic regression model on the activity of the guides across the one or more input features.
30. The method of claim 23, wherein the predicting highly active guides for the target molecule comprises selecting guides with an increase in activity of a guide relative to the median activity, or selecting guides with highest guide activity.
31. The method of claim 30, wherein the increase in activity is measured by an increase in fluorescence.
32. The method of claim 29, wherein the guides are selected with a 1.5, 2, 2.5 or 3-fold activity relative to median, or are in the top quartile or quintile for each target tested.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] An understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention may be utilized, and the accompanying drawings of which:
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038] The figures herein are for illustrative purposes only and are not necessarily drawn to scale.
DETAILED DESCRIPTION OF THE EXAMPLE EMBODIMENTS
General Definitions
[0039] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Definitions of common terms and techniques in molecular biology may be found in Molecular Cloning: A Laboratory Manual, 2.sup.nd edition (1989) (Sambrook, Fritsch, and Maniatis); Molecular Cloning: A Laboratory Manual, 4.sup.th edition (2012) (Green and Sambrook); Current Protocols in Molecular Biology (1987) (F. M. Ausubel et al. eds.); the series Methods in Enzymology (Academic Press, Inc.): PCR 2: A Practical Approach (1995) (M. J. MacPherson, B. D. Hames, and G. R. Taylor eds.): Antibodies, A Laboratory Manual (1988) (Harlow and Lane, eds.): Antibodies A Laboratory Manual, 2.sup.nd edition 2013 (E. A. Greenfield ed.); Animal Cell Culture (1987) (R. I. Freshney, ed.); Benjamin Lewin, Genes IX, published by Jones and Bartlet, 2008 (ISBN 0763752223); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0632021829); Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 9780471185710); Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, N.Y. 1994), March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., John Wiley & Sons (New York, N.Y. 1992); and Marten H. Hofker and Jan van Deursen, Transgenic Mouse Methods and Protocols, 2.sup.nd edition (2011).
[0040] As used herein, the singular forms “a” “an”, and “the” include both singular and plural referents unless the context clearly dictates otherwise.
[0041] The term “optional” or “optionally” means that the subsequent described event, circumstance or substituent may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.
[0042] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.
[0043] The terms “about” or “approximately” as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value, such as variations of +/−10% or less, +/−5% or less, +/−1% or less, and +/−0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier “about” or “approximately” refers is itself also specifically, and preferably, disclosed.
[0044] As used herein, a “biological sample” may contain whole cells and/or live cells and/or cell debris. The biological sample may contain (or be derived from) a “bodily fluid”. The present invention encompasses embodiments wherein the bodily fluid is selected from amniotic fluid, aqueous humour, vitreous humour, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof. Biological samples include cell cultures, bodily fluids, cell cultures from bodily fluids. Bodily fluids may be obtained from a mammal organism, for example by puncture, or other collecting or sampling procedures.
[0045] The terms “subject,” “individual,” and “patient” are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.
[0046] Various embodiments are described hereinafter. It should be noted that the specific embodiments are not intended as an exhaustive description or as a limitation to the broader aspects discussed herein. One aspect described in conjunction with a particular embodiment is not necessarily limited to that embodiment and can be practiced with any other embodiment(s). Reference throughout this specification to “one embodiment”, “an embodiment,” “an example embodiment,” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases “in one embodiment,” “in an embodiment,” or “an example embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention. For example, in the appended claims, any of the claimed embodiments can be used in any combination.
[0047] All publications, published patent documents, and patent applications cited herein are hereby incorporated by reference to the same extent as though each individual publication, published patent document, or patent application was specifically and individually indicated as being incorporated by reference.
Overview
[0048] Embodiments disclosed herein provide multiplex lateral flow devices and methods of use. The embodiments disclosed herein are directed to lateral flow detection devices that comprise CRISPR Cas systems for target molecule detection.
[0049] Instead of relying on general capture of antibody that was not bound by intact reporter RNAs (Gootenberg, 2018), the presently disclosed system is more suitable for detecting two targets. Applicants adapted a lateral flow approach with two separate detection lines consisting of deposited materials that capture reporter RNA appended with a fluorophore and a molecule specific to the deposited material, allowing fluorescent visualization of signal loss at detection lines due to collateral activity and cleavage of corresponding reporter RNA. Further advances were made utilizing guide design that allows for design of highly active guide RNAs for use with the specific Cas protein of the systems as well as for the desired target molecule.
Lateral Flow Devices
[0050] In one embodiment, the invention provides a lateral flow device comprising a substrate comprising a first end and a second end. The first end may comprise a sample loading portion, a first region comprising a detectable ligand, two or more CRISPR effector systems, two or more detection constructs, and one or more first capture regions, each comprising a first binding agent. The substrate may also comprise two or more second capture regions between the first region of the first end and the second end, each second capture region comprising a different binding agent. Each of the two or more CRISPR effector systems may comprise a CRISPR effector protein and one or more guide sequences, each guide sequence configured to bind one or more target molecules.
[0051] The embodiments disclosed herein are directed to lateral flow detection devices that comprise SHERLOCK systems. SHERLOCK utilizes Cas13s non-specific RNase activity to cleave fluorescent reporters upon target recognition, providing sensitive and specific diagnostics using Cas13, including single nucleotide variants, detection based on rRNA sequences, screening for drug resistance, monitoring microbe outbreaks, genetic perturbations, and screening of environmental samples, as described, for example, in PCT/US18/054472 filed Oct. 22, 2018 at [0183]-[0327], incorporated herein by reference. Reference is made to WO 2017/219027, WO2018/107129, US20180298445, US 2018-0274017, US 2018-0305773, WO 2018/170340, U.S. application Ser. No. 15/922,837, filed Mar. 15, 2018 entitled “Devices for CRISPR Effector System Based Diagnostics”, PCT/US18/50091, filed Sep. 7, 2018 “Multi-Effector CRISPR Based Diagnostic Systems”, PCT/US18/66940 filed Dec. 20, 2018 entitled “CRISPR Effector System Based Multiplex Diagnostics”, PCT/US18/054472 filed Oct. 4, 2018 entitled “CRISPR Effector System Based Diagnostic”, U.S. Provisional 62/740,728 filed Oct. 3, 2018 entitled “CRISPR Effector System Based Diagnostics for Hemorrhagic Fever Detection”, U.S. Provisional 62/690,278 filed Jun. 26, 2018 and U.S. Provisional 62/767,059 filed Nov. 14, 2018 both entitled “CRISPR Double Nickase Based Amplification, Compositions, Systems and Methods”, U.S. Provisional 62/690,160 filed Jun. 26, 2018 and U.S. Pat. No. 62,767,077 filed Novemebr 14, 2018, both entitled “CRISPR/CAS and Transposase Based Amplification Compositions, Systems, And Methods”, U.S. Provisional 62/690,257 filed Jun. 26, 2018 and 62/767,052 filed Nov. 14, 2018 both entitled “CRISPR Effector System Based Amplification Methods, Systems, And Diagnostics”, U.S. Provisional 62/767,076 filed Nov. 14, 2018 entitled “Multiplexing Highly Evolving Viral Variants With SHERLOCK” and 62/767,070 filed Nov. 14, 2018 entitled “Droplet SHERLOCK.” Reference is further made to WO2017/127807, WO2017/184786, WO 2017/184768, WO 2017/189308, WO 2018/035388, WO 2018/170333, WO 2018/191388, WO 2018/213708, WO 2019/005866, PCT/US18/67328 filed Dec. 21, 2018 entitled “Novel CRISPR Enzymes and Systems”, PCT/US18/67225 filed Dec. 21, 2018 entitled “Novel CRISPR Enzymes and Systems” and PCT/US18/67307 filed Dec. 21, 2018 entitled “Novel CRISPR Enzymes and Systems”, U.S. 62/712,809 filed Jul. 31, 2018 entitled “Novel CRISPR Enzymes and Systems”, U.S. 62/744,080 filed Oct. 10, 2018 entitled “Novel Cas12b Enzymes and Systems” and U.S. 62/751,196 filed Oct. 26, 2018 entitled “Novel Cas12b Enzymes and Systems”, U.S. 715,640 filed August 7, 2-18 entitled “Novel CRISPR Enzymes and Systems”, WO 2016/205711, U.S. Pat. No. 9,790,490, WO 2016/205749, WO 2016/205764, WO 2017/070605, WO 2017/106657, and WO 2016/149661, WO2018/035387, WO2018/194963, Cox DBT, et al., RNA editing with CRISPR-Cas13, Science. 2017 Nov. 24; 358(6366):1019-1027; Gootenberg J S, et al., Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6., Science. 2018 Apr. 27; 360(6387):439-444; Gootenberg J S, et al., Nucleic acid detection with CRISPR-Cas13a/C2c2, Science. 2017 Apr. 28; 356(6336):438-442; Abudayyeh O O, et al., RNA targeting with CRISPR-Cas13, Nature. 2017 Oct. 12; 550(7675):280-284; Smargon A A, et al., Cas13b Is a Type VI-B CRISPR-Associated RNA-Guided RNase Differentially Regulated by Accessory Proteins Csx27 and Csx28. Mol Cell. 2017 Feb. 16; 65(4):618-630.e7; Abudayyeh 00, et al., C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector, Science. 2016 Aug. 5; 353(6299):aaf5573; Yang L, et al., Engineering and optimising deaminase fusions for genome editing. Nat Commun. 2016 Nov. 2; 7:13330, Myrvhold et al., Field deployable viral diagnostics using CRISPR-Cas13, Science 2018 360, 444-448, Shmakov et al. “Diversity and evolution of class 2 CRISPR-Cas systems,” Nat Rev Microbiol. 2017 15(3):169-182, each of which is incorporated herein by reference in its entirety.
[0052] The device may comprise a lateral flow substrate for detecting a SHERLOCK reaction. Substrates suitable for use in lateral flow assays are known in the art. These may include, but are not necessarily limited to membranes or pads made of cellulose and/or glass fiber, polyesters, nitrocellulose, or absorbent pads (J Saudi Chem Soc 19(6):689-705; 2015). The SHERLOCK system, i.e. one or more CRISPR systems and corresponding reporter constructs are added to the lateral flow substrate at a defined reagent portion of the lateral flow substrate, typically on one end of the lateral flow substrate. Reporting constructs used within the context of the present invention comprise a first molecule and a second molecule linked by an RNA or DNA linker. The lateral flow substrate further comprises a sample portion. The sample portion may be equivalent to, continuous with, or adjacent to the reagent portion.
Lateral Flow Substrate
[0053] In certain example embodiments, a lateral flow device comprises a lateral flow substrate on which detection can be performed. Substrates suitable for use in lateral flow assays are known in the art. These may include, but are not necessarily limited to, membranes or pads made of cellulose and/or glass fiber, polyesters, nitrocellulose, or absorbent pads (J Saudi Chem Soc 19(6):689-705; 2015).
[0054] Lateral support substrates comprise a first and second end, and one or more capture regions that each comprise binding agents. The first end may comprise a sample loading portion, a first region comprising a detectable ligand, two or more CRISPR effector systems, two or more detection constructs, and one or more first capture regions, each comprising a first binding agent. The substrate may also comprise two or more second capture regions between the first region of the first end and the second end, each second capture region comprising a different binding agent. Each of the two or more CRISPR effector systems may comprise a CRISPR effector protein and one or more guide sequences, each guide sequence configured to bind one or more target molecules. The lateral flow substrates may be configured to detect a SHERLOCK reaction. Reference is made to Gootenberg, et al., “Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6,” Science. 2018 Apr. 27; 360(6387):439-444. doi: 10.1126/science.aaq0179, and International Patent Publication No, WO 2019/071051, each specifically incorporated herein by reference. Lateral support substrates may be located within a housing (see for example, “Rapid Lateral Flow Test Strips” Merck Millipore 2013). The housing may comprise at least one opening for loading samples and a second single opening or separate openings that allow for reading of detectable signal generated at the first and second capture regions.
[0055] The embodiments disclosed herein can be prepared in freeze-dried format for convenient distribution and point-of-care (POC) applications. Such embodiments are useful in multiple scenarios in human health including, for example, viral detection, bacterial strain typing, sensitive genotyping, and detection of disease-associated cell free DNA. Accordingly, the lateral substrate comprising one or more of the elements of the system, including detectable ligands, CRISPR effector systems, detection constructs and binding agents may be freeze-dried to the lateral flow substrate and packaged as a ready to use device. Alternatively, all or a portion of the elements of the system may be added to the reagent portion of the lateral flow substrate at the time of using the device.
First End and Second End of the Substrate
[0056] The substrate of the lateral flow device comprises a first and second end. The SHERLOCK system, i.e. one or more CRISPR systems and corresponding reporter constructs are added to the lateral flow substrate at a defined reagent portion of the lateral flow substrate, typically on a first end of the lateral flow substrate. Reporting constructs used within the context of the present invention comprise a first molecule and a second molecule linked by an RNA or DNA linker. The lateral flow substrate further comprises a sample portion. The sample portion may be equivalent to, continuous with, or adjacent to the reagent portion. The first end of the substrate for application of a sample.
[0057] In certain example embodiments, the first end comprises a first region. The first region comprises a detectable ligand, two or more CRISPR effector systems, two or more detection constructs, and one or more first capture regions, each comprising a first binding agent.
Capture Regions
[0058] The lateral flow substrate can comprise one or more capture regions. In embodiments the first end of the lateral flow substrate comprises one or more first capture regions, with two or more second capture regions between the first region of the first end of the substrate and the second end of the substrate. The capture regions may be provided as a capture line, typically a horizontal line running across the device, but other configurations are possible. The first capture region is proximate to and on the same end of the lateral flow substrate as the sample loading portion.
Binding Agents
[0059] Specific binding-integrating molecules comprise any members of binding pairs that can be used in the present invention. Such binding pairs are known to those skilled in the art and include, but are not limited to, antibody-antigen pairs, enzyme-substrate pairs, receptor-ligand pairs, and streptavidin-biotin. In addition to such known binding pairs, novel binding pairs may be specifically designed. A characteristic of binding pairs is the binding between the two members of the binding pair.
[0060] A first binding agent that specifically binds the first molecule of the reporter construct is fixed or otherwise immobilized to the first capture region. The second capture region is located towards the opposite end of the lateral flow substrate from the first capture region. A second binding agent is fixed or otherwise immobilized at the second capture region. The second binding agent specifically binds the second molecule of the reporter construct, or the second binding agent may bind a detectable ligand. For example, the detectable ligand may be a particle, such as a colloidal particle, that when it aggregates can be detected visually, and generates a detectable positive signal. The particle may be modified with an antibody that specifically binds the second molecule on the reporter construct. If the reporter construct is not cleaved it will facilitate accumulation of the detectable ligand at the first binding region. If the reporter construct is cleaved the detectable ligand is released to flow to the second binding region. In such an embodiment, the second binding region comprises a second binding agent capable of specifically or non-specifically binding the detectable ligand on the antibody of the detectable ligand. Binding agents can be, for example, antibodies, that recognize a particular affinity tag. Such binding agents can further contain, for example, detectable labels, such as isotope labels and/or nucleic acid barcodes. A barcode is a short sequence of nucleotides (for example, DNA, RNA, or combinations thereof) that is used as an identifier. A nucleic acid barcode may have a length of 4-100 nucleotides and be either single or double-stranded. Methods for identifying cells with barcodes are known in the art. Accordingly, guide RNAs of the CRISPR effector systems described herein may be used to detect the barcode.
Detectable Ligands
[0061] The first region is loaded with a detectable ligand, such as those disclosed herein, for example a gold nanoparticle. The detectable ligand may be a particle, such as a colloidal particle, that when it aggregates can be detected visually. The particle may be modified with an antibody that specifically binds the second molecule on the reporter construct. If the reporter construct is not cleaved it will facilitate accumulation of the detectable ligand at the first binding region. If the reporter construct is cleaved the detectable ligand is released to flow to the second binding region. In such an embodiment, the second binding agent is an agent capable of specifically or non-specifically binding the detectable ligand on the antibody on the detectable ligand. Examples of suitable binding agents for such an embodiment include, but are not limited to, protein A and protein G. In some examples, the detectable ligand is a gold nanoparticle, which may be modified with a first antibody, such as an anti-FITC antibody.
Detection Constructs
[0062] The first region also comprises a detection construct. In one example embodiment, a RNA detection construct and a CRISPR effector system (a CRISPR effector protein and one or more guide sequences configured to bind to one or more target sequences) as disclosed herein. In one example embodiment, and for purposes of further illustration, the RNA construct may comprise a FAM molecule on a first end of the detection construction and a biotin on a second end of the detection construct. Upstream of the flow of solution from the first end of the lateral flow substrate is a first test band. The test band may comprise a biotin ligand. Accordingly, when the RNA detection construct is present it its initial state, i.e. in the absence of target, the FAM molecule on the first end will bind the anti-FITC antibody on the gold nanoparticle, and the biotin on the second end of the RNA construct will bind the biotin ligand allowing for the detectable ligand to accumulate at the first test, generating a detectable signal. Generation of a detectable signal at the first band indicates the absence of the target ligand. In the presence of target, the CRISPR effector complex forms and the CRISPR effector protein is activated resulting in cleavage of the RND detection construct. In the absence of intact RNA detection construct the colloidal gold will flow past the second strip. The lateral flow device may comprise a second band, upstream of the first band. The second band may comprise a molecule capable of binding the antibody-labeled colloidal gold molecule, for example an anti-rabbit antibody capable of binding a rabbit anti-FITC antibody on the colloidal gold. Therefore, in the presence of one or more targets, the detectable ligand will accumulate at the second band, indicating the presence of the one or more targets in the sample.
[0063] In some embodiments, the first end of the lateral flow device comprises two detection constructs and each of the two detection constructs comprises an RNA or DNA oligonucleotide, comprising a first molecule on a first end and a second molecule on a second end. The first molecule and the second molecule may be linked by an RNA or DNA linker.
[0064] In some embodiments, the first molecule on the first end of the first detection construct may be FAM and the second molecule on the second end of the first detection construct may be biotin, or vice versa. In some embodiments, the first molecule on the first end of the second detection construct may be FAM and the second molecule on the second end of the second detection construct may be Digoxigenin (DIG), or vice versa.
[0065] In some embodiments, the first end may comprise three detection constructs, wherein each of the three detection constructs comprises an RNA or DNA oligonucleotide, comprising a first molecule on a first end and a second molecule on a second end. In specific embodiments, the first and second molecules on the detection constructs comprise Tye 665 and Alexa 488; Tye 665 and FAM, and Tye 665 and Digoxigenin (DIG), respectively.
[0066] As used herein, a “detection construct” refers to a molecule that can be cleaved or otherwise deactivated by an activated CRISPR system effector protein described herein. The term “detection construct” may also be referred to in the alternative as a “masking construct.” Depending on the nuclease activity of the CRISPR effector protein, the masking construct may be a RNA-based masking construct or a DNA-based masking construct. The Nucleic Acid-based masking constructs comprises a nucleic acid element that is cleavable by a CRISPR effector protein. Cleavage of the nucleic acid element releases agents or produces conformational changes that allow a detectable signal to be produced. Example constructs demonstrating how the nucleic acid element may be used to prevent or mask generation of detectable signal are described below and embodiments of the invention comprise variants of the same. Prior to cleavage, or when the masking construct is in an ‘active’ state, the masking construct blocks the generation or detection of a positive detectable signal. It will be understood that in certain example embodiments a minimal background signal may be produced in the presence of an active masking construct. A positive detectable signal may be any signal that can be detected using optical, fluorescent, chemiluminescent, electrochemical or other detection methods known in the art. The term “positive detectable signal” is used to differentiate from other detectable signals that may be detectable in the presence of the masking construct. For example, in certain embodiments a first signal may be detected when the masking agent is present or when a CRISPR system has not been activated (i.e. a negative detectable signal), which then converts to a second signal (e.g. the positive detectable signal) upon detection of the target molecules and cleavage or deactivation of the masking agent, or upon activation of the CRISPR effector protein. The positive detectable signal, then, is a signal detected upon activation of the CRISPR effector protein, and may be, in a colorimetric or fluorescent assay, a decrease in fluorescence or color relative to a control or an increase in fluorescence or color relative to a control, depending on the configuration of the lateral flow substrate, and as described further herein.
[0067] In certain example embodiments, the masking construct may comprise a HCR initiator sequence and a cutting motif, or a cleavable structural element, such as a loop or hairpin, that prevents the initiator from initiating the HCR reaction. The cutting motif may be preferentially cut by one of the activated CRISPR effector proteins. Upon cleavage of the cutting motif or structure element by an activated CRISPR effector protein, the initiator is then released to trigger the HCR reaction, detection thereof indicating the presence of one or more targets in the sample. In certain example embodiments, the masking construct comprises a hairpin with a RNA loop. When an activated CRISPR effector protein cuts the RNA loop, the initiator can be released to trigger the HCR reaction.
[0068] In certain example embodiments, the masking construct may suppress generation of a gene product. The gene product may be encoded by a reporter construct that is added to the sample. The masking construct may be an interfering RNA involved in a RNA interference pathway, such as a short hairpin RNA (shRNA) or small interfering RNA (siRNA). The masking construct may also comprise microRNA (miRNA). While present, the masking construct suppresses expression of the gene product. The gene product may be a fluorescent protein or other RNA transcript or proteins that would otherwise be detectable by a labeled probe, aptamer, or antibody but for the presence of the masking construct. Upon activation of the effector protein the masking construct is cleaved or otherwise silenced allowing for expression and detection of the gene product as the positive detectable signal.
[0069] In specific embodiments, the masking construct comprises a silencing RNA that suppresses generation of a gene product encoded by a reporting construct, wherein the gene product generates the detectable positive signal when expressed.
[0070] In certain example embodiments, the masking construct may sequester one or more reagents needed to generate a detectable positive signal such that release of the one or more reagents from the masking construct results in generation of the detectable positive signal. The one or more reagents may combine to produce a colorimetric signal, a chemiluminescent signal, a fluorescent signal, or any other detectable signal and may comprise any reagents known to be suitable for such purposes. In certain example embodiments, the one or more reagents are sequestered by RNA aptamers that bind the one or more reagents. The one or more reagents are released when the effector protein is activated upon detection of a target molecule and the RNA or DNA aptamers are degraded.
[0071] In certain example embodiments, the masking construct may be immobilized on a solid substrate in an individual discrete volume (defined further below) and sequesters a single reagent. For example, the reagent may be a bead comprising a dye. When sequestered by the immobilized reagent, the individual beads are too diffuse to generate a detectable signal, but upon release from the masking construct are able to generate a detectable signal, for example by aggregation or simple increase in solution concentration. In certain example embodiments, the immobilized masking agent is a RNA- or DNA-based aptamer that can be cleaved by the activated effector protein upon detection of a target molecule.
[0072] In certain other example embodiments, the masking construct binds to an immobilized reagent in solution thereby blocking the ability of the reagent to bind to a separate labeled binding partner that is free in solution. Thus, upon application of a washing step to a sample, the labeled binding partner can be washed out of the sample in the absence of a target molecule. However, if the effector protein is activated, the masking construct is cleaved to a degree sufficient to interfere with the ability of the masking construct to bind the reagent thereby allowing the labeled binding partner to bind to the immobilized reagent. Thus, the labeled binding partner remains after the wash step indicating the presence of the target molecule in the sample. In certain aspects, the masking construct that binds the immobilized reagent is a DNA or RNA aptamer. The immobilized reagent may be a protein and the labeled binding partner may be a labeled antibody. Alternatively, the immobilized reagent may be streptavidin and the labeled binding partner may be labeled biotin. The label on the binding partner used in the above embodiments may be any detectable label known in the art. In addition, other known binding partners may be used in accordance with the overall design described herein.
[0073] In certain example embodiments, the masking construct may comprise a ribozyme. Ribozymes are RNA molecules having catalytic properties. Ribozymes, both naturally and engineered, comprise or consist of RNA that may be targeted by the effector proteins disclosed herein. The ribozyme may be selected or engineered to catalyze a reaction that either generates a negative detectable signal or prevents generation of a positive control signal. Upon deactivation of the ribozyme by the activated effector protein the reaction generating a negative control signal, or preventing generation of a positive detectable signal, is removed thereby allowing a positive detectable signal to be generated. In one example embodiment, the ribozyme may catalyze a colorimetric reaction causing a solution to appear as a first color. When the ribozyme is deactivated the solution then turns to a second color, the second color being the detectable positive signal. An example of how ribozymes can be used to catalyze a colorimetric reaction are described in Zhao et al. “Signal amplification of glucosamine-6-phosphate based on ribozyme glmS,” Biosens Bioelectron. 2014; 16:337-42, and provide an example of how such a system could be modified to work in the context of the embodiments disclosed herein. Alternatively, ribozymes, when present can generate cleavage products of, for example, RNA transcripts. Thus, detection of a positive detectable signal may comprise detection of non-cleaved RNA transcripts that are only generated in the absence of the ribozyme.
[0074] In some embodiments, the masking construct may be a ribozyme that generates a negative detectable signal, and wherein a positive detectable signal is generated when the ribozyme is deactivated.
[0075] In certain example embodiments, the one or more reagents is a protein, such as an enzyme, capable of facilitating generation of a detectable signal, such as a colorimetric, chemiluminescent, or fluorescent signal, that is inhibited or sequestered such that the protein cannot generate the detectable signal by the binding of one or more DNA or RNA aptamers to the protein. Upon activation of the effector proteins disclosed herein, the DNA or RNA aptamers are cleaved or degraded to an extent that they no longer inhibit the protein's ability to generate the detectable signal. In certain example embodiments, the aptamer is a thrombin inhibitor aptamer. In certain example embodiments the thrombin inhibitor aptamer has a sequence of GGGAACAAAGCUGAAGUACUUACCC (SEQ ID NO: 8). When this aptamer is cleaved, thrombin will become active and will cleave a peptide colorimetric or fluorescent substrate. In certain example embodiments, the colorimetric substrate is para-nitroanilide (pNA) covalently linked to the peptide substrate for thrombin. Upon cleavage by thrombin, pNA is released and becomes yellow in color and easily visible to the eye. In certain example embodiments, the fluorescent substrate is 7-amino-4-methylcoumarin a blue fluorophore that can be detected using a fluorescence detector. Inhibitory aptamers may also be used for horseradish peroxidase (HRP), beta-galactosidase, or calf alkaline phosphatase (CAP) and within the general principals laid out above.
[0076] In certain embodiments, RNAse or DNAse activity is detected colorimetrically via cleavage of enzyme-inhibiting aptamers. One potential mode of converting DNAse or RNAse activity into a colorimetric signal is to couple the cleavage of a DNA or RNA aptamer with the re-activation of an enzyme that is capable of producing a colorimetric output. In the absence of RNA or DNA cleavage, the intact aptamer will bind to the enzyme target and inhibit its activity. The advantage of this readout system is that the enzyme provides an additional amplification step: once liberated from an aptamer via collateral activity (e.g. Cpf1 collateral activity), the colorimetric enzyme will continue to produce colorimetric product, leading to a multiplication of signal.
[0077] In certain embodiments, an existing aptamer that inhibits an enzyme with a colorimetric readout is used. Several aptamer/enzyme pairs with colorimetric readouts exist, such as thrombin, protein C, neutrophil elastase, and subtilisin. These proteases have colorimetric substrates based upon pNA and are commercially available. In certain embodiments, a novel aptamer targeting a common colorimetric enzyme is used. Common and robust enzymes, such as beta-galactosidase, horseradish peroxidase, or calf intestinal alkaline phosphatase, could be targeted by engineered aptamers designed by selection strategies such as SELEX. Such strategies allow for quick selection of aptamers with nanomolar binding efficiencies and could be used for the development of additional enzyme/aptamer pairs for colorimetric readout.
[0078] In certain embodiments, the masking construct may be a DNA or RNA aptamer and/or may comprise a DNA or RNA-tethered inhibitor.
[0079] In certain embodiments, the masking construct may comprise a DNA or RNA oligonucleotide to which a detectable ligand and a masking component are attached.
[0080] In certain embodiments, RNAse or DNase activity is detected colorimetrically via cleavage of RNA-tethered inhibitors. Many common colorimetric enzymes have competitive, reversible inhibitors: for example, beta-galactosidase can be inhibited by galactose. Many of these inhibitors are weak, but their effect can be increased by increases in local concentration. By linking local concentration of inhibitors to DNase RNAse activity, colorimetric enzyme and inhibitor pairs can be engineered into DNase and RNAse sensors. The colorimetric DNase or RNAse sensor based upon small-molecule inhibitors involves three components: the colorimetric enzyme, the inhibitor, and a bridging RNA or DNA that is covalently linked to both the inhibitor and enzyme, tethering the inhibitor to the enzyme. In the uncleaved configuration, the enzyme is inhibited by the increased local concentration of the small molecule; when the DNA or RNA is cleaved (e.g. by Cas13 or Cas12 collateral cleavage), the inhibitor will be released and the colorimetric enzyme will be activated.
[0081] In certain embodiments, the aptamer or DNA- or RNA-tethered inhibitor may sequester an enzyme, wherein the enzyme generates a detectable signal upon release from the aptamer or DNA or RNA tethered inhibitor by acting upon a substrate. In some embodiments, the aptamer may be an inhibitor aptamer that inhibits an enzyme and prevents the enzyme from catalyzing generation of a detectable signal from a substance. In some embodiments, the DNA- or RNA-tethered inhibitor may inhibit an enzyme and may prevent the enzyme from catalyzing generation of a detectable signal from a substrate.
[0082] In certain embodiments, RNAse activity is detected colorimetrically via formation and/or activation of G-quadruplexes. G quadruplexes in DNA can complex with heme (iron (III)-protoporphyrin IX) to form a DNAzyme with peroxidase activity. When supplied with a peroxidase substrate (e.g. ABTS: (2,2′-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt)), the G-quadruplex-heme complex in the presence of hydrogen peroxide causes oxidation of the substrate, which then forms a green color in solution. An example G-quadruplex forming DNA sequence is: GGGTAGGGCGGGTTGGGA (SEQ ID NO: 9). By hybridizing an additional DNA or RNA sequence, referred to herein as a “staple,” to this DNA aptamer, formation of the G-quadraplex structure will be limited. Upon collateral activation, the staple will be cleaved allowing the G quadraplex to form and heme to bind. This strategy is particularly appealing because color formation is enzymatic, meaning there is additional amplification beyond collateral activation.
[0083] In certain embodiments, the masking construct may comprise an RNA oligonucleotide designed to bind a G-quadruplex forming sequence, wherein a G-quadruplex structure is formed by the G-quadruplex forming sequence upon cleavage of the masking construct, and wherein the G-quadruplex structure generates a detectable positive signal.
[0084] In certain example embodiments, the masking construct may be immobilized on a solid substrate in an individual discrete volume (defined further below) and sequesters a single reagent. For example, the reagent may be a bead comprising a dye. When sequestered by the immobilized reagent, the individual beads are too diffuse to generate a detectable signal, but upon release from the masking construct are able to generate a detectable signal, for example by aggregation or simple increase in solution concentration. In certain example embodiments, the immobilized masking agent is a DNA- or RNA-based aptamer that can be cleaved by the activated effector protein upon detection of a target molecule.
[0085] In one example embodiment, the masking construct comprises a detection agent that changes color depending on whether the detection agent is aggregated or dispersed in solution. For example, certain nanoparticles, such as colloidal gold, undergo a visible purple to red color shift as they move from aggregates to dispersed particles. Accordingly, in certain example embodiments, such detection agents may be held in aggregate by one or more bridge molecules. At least a portion of the bridge molecule comprises RNA or DNA. Upon activation of the effector proteins disclosed herein, the RNA or DNA portion of the bridge molecule is cleaved allowing the detection agent to disperse and resulting in the corresponding change in color. In certain example embodiments, the detection agent is a colloidal metal. The colloidal metal material may include water-insoluble metal particles or metallic compounds dispersed in a liquid, a hydrosol, or a metal sol. The colloidal metal may be selected from the metals in groups IA, IB, IIB and IIIB of the periodic table, as well as the transition metals, especially those of group VIII. Preferred metals include gold, silver, aluminum, ruthenium, zinc, iron, nickel and calcium. Other suitable metals also include the following in all of their various oxidation states: lithium, sodium, magnesium, potassium, scandium, titanium, vanadium, chromium, manganese, cobalt, copper, gallium, strontium, niobium, molybdenum, palladium, indium, tin, tungsten, rhenium, platinum, and gadolinium. The metals are preferably provided in ionic form, derived from an appropriate metal compound, for example the A13+, Ru3+, Zn2+, Fe3+, Ni2+ and Ca2+ ions.
[0086] When the RNA or DNA bridge is cut by the activated CRISPR effector, the aforementioned color shift is observed. In certain example embodiments the particles are colloidal metals. In certain other example embodiments, the colloidal metal is a colloidal gold. In certain example embodiments, the colloidal nanoparticles are 15 nm gold nanoparticles (AuNPs). Due to the unique surface properties of colloidal gold nanoparticles, maximal absorbance is observed at 520 nm when fully dispersed in solution and appear red in color to the naked eye. Upon aggregation of AuNPs, they exhibit a red-shift in maximal absorbance and appear darker in color, eventually precipitating from solution as a dark purple aggregate. In certain example embodiments the nanoparticles are modified to include DNA linkers extending from the surface of the nanoparticle. Individual particles are linked together by single-stranded RNA (ssRNA) or single-stranded DNA bridges that hybridize on each end to at least a portion of the DNA linkers. Thus, the nanoparticles will form a web of linked particles and aggregate, appearing as a dark precipitate. Upon activation of the CRISPR effectors disclosed herein, the ssRNA or ssDNA bridge will be cleaved, releasing the AU NPS from the linked mesh and producing a visible red color. Example DNA linkers and bridge sequences are listed below. Thiol linkers on the end of the DNA linkers may be used for surface conjugation to the AuNPS. Other forms of conjugation may be used. In certain example embodiments, two populations of AuNPs may be generated, one for each DNA linker. This will help facilitate proper binding of the ssRNA bridge with proper orientation. In certain example embodiments, a first DNA linker is conjugated by the 3′ end while a second DNA linker is conjugated by the 5′ end.
[0087] In certain other example embodiments, the masking construct may comprise an RNA or DNA oligonucleotide to which are attached a detectable label and a masking agent of that detectable label. An example of such a detectable label/masking agent pair is a fluorophore and a quencher of the fluorophore. Quenching of the fluorophore can occur as a result of the formation of a non-fluorescent complex between the fluorophore and another fluorophore or non-fluorescent molecule. This mechanism is known as ground-state complex formation, static quenching, or contact quenching. Accordingly, the RNA or DNA oligonucleotide may be designed so that the fluorophore and quencher are in sufficient proximity for contact quenching to occur. Fluorophores and their cognate quenchers are known in the art and can be selected for this purpose by one having ordinary skill in the art. The particular fluorophore/quencher pair is not critical in the context of this invention, only that selection of the fluorophore/quencher pairs ensures masking of the fluorophore. Upon activation of the effector proteins disclosed herein, the RNA or DNA oligonucleotide is cleaved thereby severing the proximity between the fluorophore and quencher needed to maintain the contact quenching effect. Accordingly, detection of the fluorophore may be used to determine the presence of a target molecule in a sample.
[0088] In certain other example embodiments, the masking construct may comprise one or more RNA oligonucleotides to which are attached one or more metal nanoparticles, such as gold nanoparticles. In some embodiments, the masking construct comprises a plurality of metal nanoparticles crosslinked by a plurality of RNA or DNA oligonucleotides forming a closed loop. In one embodiment, the masking construct comprises three gold nanoparticles crosslinked by three RNA or DNA oligonucleotides forming a closed loop. In some embodiments, the cleavage of the RNA or DNA oligonucleotides by the CRISPR effector protein leads to a detectable signal produced by the metal nanoparticles.
[0089] In certain other example embodiments, the masking construct may comprise one or more RNA or DNA oligonucleotides to which are attached one or more quantum dots. In some embodiments, the cleavage of the RNA or DNA oligonucleotides by the CRISPR effector protein leads to a detectable signal produced by the quantum dots.
[0090] In one example embodiment, the masking construct may comprise a quantum dot. The quantum dot may have multiple linker molecules attached to the surface. At least a portion of the linker molecule comprises RNA or DNA. The linker molecule is attached to the quantum dot at one end and to one or more quenchers along the length or at terminal ends of the linker such that the quenchers are maintained in sufficient proximity for quenching of the quantum dot to occur. The linker may be branched. As above, the quantum dot/quencher pair is not critical, only that selection of the quantum dot/quencher pair ensures masking of the fluorophore. Quantum dots and their cognate quenchers are known in the art and can be selected for this purpose by one having ordinary skill in the art. Upon activation of the effector proteins disclosed herein, the RNA or DNA portion of the linker molecule is cleaved thereby eliminating the proximity between the quantum dot and one or more quenchers needed to maintain the quenching effect. In certain example embodiments the quantum dot is streptavidin conjugated. RNA or DNA are attached via biotin linkers and recruit quenching molecules with the sequences /5Biosg/UCUCGUACGUUC/3IAbRQSp/ (SEQ ID NO: 10) or /5Biosg/UCUCGUACGUUCUCUCGUACGUUC/3IAbRQSp/ (SEQ ID NO. 11) where /5Biosg/ is a biotin tag and /31AbRQSp/ is an Iowa black quencher (Iowa Black FQ). Upon cleavage, by the activated effectors disclosed herein the quantum dot will fluoresce visibly.
[0091] In specific embodiments, the detectable ligand may be a fluorophore and the masking component may be a quencher molecule.
[0092] In a similar fashion, fluorescence energy transfer (FRET) may be used to generate a detectable positive signal. FRET is a non-radiative process by which a photon from an energetically excited fluorophore (i.e. “donor fluorophore”) raises the energy state of an electron in another molecule (i.e. “the acceptor”) to higher vibrational levels of the excited singlet state. The donor fluorophore returns to the ground state without emitting a fluoresce characteristic of that fluorophore. The acceptor can be another fluorophore or non-fluorescent molecule. If the acceptor is a fluorophore, the transferred energy is emitted as fluorescence characteristic of that fluorophore. If the acceptor is a non-fluorescent molecule the absorbed energy is loss as heat. Thus, in the context of the embodiments disclosed herein, the fluorophore/quencher pair is replaced with a donor fluorophore/acceptor pair attached to the oligonucleotide molecule. When intact, the masking construct generates a first signal (negative detectable signal) as detected by the fluorescence or heat emitted from the acceptor. Upon activation of the effector proteins disclosed herein the RNA oligonucleotide is cleaved and FRET is disrupted such that fluorescence of the donor fluorophore is now detected (positive detectable signal).
[0093] In certain example embodiments, the masking construct comprises the use of intercalating dyes which change their absorbance in response to cleavage of long RNAs or DNAs to short nucleotides. Several such dyes exist. For example, pyronine-Y will complex with RNA and form a complex that has an absorbance at 572 nm. Cleavage of the RNA results in loss of absorbance and a color change. Methylene blue may be used in a similar fashion, with changes in absorbance at 688 nm upon RNA cleavage. Accordingly, in certain example embodiments the masking construct comprises a RNA and intercalating dye complex that changes absorbance upon the cleavage of RNA by the effector proteins disclosed herein.
[0094] In certain example embodiments, the masking construct may comprise an initiator for an HCR reaction. See e.g. Dirks and Pierce. PNAS 101, 15275-15728 (2004). HCR reactions utilize the potential energy in two hairpin species. When a single-stranded initiator having a portion of complementary to a corresponding region on one of the hairpins is released into the previously stable mixture, it opens a hairpin of one species. This process, in turn, exposes a single-stranded region that opens a hairpin of the other species. This process, in turn, exposes a single stranded region identical to the original initiator. The resulting chain reaction may lead to the formation of a nicked double helix that grows until the hairpin supply is exhausted. Detection of the resulting products may be done on a gel or colorimetrically. Example colorimetric detection methods include, for example, those disclosed in Lu et al. “Ultra-sensitive colorimetric assay system based on the hybridization chain reaction-triggered enzyme cascade amplification ACS Appl Mater Interfaces, 2017, 9(1):167-175, Wang et al. “An enzyme-free colorimetric assay using hybridization chain reaction amplification and split aptamers” Analyst 2015, 150, 7657-7662, and Song et al. “Non covalent fluorescent labeling of hairpin DNA probe coupled with hybridization chain reaction for sensitive DNA detection.” Applied Spectroscopy, 70(4): 686-694 (2016).
[0095] In certain example embodiments, the masking construct may comprise a HCR initiator sequence and a cleavable structural element, such as a loop or hairpin, that prevents the initiator from initiating the HCR reaction. Upon cleavage of the structure element by an activated CRISPR effector protein, the initiator is then released to trigger the HCR reaction, detection thereof indicating the presence of one or more targets in the sample. In certain example embodiments, the masking construct comprises a hairpin with a RNA loop. When an activated CRISRP effector protein cuts the RNA loop, the initiator can be released to trigger the HCR reaction.
[0096] In certain example embodiments, the masking construct may comprise a HCR initiator sequence and a cutting motif, or a cleavable structural element, such as a loop or hairpin, that prevents the initiator from initiating the HCR reaction. The cutting motif may be preferentially cut by one of the activated CRISPR effector proteins. Upon cleavage of the cutting motif or structure element by an activated CRISPR effector protein, the initiator is then released to trigger the HCR reaction, detection thereof indicating the presence of one or more targets in the sample. In certain example embodiments, the masking construct comprises a hairpin with a RNA loop. When an activated CRISPR effector protein cuts the RNA loop, the initiator can be released to trigger the HCR reaction.
[0097] In embodiments, different orthologs with different sequence specificities may be used. Cutting motifs may be used to take advantage of the sequence specificities of different orthologs. The masking construct can comprise a cutting motif preferentially cut by a Cas protein. A cutting motif sequence can be a particular nucleotide base, a repeat nucleotide base in a homopolymer, or a heteropolymer of bases. The cutting motif can be a dinucleotide sequence, a trinucleotide sequence or more complex motifs comprising 4, 5, 6, 7, 8, 9, or 10 nucleotide motifs. For example, one orthologue may preferentially cut A, while others preferentially cut C, G, U/T. Reference is made to Gootenberg, et al., “Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6,” Science. 2018 Apr. 27; 360(6387):439-444. doi: 10.1126/science.aaq0179, and WO 2019/126577, incorporated by reference in their entirety. Accordingly, masking constructs completely comprising, or comprised of a substantial portion, of a single nucleotide may be generated, each with a different fluorophore that can be detected at differing wavelengths. In this way up to four different targets may be screened in a single individual discrete volume. In certain example embodiments, different orthologues from a same class of CRISPR effector protein may be used, such as two Cas13a orthologues, two Cas13b orthologues, or two Cas13c orthologues. In certain other example embodiments, different orthologues with different nucleotide editing preferences may be used such as a Cas13a and Cas13b orthologs, or a Cas13a and a Cas13c orthologs, or a Cas13b orthologs and a Cas13c orthologs etc. In certain example embodiments, a Cas13 protein with a polyU preference and a Cas13 protein with a polyA preference are used. In certain example embodiments, the Cas13 protein with a polyU preference is a Prevotella intermedia Cas13b, and the Cas13 protein with a polyA preference is a Prevotella sp. MA2106 Cas13b protein (PsmCas13b). In certain example embodiments, the Cas13 protein with a polyU preference is a Leptotrichia wadei Cas13a (LwaCas13a) protein and the Cas13 protein with a poly A preference is a Prevotella sp. MA2106 Cas13b protein. In certain example embodiments, the Cas13 protein with a polyU preference is Capnocytophaga canimorsus Cas13b protein (CcaCas13b).
[0098] In certain example embodiments, the masking construct suppresses generation of a detectable positive signal until cleaved, or modified by an activated CRISPR effector protein. In some embodiments, the masking construct may suppress generation of a detectable positive signal by masking the detectable positive signal, or generating a detectable negative signal instead.
CRISPR Systems
[0099] In some embodiments, the first end of the lateral flow device comprises two or more CRISPR effector systems, also referred to as a CRISPR-Cas or CRISPR system. In some embodiments, such a CRISPR effector system may include a CRISPR effector protein and one or more guide sequences configured to bind to one or more target sequences.
[0100] The two or more CRISPR effector systems may be RNA-targeting effector proteins, DNA-targeting effector proteins, or a combination thereof. The RNA-targeting effector proteins may be a Cas13 protein, such as Cas13a, Cas13b, or Cas13c. The DNA-targeting effector protein may be a Cas12 protein such as Cpf1 and C2c1.
[0101] In general, a CRISPR-Cas or CRISPR system as used herein and in documents, such as WO 2014/093622 (PCT/US2013/074667), refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or “RNA(s)” as that term is herein used (e.g., RNA(s) to guide Cas, such as Cas9, e.g. CRISPR RNA and transactivating (tracr) RNA or a single guide RNA (sgRNA) (chimeric RNA)) or other sequences and transcripts from a CRISPR locus. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system). When the CRISPR protein is a C2c2 protein, a tracrRNA is not required. C2c2 has been described in Abudayyeh et al. (2016) “C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector”; Science; DOI: 10.1126/science.aaf5573; and Shmakov et al. (2015) “Discovery and Functional Characterization of Diverse Class 2 CRISPR-Cas Systems”, Molecular Cell, DOI: dx.doi.org/10.1016/j.molcel.2015.10.008; which are incorporated herein in their entirety by reference. Cas13b has been described in Smargon et al. (2017) “Cas13b Is a Type VI-B CRISPR-Associated RNA-Guided RNases Differentially Regulated by Accessory Proteins Csx27 and Csx28,” Molecular Cell. 65, 1-13; dx.doi.org/10.1016/j.molcel.2016.12.023., which is incorporated herein in its entirety by reference.
[0102] In certain embodiments, a protospacer adjacent motif (PAM) or PAM-like motif directs binding of the effector protein complex as disclosed herein to the target locus of interest. In some embodiments, the PAM may be a 5′ PAM (i.e., located upstream of the 5′ end of the protospacer). In other embodiments, the PAM may be a 3′ PAM (i.e., located downstream of the 5′ end of the protospacer). The term “PAM” may be used interchangeably with the term “PFS” or “protospacer flanking site” or “protospacer flanking sequence”.
[0103] In a preferred embodiment, the CRISPR effector protein may recognize a 3′ PAM. In certain embodiments, the CRISPR effector protein may recognize a 3′ PAM which is 5′H, wherein H is A, C or U. In certain embodiments, the effector protein may be Leptotrichia shahii C2c2p, more preferably Leptotrichia shahii DSM 19757 C2c2, and the 3′ PAM is a 5′ H.
[0104] In the context of formation of a CRISPR complex, “target molecule” or “target sequence” or “target nucleic acid” refers to a molecule harboring a sequence, or a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. A target sequence may comprise RNA polynucleotides. The term “target RNA” refers to a RNA polynucleotide being or comprising the target sequence. In other words, the target RNA may be a RNA polynucleotide or a part of a RNA polynucleotide to which a part of the gRNA, i.e. the guide sequence, is designed to have complementarity and to which the effector function mediated by the complex comprising CRISPR effector protein and a gRNA is to be directed. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. A target sequence may comprise DNA polynucleotides.
[0105] As such, a CRISPR system may comprise RNA-targeting effector proteins. A CRISPR system may comprise DNA-targeting effector proteins. In some embodiments, a CRISPR system may comprise a combination of RNA- and DNA-targeting effector proteins, or effector proteins that target both RNA and DNA.
[0106] The nucleic acid molecule encoding a CRISPR effector protein, in particular C2c2, is advantageously codon optimized CRISPR effector protein. An example of a codon optimized sequence, is in this instance a sequence optimized for expression in eukaryotes, e.g., humans (i.e. being optimized for expression in humans), or for another eukaryote, animal or mammal as herein discussed; see, e.g., SaCas9 human codon optimized sequence in WO 2014/093622 (PCT/US2013/074667). Whilst this is preferred, it will be appreciated that other examples are possible and codon optimization for a host species other than human, or for codon optimization for specific organs is known. In some embodiments, an enzyme coding sequence encoding a CRISPR effector protein is a codon optimized for expression in particular cells, such as eukaryotic cells. The eukaryotic cells may be those of or derived from a particular organism, such as a plant or a mammal, including but not limited to human, or non-human eukaryote or animal or mammal as herein discussed, e.g., mouse, rat, rabbit, dog, livestock, or non-human mammal or primate. In some embodiments, processes for modifying the germ line genetic identity of human beings and/or processes for modifying the genetic identity of animals which are likely to cause them suffering without any substantial medical benefit to man or animal, and also animals resulting from such processes, may be excluded. In general, codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon (e.g. about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons) of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Various species exhibit particular bias for certain codons of a particular amino acid. Codon bias (differences in codon usage between organisms) often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, among other things, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example, at the “Codon Usage Database” available at kazusa.orjp/codon/and these tables can be adapted in a number of ways. See Nakamura, Y., et al. “Codon usage tabulated from the international DNA sequence databases: status for the year 2000” Nucl. Acids Res. 28:292 (2000). Computer algorithms for codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge (Aptagen; Jacobus, Pa.), are also available. In some embodiments, one or more codons (e.g. 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more, or all codons) in a sequence encoding a Cas correspond to the most frequently used codon for a particular amino acid.
[0107] In certain embodiments, the methods as described herein may comprise providing a Cas transgenic cell, in particular a C2c2 transgenic cell, in which one or more nucleic acids encoding one or more guide RNAs are provided or introduced operably connected in the cell with a regulatory element comprising a promoter of one or more gene of interest. As used herein, the term “Cas transgenic cell” refers to a cell, such as a eukaryotic cell, in which a Cas gene has been genomically integrated. The nature, type, or origin of the cell are not particularly limiting according to the present invention. Also the way the Cas transgene is introduced in the cell may vary and can be any method as is known in the art. In certain embodiments, the Cas transgenic cell is obtained by introducing the Cas transgene in an isolated cell. In certain other embodiments, the Cas transgenic cell is obtained by isolating cells from a Cas transgenic organism. By means of example, and without limitation, the Cas transgenic cell as referred to herein may be derived from a Cas transgenic eukaryote, such as a Cas knock-in eukaryote. Reference is made to WO 2014/093622 (PCT/US13/74667), incorporated herein by reference. Methods of US Patent Publication Nos. 20120017290 and 20110265198 assigned to Sangamo BioSciences, Inc. directed to targeting the Rosa locus may be modified to utilize the CRISPR Cas system of the present invention. Methods of US Patent Publication No. 20130236946 assigned to Cellectis directed to targeting the Rosa locus may also be modified to utilize the CRISPR Cas system of the present invention. By means of further example reference is made to Platt et. al. (Cell; 159(2):440-455 (2014)), describing a Cas9 knock-in mouse, which is incorporated herein by reference. The Cas transgene can further comprise a Lox-Stop-polyA-Lox(LSL) cassette thereby rendering Cas expression inducible by Cre recombinase. Alternatively, the Cas transgenic cell may be obtained by introducing the Cas transgene in an isolated cell. Delivery systems for transgenes are well known in the art. By means of example, the Cas transgene may be delivered in for instance eukaryotic cell by means of vector (e.g., AAV, adenovirus, lentivirus) and/or particle and/or nanoparticle delivery, as also described herein elsewhere.
[0108] It will be understood by the skilled person that the cell, such as the Cas transgenic cell, as referred to herein may comprise further genomic alterations besides having an integrated Cas gene or the mutations arising from the sequence specific action of Cas when complexed with RNA capable of guiding Cas to a target locus.
[0109] In certain aspects the invention involves vectors, e.g. for delivering or introducing in a cell Cas and/or RNA capable of guiding Cas to a target locus (i.e. guide RNA), but also for propagating these components (e.g. in prokaryotic cells). A used herein, a “vector” is a tool that allows or facilitates the transfer of an entity from one environment to another. It is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. Generally, a vector is capable of replication when associated with the proper control elements. In general, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g. circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art. One type of vector is a “plasmid,” which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector, wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g. retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses (AAVs)). Viral vectors also include polynucleotides carried by a virus for transfection into a host cell. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g. bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively-linked. Such vectors are referred to herein as “expression vectors.” Common expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
[0110] Recombinant expression vectors can comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory elements, which may be selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence (e.g. in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). With regards to recombination and cloning methods, mention is made of U.S. patent application Ser. No. 10/815,730, published Sep. 2, 2004 as US 2004-0171156 A1, the contents of which are herein incorporated by reference in their entirety. Thus, the embodiments disclosed herein may also comprise transgenic cells comprising the CRISPR effector system. In certain example embodiments, the transgenic cell may function as an individual discrete volume. In other words samples comprising a masking construct may be delivered to a cell, for example in a suitable delivery vesicle and if the target is present in the delivery vesicle the CRISPR effector is activated and a detectable signal generated.
[0111] The vector(s) can include the regulatory element(s), e.g., promoter(s). The vector(s) can comprise Cas encoding sequences, and/or a single, but possibly also can comprise at least 3 or 8 or 16 or 32 or 48 or 50 guide RNA(s) (e.g., sgRNAs) encoding sequences, such as 1-2, 1-3, 1-4 1-5, 3-6, 3-7, 3-8, 3-9, 3-10, 3-8, 3-16, 3-30, 3-32, 3-48, 3-50 RNA(s) (e.g., sgRNAs). In a single vector there can be a promoter for each RNA (e.g., sgRNA), advantageously when there are up to about 16 RNA(s); and, when a single vector provides for more than 16 RNA(s), one or more promoter(s) can drive expression of more than one of the RNA(s), e.g., when there are 32 RNA(s), each promoter can drive expression of two RNA(s), and when there are 48 RNA(s), each promoter can drive expression of three RNA(s). By simple arithmetic and well established cloning protocols and the teachings in this disclosure one skilled in the art can readily practice the invention as to the RNA(s) for a suitable exemplary vector such as AAV, and a suitable promoter such as the U6 promoter. For example, the packaging limit of AAV is ˜4.7 kb. The length of a single U6-gRNA (plus restriction sites for cloning) is 361 bp. Therefore, the skilled person can readily fit about 12-16, e.g., 13 U6-gRNA cassettes in a single vector. This can be assembled by any suitable means, such as a golden gate strategy used for TALE assembly (genome-engineering.org/taleffectors/). The skilled person can also use a tandem guide strategy to increase the number of U6-gRNAs by approximately 1.5 times, e.g., to increase from 12-16, e.g., 13 to approximately 18-24, e.g., about 19 U6-gRNAs. Therefore, one skilled in the art can readily reach approximately 18-24, e.g., about 19 promoter-RNAs, e.g., U6-gRNAs in a single vector, e.g., an AAV vector. A further means for increasing the number of promoters and RNAs in a vector is to use a single promoter (e.g., U6) to express an array of RNAs separated by cleavable sequences. And an even further means for increasing the number of promoter-RNAs in a vector, is to express an array of promoter-RNAs separated by cleavable sequences in the intron of a coding sequence or gene; and, in this instance it is advantageous to use a polymerase II promoter, which can have increased expression and enable the transcription of long RNA in a tissue specific manner. (see, e.g., nar.oxfordjoumals.org/content/34/7/e53.short and nature.com/mt/journal/v16/n9/abs/mt2008144a.html). In an advantageous embodiment, AAV may package U6 tandem gRNA targeting up to about 50 genes. Accordingly, from the knowledge in the art and the teachings in this disclosure the skilled person can readily make and use vector(s), e.g., a single vector, expressing multiple RNAs or guides under the control or operatively or functionally linked to one or more promoters—especially as to the numbers of RNAs or guides discussed herein, without any undue experimentation.
[0112] The guide RNA(s) encoding sequences and/or Cas encoding sequences, can be functionally or operatively linked to regulatory element(s) and hence the regulatory element(s) drive expression. The promoter(s) can be constitutive promoter(s) and/or conditional promoter(s) and/or inducible promoter(s) and/or tissue specific promoter(s). The promoter can be selected from the group consisting of RNA polymerases, pol I, pol II, pol III, T7, U6, H1, retroviral Rous sarcoma virus (RSV) LTR promoter, the cytomegalovirus (CMV) promoter, the SV40 promoter, the dihydrofolate reductase promoter, the 3-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1α promoter. An advantageous promoter is the promoter is U6.
[0113] In some embodiments, one or more elements of a nucleic acid-targeting system is derived from a particular organism comprising an endogenous CRISPR RNA-targeting system. In certain example embodiments, the effector protein CRISPR RNA-targeting system comprises at least one HEPN domain, including but not limited to the HEPN domains described herein, HEPN domains known in the art, and domains recognized to be HEPN domains by comparison to consensus sequence motifs. Several such domains are provided herein. In one non-limiting example, a consensus sequence can be derived from the sequences of C2c2 or Cas13b orthologs provided herein. In certain example embodiments, the effector protein comprises a single HEPN domain. In certain other example embodiments, the effector protein comprises two HEPN domains.
[0114] In one example embodiment, the effector protein comprises one or more HEPN domains comprising a RxxxxH motif sequence. The RxxxxH motif sequence can be, without limitation, from a HEPN domain described herein or a HEPN domain known in the art. RxxxxH motif sequences further include motif sequences created by combining portions of two or more HEPN domains. As noted, consensus sequences can be derived from the sequences of the orthologs disclosed in U.S. Provisional Patent Application 62/432,240 entitled “Novel CRISPR Enzymes and Systems,” U.S. Provisional Patent Application 62/471,710 entitled “Novel Type VI CRISPR Orthologs and Systems” filed on Mar. 15, 2017, and U.S. Provisional Patent Application entitled “Novel Type VI CRISPR Orthologs and Systems,” labeled as attorney docket number 47627-05-2133 and filed on Apr. 12, 2017.
[0115] In an embodiment of the invention, a HEPN domain comprises at least one RxxxxH motif comprising the sequence of R(N/H/K)X1X2X3H In an embodiment of the invention, a HEPN domain comprises a RxxxxH motif comprising the sequence of R(N/H)X1X2X3H In an embodiment of the invention, a HEPN domain comprises the sequence of R(N/K)X1X2X3H In certain embodiments, X1 is R, S, D, E, Q, N, G, Y, or H. In certain embodiments, X2 is I, S, T, V, or L. In certain embodiments, X3 is L, F, N, Y, V, I, S, D, E, or A.
[0116] CRISPR-Cas Systems
[0117] Embodiments disclosed herein utilize Cas proteins possessing non-specific nuclease collateral activity to cleave detectable reporters upon target recognition, providing sensitive and specific diagnostics, including single nucleotide variants, detection based on rRNA sequences, screening for drug resistance, monitoring microbe outbreaks, genetic perturbations, and screening of environmental samples, as described, for example, in PCT/US18/054472 filed Oct. 22, 2018 at [0183]-[0327], incorporated herein by reference. Reference is made to WO 2017/219027, WO2018/107129, US20180298445, US 2018-0274017, US 2018-0305773, WO 2018/170340, U.S. application Ser. No. 15/922,837, filed Mar. 15, 2018 entitled “Devices for CRISPR Effector System Based Diagnostics”, PCT/US18/50091, filed Sep. 7, 2018 “Multi-Effector CRISPR Based Diagnostic Systems”, PCT/US18/66940 filed Dec. 20, 2018 entitled “CRISPR Effector System Based Multiplex Diagnostics”, PCT/US18/054472 filed Oct. 4, 2018 entitled “CRISPR Effector System Based Diagnostic”, U.S. Provisional 62/740,728 filed Oct. 3, 2018 entitled “CRISPR Effector System Based Diagnostics for Hemorrhagic Fever Detection”, U.S. Provisional 62/690,278 filed Jun. 26, 2018 and U.S. Provisional 62/767,059 filed Nov. 14, 2018 both entitled “CRISPR Double Nickase Based Amplification, Compositions, Systems and Methods”, U.S. Provisional 62/690,160 filed Jun. 26, 2018 and U.S. Pat. No. 62,767,077 filed Nov. 14, 2018, both entitled “CRISPR/CAS and Transposase Based Amplification Compositions, Systems, And Methods”, U.S. Provisional 62/690,257 filed Jun. 26, 2018 and 62/767,052 filed Nov. 14, 2018 both entitled “CRISPR Effector System Based Amplification Methods, Systems, And Diagnostics”, U.S. Provisional 62/767,076 filed Nov. 14, 2018 entitled “Multiplexing Highly Evolving Viral Variants With SHERLOCK” and 62/767,070 filed Nov. 14, 2018 entitled “Droplet SHERLOCK.” Reference is further made to WO2017/127807, WO2017/184786, WO 2017/184768, WO 2017/189308, WO 2018/035388, WO 2018/170333, WO 2018/191388, WO 2018/213708, WO 2019/005866, PCT/US18/67328 filed Dec. 21, 2018 entitled “Novel CRISPR Enzymes and Systems”, PCT/US18/67225 filed Dec. 21, 2018 entitled “Novel CRISPR Enzymes and Systems” and PCT/US18/67307 filed Dec. 21, 2018 entitled “Novel CRISPR Enzymes and Systems”, U.S. 62/712,809 filed Jul. 31, 2018 entitled “Novel CRISPR Enzymes and Systems”, U.S. 62/744,080 filed Oct. 10, 2018 entitled “Novel Cas12b Enzymes and Systems” and U.S. 62/751,196 filed Oct. 26, 2018 entitled “Novel Cas12b Enzymes and Systems”, U.S. 715,640 filed August 7, 2-18 entitled “Novel CRISPR Enzymes and Systems”, WO 2016/205711, U.S. Pat. No. 9,790,490, WO 2016/205749, WO 2016/205764, WO 2017/070605, WO 2017/106657, and WO 2016/149661, WO2018/035387, WO2018/194963, Cox DBT, et al., RNA editing with CRISPR-Cas13, Science. 2017 Nov. 24; 358(6366):1019-1027; Gootenberg J S, et al., Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6, Science. 2018 Apr. 27; 360(6387):439-444; Gootenberg J S, et al., Nucleic acid detection with CRISPR-Cas13a/C2c2, Science. 2017 Apr. 28; 356(6336):438-442; Abudayyeh 00, et al., RNA targeting with CRISPR-Cas13, Nature. 2017 Oct. 12; 550(7675):280-284; Smargon A A, et al., Cas13b Is a Type VI-B CRISPR-Associated RNA-Guided RNase Differentially Regulated by Accessory Proteins Csx27 and Csx28. Mol Cell. 2017 Feb. 16; 65(4):618-630.e7; Abudayyeh 00, et al., C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector, Science. 2016 Aug. 5; 353(6299):aaf5573; Yang L, et al., Engineering and optimising deaminase fusions for genome editing. Nat Commun. 2016 Nov. 2; 7:13330, Myhrvold et al., Field deployable viral diagnostics using CRISPR-Cas13, Science 2018 360, 444-448, Shmakov et al. “Diversity and evolution of class 2 CRISPR-Cas systems,” Nat Rev Microbiol. 2017 15(3):169-182, each of which is incorporated herein by reference in its entirety.
[0118] When using two or more CRISPR effector systems, the CRISPR effector systems may be RNA-targeting effector proteins, DNA-targeting effector proteins, or a combination thereof. The RNA-targeting effector proteins may be a Type VI Cas protein, such as Cas13 protein, including Cas13b, Cas13c, or Cas13d. The DNA-targeting effector protein may be a Type V Cas protein, such as Cas12a (Cpf1), Cas12b (C2c2), Cas12c (C2c3), Cas X, Cas Y, or Cas14.
[0119] In general, a CRISPR-Cas or CRISPR system as used in herein and in documents, such as WO 2014/093622 (PCT/US2013/074667), refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or “RNA(s)” as that term is herein used (e.g., RNA(s) to guide Cas, such as Cas9, e.g. CRISPR RNA and transactivating (tracr) RNA or a single guide RNA (sgRNA) (chimeric RNA)) or other sequences and transcripts from a CRISPR locus. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system). See, e.g, Shmakov et al. (2015) “Discovery and Functional Characterization of Diverse Class 2 CRISPR-Cas Systems”, Molecular Cell, DOI: dx.doi.org/10.1016/j.molcel.2015.10.008.
RNA Targeting Cas Protein
[0120] In an aspect, the invention utilizes an RNA targeting Cas protein. In certain embodiments, protospacer flanking site, or protospacer flanking sequence (PFS) directs binding of the effector proteins (e.g. Type VI) as disclosed herein to the target locus of interest. A PFS is a region that can affect the efficacy of Cas13a mediated targeting, and may be adjacent to the protospacer target in certain Cas13a proteins, while other orthologs do not require a specific PFS. In a preferred embodiment, the CRISPR effector protein may recognize a 3′ PFS. In certain embodiments, the CRISPR effector protein may recognize a 3′ PFS which is 5′H, wherein H is A, C or U. See, e.g. Abudayyeh, 2016. In certain embodiments, the effector protein may be Leptotrichia shahii Cas13p, more preferably Leptotrichia shahii DSM 19757 Cas13, and the 3′ PFS is a 5′ H.
[0121] In the context of formation of a CRISPR complex, “target molecule” or “target sequence” or “target nucleic acid” refers to a molecule harboring a sequence, or a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. A target sequence may comprise RNA polynucleotides. The term “target RNA” refers to a RNA polynucleotide being or comprising the target sequence. In other words, the target RNA may be a RNA polynucleotide or a part of a RNA polynucleotide to which a part of the gRNA, i.e. the guide sequence, is designed to have complementarity and to which the effector function mediated by the complex comprising CRISPR effector protein and a gRNA is to be directed. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. A target sequence may comprise DNA polynucleotides.
[0122] As such, a CRISPR system may comprise RNA-targeting effector proteins. A CRISPR system may comprise DNA-targeting effector proteins. In some embodiments, a CRISPR system may comprise a combination of RNA- and DNA-targeting effector proteins, or effector proteins that target both RNA and DNA.
[0123] In some embodiments, one or more elements of a nucleic acid-targeting system is derived from a particular organism comprising an endogenous CRISPR RNA-targeting system. In certain example embodiments, the effector protein CRISPR RNA-targeting system comprises at least one HEPN domain, including but not limited to the HEPN domains described herein, HEPN domains known in the art, and domains recognized to be HEPN domains by comparison to consensus sequence motifs. Several such domains are provided herein. In one non-limiting example, a consensus sequence can be derived from the sequences of Cas13a or Cas13b orthologs provided herein. In certain example embodiments, the effector protein comprises a single HEPN domain. In certain other example embodiments, the effector protein comprises two HEPN domains.
[0124] In one example embodiment, the effector protein comprises one or more HEPN domains comprising a RxxxxH motif sequence. The RxxxxH motif sequence can be, without limitation, from a HEPN domain described herein or a HEPN domain known in the art. RxxxxH motif sequences further include motif sequences created by combining portions of two or more HEPN domains. As noted, consensus sequences can be derived from the sequences of the orthologs disclosed in U.S. Provisional Patent Application 62/432,240 entitled “Novel CRISPR Enzymes and Systems,” U.S. Provisional Patent Application 62/471,710 entitled “Novel Type VI CRISPR Orthologs and Systems” filed on Mar. 15, 2017, and U.S. Provisional Patent Application entitled “Novel Type VI CRISPR Orthologs and Systems,” labeled as attorney docket number 47627-05-2133 and filed on Apr. 12, 2017.
[0125] In an embodiment of the invention, a HEPN domain comprises at least one RxxxxH motif comprising the sequence of R(N/H/K)X1X2X3H (SEQ ID NO:XX). In an embodiment of the invention, a HEPN domain comprises a RxxxxH motif comprising the sequence of R(N/H)X1X2X3H (SEQ ID NO:XX). In an embodiment of the invention, a HEPN domain comprises the sequence of R(N/K)X1X2X3H (SEQ ID NO:XX). In certain embodiments, X1 is R, S, D, E, Q, N, G, Y, or H. In certain embodiments, X2 is I, S, T, V, or L. In certain embodiments, X3 is L, F, N, Y, V, I, S, D, E, or A.
[0126] In particular embodiments, the Type VI RNA-targeting Cas enzyme is Cas13a. In other example embodiments, the Type VI RNA-targeting Cas enzyme is Cas13b. In certain embodiments, the Cas13b protein is from an organism of a genus selected from the group consisting of: Bergeyella, Prevotella, Porphyromonas, Bacterioides, Alistipes, Riemerella, Myroides, Capnocytophaga, Porphyromonas, Flavobacterium, Porphyromonas, Chryseobacterium, Paludibacter, Psychroflexus, Riemerella, Phaeodactylibacter, Sinomicrobium, Reichenbachiella.
[0127] In particular embodiments, the homologue or orthologue of a Type VI protein such as Cas13a as referred to herein has a sequence homology or identity of at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for instance at least 95% with a Type VI protein such as Cas13a (e.g., based on the wild-type sequence of any of Leptotrichia shahii Cas13a, Lachnospiraceae bacterium MA2020 Cas13a, Lachnospiraceae bacterium NK4A179 Cas13a, Clostridium aminophilum (DSM 10710) Cas13a, Carnobacterium gallinarum (DSM 4847) Cas13, Paludibacter propionicigenes (WB4) Cas13, Listeria weihenstephanensis (FSL R9-0317) Cas13, Listeriaceae bacterium (FSL M6-0635) Cas13, Listeria newyorkensis (FSL M6-0635) Cas13, Leptotrichia wadei (F0279) Cas13, Rhodobacter capsulatus (SB 1003) Cas13, Rhodobacter capsulatus (R121) Cas13, Rhodobacter capsulatus (DE442) Cas13, Leptotrichia wadei (Lw2) Cas13, or Listeria seeligeri Cas13). In further embodiments, the homologue or orthologue of a Type VI protein such as Cas13 as referred to herein has a sequence identity of at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for instance at least 95% with the wild type Cas13 (e.g., based on the wild-type sequence of any of Leptotrichia shahii Cas13, Lachnospiraceae bacterium MA2020 Cas13, Lachnospiraceae bacterium NK4A179 Cas13, Clostridium aminophilum (DSM 10710) Cas13, Carnobacterium gallinarum (DSM 4847) Cas13, Paludibacter propionicigenes (WB4) Cas13, Listeria weihenstephanensis (FSL R9-0317) Cas13, Listeriaceae bacterium (FSL M6-0635) Cas13, Listeria newyorkensis (FSL M6-0635) Cas13, Leptotrichia wadei (F0279) Cas13, Rhodobacter capsulatus (SB 1003) Cas13, Rhodobacter capsulatus (R121) Cas13, Rhodobacter capsulatus (DE442) Cas13, Leptotrichia wadei (Lw2) Cas13, or Listeria seeligeri Cas13).
[0128] In certain other example embodiments, the CRISPR system the effector protein is a Cas13 nuclease. The activity of Cas13 may depend on the presence of two HEPN domains. These have been shown to be RNase domains, i.e. nuclease (in particular an endonuclease) cutting RNA. Cas13a HEPN may also target DNA, or potentially DNA and/or RNA. On the basis that the HEPN domains of Cas13a are at least capable of binding to and, in their wild-type form, cutting RNA, then it is preferred that the Cas13a effector protein has RNase function. Regarding Cas13a CRISPR systems, reference is made to U.S. Provisional 62/351,662 filed on Jun. 17, 2016 and U.S. Provisional 62/376,377 filed on Aug. 17, 2016. Reference is also made to U.S. Provisional 62/351,803 filed on Jun. 17, 2016. Reference is also made to U.S. Provisional entitled “Novel Crispr Enzymes and Systems” filed Dec. 8, 2016 bearing Broad Institute No. 10035.PA4 and Attorney Docket No. 47627.03.2133. Reference is further made to East-Seletsky et al. “Two distinct RNase activities of CRISPR-C2c2 enable guide-RNA processing and RNA detection” Nature doi:10/1038/nature19802 and Abudayyeh et al. “C2c2 is a single-component programmable RNA-guided RNA targeting CRISPR effector” bioRxiv doi:10.1101/054742.
[0129] RNase function in CRISPR systems is known, for example mRNA targeting has been reported for certain type III CRISPR-Cas systems (Hale et al., 2014, Genes Dev, vol. 28, 2432-2443; Hale et al., 2009, Cell, vol. 139, 945-956; Peng et al., 2015, Nucleic acids research, vol. 43, 406-417) and provides significant advantages. In the Staphylococcus epidermis type III-A system, transcription across targets results in cleavage of the target DNA and its transcripts, mediated by independent active sites within the Cas10-Csm ribonucleoprotein effector protein complex (see, Samai et al., 2015, Cell, vol. 151, 1164-1174). A CRISPR-Cas system, composition or method targeting RNA via the present effector proteins is thus provided.
[0130] In an embodiment, the Cas protein may be a Cas13a ortholog of an organism of a genus which includes but is not limited to Leptotrichia, Listeria, Corynebacter, Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma and Campylobacter. Species of organism of such a genus can be as otherwise herein discussed.
[0131] It will be appreciated that any of the functionalities described herein may be engineered into CRISPR enzymes from other orthologs, including chimeric enzymes comprising fragments from multiple orthologs. Examples of such orthologs are described elsewhere herein. Thus, chimeric enzymes may comprise fragments of CRISPR enzyme orthologs of an organism which includes but is not limited to Leptotrichia, Listeria, Corynebacter, Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma and Campylobacter. A chimeric enzyme can comprise a first fragment and a second fragment, and the fragments can be of CRISPR enzyme orthologs of organisms of genera herein mentioned or of species herein mentioned; advantageously the fragments are from CRISPR enzyme orthologs of different species.
[0132] In embodiments, the Cas13a protein as referred to herein also encompasses a functional variant of Cas13a or a homologue or an orthologue thereof. A “functional variant” of a protein as used herein refers to a variant of such protein which retains at least partially the activity of that protein. Functional variants may include mutants (which may be insertion, deletion, or replacement mutants), including polymorphs, etc. Also included within functional variants are fusion products of such protein with another, usually unrelated, nucleic acid, protein, polypeptide or peptide. Functional variants may be naturally occurring or may be man-made. Advantageous embodiments can involve engineered or non-naturally occurring Type VI RNA-targeting effector protein.
[0133] In an embodiment, nucleic acid molecule(s) encoding the Cas13 or an ortholog or homolog thereof, may be codon-optimized for expression in a eukaryotic cell. A eukaryote can be as herein discussed. Nucleic acid molecule(s) can be engineered or non-naturally occurring.
[0134] In an embodiment, the Cas13a or an ortholog or homolog thereof, may comprise one or more mutations (and hence nucleic acid molecule(s) coding for same may have mutation(s). The mutations may be artificially introduced mutations and may include but are not limited to one or more mutations in a catalytic domain. Examples of catalytic domains with reference to a Cas9 enzyme may include but are not limited to RuvC I, RuvC II, RuvC III and HNH domains.
[0135] In an embodiment, the Cas13a or an ortholog or homolog thereof, may comprise one or more mutations. The mutations may be artificially introduced mutations and may include but are not limited to one or more mutations in a catalytic domain. Examples of catalytic domains with reference to a Cas enzyme may include but are not limited to HEPN domains.
[0136] In an embodiment, the Cas13a or an ortholog or homolog thereof, may be used as a generic nucleic acid binding protein with fusion to or being operably linked to a functional domain. Exemplary functional domains may include but are not limited to translational initiator, translational activator, translational repressor, nucleases, in particular ribonucleases, a spliceosome, beads, a light inducible/controllable domain or a chemically inducible/controllable domain.
[0137] In certain example embodiments, the Cas13a effector protein may be from an organism selected from the group consisting of, Leptotrichia, Listeria, Corynebacter, Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma, and Campylobacter.
[0138] In certain embodiments, the effector protein may be a Listeria sp. Cas13p, preferably Listeria seeligeria Cas13p, more preferably Listeria seeligeria serovar 1/2b str. SLCC3954 Cas13p and the crRNA sequence may be 44 to 47 nucleotides in length, with a 5′ 29-nt direct repeat (DR) and a 15-nt to 18-nt spacer.
[0139] In certain embodiments, the effector protein may be a Leptotrichia sp. Cas13p, preferably Leptotrichia shahii Cas13p, more preferably Leptotrichia shahii DSM 19757 Cas13p and the crRNA sequence may be 42 to 58 nucleotides in length, with a 5′ direct repeat of at least 24 nt, such as a 5′ 24-28-nt direct repeat (DR) and a spacer of at least 14 nt, such as a 14-nt to 28-nt spacer, or a spacer of at least 18 nt, such as 19, 20, 21, 22, or more nt, such as 18-28, 19-28, 20-28, 21-28, or 22-28 nt.
[0140] In certain example embodiments, the effector protein may be a Leptotrichia sp., Leptotrichia wadei F0279, or a Listeria sp., preferably Listeria newyorkensis FSL M6-0635.
[0141] In certain example embodiments, the Cas13 effector proteins of the invention include, without limitation, the following 21 ortholog species (including multiple CRISPR loci: Leptotrichia shahii; Leptotrichia wadei (Lw2); Listeria seeligeri; Lachnospiraceae bacterium MA2020; Lachnospiraceae bacterium NK4A179; [Clostridium] aminophilum DSM 10710; Carnobacterium gallinarum DSM 4847; Carnobacterium gallinarum DSM 4847 (second CRISPR Loci); Paludibacter propionicigenes WB4; Listeria weihenstephanensis FSL R9-0317; Listeriaceae bacterium FSL M6-0635; Leptotrichia wadei F0279; Rhodobacter capsulatus SB 1003; Rhodobacter capsulatus R121; Rhodobacter capsulatus DE442; Leptotrichia buccalis C-1013-b; Herbinix hemicellulosilytica; [Eubacterium] rectale; Eubacteriaceae bacterium CHKCI004; Blautia sp. Marseille-P2398; and Leptotrichia sp. oral taxon 879 str. F0557. Twelve (12) further non-limiting examples are: Lachnospiraceae bacterium NK4A144; Chloroflexus aggregans; Demequina aurantiaca; Thalassospira sp. TSL5-1; Pseudobutyrivibrio sp. OR37; Butyrivibrio sp. YAB3001; Blautia sp. Marseille-P2398; Leptotrichia sp. Marseille-P3007; Bacteroides ihuae; Porphyromonadaceae bacterium KH3CP3RA; Listeria riparia; and Insolitispirillum peregrinum.
[0142] In certain embodiments, the Cas13 protein according to the invention is or is derived from one of the orthologues as described herein, or is a chimeric protein of two or more of the orthologues as described herein, or is a mutant or variant of one of the orthologues as described in the table below (or a chimeric mutant or variant), including dead Cas13, split Cas13, destabilized Cas13, etc. as defined herein elsewhere, with or without fusion with a heterologous/functional domain.
[0143] In certain example embodiments, the Cas13a effector protein is from an organism of a genus selected from the group consisting of: Leptotrichia, Listeria, Corynebacter, Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma, Campylobacter, and Lachnospira.
[0144] In an embodiment of the invention, there is provided an effector protein which comprises an amino acid sequence having at least 80% sequence homology to the wild-type sequence of any of Leptotrichia shahii Cas13, Lachnospiraceae bacterium MA2020 Cas13, Lachnospiraceae bacterium NK4A179 Cas13, Clostridium aminophilum (DSM 10710) Cas13, Carnobacterium gallinarum (DSM 4847) Cas13, Paludibacter propionicigenes (WB4) Cas13, Listeria weihenstephanensis (FSL R9-0317) Cas13, Listeriaceae bacterium (FSL M6-0635) Cas13, Listeria newyorkensis (FSL M6-0635) Cas13, Leptotrichia wadei (F0279) Cas13, Rhodobacter capsulatus (SB 1003) Cas13, Rhodobacter capsulatus (R121) Cas13, Rhodobacter capsulatus (DE442) Cas13, Leptotrichia wadei (Lw2) Cas13, or Listeria seeligeri Cas13. According to the invention, a consensus sequence can be generated from multiple Cas13 orthologs, which can assist in locating conserved amino acid residues, and motifs, including but not limited to catalytic residues and HEPN motifs in Cas13 orthologs that mediate Cas13 function. One such consensus sequence, generated from selected orthologs.
[0145] In an embodiment of the invention, the effector protein comprises an amino acid sequence having at least 80% sequence homology to a Type VI effector protein consensus sequence including but not limited to a consensus sequence described herein.
[0146] In another non-limiting example, a sequence alignment tool to assist generation of a consensus sequence and identification of conserved residues is the MUSCLE alignment tool (www.ebi.ac.uk/Tools/msa/muscle/). For example, using MUSCLE, the following amino acid locations conserved among Cas13a orthologs can be identified in Leptotrichia wadei Cas13a:K2; K5; V6; E301; L331; I335; N341; G351; K352; E375; L392; L396; D403; F446; I466; I470; R474 (HEPN); H475; H479 (HEPN), E508; P556; L561; I595; Y596; F600; Y669; I673; F681; L685; Y761; L676; L779; Y782; L836; D847; Y863; L869; I872; K879; I933; L954; I958; R961; Y965; E970; R971; D972; R1046 (HEPN), H1051 (HEPN), Y1075; D1076; K1078; K1080; 11083; 11090.
[0147] In certain example embodiments, the RNA-targeting effector protein is a Type VI-B effector protein, such as Cas13b and Group 29 or Group 30 proteins. In certain example embodiments, the RNA-targeting effector protein comprises one or more HEPN domains. In certain example embodiments, the RNA-targeting effector protein comprises a C-terminal HEPN domain, a N-terminal HEPN domain, or both. Regarding example Type VI-B effector proteins that may be used in the context of this invention, reference is made to U.S. application Ser. No. 15/331,792 entitled “Novel CRISPR Enzymes and Systems” and filed Oct. 21, 2016, International Patent Application No. PCT/US2016/058302 entitled “Novel CRISPR Enzymes and Systems”, and filed Oct. 21, 2016, and Smargon et al. “Cas13b is a Type VI-B CRISPR-associated RNA-Guided RNase differentially regulated by accessory proteins Csx27 and Csx28” Molecular Cell, 65, 1-13 (2017); dx.doi.org/10.1016/j.molcel.2016.12.023. In certain example embodiments, the Cas13b effector protein is, or comprises an amino acid sequence having at least 80% sequence homology to any of the sequences of Table 1 of International Patent Application No. PCT/US2016/058302. Further reference is made to example Type VI-B effector proteins of U.S. Provisional Application Nos. 62/471,710, 62/566,829 and International Patent Publication No. WO2018/1703333, entitled “Novel Cas13b Orthologues CRISPR Enzymes and System”. In particular embodiments, the Cas13b enzyme is derived from Bergeyella zoohelcum. In certain other example embodiments, the effector protein is, or comprises an amino acid sequence having at least 80% sequence homology to any of the sequences listed in Tables 1A or 1B of International Patent Publication No. WO2018/1703333, specifically incorporated herein by reference. In certain embodiments, the Cas13b effector protein is, or comprises an amino acid sequence having at least 80% sequence homology to any of the polypeptides in U.S. Provisional Applications 62/484,791, 62/561,662, 62/568,129 or International Patent Publication WO2018/191388, all entitled “Novel Type VI CRISPR Orthologs and Systems,” incorporated herein by reference. In certain embodiments, the Cas13b effector protein is, or comprises an amin acid sequence having at least 80% sequence homology to a polypeptide as set forth in
[0148] In certain example embodiments, the RNA-targeting effector protein is a Cas13c effector protein as disclosed in U.S. Provisional Patent Application No. 62/525,165 filed Jun. 26, 2017, and International Patent Publication No. WO2018/035250 filed Aug. 16, 2017. In certain example embodiments, the Cas13c protein may be from an organism of a genus such as Fusobacterium or Anaerosalibacter. Example wildtype orthologue sequences of Cas13c are: EH019081, WP_094899336, WP_040490876, WP_047396607, WP_035935671, WP_035906563, WP_042678931, WP_062627846, WP_005959231, WP_027128616, WP_062624740, WP_096402050.
[0149] In certain example embodiments, the Cas13 protein may be selected from any of the following: Cas13a: Leptotrichia shahii, Leptotrichia wadei (Lw2), Listeria seeligeri, Lachnospiraceae bacterium MA2020, Lachnospiraceae bacterium NK4A179, [Clostridium]aminophilum DSM 10710, Carnobacterium gallinarum DSM 4847, Carnobacterium gallinarum DSM 4847, Paludibacter propionicigenes WB4, Listeria weihenstephanensis FSL R9-0317, Listeriaceae bacterium FSL M6-0635, Leptotrichia wadei F0279, Rhodobacter capsulatus SB 1003, Rhodobacter capsulatus R121, Rhodobacter capsulatus DE442, Leptotrichia buccalis C-1013-b, Herbinix hemicellulosilytica, [Eubacterium] rectale, Eubacteriaceae bacterium CHKCI004, Blautia sp. Marseille-P2398, Leptotrichia sp. oral taxon 879 str. F0557; Cas13b: Bergeyella zoohelcum, Prevotella intermedia, Prevotella buccae, Alistipes sp. ZOR0009, Prevotella sp. MA2016, Riemerella anatipestifer, Prevotella aurantiaca, Prevotella saccharolytica, Prevotella intermedia, Capnocytophaga canimorsus, Porphyromonas gulae, Prevotella sp. P5-125, Flavobacterium branchiophilum, Porphyromonas gingivalis, Prevotella intermedia; Cas13c: Fusobacterium necrophorum subsp. funduliforme ATCC 51357 contig00003, Fusobacterium necrophorum DJ-2 contig0065, whole genome shotgun sequence, Fusobacterium necrophorum BFTR-1 contig0068, Fusobacterium necrophorum subsp. funduliforme 1_1_36S cont1.14, Fusobacterium perfoetens ATCC 29250 T364DRAFT_scaffold00009.9_C, Fusobacterium ulcerans ATCC 49185 cont2.38, Anaerosalibacter sp. ND1 genome assembly Anaerosalibacter massiliensis ND1.Cas13s non-specific RNase activity can be leveraged to cleave reporters upon target recognition, allowing for the design of sensitive and specific diagnostics using Cas13, including single nucleotide variants, detection based on rRNA sequences, screening for drug resistance, monitoring microbe outbreaks, genetic perturbations, and screening of environmental samples, as described, for example, in PCT/US18/054472 filed Oct. 22, 2018 at [0183]-[0327], incorporated herein by reference. Reference is made to WO 2017/219027, WO2018/107129, US20180298445, US 2018-0274017, US 2018-0305773, WO 2018/170340, U.S. application Ser. No. 15/922,837, filed Mar. 15, 2018 entitled “Devices for CRISPR Effector System Based Diagnostics”, PCT/US18/50091, filed Sep. 7, 2018 “Multi-Effector CRISPR Based Diagnostic Systems”, PCT/US18/66940 filed Dec. 20, 2018 entitled “CRISPR Effector System Based Multiplex Diagnostics”, PCT/US18/054472 filed Oct. 4, 2018 entitled “CRISPR Effector System Based Diagnostic”, U.S. Provisional 62/740,728 filed Oct. 3, 2018 entitled “CRISPR Effector System Based Diagnostics for Hemorrhagic Fever Detection”, U.S. Provisional 62/690,278 filed Jun. 26, 2018 and U.S. Provisional 62/767,059 filed Nov. 14, 2018 both entitled “CRISPR Double Nickase Based Amplification, Compositions, Systems and Methods”, U.S. Provisional 62/690,160 filed Jun. 26, 2018 and U.S. Pat. No. 62,767,077 filed Nov. 14, 2018, both entitled “CRISPR/CAS and Transposase Based Amplification Compositions, Systems, And Methods”, U.S. Provisional 62/690,257 filed Jun. 26, 2018 and 62/767,052 filed Nov. 14, 2018 both entitled “CRISPR Effector System Based Amplification Methods, Systems, And Diagnostics”, U.S. Provisional 62/767,076 filed Nov. 14, 2018 entitled “Multiplexing Highly Evolving Viral Variants With SHERLOCK” and 62/767,070 filed Nov. 14, 2018 entitled “Droplet SHERLOCK.” Reference is further made to WO2017/127807, WO2017/184786, WO 2017/184768, WO 2017/189308, WO 2018/035388, WO 2018/170333, WO 2018/191388, WO 2018/213708, WO 2019/005866, PCT/US18/67328 filed Dec. 21, 2018 entitled “Novel CRISPR Enzymes and Systems”, PCT/US18/67225 filed Dec. 21, 2018 entitled “Novel CRISPR Enzymes and Systems” and PCT/US18/67307 filed Dec. 21, 2018 entitled “Novel CRISPR Enzymes and Systems”, U.S. 62/712,809 filed Jul. 31, 2018 entitled “Novel CRISPR Enzymes and Systems”, U.S. 62/744,080 filed Oct. 10, 2018 entitled “Novel Cas12b Enzymes and Systems” and U.S. 62/751,196 filed Oct. 26, 2018 entitled “Novel Cas12b Enzymes and Systems”, U.S. 715,640 filed August 7, 2-18 entitled “Novel CRISPR Enzymes and Systems”, WO 2016/205711, U.S. Pat. No. 9,790,490, WO 2016/205749, WO 2016/205764, WO 2017/070605, WO 2017/106657, and WO 2016/149661, WO2018/035387, WO2018/194963, Cox DBT, et al., RNA editing with CRISPR-Cas13, Science. 2017 Nov. 24; 358(6366):1019-1027; Gootenberg J S, et al., Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6, Science. 2018 Apr. 27; 360(6387):439-444; Gootenberg J S, et al., Nucleic acid detection with CRISPR-Cas13a/C2c2, Science. 2017 Apr. 28; 356(6336):438-442; Abudayyeh O O, et al., RNA targeting with CRISPR-Cas13, Nature. 2017 Oct. 12; 550(7675):280-284; Smargon A A, et al., Cas13b Is a Type VI-B CRISPR-Associated RNA-Guided RNase Differentially Regulated by Accessory Proteins Csx27 and Csx28. Mol Cell. 2017 Feb. 16; 65(4):618-630.e7; Abudayyeh 00, et al., C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector, Science. 2016 Aug. 5; 353(6299):aaf5573; Yang L, et al., Engineering and optimising deaminase fusions for genome editing. Nat Commun. 2016 Nov. 2; 7:13330, Myrvhold et al., Field deployable viral diagnostics using CRISPR-Cas13, Science 2018 360, 444-448, Shmakov et al. “Diversity and evolution of class 2 CRISPR-Cas systems,” Nat Rev Microbiol. 2017 15(3):169-182, each of which is incorporated herein by reference in its entirety.
DNA-Targeting Effector Proteins
[0150] In certain example embodiments, the assays may comprise a DNA-targeting effector protein. In certain example embodiments, the assays may comprise multiple DNA-targeting effectors or one or more orthologs in combination with one or more RNA-targeting effectors. In certain example embodiments, the DNA targeting are Type V Cas proteins, such as Cas12 proteins. In certain other example embodiments, the Cas12 proteins are Cas12a, Cas12b, Cas12c, or a combination thereof.
[0151] Cas12a Orthologs
[0152] The present invention encompasses the use of a Cpf1 effector protein, derived from a Cpf1 locus denoted as subtype V-A. Herein such effector proteins are also referred to as “Cpf1p”, e.g., a Cpf1 protein (and such effector protein or Cpf1 protein or protein derived from a Cpf1 locus is also called “CRISPR enzyme”). Presently, the subtype V-A loci encompasses cas1, cas2, a distinct gene denoted cpf1 and a CRISPR array. Cpf1 (CRISPR-associated protein Cpf1, subtype PREFRAN) is a large protein (about 1300 amino acids) that contains a RuvC-like nuclease domain homologous to the corresponding domain of Cas9 along with a counterpart to the characteristic arginine-rich cluster of Cas9. However, Cpf1 lacks the HNH nuclease domain that is present in all Cas9 proteins, and the RuvC-like domain is contiguous in the Cpf1 sequence, in contrast to Cas9 where it contains long inserts including the HNH domain. Accordingly, in particular embodiments, the CRISPR-Cas enzyme comprises only a RuvC-like nuclease domain.
[0153] The programmability, specificity, and collateral activity of the RNA-guided Cpf1 also make it an ideal switchable nuclease for non-specific cleavage of nucleic acids. In one embodiment, a Cpf1 system is engineered to provide and take advantage of collateral non-specific cleavage of RNA. In another embodiment, a Cpf1 system is engineered to provide and take advantage of collateral non-specific cleavage of ssDNA. Accordingly, engineered Cpf1 systems provide platforms for nucleic acid detection and transcriptome manipulation. Cpf1 is developed for use as a mammalian transcript knockdown and binding tool. Cpf1 is capable of robust collateral cleavage of RNA and ssDNA when activated by sequence-specific targeted DNA binding.
[0154] Homologs and orthologs may be identified by homology modelling (see, e.g., Greer, Science vol. 228 (1985) 1055, and Blundell et al. Eur J Biochem vol 172 (1988), 513) or “structural BLAST” (Dey F, Cliff Zhang Q, Petrey D, Honig B. Toward a “structural BLAST”: using structural relationships to infer function. Protein Sci. 2013 April; 22(4):359-66. doi: 10.1002/pro.2225.). See also Shmakov et al. (2015) for application in the field of CRISPR-Cas loci. Homologous proteins may but need not be structurally related, or are only partially structurally related. The Cpf1 gene is found in several diverse bacterial genomes, typically in the same locus with cas1, cas2, and cas4 genes and a CRISPR cassette (for example, FNFX1_1431-FNFX1_1428 of Francisella cf. novicida Fxl). In particular embodiments, the effector protein is a Cpf1 effector protein from an organism from a genus comprising Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiraceae, Clostridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacilus, Methylobacterium or Acidaminococcus.
[0155] In further particular embodiments, the Cpf1 effector protein is from an organism selected from S. mutans, S. agalactiae, S. equisimilis, S. sanguinis, S. pneumonia; C. jejuni, C. coli; N. salsuginis, N. tergarcus; S. auricularis, S. carnosus; N. meningitides, N. gonorrhoeae; L. monocytogenes, L. ivanovii; C. botulinum, C. difficile, C. tetani, C. sordellii.
[0156] The effector protein may comprise a chimeric effector protein comprising a first fragment from a first effector protein (e.g., a Cpf1) ortholog and a second fragment from a second effector (e.g., a Cpf1) protein ortholog, and wherein the first and second effector protein orthologs are different. At least one of the first and second effector protein (e.g., a Cpf1) orthologs may comprise an effector protein (e.g., a Cpf1) from an organism comprising Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiraceae, Clostridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacilus, Methylobacterium or Acidaminococcus; e.g., a chimeric effector protein comprising a first fragment and a second fragment wherein each of the first and second fragments is selected from a Cpf1 of an organism comprising Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiraceae, Clostridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacilus, Methylobacterium or Acidaminococcus wherein the first and second fragments are not from the same bacteria; for instance a chimeric effector protein comprising a first fragment and a second fragment wherein each of the first and second fragments is selected from a Cpf1 of S. mutans, S. agalactiae, S. equisimilis, S. sanguinis, S. pneumonia; C. jejuni, C. coli; N. salsuginis, N. tergarcus; S. auricularis, S. carnosus; N. meningitides, N. gonorrhoeae; L. monocytogenes, L. ivanovii; C. botulinum, C. difficile, C. tetani, C. sordellii; Francisella tularensis 1, Prevotella albensis, Lachnospiraceae bacterium MC2017 1, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44_17, Smithella sp. SCADC, Acidaminococcus sp. BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella disiens and Porphyromonas macacae, wherein the first and second fragments are not from the same bacteria. In a more preferred embodiment, the Cpf1p is derived from a bacterial species selected from Francisella tularensis 1, Prevotella albensis, Lachnospiraceae bacterium MC2017 1, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44_17, Smithella sp. SCADC, Acidaminococcus sp. BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella disiens and Porphyromonas macacae. In certain embodiments, the Cpf1p is derived from a bacterial species selected from Acidaminococcus sp. BV3L6, Lachnospiraceae bacterium MA2020. In certain embodiments, the effector protein is derived from a subspecies of Francisella tularensis 1, including but not limited to Francisella tularensis subsp. Novicida.
[0157] In some embodiments, the Cpf1p is derived from an organism from the genus of Eubacterium. In some embodiments, the CRISPR effector protein is a Cpf1 protein derived from an organism from the bacterial species of Eubacterium rectale. In some embodiments, the amino acid sequence of the Cpf1 effector protein corresponds to NCBI Reference Sequence WP_055225123.1, NCBI Reference Sequence WP_055237260.1, NCBI Reference Sequence WP_055272206.1, or GenBank ID OLA16049.1. In some embodiments, the Cpf1 effector protein has a sequence homology or sequence identity of at least 60%, more particularly at least 70, such as at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for instance at least 95%, with NCBI Reference Sequence WP_055225123.1, NCBI Reference Sequence WP_055237260.1, NCBI Reference Sequence WP_055272206.1, or GenBank ID OLA16049.1. The skilled person will understand that this includes truncated forms of the Cpf1 protein whereby the sequence identity is determined over the length of the truncated form. In some embodiments, the Cpf1 effector recognizes the PAM sequence of TTTN or CTTN.
[0158] In particular embodiments, the homologue or orthologue of Cpf1 as referred to herein has a sequence homology or identity of at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for instance at least 95% with Cpf1. In further embodiments, the homologue or orthologue of Cpf1 as referred to herein has a sequence identity of at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for instance at least 95% with the wild type Cpf1. Where the Cpf1 has one or more mutations (mutated), the homologue or orthologue of said Cpf1 as referred to herein has a sequence identity of at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for instance at least 95% with the mutated Cpf1.
[0159] In an embodiment, the Cpf1 protein may be an ortholog of an organism of a genus which includes, but is not limited to Acidaminococcus sp, Lachnospiraceae bacterium or Moraxella bovoculi; in particular embodiments, the type V Cas protein may be an ortholog of an organism of a species which includes, but is not limited to Acidaminococcus sp. BV3L6; Lachnospiraceae bacterium ND2006 (LbCpf1) or Moraxella bovoculi 237. In particular embodiments, the homologue or orthologue of Cpf1 as referred to herein has a sequence homology or identity of at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for instance at least 95% with one or more of the Cpf1 sequences disclosed herein. In further embodiments, the homologue or orthologue of Cpf as referred to herein has a sequence identity of at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for instance at least 95% with the wild type FnCpf1, AsCpf1 or LbCpf1. The skilled person will understand that this includes truncated forms of the Cpf1 protein whereby the sequence identity is determined over the length of the truncated form. In certain of the following, Cpf1 amino acids are followed by nuclear localization signals (NLS) (italics), a glycine-serine (GS) linker, and 3×HA tag. Further Cpf1 orthologs include NCBI WP_055225123.1, NCBI WP_055237260.1, NCBI WP_055272206.1, and GenBank OLA16049.1.
[0160] Cas12b Orthologs
[0161] The present invention encompasses the use of a Cas12b (C2c1) effector proteins, derived from a C2c1 locus denoted as subtype V-B. Herein such effector proteins are also referred to as “C2c1p”, e.g., a C2c1 protein (and such effector protein or C2c1 protein or protein derived from a C2c1 locus is also called “CRISPR enzyme”). Presently, the subtype V-B loci encompasses cas1-Cas4 fusion, cas2, a distinct gene denoted C2c1 and a CRISPR array. C2c1 (CRISPR-associated protein C2c1) is a large protein (about 1100-1300 amino acids) that contains a RuvC-like nuclease domain homologous to the corresponding domain of Cas9 along with a counterpart to the characteristic arginine-rich cluster of Cas9. However, C2c1 lacks the HNH nuclease domain that is present in all Cas9 proteins, and the RuvC-like domain is contiguous in the C2c1 sequence, in contrast to Cas9 where it contains long inserts including the HNH domain. Accordingly, in particular embodiments, the CRISPR-Cas enzyme comprises only a RuvC-like nuclease domain.
[0162] The programmability, specificity, and collateral activity of the RNA-guided C2c1 also make it an ideal switchable nuclease for non-specific cleavage of nucleic acids. In one embodiment, a C2c1 system is engineered to provide and take advantage of collateral non-specific cleavage of RNA. In another embodiment, a C2c1 system is engineered to provide and take advantage of collateral non-specific cleavage of ssDNA. Accordingly, engineered C2c1 systems provide platforms for nucleic acid detection and transcriptome manipulation, and inducing cell death. C2c1 is developed for use as a mammalian transcript knockdown and binding tool. C2c1 is capable of robust collateral cleavage of RNA and ssDNA when activated by sequence-specific targeted DNA binding.
[0163] In certain embodiments, C2c1 is provided or expressed in an in vitro system or in a cell, transiently or stably, and targeted or triggered to non-specifically cleave cellular nucleic acids. In one embodiment, C2c1 is engineered to knock down ssDNA, for example viral ssDNA. In another embodiment, C2c1 is engineered to knock down RNA. The system can be devised such that the knockdown is dependent on a target DNA present in the cell or in vitro system, or triggered by the addition of a target nucleic acid to the system or cell.
[0164] C2c1 (also known as Cas12b) proteins are RNA guided nucleases. In certain embodiments, the Cas protein may comprise at least 80% sequence identity to a polypeptide as described in International Patent Publication WO 2016/205749 at
[0165] In particular embodiments, the effector protein is a C2c1 effector protein from an organism from a genus comprising Alicyclobacillus, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacillus, Candidatus, Desulfatirhabdium, Citrobacter, Elusimicrobia, Methylobacterium, Omnitrophica, Phycisphaerae, Planctomycetes, Spirochaetes, and Verrucomicrobiaceae.
[0166] In further particular embodiments, the C2c1 effector protein is from a species selected from Alicyclobacillus acidoterrestris (e.g., ATCC 49025), Alicyclobacillus contaminans (e.g., DSM 17975), Alicyclobacillus macrosporangiidus (e.g. DSM 17980), Bacillus hisashii strain C4, Candidatus Lindowbacteria bacterium RIFCSPLOWO2, Desulfovibrio inopinatus (e.g., DSM 10711), Desulfonatronum thiodismutans (e.g., strain MLF-1), Elusimicrobia bacterium RIFOXYA12, Omnitrophica WOR_2 bacterium RIFCSPHIGHO2, Opitutaceae bacterium TAV5, Phycisphaerae bacterium ST-NAGAB-D1, Planctomycetes bacterium RBG_13_46_10, Spirochaetes bacterium GWB1_27_13, Verrucomicrobiaceae bacterium UBA2429, Tuberibacillus calidus (e.g., DSM 17572), Bacillus thermoamylovorans (e.g., strain B4166), Brevibacillus sp. CF112, Bacillus sp. NSP2.1, Desulfatirhabdium butyrativorans (e.g., DSM 18734), Alicyclobacillus herbarius (e.g., DSM 13609), Citrobacter freundii (e.g., ATCC 8090), Brevibacillus agri (e.g., BAB-2500), Methylobacterium nodulans (e.g., ORS 2060).
[0167] The effector protein may comprise a chimeric effector protein comprising a first fragment from a first effector protein (e.g., a C2c1) ortholog and a second fragment from a second effector (e.g., a C2c1) protein ortholog, and wherein the first and second effector protein orthologs are different. At least one of the first and second effector protein (e.g., a C2c1) orthologs may comprise an effector protein (e.g., a C2c1) from an organism comprising Alicyclobacillus, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacillus, Candidatus, Desulfatirhabdium, Elusimicrobia, Citrobacter, Methylobacterium, Omnitrophicai, Phycisphaerae, Planctomycetes, Spirochaetes, and Verrucomicrobiaceae; e.g., a chimeric effector protein comprising a first fragment and a second fragment wherein each of the first and second fragments is selected from a C2c1 of an organism comprising Alicyclobacillus, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacillus, Candidatus, Desulfatirhabdium, Elusimicrobia, Citrobacter, Methylobacterium, Omnitrophicai, Phycisphaerae, Planctomycetes, Spirochaetes, and Verrucomicrobiaceae wherein the first and second fragments are not from the same bacteria; for instance a chimeric effector protein comprising a first fragment and a second fragment wherein each of the first and second fragments is selected from a C2c1 of Alicyclobacillus acidoterrestris (e.g., ATCC 49025), Alicyclobacillus contaminans (e.g., DSM 17975), Alicyclobacillus macrosporangiidus (e.g. DSM 17980), Bacillus hisashii strain C4, Candidatus Lindowbacteria bacterium RIFCSPLOWO2, Desulfovibrio inopinatus (e.g., DSM 10711), Desulfonatronum thiodismutans (e.g., strain MLF-1), Elusimicrobia bacterium RIFOXYA12, Omnitrophica WOR_2 bacterium RIFCSPHIGHO2, Opitutaceae bacterium TAV5, Phycisphaerae bacterium ST-NAGAB-D1, Planctomycetes bacterium RBG_13_46_10, Spirochaetes bacterium GWB1_27_13, Verrucomicrobiaceae bacterium UBA2429, Tuberibacillus calidus (e.g., DSM 17572), Bacillus thermoamylovorans (e.g., strain B4166), Brevibacillus sp. CF112, Bacillus sp. NSP2.1, Desulfatirhabdium butyrativorans (e.g., DSM 18734), Alicyclobacillus herbarius (e.g., DSM 13609), Citrobacter freundii (e.g., ATCC 8090), Brevibacillus agri (e.g., BAB-2500), Methylobacterium nodulans (e.g., ORS 2060), wherein the first and second fragments are not from the same bacteria.
[0168] In a more preferred embodiment, the C2c1p is derived from a bacterial species selected from Alicyclobacillus acidoterrestris (e.g., ATCC 49025), Alicyclobacillus contaminans (e.g., DSM 17975), Alicyclobacillus macrosporangiidus (e.g. DSM 17980), Bacillus hisashii strain C4, Candidatus Lindowbacteria bacterium RIFCSPLOWO2, Desulfovibrio inopinatus (e.g., DSM 10711), Desulfonatronum thiodismutans (e.g., strain MLF-1), Elusimicrobia bacterium RIFOXYA12, Omnitrophica WOR_2 bacterium RIFCSPHIGHO2, Opitutaceae bacterium TAV5, Phycisphaerae bacterium ST-NAGAB-D1, Planctomycetes bacterium RBG_13_46_10, Spirochaetes bacterium GWB1_27_13, Verrucomicrobiaceae bacterium UBA2429, Tuberibacillus calidus (e.g., DSM 17572), Bacillus thermoamylovorans (e.g., strain B4166), Brevibacillus sp. CF112, Bacillus sp. NSP2.1, Desulfatirhabdium butyrativorans (e.g., DSM 18734), Alicyclobacillus herbarius (e.g., DSM 13609), Citrobacter freundii (e.g., ATCC 8090), Brevibacillus agri (e.g., BAB-2500), Methylobacterium nodulans (e.g., ORS 2060). In certain embodiments, the C2c1p is derived from a bacterial species selected from Alicyclobacillus acidoterrestris (e.g., ATCC 49025), Alicyclobacillus contaminans (e.g., DSM 17975).
[0169] In particular embodiments, the homologue or orthologue of C2c1 as referred to herein has a sequence homology or identity of at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for instance at least 95% with C2c1. In further embodiments, the homologue or orthologue of C2c1 as referred to herein has a sequence identity of at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for instance at least 95% with the wild type C2c1. Where the C2c1 has one or more mutations (mutated), the homologue or orthologue of said C2c1 as referred to herein has a sequence identity of at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for instance at least 95% with the mutated C2c1.
[0170] In an embodiment, the C2c1 protein may be an ortholog of an organism of a genus which includes, but is not limited to Alicyclobacillus, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacillus, Candidatus, Desulfatirhabdium, Elusimicrobia, Citrobacter, Methylobacterium, Omnitrophicai, Phycisphaerae, Planctomycetes, Spirochaetes, and Verrucomicrobiaceae; in particular embodiments, the type V Cas protein may be an ortholog of an organism of a species which includes, but is not limited to Alicyclobacillus acidoterrestris (e.g., ATCC 49025), Alicyclobacillus contaminans (e.g., DSM 17975), Alicyclobacillus macrosporangiidus (e.g. DSM 17980), Bacillus hisashii strain C4, Candidatus Lindowbacteria bacterium RIFCSPLOWO2, Desulfovibrio inopinatus (e.g., DSM 10711), Desulfonatronum thiodismutans (e.g., strain MLF-1), Elusimicrobia bacterium RIFOXYA12, Omnitrophica WOR_2 bacterium RIFCSPHIGHO2, Opitutaceae bacterium TAV5, Phycisphaerae bacterium ST-NAGAB-D1, Planctomycetes bacterium RBG_13_46_10, Spirochaetes bacterium GWB1_27_13, Verrucomicrobiaceae bacterium UBA2429, Tuberibacillus calidus (e.g., DSM 17572), Bacillus thermoamylovorans (e.g., strain B4166), Brevibacillus sp. CF112, Bacillus sp. NSP2.1, Desulfatirhabdium butyrativorans (e.g., DSM 18734), Alicyclobacillus herbarius (e.g., DSM 13609), Citrobacter freundii (e.g., ATCC 8090), Brevibacillus agri (e.g., BAB-2500), Methylobacterium nodulans (e.g., ORS 2060). In particular embodiments, the homologue or orthologue of C2c1 as referred to herein has a sequence homology or identity of at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for instance at least 95% with one or more of the C2c1 sequences disclosed herein. In further embodiments, the homologue or orthologue of C2c1 as referred to herein has a sequence identity of at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for instance at least 95% with the wild type AacC2c1 or BthC2c1.
[0171] In particular embodiments, the C2c1 protein of the invention has a sequence homology or identity of at least 60%, more particularly at least 70, such as at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for instance at least 95% with AacC2c1 or BthC2c1. In further embodiments, the C2c1 protein as referred to herein has a sequence identity of at least 60%, such as at least 70%, more particularly at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for instance at least 95% with the wild type AacC2c1. In particular embodiments, the C2c1 protein of the present invention has less than 60% sequence identity with AacC2c1. The skilled person will understand that this includes truncated forms of the C2c1 protein whereby the sequence identity is determined over the length of the truncated form.
[0172] In certain methods according to the present invention, the CRISPR-Cas protein is preferably mutated with respect to a corresponding wild-type enzyme such that the mutated CRISPR-Cas protein lacks the ability to cleave one or both DNA strands of a target locus containing a target sequence. In particular embodiments, one or more catalytic domains of the C2c1 protein are mutated to produce a mutated Cas protein which cleaves only one DNA strand of a target sequence.
[0173] In particular embodiments, the CRISPR-Cas protein may be mutated with respect to a corresponding wild-type enzyme such that the mutated CRISPR-Cas protein lacks substantially all DNA cleavage activity. In some embodiments, a CRISPR-Cas protein may be considered to substantially lack all DNA and/or RNA cleavage activity when the cleavage activity of the mutated enzyme is about no more than 25%, 10%, 5%, 1%, 0.1%, 0.01%, or less of the nucleic acid cleavage activity of the non-mutated form of the enzyme; an example can be when the nucleic acid cleavage activity of the mutated form is nil or negligible as compared with the non-mutated form.
[0174] In certain embodiments of the methods provided herein the CRISPR-Cas protein is a mutated CRISPR-Cas protein which cleaves only one DNA strand, i.e. a nickase. More particularly, in the context of the present invention, the nickase ensures cleavage within the non-target sequence, i.e. the sequence which is on the opposite DNA strand of the target sequence and which is 3′ of the PAM sequence. By means of further guidance, and without limitation, an arginine-to-alanine substitution (R911A) in the Nuc domain of C2c1 from Alicyclobacillus acidoterrestris converts C2c1 from a nuclease that cleaves both strands to a nickase (cleaves a single strand). It will be understood by the skilled person that where the enzyme is not AacC2c1, a mutation may be made at a residue in a corresponding position.
Cas12c Orthologs
[0175] In certain embodiments, the effector protein, particularly a Type V loci effector protein, more particularly a Type V-C loci effector protein, a Cas12c protein, even more particularly a C2c3p, may originate, may be isolated or may be derived from a bacterial metagenome selected from the group consisting of the bacterial metagenomes listed in the Table in
[0176] In certain embodiments, the effector protein, particularly a Type V loci effector protein, more particularly a Type V-C loci effector protein, even more particularly a C2c3p, may comprise, consist essentially of or consist of an amino acid sequence selected from the group consisting of amino acid sequences shown in the multiple sequence alignment in
[0177] In certain embodiments, a Type V-C locus as intended herein may encode Cas1 and the C2c3p effector protein. See
[0178] In certain embodiments, the effector protein, particularly a Type V loci effector protein, more particularly a Type V-C loci effector protein, even more particularly a C2c3p, such as a native C2c3p, may be about 1100 to about 1500 amino acids long, e.g., about 1100 to about 1200 amino acids long, or about 1200 to about 1300 amino acids long, or about 1300 to about 1400 amino acids long, or about 1400 to about 1500 amino acids long, e.g., about 1100, about 1200, about 1300, about 1400 or about 1500 amino acids long, or at least about 1100, at least about 1200, at least about 1300, at least about 1400 or at least about 1500 amino acids long.
[0179] In certain embodiments, the effector protein, particularly a Type V loci effector protein, more particularly a Type V-C loci effector protein, even more particularly a C2c3p, and preferably the C-terminal portion of said effector protein, comprises the three catalytic motifs of the RuvC-like nuclease (i.e., RuvCI, RuvCII and RuvCIII). In certain embodiments, said effector protein, and preferably the C-terminal portion of said effector protein, may further comprise a region corresponding to the bridge helix (also known as arginine-rich cluster) that in Cas9 protein is involved in crRNA-binding. In certain embodiments, said effector protein, and preferably the C-terminal portion of said effector protein, may further comprise a Zn finger region. Preferably, the Zn-binding cysteine residue(s) may be conserved in C2c3p. In certain embodiments, said effector protein, and preferably the C-terminal portion of said effector protein, may comprise the three catalytic motifs of the RuvC-like nuclease (i.e., RuvCI, RuvCII and RuvCIII), the region corresponding to the bridge helix, and the Zn finger region, preferably in the following order, from N to C terminus: RuvCI-bridge helix-RuvCII-Zinc finger-RuvCIII. See
[0180] In certain embodiments, Type V-C loci as intended herein may comprise CRISPR repeats between 20 and 30 bp long, more typically between 22 and 27 bp long, yet more typically 25 bp long, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bp long.
[0181] Orthologous proteins may but need not be structurally related, or are only partially structurally related. In particular embodiments, the homologue or orthologue of a Type V protein such as Cas12c as referred to herein has a sequence homology or identity of at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for instance at least 95% with a Cas12c. In further embodiments, the homologue or orthologue of a Type V Cas12c as referred to herein has a sequence identity of at least 80%, more preferably at least 85%, even more preferably at least 90%, such as for instance at least 95% with the wild type Cas12c.
[0182] In an embodiment, the Type V RNA-targeting Cas protein may be a Cas12c ortholog of an organism of a genus which includes but is not limited to Corynebacter, Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma and Campylobacter.
In an embodiment, the Cas12c or an ortholog or homolog thereof, may comprise one or more mutations (and hence nucleic acid molecule(s) coding for same may have mutation(s). The mutations may be artificially introduced mutations and may include but are not limited to one or more mutations in a catalytic domain. Examples of catalytic domains with reference to a Cas enzyme may include but are not limited to RuvC I, RuvC II, RuvC III, HNH domains, and HEPN domains, as described herein. In an embodiment, the Cas12c or an ortholog or homolog thereof, may comprise one or more mutations. The mutations may be artificially introduced mutations and may include but are not limited to one or more mutations in a catalytic domain. Guide Sequences
[0183] As used herein, the term “guide sequence” and “guide molecule” in the context of a CRISPR-Cas system, comprises any polynucleotide sequence having sufficient complementarity with a target nucleic acid sequence to hybridize with the target nucleic acid sequence and direct sequence-specific binding of a nucleic acid-targeting complex to the target nucleic acid sequence. The guide sequences made using the methods disclosed herein may be a full-length guide sequence, a truncated guide sequence, a full-length sgRNA sequence, a truncated sgRNA sequence, or an E+F sgRNA sequence. In some embodiments, the degree of complementarity of the guide sequence to a given target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. In certain example embodiments, the guide molecule comprises a guide sequence that may be designed to have at least one mismatch with the target sequence, such that a RNA duplex formed between the guide sequence and the target sequence. Accordingly, the degree of complementarity is preferably less than 99%. For instance, where the guide sequence consists of 24 nucleotides, the degree of complementarity is more particularly about 96% or less. In particular embodiments, the guide sequence is designed to have a stretch of two or more adjacent mismatching nucleotides, such that the degree of complementarity over the entire guide sequence is further reduced. For instance, where the guide sequence consists of 24 nucleotides, the degree of complementarity is more particularly about 96% or less, more particularly, about 92% or less, more particularly about 88% or less, more particularly about 84% or less, more particularly about 80% or less, more particularly about 76% or less, more particularly about 72% or less, depending on whether the stretch of two or more mismatching nucleotides encompasses 2, 3, 4, 5, 6 or 7 nucleotides, etc. In some embodiments, aside from the stretch of one or more mismatching nucleotides, the degree of complementarity, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g., the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies; available at www.novocraft.com), ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). The ability of a guide sequence (within a nucleic acid-targeting guide RNA) to direct sequence-specific binding of a nucleic acid-targeting complex to a target nucleic acid sequence may be assessed by any suitable assay. For example, the components of a nucleic acid-targeting CRISPR system sufficient to form a nucleic acid-targeting complex, including the guide sequence to be tested, may be provided to a host cell having the corresponding target nucleic acid sequence, such as by transfection with vectors encoding the components of the nucleic acid-targeting complex, followed by an assessment of preferential targeting (e.g., cleavage) within the target nucleic acid sequence, such as by Surveyor assay as described herein. Similarly, cleavage of a target nucleic acid sequence (or a sequence in the vicinity thereof) may be evaluated in a test tube by providing the target nucleic acid sequence, components of a nucleic acid-targeting complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at or in the vicinity of the target sequence between the test and control guide sequence reactions. Other assays are possible, and will occur to those skilled in the art. A guide sequence, and hence a nucleic acid-targeting guide RNA may be selected to target any target nucleic acid sequence.
[0184] As used herein, the term “guide sequence,” “crRNA,” “guide RNA,” or “single guide RNA,” or “gRNA” refers to a polynucleotide comprising any polynucleotide sequence having sufficient complementarity with a target nucleic acid sequence to hybridize with the target nucleic acid sequence and to direct sequence-specific binding of a RNA-targeting complex comprising the guide sequence and a CRISPR effector protein to the target nucleic acid sequence. In some example embodiments, the degree of complementarity, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g., the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies; available at www.novocraft.com), ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). The ability of a guide sequence (within a nucleic acid-targeting guide RNA) to direct sequence-specific binding of a nucleic acid-targeting complex to a target nucleic acid sequence may be assessed by any suitable assay. For example, the components of a nucleic acid-targeting CRISPR system sufficient to form a nucleic acid-targeting complex, including the guide sequence to be tested, may be provided to a host cell having the corresponding target nucleic acid sequence, such as by transfection with vectors encoding the components of the nucleic acid-targeting complex, followed by an assessment of preferential targeting (e.g., cleavage) within the target nucleic acid sequence, such as by Surveyor assay as described herein. Similarly, cleavage of a target nucleic acid sequence may be evaluated in a test tube by providing the target nucleic acid sequence, components of a nucleic acid-targeting complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions. Other assays are possible, and will occur to those skilled in the art. A guide sequence, and hence a nucleic acid-targeting guide may be selected to target any target nucleic acid sequence. The target sequence may be DNA. The target sequence may be any RNA sequence. In some embodiments, the target sequence may be a sequence within a RNA molecule selected from the group consisting of messenger RNA (mRNA), pre-mRNA, ribosomal RNA (rRNA), transfer RNA (tRNA), micro-RNA (miRNA), small interfering RNA (siRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), double stranded RNA (dsRNA), non-coding RNA (ncRNA), long non-coding RNA (lncRNA), and small cytoplasmatic RNA (scRNA). In some preferred embodiments, the target sequence may be a sequence within a RNA molecule selected from the group consisting of mRNA, pre-mRNA, and rRNA. In some preferred embodiments, the target sequence may be a sequence within a RNA molecule selected from the group consisting of ncRNA, and lncRNA. In some more preferred embodiments, the target sequence may be a sequence within an mRNA molecule or a pre-mRNA molecule.
[0185] In certain embodiments, the guide sequence or spacer length of the guide molecules is from 15 to 50 nt. In certain embodiments, the spacer length of the guide RNA is at least 15 nucleotides. In certain embodiments, the spacer length is from 15 to 17 nt, e.g., 15, 16, or 17 nt, from 17 to 20 nt, e.g., 17, 18, 19, or 20 nt, from 20 to 24 nt, e.g., 20, 21, 22, 23, or 24 nt, from 23 to 25 nt, e.g., 23, 24, or 25 nt, from 24 to 27 nt, e.g., 24, 25, 26, or 27 nt, from 27-30 nt, e.g., 27, 28, 29, or 30 nt, from 30-35 nt, e.g., 30, 31, 32, 33, 34, or 35 nt, or 35 nt or longer. In certain example embodiment, the guide sequence is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 40, 41, 42, 43, 44, 45, 46, 47 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nt.
[0186] In some embodiments, the sequence of the guide molecule (direct repeat and/or spacer) is selected to reduce the degree secondary structure within the guide molecule. In some embodiments, about or less than about 75%, 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 1%, or fewer of the nucleotides of the nucleic acid-targeting guide RNA participate in self-complementary base pairing when optimally folded. Optimal folding may be determined by any suitable polynucleotide folding algorithm. Some programs are based on calculating the minimal Gibbs free energy. An example of one such algorithm is mFold, as described by Zuker and Stiegler (Nucleic Acids Res. 9 (1981), 133-148). Another example folding algorithm is the online webserver RNAfold, developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see e.g., A. R. Gruber et al., 2008, Cell 106(1): 23-24; and PA Carr and GM Church, 2009, Nature Biotechnology 27(12): 1151-62).
[0187] In some embodiments, it is of interest to reduce the susceptibility of the guide molecule to RNA cleavage, such as to cleavage by Cas13. Accordingly, in particular embodiments, the guide molecule is adjusted to avoide cleavage by Cas13 or other RNA-cleaving enzymes.
[0188] In certain embodiments, the guide molecule comprises non-naturally occurring nucleic acids and/or non-naturally occurring nucleotides and/or nucleotide analogs, and/or chemically modifications. Preferably, these non-naturally occurring nucleic acids and non-naturally occurring nucleotides are located outside the guide sequence. Non-naturally occurring nucleic acids can include, for example, mixtures of naturally and non-naturally occurring nucleotides. Non-naturally occurring nucleotides and/or nucleotide analogs may be modified at the ribose, phosphate, and/or base moiety. In an embodiment of the invention, a guide nucleic acid comprises ribonucleotides and non-ribonucleotides. In one such embodiment, a guide comprises one or more ribonucleotides and one or more deoxyribonucleotides. In an embodiment of the invention, the guide comprises one or more non-naturally occurring nucleotide or nucleotide analog such as a nucleotide with phosphorothioate linkage, a locked nucleic acid (LNA) nucleotides comprising a methylene bridge between the 2′ and 4′ carbons of the ribose ring, or bridged nucleic acids (BNA). Other examples of modified nucleotides include 2′-O-methyl analogs, 2′-deoxy analogs, or 2′-fluoro analogs. Further examples of modified bases include, but are not limited to, 2-aminopurine, 5-bromo-uridine, pseudouridine, inosine, 7-methylguanosine. Examples of guide RNA chemical modifications include, without limitation, incorporation of 2′-O-methyl (M), 2′-O-methyl 3′phosphorothioate (MS), S-constrained ethyl(cEt), or 2′-O-methyl 3′thioPACE (MSP) at one or more terminal nucleotides. Such chemically modified guides can comprise increased stability and increased activity as compared to unmodified guides, though on-target vs. off-target specificity is not predictable. (See, Hendel, 2015, Nat Biotechnol. 33(9):985-9, doi: 10.1038/nbt.3290, published online 29 Jun. 2015 Ragdarm et al., 0215, PNAS, E7110-E7111; Allerson et al., J. Med. Chem. 2005, 48:901-904; Bramsen et al., Front. Genet., 2012, 3:154; Deng et al., PNAS, 2015, 112:11870-11875; Sharma et al., MedChemComm., 2014, 5:1454-1471; Hendel et al., Nat. Biotechnol. (2015) 33(9): 985-989; Li et al., Nature Biomedical Engineering, 2017, 1, 0066 DOI:10.1038/s41551-017-0066). In some embodiments, the 5′ and/or 3′ end of a guide RNA is modified by a variety of functional moieties including fluorescent dyes, polyethylene glycol, cholesterol, proteins, or detection tags. (See Kelly et al., 2016, J. Biotech. 233:74-83). In certain embodiments, a guide comprises ribonucleotides in a region that binds to a target RNA and one or more deoxyribonucletides and/or nucleotide analogs in a region that binds to Cas13. In an embodiment of the invention, deoxyribonucleotides and/or nucleotide analogs are incorporated in engineered guide structures, such as, without limitation, stem-loop regions, and the seed region. For Cas13 guide, in certain embodiments, the modification is not in the 5′-handle of the stem-loop regions. Chemical modification in the 5′-handle of the stem-loop region of a guide may abolish its function (see Li, et al., Nature Biomedical Engineering, 2017, 1:0066). In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or 75 nucleotides of a guide is chemically modified. In some embodiments, 3-5 nucleotides at either the 3′ or the 5′ end of a guide is chemically modified. In some embodiments, only minor modifications are introduced in the seed region, such as 2′-F modifications. In some embodiments, 2′-F modification is introduced at the 3′ end of a guide. In certain embodiments, three to five nucleotides at the 5′ and/or the 3′ end of the guide are chemically modified with 2′-O-methyl (M), 2′-O-methyl 3′ phosphorothioate (MS), S-constrained ethyl(cEt), or 2′-O-methyl 3′ thioPACE (MSP). Such modification can enhance genome editing efficiency (see Hendel et al., Nat. Biotechnol. (2015) 33(9): 985-989). In certain embodiments, all of the phosphodiester bonds of a guide are substituted with phosphorothioates (PS) for enhancing levels of gene disruption. In certain embodiments, more than five nucleotides at the 5′ and/or the 3′ end of the guide are chemicially modified with 2′-O-Me, 2′-F or S-constrained ethyl(cEt). Such chemically modified guide can mediate enhanced levels of gene disruption (see Ragdarm et al., 0215, PNAS, E7110-E7111). In an embodiment of the invention, a guide is modified to comprise a chemical moiety at its 3′ and/or 5′ end. Such moieties include, but are not limited to amine, azide, alkyne, thio, dibenzocyclooctyne (DBCO), or Rhodamine. In certain embodiment, the chemical moiety is conjugated to the guide by a linker, such as an alkyl chain. In certain embodiments, the chemical moiety of the modified guide can be used to attach the guide to another molecule, such as DNA, RNA, protein, or nanoparticles. Such chemically modified guide can be used to identify or enrich cells generically edited by a CRISPR system (see Lee et al., eLife, 2017, 6:e25312, DOI:10.7554).
[0189] In some embodiments, a nucleic acid-targeting guide is selected to reduce the degree secondary structure within the nucleic acid-targeting guide. In some embodiments, about or less than about 75%, 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 1%, or fewer of the nucleotides of the nucleic acid-targeting guide participate in self-complementary base pairing when optimally folded. Optimal folding may be determined by any suitable polynucleotide folding algorithm. Some programs are based on calculating the minimal Gibbs free energy. An example of one such algorithm is mFold, as described by Zuker and Stiegler (Nucleic Acids Res. 9 (1981), 133-148). Another example folding algorithm is the online webserver RNAfold, developed at Institute for Theoretical Chemistry at the University of Vienna, using the centroid structure prediction algorithm (see e.g., A. R. Gruber et al., 2008, Cell 106(1): 23-24; and PA Carr and GM Church, 2009, Nature Biotechnology 27(12): 1151-62).
[0190] In some embodiments, a nucleic acid-targeting guide is designed or selected to modulate intermolecular interactions among guide molecules, such as among stem-loop regions of different guide molecules. It will be appreciated that nucleotides within a guide that base-pair to form a stem-loop are also capable of base-pairing to form an intermolecular duplex with a second guide and that such an intermolecular duplex would not have a secondary structure compatible with CRISPR complex formation. Accordingly, is useful to select or design DR sequences in order to modulate stem-loop formation and CRISPR complex formation. In some embodiments, about or less than about 75%, 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5%, 1%, or fewer of nucleic acid-targeting guides are in intermolecular duplexes. It will be appreciated that stem-loop variation will often be within limits imposed by DR-CRISPR effector interactions. One way to modulate stem-loop formation or change the equilibrium between stem-loop and intermolecular duplex is to vary nucleotide pairs in the stem of the stem-loop of a DR. For example, in one embodiment, a G-C pair is replaced by an A-U or U-A pair. In another embodiment, an A-U pair is substituted for a G-C or a C-G pair. In another embodiment, a naturally occurring nucleotide is replaced by a nucleotide analog. Another way to modulate stem-loop formation or change the equilibrium between stem-loop and intermolecular duplex is to modify the loop of the stem-loop of a DR. Without be bound by theory, the loop can be viewed as an intervening sequence flanked by two sequences that are complementary to each other. When that intervening sequence is not self-complementary, its effect will be to destabilize intermolecular duplex formation. The same principle applies when guides are multiplexed: while the targeting sequences may differ, it may be advantageous to modify the stem-loop region in the DRs of the different guides. Moreover, when guides are multiplexed, the relative activities of the different guides can be modulated by balancing the activity of each individual guide. In certain embodiments, the equilibrium between intermolecular stem-loops vs. intermolecular duplexes is determined. The determination may be made by physical or biochemical means and can be in the presence or absence of a CRISPR effector.
[0191] In certain embodiments, a guide RNA or crRNA may comprise, consist essentially of, or consist of a direct repeat (DR) sequence and a guide sequence or spacer sequence. In certain embodiments, the guide RNA or crRNA may comprise, consist essentially of, or consist of a direct repeat sequence fused or linked to a guide sequence or spacer sequence. In certain embodiments, the direct repeat sequence may be located upstream (i.e., 5′) from the guide sequence or spacer sequence. In other embodiments, the direct repeat sequence may be located downstream (i.e., 3′) from the guide sequence or spacer sequence.
[0192] In certain embodiments, the crRNA comprises a stem loop, preferably a single stem loop. In certain embodiments, the direct repeat sequence forms a stem loop, preferably a single stem loop.
[0193] In certain embodiments, the spacer length of the guide RNA is from 15 to 35 nt. In certain embodiments, the spacer length of the guide RNA is at least 15 nucleotides. In certain embodiments, the spacer length is from 15 to 17 nt, e.g., 15, 16, or 17 nt, from 17 to 20 nt, e.g., 17, 18, 19, or 20 nt, from 20 to 24 nt, e.g., 20, 21, 22, 23, or 24 nt, from 23 to 25 nt, e.g., 23, 24, or 25 nt, from 24 to 27 nt, e.g., 24, 25, 26, or 27 nt, from 27-30 nt, e.g., 27, 28, 29, or 30 nt, from 30-35 nt, e.g., 30, 31, 32, 33, 34, or 35 nt, or 35 nt or longer.
[0194] In general, the CRISPR-Cas, CRISPR-Cas9 or CRISPR system may be as used in the foregoing documents, such as WO 2014/093622 (PCT/US2013/074667) and refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, in particular a Cas9 gene in the case of CRISPR-Cas9, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or “RNA(s)” as that term is herein used (e.g., RNA(s) to guide Cas9, e.g. CRISPR RNA and transactivating (tracr) RNA or a single guide RNA (sgRNA) (chimeric RNA)) or other sequences and transcripts from a CRISPR locus. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system). In the context of formation of a CRISPR complex, “target sequence” refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. The section of the guide sequence through which complementarity to the target sequence is important for cleavage activity is referred to herein as the seed sequence. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell, and may include nucleic acids in or from mitochondrial, organelles, vesicles, liposomes or particles present within the cell. In some embodiments, especially for non-nuclear uses, NLSs are not preferred. In some embodiments, a CRISPR system comprises one or more nuclear exports signals (NESs). In some embodiments, a CRISPR system comprises one or more NLSs and one or more NESs. In some embodiments, direct repeats may be identified in silico by searching for repetitive motifs that fulfill any or all of the following criteria: 1. found in a 2 Kb window of genomic sequence flanking the type II CRISPR locus; 2. span from 20 to 50 bp; and 3. interspaced by 20 to 50 bp. In some embodiments, 2 of these criteria may be used, for instance 1 and 2, 2 and 3, or 1 and 3. In some embodiments, all 3 criteria may be used.
[0195] In embodiments of the invention the terms guide sequence and guide RNA, i.e. RNA capable of guiding Cas to a target genomic locus, are used interchangeably as in foregoing cited documents such as WO 2014/093622 (PCT/US2013/074667). In general, a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g. the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies; available at www.novocraft.com), ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). In some embodiments, a guide sequence is about or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length. Preferably the guide sequence is 10 30 nucleotides long. The ability of a guide sequence to direct sequence-specific binding of a CRISPR complex to a target sequence may be assessed by any suitable assay. For example, the components of a CRISPR system sufficient to form a CRISPR complex, including the guide sequence to be tested, may be provided to a host cell having the corresponding target sequence, such as by transfection with vectors encoding the components of the CRISPR sequence, followed by an assessment of preferential cleavage within the target sequence, such as by Surveyor assay as described herein. Similarly, cleavage of a target polynucleotide sequence may be evaluated in a test tube by providing the target sequence, components of a CRISPR complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions. Other assays are possible, and will occur to those skilled in the art.
[0196] In some embodiments of CRISPR-Cas systems, the degree of complementarity between a guide sequence and its corresponding target sequence can be about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or 100%; a guide or RNA or sgRNA can be about or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length; or guide or RNA or sgRNA can be less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length; and advantageously tracr RNA is 30 or 50 nucleotides in length. However, an aspect of the invention is to reduce off-target interactions, e.g., reduce the guide interacting with a target sequence having low complementarity. Indeed, in the examples, it is shown that the invention involves mutations that result in the CRISPR-Cas system being able to distinguish between target and off-target sequences that have greater than 80% to about 95% complementarity, e.g., 83%-84% or 88-89% or 94-95% complementarity (for instance, distinguishing between a target having 18 nucleotides from an off-target of 18 nucleotides having 1, 2 or 3 mismatches). Accordingly, in the context of the present invention the degree of complementarity between a guide sequence and its corresponding target sequence is greater than 94.5% or 95% or 95.5% or 96% or 96.5% or 97% or 97.5% or 98% or 98.5% or 99% or 99.5% or 99.9%, or 100%. Off target is less than 100% or 99.9% or 99.5% or 99% or 99% or 98.5% or 98% or 97.5% or 97% or 96.5% or 96% or 95.5% or 95% or 94.5% or 94% or 93% or 92% or 91% or 90% or 89% or 88% or 87% or 86% or 85% or 84% or 83% or 82% or 81% or 80% complementarity between the sequence and the guide, with it advantageous that off target is 100% or 99.9% or 99.5% or 99% or 99% or 98.5% or 98% or 97.5% or 97% or 96.5% or 96% or 95.5% or 95% or 94.5% complementarity between the sequence and the guide.
Multiplexing Polynucleotides
[0197] Provided herein are engineered polynucleotide sequences that can direct the activity of a CRISPR protein to multiple targets using a single crRNA. The engineered polynucleotide sequences, also referred to as a multiplexing polynucleotides, can include two or more direct repeats interspersed with two or more guide sequences. More specifically, the engineered polynucleotide sequences can include a direct repeat sequence having one or more mutations relative to the corresponding wild type direct repeat sequence. The engineered polynucleotide can be configured, for example, as: 5′ DR1-G1-DR2-G2 3′. In some embodiments, the engineered polynucleotide can be configured to include three, four, five, or more additional direct repeat and guide sequences, for example: 5′ DR1-G1-DR2-G2-DR3-G3 3′, 5″ DR1-G1-DR2-G2-DR3-G3-DR4-G4 3′, or 5′ DR1-G1-DR2-G2-DR3-G3-DR4-G4-DR5-G5 3′.
[0198] Regardless of the number of direct repeat sequences, the direct repeat sequences differ from one another. Thus, DR1 can be a wild type sequence and DR2 can include one or more mutations relative to the wild type sequence in accordance with the disclosure provided herein regarding direct repeats for Cas orthologs. The guide sequences can also be the same or different. In some embodiments, the guide sequences can bind to different nucleic acid targets, for example, nucleic acids encoding different polypeptides. The multiplexing polynucleotides can be as described, for example, at [0039]-[0072] in U.S. Application 62/780,748 entitled “CRISPR Cpf1 Directe Repeat Variants” and filed Dec. 17, 2018, incorporated herein in its entirety by reference.
Guide Modifications
[0199] In certain embodiments, guides of the invention comprise non-naturally occurring nucleic acids and/or non-naturally occurring nucleotides and/or nucleotide analogs, and/or chemical modifications. Non-naturally occurring nucleic acids can include, for example, mixtures of naturally and non-naturally occurring nucleotides. Non-naturally occurring nucleotides and/or nucleotide analogs may be modified at the ribose, phosphate, and/or base moiety. In an embodiment of the invention, a guide nucleic acid comprises ribonucleotides and non-ribonucleotides. In one such embodiment, a guide comprises one or more ribonucleotides and one or more deoxyribonucleotides. In an embodiment of the invention, the guide comprises one or more non-naturally occurring nucleotide or nucleotide analog such as a nucleotide with phosphorothioate linkage, boranophosphate linkage, a locked nucleic acid (LNA) nucleotides comprising a methylene bridge between the 2′ and 4′ carbons of the ribose ring, or bridged nucleic acids (BNA). Other examples of modified nucleotides include 2′-O-methyl analogs, 2′-deoxy analogs, 2-thiouridine analogs, N6-methyladenosine analogs, or 2′-fluoro analogs. Further examples of modified bases include, but are not limited to, 2-aminopurine, 5-bromo-uridine, pseudouridine (Ψ), N1-methylpseudouridine (me1Ψ), 5-methoxyuridine(5moU), inosine, 7-methylguanosine. Examples of guide RNA chemical modifications include, without limitation, incorporation of 2′-O-methyl (M), 2′-O-methyl-3′-phosphorothioate (MS), phosphorothioate (PS), S-constrained ethyl(cEt), or 2′-O-methyl-3′-thioPACE (MSP) at one or more terminal nucleotides. Such chemically modified guides can comprise increased stability and increased activity as compared to unmodified guides, though on-target vs. off-target specificity is not predictable. (See, Hendel, 2015, Nat Biotechnol. 33(9):985-9, doi: 10.1038/nbt.3290, published online 29 Jun. 2015; Ragdarm et al., 0215, PNAS, E7110-E7111; Allerson et al., J. Med. Chem. 2005, 48:901-904; Bramsen et al., Front. Genet., 2012, 3:154; Deng et al., PNAS, 2015, 112:11870-11875; Sharma et al., MedChemComm., 2014, 5:1454-1471; Hendel et al., Nat. Biotechnol. (2015) 33(9): 985-989; Li et al., Nature Biomedical Engineering, 2017, 1, 0066 DOI:10.1038/s41551-017-0066). In some embodiments, the 5′ and/or 3′ end of a guide RNA is modified by a variety of functional moieties including fluorescent dyes, polyethylene glycol, cholesterol, proteins, or detection tags. (See Kelly et al., 2016, J. Biotech. 233:74-83). In certain embodiments, a guide comprises ribonucleotides in a region that binds to a target DNA and one or more deoxyribonucleotides and/or nucleotide analogs in a region that binds to Cas9, Cpf1, or C2c1. In an embodiment of the invention, deoxyribonucleotides and/or nucleotide analogs are incorporated in engineered guide structures, such as, without limitation, 5′ and/or 3′ end, stem-loop regions, and the seed region. In certain embodiments, the modification is not in the 5′-handle of the stem-loop regions. Chemical modification in the 5′-handle of the stem-loop region of a guide may abolish its function (see Li, et al., Nature Biomedical Engineering, 2017, 1:0066). In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or 75 nucleotides of a guide is chemically modified. In some embodiments, 3-5 nucleotides at either the 3′ or the 5′ end of a guide is chemically modified. In some embodiments, only minor modifications are introduced in the seed region, such as 2′-F modifications. In some embodiments, 2′-F modification is introduced at the 3′ end of a guide. In certain embodiments, three to five nucleotides at the 5′ and/or the 3′ end of the guide are chemically modified with 2′-O-methyl (M), 2′-O-methyl-3′-phosphorothioate (MS), S-constrained ethyl(cEt), or 2′-O-methyl-3′-thioPACE (MSP). Such modification can enhance genome editing efficiency (see Hendel et al., Nat. Biotechnol. (2015) 33(9): 985-989). In certain embodiments, all of the phosphodiester bonds of a guide are substituted with phosphorothioates (PS) for enhancing levels of gene disruption. In certain embodiments, more than five nucleotides at the 5′ and/or the 3′ end of the guide are chemically modified with 2′-O-Me, 2′-F or S-constrained ethyl(cEt). Such chemically modified guide can mediate enhanced levels of gene disruption (see Ragdarm et al., 0215, PNAS, E7110-E7111). In an embodiment of the invention, a guide is modified to comprise a chemical moiety at its 3′ and/or 5′ end. Such moieties include, but are not limited to amine, azide, alkyne, thio, dibenzocyclooctyne (DBCO), or Rhodamine. In certain embodiment, the chemical moiety is conjugated to the guide by a linker, such as an alkyl chain. In certain embodiments, the chemical moiety of the modified guide can be used to attach the guide to another molecule, such as DNA, RNA, protein, or nanoparticles. Such chemically modified guide can be used to identify or enrich cells generically edited by a CRISPR system (see Lee et al., eLife, 2017, 6:e25312, DOI:10.7554).
[0200] In certain embodiments, the CRISPR system as provided herein can make use of a crRNA or analogous polynucleotide comprising a guide sequence, wherein the polynucleotide is an RNA, a DNA or a mixture of RNA and DNA, and/or wherein the polynucleotide comprises one or more nucleotide analogs. The sequence can comprise any structure, including but not limited to a structure of a native crRNA, such as a bulge, a hairpin or a stem loop structure. In certain embodiments, the polynucleotide comprising the guide sequence forms a duplex with a second polynucleotide sequence which can be an RNA or a DNA sequence.
[0201] In certain embodiments, use is made of chemically modified guide RNAs. Examples of guide RNA chemical modifications include, without limitation, incorporation of 2′-O-methyl (M), 2′-O-methyl 3′phosphorothioate (MS), or 2′-O-methyl 3′thioPACE (MSP) at one or more terminal nucleotides. Such chemically modified guide RNAs can comprise increased stability and increased activity as compared to unmodified guide RNAs, though on-target vs. off-target specificity is not predictable. (See, Hendel, 2015, Nat Biotechnol. 33(9):985-9, doi: 10.1038/nbt.3290, published online 29 Jun. 2015). Chemically modified guide RNAs further include, without limitation, RNAs with phosphorothioate linkages and locked nucleic acid (LNA) nucleotides comprising a methylene bridge between the 2′ and 4′ carbons of the ribose ring.
[0202] In some embodiments, a guide sequence is about or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length. Preferably the guide sequence is 10 to 30 nucleotides long. The ability of a guide sequence to direct sequence-specific binding of a CRISPR complex to a target sequence may be assessed by any suitable assay. For example, the components of a CRISPR system sufficient to form a CRISPR complex, including the guide sequence to be tested, may be provided to a host cell having the corresponding target sequence, such as by transfection with vectors encoding the components of the CRISPR sequence, followed by an assessment of preferential cleavage within the target sequence, such as by Surveyor assay. Similarly, cleavage of a target RNA may be evaluated in a test tube by providing the target sequence, components of a CRISPR complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions. Other assays are possible, and will occur to those skilled in the art.
[0203] In some embodiments, the modification to the guide is a chemical modification, an insertion, a deletion or a split. In some embodiments, the chemical modification includes, but is not limited to, incorporation of 2′-O-methyl (M) analogs, 2′-deoxy analogs, 2-thiouridine analogs, N6-methyladenosine analogs, 2′-fluoro analogs, 2-aminopurine, 5-bromo-uridine, pseudouridine (Ψ), N1-methylpseudouridine (me1Ψ), 5-methoxyuridine(5moU), inosine, 7-methylguanosine, 2′-O-methyl-3′-phosphorothioate (MS), S-constrained ethyl(cEt), phosphorothioate (PS), or 2′-O-methyl-3′-thioPACE (MSP). In some embodiments, the guide comprises one or more of phosphorothioate modifications. In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 25 nucleotides of the guide are chemically modified. In certain embodiments, one or more nucleotides in the seed region are chemically modified. In certain embodiments, one or more nucleotides in the 3′-terminus are chemically modified. In certain embodiments, none of the nucleotides in the 5′-handle is chemically modified. In some embodiments, the chemical modification in the seed region is a minor modification, such as incorporation of a 2′-fluoro analog. In a specific embodiment, one nucleotide of the seed region is replaced with a 2′-fluoro analog. In some embodiments, 5 or 10 nucleotides in the 3′-terminus are chemically modified. Such chemical modifications at the 3′-terminus of the Cpf1 CrRNA improve gene cutting efficiency (see Li, et al., Nature Biomedical Engineering, 2017, 1:0066). In a specific embodiment, 5 nucleotides in the 3′-terminus are replaced with 2′-fluoro analogues. In a specific embodiment, 10 nucleotides in the 3′-terminus are replaced with 2′-fluoro analogues. In a specific embodiment, 5 nucleotides in the 3′-terminus are replaced with 2′-O-methyl (M) analogs.
[0204] In some embodiments, the loop of the 5′-handle of the guide is modified. In some embodiments, the loop of the 5′-handle of the guide is modified to have a deletion, an insertion, a split, or chemical modifications. In certain embodiments, the loop comprises 3, 4, or 5 nucleotides. In certain embodiments, the loop comprises the sequence of UCUU, UUUU, UAUU, or UGUU.
[0205] A guide sequence, and hence a nucleic acid-targeting guide RNA may be selected to target any target nucleic acid sequence. In the context of formation of a CRISPR complex, “target sequence” refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. A target sequence may comprise RNA polynucleotides. The term “target RNA” refers to a RNA polynucleotide being or comprising the target sequence. In other words, the target RNA may be a RNA polynucleotide or a part of a RNA polynucleotide to which a part of the gRNA, i.e. the guide sequence, is designed to have complementarity and to which the effector function mediated by the complex comprising CRISPR effector protein and a gRNA is to be directed. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. The target sequence may be DNA. The target sequence may be any RNA sequence. In some embodiments, the target sequence may be a sequence within a RNA molecule selected from the group consisting of messenger RNA (mRNA), pre-mRNA, ribosomal RNA (rRNA), transfer RNA (tRNA), micro-RNA (miRNA), small interfering RNA (siRNA), small nuclear RNA (snRNA), small nuclear RNA (snoRNA), double stranded RNA (dsRNA), non coding RNA (ncRNA), long non-coding RNA (lncRNA), and small cytoplasmic RNA (scRNA). In some preferred embodiments, the target sequence may be a sequence within a RNA molecule selected from the group consisting of mRNA, pre-mRNA, and rRNA. In some preferred embodiments, the target sequence may be a sequence within a RNA molecule selected from the group consisting of ncRNA, and lncRNA. In some more preferred embodiments, the target sequence may be a sequence within an mRNA molecule or a pre-mRNA molecule.
[0206] In certain embodiments, the spacer length of the guide RNA is less than 28 nucleotides. In certain embodiments, the spacer length of the guide RNA is at least 18 nucleotides and less than 28 nucleotides. In certain embodiments, the spacer length of the guide RNA is between 19 and 28 nucleotides. In certain embodiments, the spacer length of the guide RNA is between 19 and 25 nucleotides. In certain embodiments, the spacer length of the guide RNA is 20 nucleotides. In certain embodiments, the spacer length of the guide RNA is 23 nucleotides. In certain embodiments, the spacer length of the guide RNA is 25 nucleotides.
[0207] In certain embodiments, modulations of cleavage efficiency can be exploited by introduction of mismatches, e.g. 1 or more mismatches, such as 1 or 2 mismatches between spacer sequence and target sequence, including the position of the mismatch along the spacer/target. The more central (i.e. not 3′ or 5′) for instance a double mismatch is, the more cleavage efficiency is affected. Accordingly, by choosing mismatch position along the spacer, cleavage efficiency can be modulated. By means of example, if less than 100% cleavage of targets is desired (e.g. in a cell population), 1 or more, such as preferably 2 mismatches between spacer and target sequence may be introduced in the spacer sequences. The more central along the spacer of the mismatch position, the lower the cleavage percentage.
[0208] In certain example embodiments, the cleavage efficiency may be exploited to design single guides that can distinguish two or more targets that vary by a single nucleotide, such as a single nucleotide polymorphism (SNP), variation, or (point) mutation. The CRISPR effector may have reduced sensitivity to SNPs (or other single nucleotide variations) and continue to cleave SNP targets with a certain level of efficiency. Thus, for two targets, or a set of targets, a guide RNA may be designed with a nucleotide sequence that is complementary to one of the targets i.e. the on-target SNP. The guide RNA is further designed to have a synthetic mismatch. As used herein a “synthetic mismatch” refers to a non-naturally occurring mismatch that is introduced upstream or downstream of the naturally occurring SNP, such as at most 5 nucleotides upstream or downstream, for instance 4, 3, 2, or 1 nucleotide upstream or downstream, preferably at most 3 nucleotides upstream or downstream, more preferably at most 2 nucleotides upstream or downstream, most preferably 1 nucleotide upstream or downstream (i.e. adjacent the SNP). When the CRISPR effector binds to the on-target SNP, only a single mismatch will be formed with the synthetic mismatch and the CRISPR effector will continue to be activated and a detectable signal produced. When the guide RNA hybridizes to an off-target SNP, two mismatches will be formed, the mismatch from the SNP and the synthetic mismatch, and no detectable signal generated. Thus, the systems disclosed herein may be designed to distinguish SNPs within a population. For, example the systems may be used to distinguish pathogenic strains that differ by a single SNP or detect certain disease specific SNPs, such as but not limited to, disease associated SNPs, such as without limitation cancer associated SNPs.
[0209] In certain embodiments, the guide RNA is designed such that the SNP is located on position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 of the spacer sequence (starting at the 5′ end). In certain embodiments, the guide RNA is designed such that the SNP is located on position 1, 2, 3, 4, 5, 6, 7, 8, or 9 of the spacer sequence (starting at the 5′ end). In certain embodiments, the guide RNA is designed such that the SNP is located on position 2, 3, 4, 5, 6, or 7 of the spacer sequence (starting at the 5′ end). In certain embodiments, the guide RNA is designed such that the SNP is located on position 3, 4, 5, or 6 of the spacer sequence (starting at the 5′ end). In certain embodiments, the guide RNA is designed such that the SNP is located on position 3 of the spacer sequence (starting at the 5′ end).
[0210] In certain embodiments, the guide RNA is designed such that the mismatch (e.g. the synthetic mismatch, i.e. an additional mutation besides a SNP) is located on position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 of the spacer sequence (starting at the 5′ end). In certain embodiments, the guide RNA is designed such that the mismatch is located on position 1, 2, 3, 4, 5, 6, 7, 8, or 9 of the spacer sequence (starting at the 5′ end). In certain embodiments, the guide RNA is designed such that the mismatch is located on position 4, 5, 6, or 7 of the spacer sequence (starting at the 5′ end. In certain embodiments, the guide RNA is designed such that the mismatch is located at position 3, 4, 5, or 6 of the spacer, preferably position 3. In certain embodiments, the guide RNA is designed such that the mismatch is located on position 5 of the spacer sequence (starting at the 5′ end).
[0211] In certain embodiments, said mismatch is 1, 2, 3, 4, or 5 nucleotides upstream or downstream, preferably 2 nucleotides, preferably downstream of said SNP or other single nucleotide variation in said guide RNA.
[0212] In certain embodiments, the guide RNA is designed such that the mismatch is located 2 nucleotides upstream of the SNP (i.e. one intervening nucleotide).
[0213] In certain embodiments, the guide RNA is designed such that the mismatch is located 2 nucleotides downstream of the SNP (i.e. one intervening nucleotide).
[0214] In certain embodiments, the guide RNA is designed such that the mismatch is located on position 5 of the spacer sequence (starting at the 5′ end) and the SNP is located on position 3 of the spacer sequence (starting at the 5′ end).
[0215] In certain embodiments, the guide RNA comprises a spacer which is truncated relative to a wild type spacer. In certain embodiments, the guide RNA comprises a spacer which comprises less than 28 nucleotides, preferably between and including 20 to 27 nucleotides.
[0216] In certain embodiments, the guide RNA comprises a spacer which consists of 20-25 nucleotides or 20-23 nucleotides, such as preferably 20 or 23 nucleotides.
[0217] In certain embodiments, the one or more guide RNAs are designed to detect a single nucleotide polymorphism in a target RNA or DNA, or a splice variant of an RNA transcript.
[0218] In certain embodiments, the one or more guide RNAs may be designed to bind to one or more target molecules that are diagnostic for a disease state. In some embodiments, the disease may be cancer. In some embodiments, the disease state may be an autoimmune disease. In some embodiments, the disease state may be an infection. In some embodiments, the infection may be caused by a virus, a bacterium, a fungus, a protozoa, or a parasite. In specific embodiments, the infection is a viral infection. In specific embodiments, the viral infection is caused by a DNA virus.
[0219] The embodiments described herein comprehend inducing one or more nucleotide modifications in a eukaryotic cell (in vitro, i.e. in an isolated eukaryotic cell) as herein discussed comprising delivering to cell a vector as herein discussed. The mutation(s) can include the introduction, deletion, or substitution of one or more nucleotides at each target sequence of cell(s) via the guide(s) RNA(s). The mutations can include the introduction, deletion, or substitution of 1-75 nucleotides at each target sequence of said cell(s) via the guide(s) RNA(s). The mutations can include the introduction, deletion, or substitution of 1, 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or 75 nucleotides at each target sequence of said cell(s) via the guide(s) RNA(s). The mutations can include the introduction, deletion, or substitution of 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or 75 nucleotides at each target sequence of said cell(s) via the guide(s) RNA(s). The mutations include the introduction, deletion, or substitution of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or 75 nucleotides at each target sequence of said cell(s) via the guide(s) RNA(s). The mutations can include the introduction, deletion, or substitution of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or 75 nucleotides at each target sequence of said cell(s) via the guide(s) RNA(s). The mutations can include the introduction, deletion, or substitution of 40, 45, 50, 75, 100, 200, 300, 400 or 500 nucleotides at each target sequence of said cell(s) via the guide(s) RNA(s).
[0220] Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence, but may depend on for instance secondary structure, in particular in the case of RNA targets.
[0221] Example orthologs include Alicyclobacillus macrosporangiidus strain DSM 17980, Bacillus hisashii strain C4, Candidatus Lindowbacteria bacterium RIFCSPLOWO2, Elusimicrobia bacterium RIFOXYA12, Omnitrophica WOR_2 bacterium RIFCSPHIGHO2, Phycisphaerae bacterium ST-NAGAB-D1, Planctomycetes bacterium RBG_13_46_10, Spirochaetes bacterium GWB1_27_13, Verrucomicrobiaceae bacterium UBA2429.
Samples
[0222] Samples to be screened are loaded at the sample loading portion of the lateral flow substrate. The samples must be liquid samples or samples dissolved in an appropriate solvent, usually aqueous. The liquid sample reconstitutes the SHERLOCK reagents such that a SHERLOCK reaction can occur. The liquid sample begins to flow from the sample portion of the substrate towards the first and second capture regions.
[0223] A sample for use with the invention may be a biological or environmental sample, such as a surface sample, a fluid sample, or a food sample (fresh fruits or vegetables, meats). Food samples may include a beverage sample, a paper surface, a fabric surface, a metal surface, a wood surface, a plastic surface, a soil sample, a freshwater sample, a wastewater sample, a saline water sample, exposure to atmospheric air or other gas sample, or a combination thereof. For example, household/commercial/industrial surfaces made of any materials including, but not limited to, metal, wood, plastic, rubber, or the like, may be swabbed and tested for contaminants. Soil samples may be tested for the presence of pathogenic bacteria or parasites, or other microbes, both for environmental purposes and/or for human, animal, or plant disease testing. Water samples such as freshwater samples, wastewater samples, or saline water samples can be evaluated for cleanliness and safety, and/or potability, to detect the presence of, for example, Cryptosporidium parvum, Giardia lamblia, or other microbial contamination. In further embodiments, a biological sample may be obtained from a source including, but not limited to, a tissue sample, saliva, blood, plasma, sera, stool, urine, sputum, mucous, lymph, synovial fluid, spinal fluid, cerebrospinal fluid, ascites, pleural effusion, seroma, pus, bile, aqueous or vitreous humor, transudate, exudate, or swab of skin or a mucosal membrane surface. In some particular embodiments, an environmental sample or biological samples may be crude samples and/or the one or more target molecules may not be purified or amplified from the sample prior to application of the method. Identification of microbes may be useful and/or needed for any number of applications, and thus any type of sample from any source deemed appropriate by one of skill in the art may be used in accordance with the invention.
Methods for Detecting and/or Quantifying Target Nucleic Acids
[0224] In some embodiments, the invention provides methods for detecting target nucleic acids in a sample. Such methods may comprise contacting a sample with the first end of a lateral flow device as described herein. The first end of the lateral flow device may comprise a sample loading portion, wherein the sample flows from the sample loading portion of the substrate towards the first and second capture regions and generates a detectable signal.
[0225] A positive detectable signal may be any signal that can be detected using optical, fluorescent, chemiluminescent, electrochemical or other detection methods known in the art, as described elsewhere herein.
[0226] In some embodiments, the lateral flow device may be capable of detecting two different target nucleic acid sequences. In some embodiments, this detection of two different target nucleic acid sequences may occur simultaneously.
[0227] In some embodiments, the absence of target nucleic acid sequences in a sample elicits a detectable fluorescent signal at each capture region. In such instances, the absence of any target nucleic acid sequences in a sample may cause a detectable signal to appear at the first and second capture regions.
[0228] In some embodiments, the lateral flow device as described herein is capable of detecting three different target nucleic acid sequences. In specific embodiments, when the target nucleic acid sequences are absent from the sample, a fluorescent signal may be generated at each of the three capture regions. In such exemplary embodiments, a fluorescent signal may be absent at the capture region for the corresponding target nucleic acid sequence when the sample contains one or more target nucleic acid sequences.
[0229] Samples to be screened are loaded at the sample loading portion of the lateral flow substrate. The samples must be liquid samples or samples dissolved in an appropriate solvent, usually aqueous. The liquid sample reconstitutes the system reagents such that a SHERLOCK reaction can occur. Intact reporter construct is bound at the first capture region by binding between the first binding agent and the first molecule. Likewise, the detection agent will begin to collect at the first binding region by binding to the second molecule on the intact reporter construct. If target molecule(s) are present in the sample, the CRISPR effector protein collateral effect is activated. As activated CRISPR effector protein comes into contact with the bound reporter construct, the reporter constructs are cleaved, releasing the second molecule to flow further down the lateral flow substrate towards the second binding region. The released second molecule is then captured at the second capture region by binding to the second binding agent, where additional detection agent may also accumulate by binding to the second molecule. Accordingly, if the target molecule(s) is not present in the sample, a detectable signal will appear at the first capture region, and if the target molecule(s) is present in the sample, a detectable signal will appear at the location of the second capture region.
[0230] In some embodiments, the invention provides a method for quantifying target nucleic acids in samples comprising distributing a sample or set of samples into one or more individual discrete volumes comprising two or more CRISPR systems as described herein. The method may comprise using HDA to amplify one or more target molecules in the sample or set of samples, as described herein. The method may further comprise incubating the sample or set of samples under conditions sufficient to allow binding of the guide RNAs to one or more target molecules. The method may further comprise activating the CRISPR effector protein via binding of the guide RNAs to the one or more target molecules. Activating the CRISPR effector protein may result in modification of the detection construct such that a detectable positive signal is generated. The method may further comprise detecting the one or more detectable positive signals, wherein detection indicates the presence of one or more target molecules in the sample. The method may further comprise comparing the intensity of the one or more signals to a control to quantify the nucleic acid in the sample. The steps of amplifying, incubating, activating, and detecting may all be performed in the same individual discrete volume.
Amplifying Target Molecules
[0231] The step of amplifying one or more target molecules can comprise amplification systems known in the art. In some embodiments, amplification is isothermal. In certain example embodiments, target RNAs and/or DNAs may be amplified prior to activating the CRISPR effector protein. Any suitable RNA or DNA amplification technique may be used. In certain example embodiments, the RNA or DNA amplification is an isothermal amplification. In certain example embodiments, the isothermal amplification may be nucleic-acid sequenced-based amplification (NASBA), recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), strand displacement amplification (SDA), helicase-dependent amplification (HDA), or nicking enzyme amplification reaction (NEAR). In certain example embodiments, non-isothermal amplification methods may be used which include, but are not limited to, PCR, multiple displacement amplification (MDA), rolling circle amplification (RCA), ligase chain reaction (LCR), or ramification amplification method (RAM).
[0232] In certain example embodiments, the RNA or DNA amplification is NASBA, which is initiated with reverse transcription of target RNA by a sequence-specific reverse primer to create a RNA/DNA duplex. RNase H is then used to degrade the RNA template, allowing a forward primer containing a promoter, such as the T7 promoter, to bind and initiate elongation of the complementary strand, generating a double-stranded DNA product. The RNA polymerase promoter-mediated transcription of the DNA template then creates copies of the target RNA sequence. Importantly, each of the new target RNAs can be detected by the guide RNAs thus further enhancing the sensitivity of the assay. Binding of the target RNAs by the guide RNAs then leads to activation of the CRISPR effector protein and the methods proceed as outlined above. The NASBA reaction has the additional advantage of being able to proceed under moderate isothermal conditions, for example at approximately 41° C., making it suitable for systems and devices deployed for early and direct detection in the field and far from clinical laboratories.
[0233] In certain other example embodiments, a recombinase polymerase amplification (RPA) reaction may be used to amplify the target nucleic acids. RPA reactions employ recombinases which are capable of pairing sequence-specific primers with homologous sequence in duplex DNA. If target DNA is present, DNA amplification is initiated and no other sample manipulation such as thermal cycling or chemical melting is required. The entire RPA amplification system is stable as a dried formulation and can be transported safely without refrigeration. RPA reactions may also be carried out at isothermal temperatures with an optimum reaction temperature of 37-42° C. The sequence specific primers are designed to amplify a sequence comprising the target nucleic acid sequence to be detected. In certain example embodiments, a RNA polymerase promoter, such as a T7 promoter, is added to one of the primers. This results in an amplified double-stranded DNA product comprising the target sequence and a RNA polymerase promoter. After, or during, the RPA reaction, a RNA polymerase is added that will produce RNA from the double-stranded DNA templates. The amplified target RNA can then in turn be detected by the CRISPR effector system. In this way target DNA can be detected using the embodiments disclosed herein. RPA reactions can also be used to amplify target RNA. The target RNA is first converted to cDNA using a reverse transcriptase, followed by second strand DNA synthesis, at which point the RPA reaction proceeds as outlined above.
[0234] In an embodiment of the invention may comprise nickase-based amplification. The nicking enzyme may be a CRISPR protein. Accordingly, the introduction of nicks into dsDNA can be programmable and sequence-specific.
[0235] The amplification can be isothermal and selected for temperature. In one embodiment, the amplification proceeds rapidly at 37 degrees. In other embodiments, the temperature of the isothermal amplification may be chosen by selecting a polymerase (e.g. Bsu, Bst, Phi29, klenow fragment etc.) operable at a different temperature.
[0236] Thus, whereas nicking isothermal amplification techniques use nicking enyzmes with fixed sequence preference (e.g. in nicking enzyme amplification reaction or NEAR), which requires denaturing of the original dsDNA target to allow annealing and extension of primers that add the nicking substrate to the ends of the target, use of a CRISPR nickase wherein the nicking sites can be programed via guide RNAs means that no denaturing step is necessary, enabling the entire reaction to be truly isothermal. This also simplifies the reaction because these primers that add the nicking substrate are different than the primers that are used later in the reaction, meaning that NEAR requires two primer sets (i.e. 4 primers) while Cpf1 nicking amplification only requires one primer set (i.e. two primers). This makes nicking Cpf1 amplification much simpler and easier to operate without complicated instrumentation to perform the denaturation and then cooling to the isothermal temperature.
[0237] Accordingly, in certain example embodiments the systems disclosed herein may include amplification reagents. Different components or reagents useful for amplification of nucleic acids are described herein. For example, an amplification reagent as described herein may include a buffer, such as a Tris buffer. A Tris buffer may be used at any concentration appropriate for the desired application or use, for example including, but not limited to, a concentration of 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 25 mM, 50 mM, 75 mM, 1 M, or the like. One of skill in the art will be able to determine an appropriate concentration of a buffer such as Tris for use with the present invention.
[0238] A salt, such as magnesium chloride (MgCl2), potassium chloride (KCl), or sodium chloride (NaCl), may be included in an amplification reaction, such as PCR, in order to improve the amplification of nucleic acid fragments. Although the salt concentration will depend on the particular reaction and application, in some embodiments, nucleic acid fragments of a particular size may produce optimum results at particular salt concentrations. Larger products may require altered salt concentrations, typically lower salt, in order to produce desired results, while amplification of smaller products may produce better results at higher salt concentrations. One of skill in the art will understand that the presence and/or concentration of a salt, along with alteration of salt concentrations, may alter the stringency of a biological or chemical reaction, and therefore any salt may be used that provides the appropriate conditions for a reaction of the present invention and as described herein.
[0239] Other components of a biological or chemical reaction may include a cell lysis component in order to break open or lyse a cell for analysis of the materials therein. A cell lysis component may include, but is not limited to, a detergent, a salt as described above, such as NaCl, KCl, ammonium sulfate [(NH4)2SO4], or others. Detergents that may be appropriate for the invention may include Triton X-100, sodium dodecyl sulfate (SDS), CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate), ethyl trimethyl ammonium bromide, nonyl phenoxypolyethoxylethanol (NP-40). Concentrations of detergents may depend on the particular application, and may be specific to the reaction in some cases. Amplification reactions may include dNTPs and nucleic acid primers used at any concentration appropriate for the invention, such as including, but not limited to, a concentration of 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, 100 mM, 150 mM, 200 mM, 250 mM, 300 mM, 350 mM, 400 mM, 450 mM, 500 mM, or the like. Likewise, a polymerase useful in accordance with the invention may be any specific or general polymerase known in the art and useful or the invention, including Taq polymerase, Q5 polymerase, or the like.
[0240] In some embodiments, amplification reagents as described herein may be appropriate for use in hot-start amplification. Hot start amplification may be beneficial in some embodiments to reduce or eliminate dimerization of adaptor molecules or oligos, or to otherwise prevent unwanted amplification products or artifacts and obtain optimum amplification of the desired product. Many components described herein for use in amplification may also be used in hot-start amplification. In some embodiments, reagents or components appropriate for use with hot-start amplification may be used in place of one or more of the composition components as appropriate. For example, a polymerase or other reagent may be used that exhibits a desired activity at a particular temperature or other reaction condition. In some embodiments, reagents may be used that are designed or optimized for use in hot-start amplification, for example, a polymerase may be activated after transposition or after reaching a particular temperature. Such polymerases may be antibody-based or aptamer-based. Polymerases as described herein are known in the art. Examples of such reagents may include, but are not limited to, hot-start polymerases, hot-start dNTPs, and photo-caged dNTPs. Such reagents are known and available in the art. One of skill in the art will be able to determine the optimum temperatures as appropriate for individual reagents.
[0241] Amplification of nucleic acids may be performed using specific thermal cycle machinery or equipment, and may be performed in single reactions or in bulk, such that any desired number of reactions may be performed simultaneously. In some embodiments, amplification may be performed using microfluidic or robotic devices, or may be performed using manual alteration in temperatures to achieve the desired amplification. In some embodiments, optimization may be performed to obtain the optimum reactions conditions for the particular application or materials. One of skill in the art will understand and be able to optimize reaction conditions to obtain sufficient amplification.
[0242] In certain embodiments, detection of DNA with the methods or systems of the invention requires transcription of the (amplified) DNA into RNA prior to detection.
[0243] It will be evident that detection methods of the invention can involve nucleic acid amplification and detection procedures in various combinations. The nucleic acid to be detected can be any naturally occurring or synthetic nucleic acid, including but not limited to DNA and RNA, which may be amplified by any suitable method to provide an intermediate product that can be detected. Detection of the intermediate product can be by any suitable method including but not limited to binding and activation of a CRISPR protein which produces a detectable signal moiety by direct or collateral activity.
[0244] Helicase-Dependent Amplification
[0245] In helicase-dependent amplification, a helicase enzyme is used to unwind a double stranded nucleic acid to generate templates for primer hybridization and subsequent primer-extension. This process utilizes two oligonucleotide primers, each hybridizing to the 3′-end of either the sense strand containing the target sequence or the anti-sense strand containing the reverse-complementary target sequence. The HDA reaction is a general method for helicase-dependent nucleic acid amplification.
[0246] In combining this method with a CRISPR-SHERLOCK system, the target nucleic acid may be amplified by opening R-loops of the target nucleic acid using first and second CRISPR/Cas complexes. The first and second strand of the target nucleic acid may thus be unwound using a helicase, allowing primers and polymerase to bind and extend the DNA under isothermal conditions.
[0247] The term “helicase” refers here to any enzyme capable of unwinding a double stranded nucleic acid enzymatically. For example, helicases are enzymes that are found in all organisms and in all processes that involve nucleic acid such as replication, recombination, repair, transcription, translation and RNA splicing. (Kornberg and Baker, DNA Replication, W. H. Freeman and Company (2.sup.nd ed. (1992)), especially chapter 11). Any helicase that translocates along DNA or RNA in a 5′ to 3′ direction or in the opposite 3′ to 5′ direction may be used in present embodiments of the invention. This includes helicases obtained from prokaryotes, viruses, archaea, and eukaryotes or recombinant forms of naturally occurring enzymes as well as analogues or derivatives having the specified activity. Examples of naturally occurring DNA helicases, described by Kornberg and Baker in chapter 11 of their book, DNA Replication, W. H. Freeman and Company (2.sup.nd ed. (1992)), include E. coli helicase I, II, III, & IV, Rep, DnaB, PriA, PcrA, T4 Gp41 helicase, T4 Dda helicase, T7 Gp4 helicases, SV40 Large T antigen, yeast RAD. Additional helicases that may be useful in HDA include RecQ helicase (Harmon and Kowalczykowski, J. Biol. Chem. 276:232-243 (2001)), thermostable UvrD helicases from T. tengcongensis (disclosed in this invention, Example XII) and T. thermophilus (Collins and McCarthy, Extremophiles. 7:35-41. (2003)), thermostable DnaB helicase from T. aquaticus (Kaplan and Steitz, J. Biol. Chem. 274:6889-6897 (1999)), and MCM helicase from archaeal and eukaryotic organisms ((Grainge et al., Nucleic Acids Res. 31:4888-4898 (2003)).
[0248] A traditional definition of a helicase is an enzyme that catalyzes the reaction of separating/unzipping/unwinding the helical structure of nucleic acid duplexes (DNA, RNA or hybrids) into single-stranded components, using nucleoside triphosphate (NTP) hydrolysis as the energy source (such as ATP). However, it should be noted that not all helicases fit this definition anymore. A more general definition is that they are motor proteins that move along the single-stranded or double stranded nucleic acids (usually in a certain direction, 3′ to 5′ or 5 to 3, or both), i.e. translocases, that can or cannot unwind the duplexed nucleic acid encountered. In addition, some helicases simply bind and “melt” the duplexed nucleic acid structure without an apparent translocase activity.
[0249] Helicases exist in all living organisms and function in all aspects of nucleic acid metabolism. Helicases are classified based on the amino acid sequences, directionality, oligomerization state and nucleic-acid type and structure preferences. The most common classification method was developed based on the presence of certain amino acid sequences, called motifs. According to this classification helicases are divided into 6 super families: SF1, SF2, SF3, SF4, SF5 and SF6. SF1 and SF2 helicases do not form a ring structure around the nucleic acid, whereas SF3 to SF6 do. Superfamily classification is not dependent on the classical taxonomy.
[0250] DNA helicases are responsible for catalyzing the unwinding of double-stranded DNA (dsDNA) molecules to their respective single-stranded nucleic acid (ssDNA) forms. Although structural and biochemical studies have shown how various helicases can translocate on ssDNA directionally, consuming one ATP per nucleotide, the mechanism of nucleic acid unwinding and how the unwinding activity is regulated remains unclear and controversial (T. M. Lohman, E. J. Tomko, C. G. Wu, “Non-hexameric DNA helicases and translocases: mechanisms and regulation,” Nat Rev Mol Cell Biol 9:391-401 (2008)). Since helicases can potentially unwind all nucleic acids encountered, understanding how their unwinding activities are regulated can lead to harnessing helicase functions for biotechnology applications.
[0251] The term “HDA” refers to Helicase Dependent Amplification, which is an in vitro method for amplifying nucleic acids by using a helicase preparation for unwinding a double stranded nucleic acid to generate templates for primer hybridization and subsequent primer-extension. This process utilizes two oligonucleotide primers, each hybridizing to the 3′-end of either the sense strand containing the target sequence or the anti-sense strand containing the reverse-complementary target sequence. The HDA reaction is a general method for helicase-dependent nucleic acid amplification.
[0252] The invention comprises use of any suitable helicase known in the art. These include, but are not necessarily limited to, UvrD helicase, CRISPR-Cas3 helicase, E. coli helicase I, E. coli helicase II, E. coli helicase III, E. coli helicase IV, Rep helicase, DnaB helicase, PriA helicase, PcrA helicase, T4 Gp41 helicase, T4 Dda helicase, SV40 Large T antigen, yeast RAD helicase, RecD helicase, RecQ helicase, thermostable T. tengcongensis UvrD helicase, thermostable T. thermophilus UvrD helicase, thermostable T. aquaticus DnaB helicase, Dda helicase, papilloma virus E1 helicase, archaeal MCM helicase, eukaryotic MCM helicase, and T7 Gp4 helicase.
[0253] In particularly preferred embodiments, the helicase comprises a super mutation. In particular embodiments, Although the E. coli mutation has been described, the mutations were generated by sequence alignment (e.g. D409A/D410A for TteUvrd) and result in thermophilic enzymes working at lower temperatures like 37 C, which is advantageous for amplification methods and systems described herein. In some embodiments, the super mutant is an aspartate to alanine mutation, with position based on sequence alignment. In some embodiments, the super mutant helicase is selected from WP_003870487.1 Thermoanaerobacter ethanolicus 403/404, WP_049660019.1 Bacillus sp. FJAT-27231 407/408, WP_034654680.1 Bacillus megaterium 415/416, WP_095390358.1 Bacillus simplex 407/408, and WP_055343022.1 Paeniclostridium sordellii 402/403.
[0254] An “individual discrete volume” is a discrete volume or discrete space, such as a container, receptacle, or other defined volume or space that can be defined by properties that prevent and/or inhibit migration of nucleic acids and reagents necessary to carry out the methods disclosed herein, for example a volume or space defined by physical properties such as walls, for example the walls of a well, tube, or a surface of a droplet, which may be impermeable or semipermeable, or as defined by other means such as chemical, diffusion rate limited, electro-magnetic, or light illumination, or any combination thereof. By “diffusion rate limited” (for example diffusion defined volumes) is meant spaces that are only accessible to certain molecules or reactions because diffusion constraints effectively defining a space or volume as would be the case for two parallel laminar streams where diffusion will limit the migration of a target molecule from one stream to the other. By “chemical” defined volume or space is meant spaces where only certain target molecules can exist because of their chemical or molecular properties, such as size, where for example gel beads may exclude certain species from entering the beads but not others, such as by surface charge, matrix size or other physical property of the bead that can allow selection of species that may enter the interior of the bead. By “electro-magnetically” defined volume or space is meant spaces where the electro-magnetic properties of the target molecules or their supports such as charge or magnetic properties can be used to define certain regions in a space such as capturing magnetic particles within a magnetic field or directly on magnets. By “optically” defined volume is meant any region of space that may be defined by illuminating it with visible, ultraviolet, infrared, or other wavelengths of light such that only target molecules within the defined space or volume may be labeled. One advantage to the used of non-walled, or semipermeable is that some reagents, such as buffers, chemical activators, or other agents maybe passed in Applicants' through the discrete volume, while other material, such as target molecules, maybe maintained in the discrete volume or space. Typically, a discrete volume will include a fluid medium, (for example, an aqueous solution, an oil, a buffer, and/or a media capable of supporting cell growth) suitable for labeling of the target molecule with the indexable nucleic acid identifier under conditions that permit labeling. Exemplary discrete volumes or spaces useful in the disclosed methods include droplets (for example, microfluidic droplets and/or emulsion droplets), hydrogel beads or other polymer structures (for example poly-ethylene glycol di-acrylate beads or agarose beads), tissue slides (for example, fixed formalin paraffin embedded tissue slides with particular regions, volumes, or spaces defined by chemical, optical, or physical means), microscope slides with regions defined by depositing reagents in ordered arrays or random patterns, tubes (such as, centrifuge tubes, microcentrifuge tubes, test tubes, cuvettes, conical tubes, and the like), bottles (such as glass bottles, plastic bottles, ceramic bottles, Erlenmeyer flasks, scintillation vials and the like), wells (such as wells in a plate), plates, pipettes, or pipette tips among others. In certain example embodiments, the individual discrete volumes are the wells of a microplate. In certain example embodiments, the microplate is a 96 well, a 384 well, or a 1536 well microplate.
Incubating
[0255] Methods of detection and or quantifying using the systems disclosed herein can comprise incubating the sample or set of samples under conditions sufficient to allow binding of the guide RNAs to one or more target molecules. In certain example embodiments, the incubation time of the present invention may be shortened. The assay may be performed in a period of time required for an enzymatic reaction to occur. One skilled in the art can perform biochemical reactions in 5 minutes (e.g., 5 minute ligation). Incubating may occur at one or more temperatures over timeframes between about 10 minutes and 3 hours, preferably less than 200 minutes, 150 minutes, 100 minutes, 75 minutes, 60 minutes, 45 minutes, 30 minutes, or 20 minutes, depending on sample, reagents and components of the system. In some embodiments, incubating is performed at one or more temperatures between about 20° C. and 80° C., in some embodiments, about 37° C.
Activating
[0256] Activating of the CRISPR effector protein occurs via binding of the guide RNAs to the one or more target molecules, wherein activating the CRISPR effector protein results in modification of the detection construct such that a detectable positive signal is generated.
Detecting a Signal
[0257] Detecting may comprise visual observance of a positive signal relative to a control. Detecting may comprise a loss of signal or presence of signal at one or more capture regions, for example colorimetric detection, or fluorescent detection. In certain example embodiments, further modifications may be introduced that further amplify the detectable positive signal. For example, activated CRISPR effector protein collateral activation may be used to generate a secondary target or additional guide sequence, or both. In one example embodiment, the reaction solution would contain a secondary target that is spiked in at high concentration. The secondary target may be distinct from the primary target (i.e. the target for which the assay is designed to detect) and in certain instances may be common across all reaction volumes. A secondary guide sequence for the secondary target may be protected, e.g. by a secondary structural feature such as a hairpin with an RNA loop, and unable to bind the second target or the CRISPR effector protein. Cleavage of the protecting group by an activated CRISPR effector protein (i.e. after activation by formation of complex with the primary target(s) in solution) and formation of a complex with free CRISPR effector protein in solution and activation from the spiked in secondary target. In certain other example embodiments, a similar concept is used with free guide sequence to a secondary target and protected secondary target. Cleavage of a protecting group off the secondary target would allow additional CRISPR effector protein, guide sequence, secondary target sequence to form. In yet another example embodiment, activation of CRISPR effector protein by the primary target(s) may be used to cleave a protected or circularized primer, which would then be released to perform an isothermal amplification reaction, such as those disclosed herein, on a template for either secondary guide sequence, secondary target, or both. Subsequent transcription of this amplified template would produce more secondary guide sequence and/or secondary target sequence, followed by additional CRISPR effector protein collateral activation.
Quantifying
[0258] In particular methods, comparing the intensity of the one or more signals to a control is performed to quantify the nucleic acid in the sample. The term “control” refers to any reference standard suitable to provide a comparison to the expression products in the test sample. In one embodiment, the control comprises obtaining a “control sample” from which expression product levels are detected and compared to the expression product levels from the test sample. Such a control sample may comprise any suitable sample, including but not limited to a sample from a control patient (can be stored sample or previous sample measurement) with a known outcome; normal tissue, fluid, or cells isolated from a subject, such as a normal patient or the patient having a condition of interest.
[0259] The intensity of a signal is “significantly” higher or lower than the normal intensity if the signal is greater or less, respectively, than the normal or control level by an amount greater than the standard error of the assay employed to assess amount, and preferably at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or than that amount. Alternatively, the signal can be considered “significantly” higher or lower than the normal and/or control signal if the amount is at least about two, and preferably at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 105%, 110%, 115%, 120%, 125%, 130%, 135%, 140%, 145%, 150%, 155%, 160%, 165%, 170%, 175%, 180%, 185%, 190%, 195%, two times, three times, four times, five times, or more, or any range in between, such as 5%-100%, higher or lower, respectively, than the normal and/or control signal. Such significant modulation values can be applied to any metric described herein, such as altered level of expression, altered activity, changes in biomarker inhibition, changes in test agent binding, and the like.
[0260] In some embodiments, the detectable positive signal may be a loss of fluorescent signal relative to a control, as described herein. In some embodiments, the detectable positive signal may be detected on a lateral flow device, as described herein.
Applications of Detection Methods
[0261] In certain example embodiments, the systems, devices, and methods, disclosed herein are directed to detecting the presence of one or more microbial agents in a sample, such as a biological sample obtained from a subject. In certain example embodiments, the microbe may be a bacterium, a fungus, a yeast, a protozoan, a parasite, or a virus. Accordingly, the methods disclosed herein can be adapted for use in other methods (or in combination) with other methods that require quick identification of microbe species, monitoring the presence of microbial proteins (antigens), antibodies, antibody genes, detection of certain phenotypes (e.g. bacterial resistance), monitoring of disease progression and/or outbreak, and antibiotic screening. Because of the rapid and sensitive diagnostic capabilities of the embodiments disclosed here, detection of microbe species type, down to a single nucleotide difference, and the ability to be deployed as a POC device, the embodiments disclosed herein may be used as guide therapeutic regimens, such as a selection of the appropriate antibiotic or antiviral. The embodiments disclosed herein may also be used to screen environmental samples (air, water, surfaces, food etc.) for the presence of microbial contamination.
[0262] Disclosed is a method to identify microbial species, such as bacterial, viral, fungal, yeast, or parasitic species, or the like. Particular embodiments disclosed herein describe methods and systems that will identify and distinguish microbial species within a single sample, or across multiple samples, allowing for recognition of many different microbes. The present methods allow the detection of pathogens and distinguishing between two or more species of one or more organisms, e.g., bacteria, viruses, yeast, protozoa, and fungi or a combination thereof, in a biological or environmental sample, by detecting the presence of a target nucleic acid sequence in the sample. A positive signal obtained from the sample indicates the presence of the microbe. Multiple microbes can be identified simultaneously using the methods and systems of the invention, by employing the use of more than one effector protein, wherein each effector protein targets a specific microbial target sequence. In this way, a multi-level analysis can be performed for a particular subject in which any number of microbes can be detected at once. In some embodiments, simultaneous detection of multiple microbes may be performed using a set of probes that can identify one or more microbial species.
[0263] The systems and methods of detection can be used to identify single nucleotide variants, detection based on rRNA sequences, screening for drug resistance, monitoring microbe outbreaks, genetic perturbations, and screening of environmental samples, as described in PCT/US2018/054472 filed Oct. 22, 2018 at [0183]-[0327], incorporated herein by reference.
[0264] In certain example embodiments, the systems, devices, and methods disclosed herein may be used for biomarker detection. For example, the systems, devices and method disclosed herein may be used for SNP detection and/or genotyping. The systems, devices and methods disclosed herein may be also used for the detection of any disease state or disorder characterized by aberrant gene expression. Aberrant gene expression includes aberration in the gene expressed, location of expression and level of expression. Multiple transcripts or protein markers related to cardiovascular, immune disorders, and cancer among other diseases may be detected. In certain example embodiments, the embodiments disclosed herein may be used for cell free DNA detection of diseases that involve lysis, such as liver fibrosis and restrictive/obstructive lung disease. In certain example embodiments, the embodiments could be utilized for faster and more portable detection for pre-natal testing of cell-free DNA. The embodiments disclosed herein may be used for screening panels of different SNPs associated with, among others, cardiovascular health, lipid/metabolic signatures, ethnicity identification, paternity matching, human ID (e.g. matching suspect to a criminal database of SNP signatures). The embodiments disclosed herein may also be used for cell free DNA detection of mutations related to and released from cancer tumors. The embodiments disclosed herein may also be used for detection of meat quality, for example, by providing rapid detection of different animal sources in a given meat product. Embodiments disclosed herein may also be used for the detection of GMOs or gene editing related to DNA. As described herein elsewhere, closely related genotypes/alleles or biomarkers (e.g. having only a single nucleotide difference in a given target sequence) may be distinguished by introduction of a synthetic mismatch in the gRNA.
[0265] In an aspect, the invention relates to a method for detecting target nucleic acids in samples, comprising:
[0266] distributing a sample or set of samples into one or more individual discrete volumes, the individual discrete volumes comprising a CRISPR system according to the invention as described herein;
[0267] incubating the sample or set of samples under conditions sufficient to allow binding of the one or more guide RNAs to one or more target molecules;
[0268] activating the CRISPR effector protein via binding of the one or more guide RNAs to the one or more target molecules, wherein activating the CRISPR effector protein results in modification of the RNA-based masking construct such that a detectable positive signal is generated; and
[0269] detecting the detectable positive signal, wherein detection of the detectable positive signal indicates a presence of one or more target molecules in the sample.
[0270] The sensitivity of the assays described herein are well suited for detection of target nucleic acids in a wide variety of biological sample types, including sample types in which the target nucleic acid is dilute or for which sample material is limited. Biomarker screening may be carried out on a number of sample types including, but not limited to, saliva, urine, blood, feces, sputum, and cerebrospinal fluid. The embodiments disclosed herein may also be used to detect up- and/or down-regulation of genes. For example, as sample may be serially diluted such that only over-expressed genes remain above the detection limit threshold of the assay.
[0271] In certain embodiments, the present invention provides steps of obtaining a sample of biological fluid (e.g., urine, blood plasma or serum, sputum, cerebral spinal fluid), and extracting the DNA. The mutant nucleotide sequence to be detected, may be a fraction of a larger molecule or can be present initially as a discrete molecule.
[0272] In certain embodiments, DNA is isolated from plasma/serum of a cancer patient. For comparison, DNA samples isolated from neoplastic tissue and a second sample may be isolated from non-neoplastic tissue from the same patient (control), for example, lymphocytes. The non-neoplastic tissue can be of the same type as the neoplastic tissue or from a different organ source. In certain embodiments, blood samples are collected and plasma immediately separated from the blood cells by centrifugation. Serum may be filtered and stored frozen until DNA extraction.
[0273] In certain example embodiments, target nucleic acids are detected directly from a crude or unprocessed sample sample, such as blood, serum, saliva, cebrospinal fluid, sputum, or urine. In certain example embodiments, the target nucleic acid is cell free DNA.
Methods for Designing Guides
[0274] A method for designing guide RNAs for use in the detection systems of the preceding claims, the method comprising the steps of designing putative guide RNAs tiled across a target molecule of interest; creating a training model based on results of incubating guide RNAs with a Cas13 protein and the target molecule; predicting highly active guide RNAs for the target molecule, wherein the predicting comprises optimizing the nucleotide at each base position in the guide RNA based on the training model; and validating the predicted highly active guide RNAs by incubating the guide RNAs with the Cas13 protein and the target molecule.
[0275] In some embodiments, the invention provides a method for designing guide RNAs for use in the detection systems described herein. The method may comprise designing putative guide RNAs tiled across a target molecule of interest. The method may further comprise creating a training model based on results of incubating guide RNAs with a Cas13 protein and the target molecule. The method may further comprise predicting highly active guide RNAs for the target molecule. Predicting may comprise optimizing the nucleotide at each base position in the guide RNA based on the training model. The method may further comprise validating the predicted highly active guide RNAs by incubating the guide RNAs with the Cas13 protein and the target molecule.
[0276] In certain instances, the optimized guide for the target molecule is generated by pooling a set of guides, the guides produced by tiling guides across the target molecule; incubating the set of guides with a Cas polypeptide and the target molecule and measuring cleavage activity of each guide in the set; creating a training model based on the cleavage activity of the set of guides in the incubating step. Steps of predicting highly active guides for the target molecule and identifying the optimized guides by incubating the predicted highly active guides with the Cas polypeptide and the target molecule and selecting optimized guides may also be utilized in generating optimized guides. In embodiments, the training model comprises one or more input features selected from guide sequence, flanking target sequence, normalized positions of the guide in the target and guide GC content. In certain instances, the guide sequence and/or flanking sequence input comprises one hit encoding mono-nucleotide and/or dinucleotide In an embodiments, the training model comprises applying logistic regression model on the activity of the guides across the one or more input features.
[0277] In an aspect, the predicting highly active guides for the target molecule comprises selecting guides with an increase in activity of a guide relative to the median activity, or selecting guides with highest guide activity. In certain instances, the increase in activity is measured by an increase in fluorescence. Guides may be selected based on a particular cutoff, in certain instances based on activity relative to a median or above a particular cutoff-, for instance, are selected with a 1.5, 2, 2.5 or 3-fold activity relative to median, or are in the top quartile or quintile for each target tested.
[0278] The optimized guides may be generated for a Cas13 ortholog, in some instances, the optimized guide is generated for an LwaCas13a or a Cca13b ortholog.
[0279] In some embodiments, the invention provides a method for designing guide RNAs for use in the detection systems described herein. The method may comprise designing putative guide RNAs tiled across a target molecule of interest. The method may further comprise creating a training model based on results of incubating guide RNAs with a Cas13 protein and the target molecule. The method may further comprise predicting highly active guide RNAs for the target molecule. Predicting may comprise optimizing the nucleotide at each base position in the guide RNA based on the training model. The method may further comprise validating the predicted highly active guide RNAs by incubating the guide RNAs with the Cas13 protein and the target molecule.
[0280] The design of putative guide RNAs for target molecules of interest is described elsewhere herein.
[0281] The creation of training models is known in the art. Machine learning can be generalized as the ability of a learning machine to perform accurately on new, unseen examples/tasks after having experienced a learning data set. Machine learning may include the following concepts and methods. Supervised learning concepts may include AODE; Artificial neural network, such as Backpropagation, Autoencoders, Hopfield networks, Boltzmann machines, Restricted Boltzmann Machines, and Spiking neural networks; Bayesian statistics, such as Bayesian network and Bayesian knowledge base; Case-based reasoning; Gaussian process regression; Gene expression programming; Group method of data handling (GMDH); Inductive logic programming; Instance-based learning; Lazy learning; Learning Automata; Learning Vector Quantization; Logistic Model Tree; Minimum message length (decision trees, decision graphs, etc.), such as Nearest Neighbor Algorithm and Analogical modeling; Probably approximately correct learning (PAC) learning; Ripple down rules, a knowledge acquisition methodology; Symbolic machine learning algorithms; Support vector machines; Random Forests; Ensembles of classifiers, such as Bootstrap aggregating (bagging) and Boosting (meta-algorithm); Ordinal classification; Information fuzzy networks (IFN); Conditional Random Field; ANOVA; Linear classifiers, such as Fisher's linear discriminant, Linear regression, Logistic regression, Multinomial logistic regression, Naive Bayes classifier, Perceptron, Support vector machines; Quadratic classifiers; k-nearest neighbor; Boosting; Decision trees, such as C4.5, Random forests, ID3, CART, SLIQ, SPRINT; Bayesian networks, such as Naive Bayes; and Hidden Markov models. Unsupervised learning concepts may include; Expectation-maximization algorithm; Vector Quantization; Generative topographic map; Information bottleneck method; Artificial neural network, such as Self-organizing map; Association rule learning, such as, Apriori algorithm, Eclat algorithm, and FP-growth algorithm; Hierarchical clustering, such as Single-linkage clustering and Conceptual clustering; Cluster analysis, such as, K-means algorithm, Fuzzy clustering, DBSCAN, and OPTICS algorithm; and Outlier Detection, such as Local Outlier Factor. Semi-supervised learning concepts may include; Generative models; Low-density separation; Graph-based methods; and Co-training. Reinforcement learning concepts may include; Temporal difference learning; Q-learning; Learning Automata; and SARSA. Deep learning concepts may include; Deep belief networks; Deep Boltzmann machines; Deep Convolutional neural networks; Deep Recurrent neural networks; and Hierarchical temporal memory.
[0282] The methods as disclosed herein designing putative guide RNAs may comprise design based on one or more variables, including guide sequence, flanking target sequence, guide position and guide GC content as input features. In certain embodiments, the length of the flanking target region can be considered a freeparameter and can be further selected during cross-validation. Additionally, mono-nucleotide and/or dinucleotide based identities across a guide length and flanking sequence in the target, varying one or more of flanking sequence length, normalized positions of the guide in the target, and GC content of the guide, or a combination thereof.
[0283] In embodiments, the training model for the guide design is Cas protein specific. In embodiments, the Cas protein is a Cas13a, Cas13b or Cas12 a protein. In certain embodiments, the protein is LwaCas13a or CcaCas13b. Selection for the best guides can be dependent on each enzyme. In particular embodiments, where majority of guides have activity above background on a per-target basis, selection of guides may be based on 1.5 fold, 2, 2.5, 3 or more fold activity over the median activity. In other instances, the best performing guides may be at or near background fluorescence. In this instance, the guide selection may be based on a top percentile, e.g. quartile or quintile, of performing guides.
[0284] Codon optimization is described elsewhere herein. In specific embodiments, the nucleotide at each base position in the guide RNA may be optimized based on the training model, thus allowing for prediction of highly active guide RNAs for the target molecule.
[0285] The predicted highly active guide RNAs may then be validated or verified by incubating the guide RNAs with a Cas effector protein, such as Cas13 protein and the target molecule, as described in the examples.
[0286] In certain embodiments, optimization comprises validation of best performing models for a particular Cas polypeptide across multiple guides may comprise comparing the predicted score of each guide versus actual collateral activity upon target recognition. In embodiments, kinetic data of the best and worst predicted guides are evaluated. In embodiments, lateral flow performance of the predicted guides is evaluated for a target sequence.
[0287] The following table 1 is comprised of sequences contained in the accompanying Sequence Listing. Sequences referenced in Column 4 “Complete crRNA sequence” are represented in the Sequence Listing by SEQ ID NOs: 12-1100; Sequences referenced in Column 5 “Spacer” are represented in the Sequence Listing by SEQ ID Nos: 1101-2189; and Sequences referenced in Column 6 “Direct Repeat” are represented in the Sequence Listing by SEQ ID NOs: 2190-3278, all in the order in which they appear.
TABLE-US-00001 TABLE 1 Guide RNA sequences used in this study Complete crRNA 1st Fig Name Ortholog sequence Spacer Direct repeat Target Fig. 9a dengue_0 LwaCas13a GATTTAGACTACCCCAAAA ttgagaggtt GATTTAGACTAC Dengue 9a 0 ACGAAGGGGACTAAAACtt ggcccctga CCCAAAAACGAA ssRNA gagaggttggcccctgaat atatgtact GGGGACTAAAAC atgtact 9a dengue_0 LwaCas13a GATTTAGACTACCCCAAAA gttgagaggt GATTTAGACTAC Dengue 9a 1 ACGAAGGGGACTAAAACgt tggcccctg CCCAAAAACGAA ssRNA tgagaggttggcccctgaa aatatgtac GGGGACTAAAAC tatgtac 9a dengue_0 LwaCas13a GATTTAGACTACCCCAAAA tgttgagagg GATTTAGACTAC Dengue 9a 2 ACGAAGGGGACTAAAACtg ttggcccctg CCCAAAAACGAA ssRNA ttgagaggttggcccctga aatatgta GGGGACTAAAAC atatgta 9a dengue_0 LwaCas13a GATTTAGACTACCCCAAAA ttgttgagag GATTTAGACTAC Dengue 9a 3 ACGAAGGGGACTAAAACtt gttggcccct CCCAAAAACGAA ssRNA gttgagaggttggcccctg gaatatgt GGGGACTAAAAC aatatgt 9a dengue_0 LwaCas13a GATTTAGACTACCCCAAAA attgttgaga GATTTAGACTAC Dengue 9a 4 ACGAAGGGGACTAAAACat ggttggccc CCCAAAAACGAA ssRNA tgttgagaggttggcccct ctgaatatg GGGGACTAAAAC gaatatg 9a dengue_0 LwaCas13a GATTTAGACTACCCCAAAA cattgttgag GATTTAGACTAC Dengue 9a 5 ACGAAGGGGACTAAAACca aggttggcc CCCAAAAACGAA ssRNA ttgttgagaggttggcccct cctgaatat GGGGACTAAAAC gaatat 9a dengue_0 LwaCas13a GATTTAGACTACCCCAAAA tcattgttgag GATTTAGACTAC Dengue 9a 6 ACGAAGGGGACTAAAACtc aggttggcc CCCAAAAACGAA ssRNA attgttgagaggttggccc cctgaata GGGGACTAAAAC ctgaata 9a dengue_0 LwaCas13a GATTTAGACTACCCCAAAA gtcattgttga GATTTAGACTAC Dengue 9a 7 ACGAAGGGGACTAAAACgt gaggttggc CCCAAAAACGAA ssRNA cattgttgagaggttggcc ccctgaat GGGGACTAAAAC cctgaat 9a dengue_0 LwaCas13a GATTTAGACTACCCCAAAA cgtcattgttg GATTTAGACTAC Dengue 9a 8 ACGAAGGGGACTAAAACcg agaggttgg CCCAAAAACGAA ssRNA tcattgttgagaggttggc cccctgaa GGGGACTAAAAC ccctgaa 9a dengue_0 LwaCas13a GATTTAGACTACCCCAAAA tcgtcattgtt GATTTAGACTAC Dengue 9a 9 ACGAAGGGGACTAAAACtc gagaggttg CCCAAAAACGAA ssRNA gtcattgttgagaggttgg gcccctga GGGGACTAAAAC cccctga 9a dengue_1 LwaCas13a GATTTAGACTACCCCAAAA ttcgtcattgt GATTTAGACTAC Dengue 9a 0 ACGAAGGGGACTAAAACtt tgagaggttg CCCAAAAACGAA ssRNA cgtcattgttgagaggttg gcccctg GGGGACTAAAAC gcccctg 9a dengue_1 LwaCas13a GATTTAGACTACCCCAAAA cttcgtcattg GATTTAGACTAC Dengue 9a 1 ACGAAGGGGACTAAAACct ttgagaggtt CCCAAAAACGAA ssRNA tcgtcattgttgagaggtt ggcccct GGGGACTAAAAC ggcccct 9a dengue_1 LwaCas13a GATTTAGACTACCCCAAAA tcttcgtcatt GATTTAGACTAC Dengue 9a 2 ACGAAGGGGACTAAAACtc gttgagaggt CCCAAAAACGAA ssRNA ttcgtcattgttgagaggt tggcccc GGGGACTAAAAC tggcccc 9a dengue_1 LwaCas13a GATTTAGACTACCCCAAAA gtcttcgtcat GATTTAGACTAC Dengue 9a 3 ACGAAGGGGACTAAAACgt tgttgagagg CCCAAAAACGAA ssRNA cttcgtcattgttgagagg ttggccc GGGGACTAAAAC ttggccc 9a dengue_1 LwaCas13a GATTTAGACTACCCCAAAA ggtcttcgtc GATTTAGACTAC Dengue 9a 4 ACGAAGGGGACTAAAACgg attgttgaga CCCAAAAACGAA ssRNA tcttcgtcattgttgagag ggttggcc GGGGACTAAAAC gttggcc 9a dengue_1 LwaCas13a GATTTAGACTACCCCAAAA tggtcttcgtc GATTTAGACTAC Dengue 9a 5 ACGAAGGGGACTAAAACtg attgttgaga CCCAAAAACGAA ssRNA gtcttcgtcattgttgaga ggttggc GGGGACTAAAAC ggttggc 9a dengue_1 LwaCas13a GATTTAGACTACCCCAAAA atggtcttcgt GATTTAGACTAC Dengue 9a 6 ACGAAGGGGACTAAAACat cattgttgag CCCAAAAACGAA ssRNA ggtcttcgtcattgttgag aggttgg GGGGACTAAAAC aggttgg 9a dengue_1 LwaCas13a GATTTAGACTACCCCAAAA catggtcttc GATTTAGACTAC Dengue 9a 7 ACGAAGGGGACTAAAACca gtcattgttga CCCAAAAACGAA ssRNA tggtcttcgtcattgttga gaggttg GGGGACTAAAAC gaggttg 9a dengue_1 LwaCas13a GATTTAGACTACCCCAAAA gcatggtctt GATTTAGACTAC Dengue 9a 8 ACGAAGGGGACTAAAACgc cgtcattgttg CCCAAAAACGAA ssRNA atggtcttcgtcattgttg agaggtt GGGGACTAAAAC agaggtt 9a dengue_1 LwaCas13a GATTTAGACTACCCCAAAA agcatggtct GATTTAGACTAC Dengue 9a 9 ACGAAGGGGACTAAAACag tcgtcattgtt CCCAAAAACGAA ssRNA catggtcttcgtcattgtt gagaggt GGGGACTAAAAC gagaggt 9a dengue_2 LwaCas13a GATTTAGACTACCCCAAAA tgagcatggt GATTTAGACTAC Dengue 9a 0 ACGAAGGGGACTAAAACtg cttcgtcattg CCCAAAAACGAA ssRNA agcatggtcttcgtcattg ttgagag GGGGACTAAAAC ttgagag 9a dengue_2 LwaCas13a GATTTAGACTACCCCAAAA agtgagcat GATTTAGACTAC Dengue 9a 1 ACGAAGGGGACTAAAACag ggtcttcgtc CCCAAAAACGAA ssRNA tgagcatggtcttcgtcat attgttgag GGGGACTAAAAC tgttgag 9a dengue_2 LwaCas13a GATTTAGACTACCCCAAAA ccagtgagc GATTTAGACTAC Dengue 9a 2 ACGAAGGGGACTAAAACcc atggtcttcgt CCCAAAAACGAA ssRNA agtgagcatggtcttcgtc cattgttg GGGGACTAAAAC attgttg 9a dengue_2 LwaCas13a GATTTAGACTACCCCAAAA gtccagtga GATTTAGACTAC Dengue 9a 3 ACGAAGGGGACTAAAACgt gcatggtctt CCCAAAAACGAA ssRNA ccagtgagcatggtcttcg cgtcattgt GGGGACTAAAAC tcattgt 9a dengue_2 LwaCas13a GATTTAGACTACCCCAAAA ctgtccagtg GATTTAGACTAC Dengue 9a 4 ACGAAGGGGACTAAAACct agcatggtct CCCAAAAACGAA ssRNA gtccagtgagcatggtctt tcgtcatt GGGGACTAAAAC cgtcatt 9a dengue_2 LwaCas13a GATTTAGACTACCCCAAAA ttctgtccagt GATTTAGACTAC Dengue 9a 5 ACGAAGGGGACTAAAACtt gagcatggt CCCAAAAACGAA ssRNA ctgtccagtgagcatggtc cttcgtca GGGGACTAAAAC ttcgtca 9a dengue_2 LwaCas13a GATTTAGACTACCCCAAAA gcttctgtcc GATTTAGACTAC Dengue 9a 6 ACGAAGGGGACTAAAACgc agtgagcat CCCAAAAACGAA ssRNA ttctgtccagtgagcatgg ggtcttcgt GGGGACTAAAAC tcttcgt 9a dengue_2 LwaCas13a GATTTAGACTACCCCAAAA ttgcttctgtc GATTTAGACTAC Dengue 9a 7 ACGAAGGGGACTAAAACtt cagtgagca CCCAAAAACGAA ssRNA gcttctgtccagtgagcat tggtcttc GGGGACTAAAAC ggtcttc 9a dengue_2 LwaCas13a GATTTAGACTACCCCAAAA ttttgcttctgt GATTTAGACTAC Dengue 9a 8 ACGAAGGGGACTAAAACtt ccagtgagc CCCAAAAACGAA ssRNA ttgcttctgtccagtgagc atggtct GGGGACTAAAAC atggtct 9a dengue_2 LwaCas13a GATTTAGACTACCCCAAAA atttttgcttct GATTTAGACTAC Dengue 9a 9 ACGAAGGGGACTAAAACat gtccagtga CCCAAAAACGAA ssRNA ttttgcttctgtccagtga gcatggt GGGGACTAAAAC gcatggt 9a dengue_3 LwaCas13a GATTTAGACTACCCCAAAA gcatttttgct GATTTAGACTAC Dengue 9a 0 ACGAAGGGGACTAAAACgc tctgtccagt CCCAAAAACGAA ssRNA atttttgcttctgtccagt gagcatg GGGGACTAAAAC gagcatg 9a dengue_3 LwaCas13a GATTTAGACTACCCCAAAA cagcatttttg GATTTAGACTAC Dengue 9a 1 ACGAAGGGGACTAAAACca cttctgtcca CCCAAAAACGAA ssRNA gcatttttgcttctgtcca gtgagca GGGGACTAAAAC gtgagca 9a dengue_3 LwaCas13a GATTTAGACTACCCCAAAA agcagcattt GATTTAGACTAC Dengue 9a 2 ACGAAGGGGACTAAAACag ttgcttctgtc CCCAAAAACGAA ssRNA cagcatttttgcttctgtc cagtgag GGGGACTAAAAC cagtgag 9a dengue_3 LwaCas13a GATTTAGACTACCCCAAAA ccagcagca GATTTAGACTAC Dengue 9a 3 ACGAAGGGGACTAAAACcc tttttgcttctg CCCAAAAACGAA ssRNA agcagcatttttgcttctg tccagtg GGGGACTAAAAC tccagtg 9a dengue_3 LwaCas13a GATTTAGACTACCCCAAAA gtccagcag GATTTAGACTAC Dengue 9a 4 ACGAAGGGGACTAAAACgt catttttgcttc CCCAAAAACGAA ssRNA ccagcagcatttttgcttc tgtccag GGGGACTAAAAC tgtccag 9a dengue_3 LwaCas13a GATTTAGACTACCCCAAAA ttgtccagca GATTTAGACTAC Dengue 9a 5 ACGAAGGGGACTAAAACtt gcatttttgct CCCAAAAACGAA ssRNA gtccagcagcatttttgct tctgtcc GGGGACTAAAAC tctgtcc 9a dengue_3 LwaCas13a GATTTAGACTACCCCAAAA tgttgtccag GATTTAGACTAC Dengue 9a 6 ACGAAGGGGACTAAAACtg cagcatttttg CCCAAAAACGAA ssRNA ttgtccagcagcatttttg cttctgt GGGGACTAAAAC cttctgt 9a dengue_3 LwaCas13a GATTTAGACTACCCCAAAA gatgttgtcc GATTTAGACTAC Dengue 9a 7 ACGAAGGGGACTAAAACga agcagcattt CCCAAAAACGAA ssRNA tgttgtccagcagcatttt ttgcttct GGGGACTAAAAC tgcttct 9a dengue_3 LwaCas13a GATTTAGACTACCCCAAAA ttgatgttgtc GATTTAGACTAC Dengue 9a 8 ACGAAGGGGACTAAAACtt cagcagcatt CCCAAAAACGAA ssRNA gatgttgtccagcagcatt tttgctt GGGGACTAAAAC tttgctt 9a dengue_3 LwaCas13a GATTTAGACTACCCCAAAA tgttgatgttg GATTTAGACTAC Dengue 9a 9 ACGAAGGGGACTAAAACtg tccagcagc CCCAAAAACGAA ssRNA ttgatgttgtccagcagca atttttgc GGGGACTAAAAC tttttgc 9a dengue_4 LwaCas13a GATTTAGACTACCCCAAAA tgtgttgatgt GATTTAGACTAC Dengue 9a 0 ACGAAGGGGACTAAAACtg tgtccagca CCCAAAAACGAA ssRNA tgttgatgttgtccagcag gcattttt GGGGACTAAAAC cattttt 9a dengue_4 LwaCas13a GATTTAGACTACCCCAAAA ggtgtgttga GATTTAGACTAC Dengue 9a 1 ACGAAGGGGACTAAAACgg tgttgtccag CCCAAAAACGAA ssRNA tgtgttgatgttgtccagc cagcattt GGGGACTAAAAC agcattt 9a dengue_4 LwaCas13a GATTTAGACTACCCCAAAA ctggtgtgtt GATTTAGACTAC Dengue 9a 2 ACGAAGGGGACTAAAACct gatgttgtcc CCCAAAAACGAA ssRNA ggtgtgttgatgttgtcca agcagcat GGGGACTAAAAC gcagcat 9a dengue_4 LwaCas13a GATTTAGACTACCCCAAAA ttctggtgtgt GATTTAGACTAC Dengue 9a 3 ACGAAGGGGACTAAAACtt tgatgttgtcc CCCAAAAACGAA ssRNA ctggtgtgttgatgttgtc agcagc GGGGACTAAAAC cagcagc 9a dengue_4 LwaCas13a GATTTAGACTACCCCAAAA ccttctggtgt GATTTAGACTAC Dengue 9a 4 ACGAAGGGGACTAAAACcc gttgatgttgt CCCAAAAACGAA ssRNA ttctggtgtgttgatgttg ccagca GGGGACTAAAAC tccagca 9a dengue_4 LwaCas13a GATTTAGACTACCCCAAAA tcccttctggt GATTTAGACTAC Dengue 9a 5 ACGAAGGGGACTAAAACtc gtgttgatgtt CCCAAAAACGAA ssRNA ccttctggtgtgttgatgt gtccag GGGGACTAAAAC tgtccag 9a dengue_4 LwaCas13a GATTTAGACTACCCCAAAA aatcccttct GATTTAGACTAC Dengue 9a 6 ACGAAGGGGACTAAAACaa ggtgtgttga CCCAAAAACGAA ssRNA tcccttctggtgtgttgat tgttgtcc GGGGACTAAAAC gttgtcc 9a dengue_4 LwaCas13a GATTTAGACTACCCCAAAA ataatcccttc GATTTAGACTAC Dengue 9a 7 ACGAAGGGGACTAAAACat tggtgtgttg CCCAAAAACGAA ssRNA aatcccttctggtgtgttg atgttgt GGGGACTAAAAC atgttgt 9a dengue_4 LwaCas13a GATTTAGACTACCCCAAAA gtataatccc GATTTAGACTAC Dengue 9a 8 ACGAAGGGGACTAAAACgta ttctggtgtgt CCCAAAAACGAA ssRNA taatcccttctggtgtgtt tgatgtt GGGGACTAAAAC gatgtt 9a dengue_4 LwaCas13a GATTTAGACTACCCCAAAA tggtataatc GATTTAGACTAC Dengue 9a 9 ACGAAGGGGACTAAAACt ccttctggtgt CCCAAAAACGAA ssRNA ggtataatcccttctggtg gttgatg GGGGACTAAAAC tgttgatg 9a dengue_5 LwaCas13a GATTTAGACTACCCCAAAA gctggtataa GATTTAGACTAC Dengue 9a 0 ACGAAGGGGACTAAAACgc tcccttctggt CCCAAAAACGAA ssRNA tggtataatcccttctggt gtgttga GGGGACTAAAAC gtgttga 9a dengue_5 LwaCas13a GATTTAGACTACCCCAAAA gagctggtat GATTTAGACTAC Dengue 9a 1 ACGAAGGGGACTAAAACga aatcccttct CCCAAAAACGAA ssRNA gctggtataatcccttctg ggtgtgtt GGGGACTAAAAC gtgtgtt 9a dengue_5 LwaCas13a GATTTAGACTACCCCAAAA gagagctgg GATTTAGACTAC Dengue 9a 2 ACGAAGGGGACTAAAACga tataatccctt CCCAAAAACGAA ssRNA gagctggtataatcccttc ctggtgtg GGGGACTAAAAC tggtgtg 9a dengue_5 LwaCas13a GATTTAGACTACCCCAAAA aagagagct GATTTAGACTAC Dengue 9a 3 ACGAAGGGGACTAAAACaa ggtataatcc CCCAAAAACGAA ssRNA gagagctggtataatccct cttctggtg GGGGACTAAAAC tctggtg 9a dengue_5 LwaCas13a GATTTAGACTACCCCAAAA caaagagag GATTTAGACTAC Dengue 9a 4 ACGAAGGGGACTAAAACca ctggtataat CCCAAAAACGAA ssRNA aagagagctggtataatcc cccttctgg GGGGACTAAAAC cttctgg 9a dengue_5 LwaCas13a GATTTAGACTACCCCAAAA ttcaaagaga GATTTAGACTAC Dengue 9a 5 ACGAAGGGGACTAAAACtt gctggtataa CCCAAAAACGAA ssRNA caaagagagctggtataat tcccttct GGGGACTAAAAC cccttct 9a dengue_5 LwaCas13a GATTTAGACTACCCCAAAA ggttcaaag GATTTAGACTAC Dengue 9a 6 ACGAAGGGGACTAAAACgg agagctggt CCCAAAAACGAA ssRNA ttcaaagagagctggtata ataatccctt GGGGACTAAAAC atccctt 9a dengue_5 LwaCas13a GATTTAGACTACCCCAAAA ctggttcaaa GATTTAGACTAC Dengue 9a 7 ACGAAGGGGACTAAAACct gagagctgg CCCAAAAACGAA ssRNA ggttcaaagagagctggta tataatccc GGGGACTAAAAC taatccc 9a dengue_5 LwaCas13a GATTTAGACTACCCCAAAA ttctggttcaa GATTTAGACTAC Dengue 9a 8 ACGAAGGGGACTAAAACtt agagagctg CCCAAAAACGAA ssRNA ctggttcaaagagagctgg gtataatc GGGGACTAAAAC tataatc 9a dengue_5 LwaCas13a GATTTAGACTACCCCAAAA ctttctggttc GATTTAGACTAC Dengue 9a 9 ACGAAGGGGACTAAAACct aaagagagc CCCAAAAACGAA ssRNA ttctggttcaaagagagct tggtataa GGGGACTAAAAC ggtataa 9a dengue_6 LwaCas13a GATTTAGACTACCCCAAAA ccctttctggt GATTTAGACTAC Dengue 9a 0 ACGAAGGGGACTAAAACcc tcaaagaga CCCAAAAACGAA ssRNA ctttctggttcaaagagag gctggtat GGGGACTAAAAC ctggtat 9a dengue_6 LwaCas13a GATTTAGACTACCCCAAAA ctccctttctg GATTTAGACTAC Dengue 9a 1 ACGAAGGGGACTAAAACct gttcaaaga CCCAAAAACGAA ssRNA ccctttctggttcaaagag gagctggt GGGGACTAAAAC agctggt 9a dengue_6 LwaCas13a GATTTAGACTACCCCAAAA ttctccctttct GATTTAGACTAC Dengue 9a 2 ACGAAGGGGACTAAAACtt ggttcaaag CCCAAAAACGAA ssRNA ctccctttctggttcaaag agagctg GGGGACTAAAAC agagctg 9a dengue_6 LwaCas13a GATTTAGACTACCCCAAAA acttctccctt GATTTAGACTAC Dengue 9a 3 ACGAAGGGGACTAAAACac tctggttcaa CCCAAAAACGAA ssRNA ttctccctttctggttcaa agagagc GGGGACTAAAAC agagagc 9a dengue_6 LwaCas13a GATTTAGACTACCCCAAAA tgacttctcc GATTTAGACTAC Dengue 9a 4 ACGAAGGGGACTAAAACtg ctttctggttc CCCAAAAACGAA ssRNA acttctccctttctggttc aaagaga GGGGACTAAAAC aaagaga 9a dengue_6 LwaCas13a GATTTAGACTACCCCAAAA ctgacttctc GATTTAGACTAC Dengue 9a 5 ACGAAGGGGACTAAAACct cctttctggtt CCCAAAAACGAA ssRNA gacttctccctttctggtt caaagag GGGGACTAAAAC caaagag 9a dengue_6 LwaCas13a GATTTAGACTACCCCAAAA gctgacttct GATTTAGACTAC Dengue 9a 6 ACGAAGGGGACTAAAACgc ccctttctggt CCCAAAAACGAA ssRNA tgacttctccctttctggt tcaaaga GGGGACTAAAAC tcaaaga 9a dengue_6 LwaCas13a GATTTAGACTACCCCAAAA ggctgacttc GATTTAGACTAC Dengue 9a 7 ACGAAGGGGACTAAAACgg tccctttctgg CCCAAAAACGAA ssRNA ctgacttctccctttctgg ttcaaag GGGGACTAAAAC ttcaaag 9a dengue_6 LwaCas13a GATTTAGACTACCCCAAAA cggctgactt GATTTAGACTAC Dengue 9a 8 ACGAAGGGGACTAAAACcg ctccctttctg CCCAAAAACGAA ssRNA gctgacttctccctttctg gttcaaa GGGGACTAAAAC gttcaaa 9a dengue_6 LwaCas13a GATTTAGACTACCCCAAAA gcggctgac GATTTAGACTAC Dengue 9a 9 ACGAAGGGGACTAAAACgc ttctccctttct CCCAAAAACGAA ssRNA ggctgacttctccctttct ggttcaa GGGGACTAAAAC ggttcaa 9a dengue_7 LwaCas13a GATTTAGACTACCCCAAAA ggcggctga GATTTAGACTAC Dengue 9a 0 ACGAAGGGGACTAAAACgg cttctcccttt CCCAAAAACGAA ssRNA cggctgacttctccctttc ctggttca GGGGACTAAAAC tggttca 9a dengue_7 LwaCas13a GATTTAGACTACCCCAAAA tggcggctg GATTTAGACTAC Dengue 9a 1 ACGAAGGGGACTAAAACtg acttctccctt CCCAAAAACGAA ssRNA gcggctgacttctcccttt tctggttc GGGGACTAAAAC ctggttc 9a dengue_7 LwaCas13a GATTTAGACTACCCCAAAA atggcggct GATTTAGACTAC Dengue 9a 2 ACGAAGGGGACTAAAACat gacttctccc CCCAAAAACGAA ssRNA ggcggctgacttctccctt tttctggtt GGGGACTAAAAC tctggtt 9a dengue_7 LwaCas13a GATTTAGACTACCCCAAAA tatggcggct GATTTAGACTAC Dengue 9a 3 ACGAAGGGGACTAAAACta gacttctccc CCCAAAAACGAA ssRNA tggcggctgacttctccct tttctggt GGGGACTAAAAC ttctggt 9a dengue_7 LwaCas13a GATTTAGACTACCCCAAAA ctatggcgg GATTTAGACTAC Dengue 9a 4 ACGAAGGGGACTAAAACct ctgacttctc CCCAAAAACGAA ssRNA atggcggctgacttctccc cctttctgg GGGGACTAAAAC tttctgg 9a dengue_7 LwaCas13a GATTTAGACTACCCCAAAA tctatggcgg GATTTAGACTAC Dengue 9a 5 ACGAAGGGGACTAAAACtc ctgacttctc CCCAAAAACGAA ssRNA tatggcggctgacttctcc cctttctg GGGGACTAAAAC ctttctg 9a dengue_7 LwaCas13a GATTTAGACTACCCCAAAA gtctatggcg GATTTAGACTAC Dengue 9a 6 ACGAAGGGGACTAAAACgt gctgacttct CCCAAAAACGAA ssRNA ctatggcggctgacttctc ccctttct GGGGACTAAAAC cctttct 9a dengue_7 LwaCas13a GATTTAGACTACCCCAAAA cgtctatggc GATTTAGACTAC Dengue 9a 7 ACGAAGGGGACTAAAACcg ggctgacttc CCCAAAAACGAA ssRNA tctatggcggctgacttct tccctttc GGGGACTAAAAC ccctttc 9a dengue_7 LwaCas13a GATTTAGACTACCCCAAAA ccgtctatgg GATTTAGACTAC Dengue 9a 8 ACGAAGGGGACTAAAACcc cggctgactt CCCAAAAACGAA ssRNA gtctatggcggctgacttc ctcccttt GGGGACTAAAAC tcccttt 9a dengue_7 LwaCas13a GATTTAGACTACCCCAAAA accgtctatg GATTTAGACTAC Dengue 9a 9 ACGAAGGGGACTAAAACac gcggctgac CCCAAAAACGAA ssRNA cgtctatggcggctgactt ttctccctt GGGGACTAAAAC ctccctt 9a dengue_8 LwaCas13a GATTTAGACTACCCCAAAA caccgtctat GATTTAGACTAC Dengue 9a 0 ACGAAGGGGACTAAAACca ggcggctga CCCAAAAACGAA ssRNA ccgtctatggcggctgact cttctccct GGGGACTAAAAC tctccct 9a dengue_8 LwaCas13a GATTTAGACTACCCCAAAA tcaccgtcta GATTTAGACTAC Dengue 9a 1 ACGAAGGGGACTAAAACtc tggcggctg CCCAAAAACGAA ssRNA accgtctatggcggctgac acttctccc GGGGACTAAAAC ttctccc 9a dengue_8 LwaCas13a GATTTAGACTACCCCAAAA ttcaccgtct GATTTAGACTAC Dengue 9a 2 ACGAAGGGGACTAAAACtt atggcggct CCCAAAAACGAA ssRNA caccgtctatggcggctga gacttctcc GGGGACTAAAAC cttctcc 9a dengue_8 LwaCas13a GATTTAGACTACCCCAAAA attcaccgtc GATTTAGACTAC Dengue 9a 3 ACGAAGGGGACTAAAACat tatggcggct CCCAAAAACGAA ssRNA tcaccgtctatggcggctg gacttctc GGGGACTAAAAC acttctc 9a dengue_8 LwaCas13a GATTTAGACTACCCCAAAA tattcaccgt GATTTAGACTAC Dengue 9a 4 ACGAAGGGGACTAAAACta ctatggcgg CCCAAAAACGAA ssRNA ttcaccgtctatggcggct ctgacttct GGGGACTAAAAC gacttct 9a dengue_8 LwaCas13a GATTTAGACTACCCCAAAA gtattcaccg GATTTAGACTAC Dengue 9a 5 ACGAAGGGGACTAAAACgt tctatggcgg CCCAAAAACGAA ssRNA attcaccgtctatggcggc ctgacttc GGGGACTAAAAC tgacttc 9a dengue_8 LwaCas13a GATTTAGACTACCCCAAAA ggtattcacc GATTTAGACTAC Dengue 9a 6 ACGAAGGGGACTAAAACgg gtctatggcg CCCAAAAACGAA ssRNA tattcaccgtctatggcgg gctgactt GGGGACTAAAAC ctgactt 9a dengue_8 LwaCas13a GATTTAGACTACCCCAAAA cggtattcac GATTTAGACTAC Dengue 9a 7 ACGAAGGGGACTAAAACcg cgtctatggc CCCAAAAACGAA ssRNA gtattcaccgtctatggcg ggctgact GGGGACTAAAAC gctgact 9a dengue_8 LwaCas13a GATTTAGACTACCCCAAAA gcggtattca GATTTAGACTAC Dengue 9a 8 ACGAAGGGGACTAAAACgc ccgtctatgg CCCAAAAACGAA ssRNA ggtattcaccgtctatggc cggctgac GGGGACTAAAAC ggctgac 9a dengue_8 LwaCas13a GATTTAGACTACCCCAAAA ggcggtattc GATTTAGACTAC Dengue 9a 9 ACGAAGGGGACTAAAACgg accgtctatg CCCAAAAACGAA ssRNA cggtattcaccgtctatgg gcggctga GGGGACTAAAAC cggctga 9a dengue_9 LwaCas13a GATTTAGACTACCCCAAAA aggcggtatt GATTTAGACTAC Dengue 9a 0 ACGAAGGGGACTAAAACag caccgtctat CCCAAAAACGAA ssRNA gcggtattcaccgtctatg ggcggctg GGGGACTAAAAC gcggctg 9a dengue_9 LwaCas13a GATTTAGACTACCCCAAAA caggcggta GATTTAGACTAC Dengue 9a 1 ACGAAGGGGACTAAAACca ttcaccgtct CCCAAAAACGAA ssRNA ggcggtattcaccgtctat atggcggct GGGGACTAAAAC ggcggct 9a dengue_9 LwaCas13a GATTTAGACTACCCCAAAA tcaggcggt GATTTAGACTAC Dengue 9a 2 ACGAAGGGGACTAAAACtc attcaccgtc CCCAAAAACGAA ssRNA aggcggtattcaccgtcta tatggcggc GGGGACTAAAAC tggcggc 9a dengue_9 LwaCas13a GATTTAGACTACCCCAAAA ttcaggcggt GATTTAGACTAC Dengue 9a 3 ACGAAGGGGACTAAAACtt attcaccgtc CCCAAAAACGAA ssRNA caggcggtattcaccgtct tatggcgg GGGGACTAAAAC atggcgg 9a dengue_9 LwaCas13a GATTTAGACTACCCCAAAA cttcaggcg GATTTAGACTAC Dengue 9a 4 ACGAAGGGGACTAAAACct gtattcaccg CCCAAAAACGAA ssRNA tcaggcggtattcaccgtc tctatggcg GGGGACTAAAAC tatggcg 9a dengue_9 LwaCas13a GATTTAGACTACCCCAAAA ccttcaggc GATTTAGACTAC Dengue 9a 5 ACGAAGGGGACTAAAACcc ggtattcacc CCCAAAAACGAA ssRNA ttcaggcggtattcaccgt gtctatggc GGGGACTAAAAC ctatggc 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA ctgtgaaag GATTTAGACTAC Ebola 1b _guide_01 ACGAAGGGGACTAAAACct acaactcttc CCCAAAAACGAA ssRNA gtgaaagacaactcttcac actgcgaat GGGGACTAAAAC tgcgaat 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA gatacaactg GATTTAGACTAC Ebola 1b _guide_06 ACGAAGGGGACTAAAACga tgaaagaca CCCAAAAACGAA ssRNA tacaactgtgaaagacaac actcttcac GGGGACTAAAAC tcttcac 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA tgatacaact GATTTAGACTAC Ebola 1b _guide_07 ACGAAGGGGACTAAAACtg gtgaaagac CCCAAAAACGAA ssRNA atacaactgtgaaagacaa aactcttca GGGGACTAAAAC ctcttca 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA tttgatacaa GATTTAGACTAC Ebola 1b _guide_08 ACGAAGGGGACTAAAACtt ctgtgaaag CCCAAAAACGAA ssRNA tgatacaactgtgaaagac acaactctt GGGGACTAAAAC aactctt 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA tccgtttgata GATTTAGACTAC Ebola 1b _guide_11 ACGAAGGGGACTAAAACtc caactgtgaa CCCAAAAACGAA ssRNA cgtttgatacaactgtgaa agacaac GGGGACTAAAAC agacaac l1b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA ggctccgttt GATTTAGACTAC Ebola 1b _guide_13 ACGAAGGGGACTAAAACgg gatacaactg CCCAAAAACGAA ssRNA ctccgtttgatacaactgt tgaaagac GGGGACTAAAAC gaaagac 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA ccactgatgt GATTTAGACTAC Ebola 1b _guide_20 ACGAAGGGGACTAAAACcc ttttggctccg CCCAAAAACGAA ssRNA actgatgtttttggctccg tttgata GGGGACTAAAAC tttgata 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA accactgatg GATTTAGACTAC Ebola 1b _guide_21 ACGAAGGGGACTAAAACac tttttggctcc CCCAAAAACGAA ssRNA cactgatgtttttggctcc gtttgat GGGGACTAAAAC gtttgat 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA gaccactgat GATTTAGACTAC Ebola 1b _guide_22 ACGAAGGGGACTAAAACga gtttttggctc CCCAAAAACGAA ssRNA ccactgatgtttttggctc cgtttga GGGGACTAAAAC cgtttga 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA ctgaccactg GATTTAGACTAC Ebola 1b _guide_23 ACGAAGGGGACTAAAACct atgtttttggc CCCAAAAACGAA ssRNA gaccactgatgtttttggc tccgttt GGGGACTAAAAC tccgttt 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA ctctgaccac GATTTAGACTAC Ebola 1b _guide_25 ACGAAGGGGACTAAAACct tgatgtttttg CCCAAAAACGAA ssRNA ctgaccactgatgtttttg gctccgt GGGGACTAAAAC gctccgt 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA cgccggact GATTTAGACTAC Ebola 1b _guide_30 ACGAAGGGGACTAAAACcg ctgaccactg CCCAAAAACGAA ssRNA ccggactctgaccactgat gatgtttttg GGGGACTAAAAC tttttg 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA cgcgccgga GATTTAGACTAC Ebola 1b _guide_31 ACGAAGGGGACTAAAACcg ctctgaccac CCCAAAAACGAA ssRNA cgccggactctgaccactg tgatgtttt GGGGACTAAAAC atgtttt 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA ttcgcgccg GATTTAGACTAC Ebola 1b _guide_32 ACGAAGGGGACTAAAACtt gactctgacc CCCAAAAACGAA ssRNA cgcgccggactctgaccac actgatgtt GGGGACTAAAAC tgatgtt 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA gttcgcgcc GATTTAGACTAC Ebola 1b _guide_33 ACGAAGGGGACTAAAACgt ggactctga CCCAAAAACGAA ssRNA tcgcgccggactctgacca ccactgatgt GGGGACTAAAAC ctgatgt 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA agttcgcgc GATTTAGACTAC Ebola 1b _guide_34 ACGAAGGGGACTAAAACag cggactctg CCCAAAAACGAA ssRNA ttcgcgccggactctgacc accactgatg GGGGACTAAAAC actgatg 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA aagttcgcg GATTTAGACTAC Ebola 1b _guide_35 ACGAAGGGGACTAAAACaa ccggactct CCCAAAAACGAA ssRNA gttcgcgccggactctgac gaccactgat GGGGACTAAAAC cactgat 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA agaagttcg GATTTAGACTAC Ebola 1b _guide_36 ACGAAGGGGACTAAAACag cgccggact CCCAAAAACGAA ssRNA aagttcgcgccggactctg ctgaccactg GGGGACTAAAAC accactg 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA ggtcggaag GATTTAGACTAC Ebola 1b _guide_42 ACGAAGGGGACTAAAACgg aagttcgcg CCCAAAAACGAA ssRNA tcggaagaagttcgcgccg ccggactct GGGGACTAAAAC gactctg g 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA ctgggtcgg GATTTAGACTAC Ebola 1b _guide_43 ACGAAGGGGACTAAAACct aagaagttc CCCAAAAACGAA ssRNA gggtcggaagaagttcgcg gcgccggac GGGGACTAAAAC ccggact t 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA cctgggtcg GATTTAGACTAC Ebola 1b _guide_44 ACGAAGGGGACTAAAACcc gaagaagtt CCCAAAAACGAA ssRNA tgggtcggaagaagttcgc cgcgccgga GGGGACTAAAAC gccggac c 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA ccctgggtc GATTTAGACTAC Ebola 1b _guide_45 ACGAAGGGGACTAAAACcc ggaagaagt CCCAAAAACGAA ssRNA ctgggtcggaagaagttcg tcgcgccgg GGGGACTAAAAC cgccgga a 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA tccctgggtc GATTTAGACTAC Ebola 1b _guide_46 ACGAAGGGGACTAAAACtcc ggaagaagt CCCAAAAACGAA ssRNA ctgggtcggaagaagttcg tcgcgccgg GGGGACTAAAAC cgccgg 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA ggtccctgg GATTTAGACTAC Ebola 1b _guide_48 ACGAAGGGGACTAAAACgg gtcggaaga CCCAAAAACGAA ssRNA tccctgggtcggaagaagt agttcgcgc GGGGACTAAAAC tcgcgcc c 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA gttggtccct GATTTAGACTAC Ebola 1b _guide_49 ACGAAGGGGACTAAAACgt gggtcggaa CCCAAAAACGAA ssRNA tggtccctgggtcggaaga gaagttcgc GGGGACTAAAAC agttcgc 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA agttgttgtgt GATTTAGACTAC Ebola 1b _guide_55 ACGAAGGGGACTAAAACag tggtccctgg CCCAAAAACGAA ssRNA ttgttgtgttggtccctgg gtcggaa GGGGACTAAAAC gtcggaa 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA tcagttgttgt GATTTAGACTAC Ebola 1b _guide_57 ACGAAGGGGACTAAAACtc gttggtccct CCCAAAAACGAA ssRNA agttgttgtgttggtccct gggtcgg GGGGACTAAAAC gggtcgg 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA ttcagttgttg GATTTAGACTAC Ebola 1b _guide_58 ACGAAGGGGACTAAAACtt tgttggtccct CCCAAAAACGAA ssRNA cagttgttgtgttggtccc gggtcg GGGGACTAAAAC tgggtcg 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA cttcagttgtt GATTTAGACTAC Ebola 1b _guide_59 ACGAAGGGGACTAAAACct gtgttggtcc CCCAAAAACGAA ssRNA tcagttgttgtgttggtcc ctgggtc GGGGACTAAAAC ctgggtc 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA tcttcagttgt GATTTAGACTAC Ebola 1b _guide_60 ACGAAGGGGACTAAAACtc tgtgttggtc CCCAAAAACGAA ssRNA ttcagttgttgtgttggtc cctgggt GGGGACTAAAAC cctgggt 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA tggtcttcagt GATTTAGACTAC Ebola 1b _guide_61 ACGAAGGGGACTAAAACtg tgttgtgttgg CCCAAAAACGAA ssRNA gtcttcagttgttgtgttg tccctg GGGGACTAAAAC gtccctg 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA attttgtggtc GATTTAGACTAC Ebola 1b _guide_66 ACGAAGGGGACTAAAACat ttcagttgttg CCCAAAAACGAA ssRNA tttgtggtcttcagttgtt tgttgg GGGGACTAAAAC gtgttgg 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA gccatgatttt GATTTAGACTAC Ebola 1b _guide_70 ACGAAGGGGACTAAAACgc gtggtcttca CCCAAAAACGAA ssRNA catgattttgtggtcttca gttgttg GGGGACTAAAAC gttgttg 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA aagccatgat GATTTAGACTAC Ebola 1b _guide_72 ACGAAGGGGACTAAAACaa tttgtggtctt CCCAAAAACGAA ssRNA gccatgattttgtggtctt cagttgt GGGGACTAAAAC cagttgt 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA ctgaagccat GATTTAGACTAC Ebola 1b _guide_73 ACGAAGGGGACTAAAACct gattttgtggt CCCAAAAACGAA ssRNA gaagccatgattttgtggt cttcagt GGGGACTAAAAC cttcagt 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA gaattttctga GATTTAGACTAC Ebola 1b _guide_78 ACGAAGGGGACTAAAACga agccatgatt CCCAAAAACGAA ssRNA attttctgaagccatgatt ttgtggt GGGGACTAAAAC ttgtggt 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA agaggaattt GATTTAGACTAC Ebola 1b _guide_81 ACGAAGGGGACTAAAACag tctgaagcca CCCAAAAACGAA ssRNA aggaattttctgaagccat tgattttg GGGGACTAAAAC gattttg 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA cagaggaat GATTTAGACTAC Ebola 1b _guide_82 ACGAAGGGGACTAAAACca tttctgaagc CCCAAAAACGAA ssRNA gaggaattttctgaagcca catgatttt GGGGACTAAAAC tgatttt 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA cattgcaga GATTTAGACTAC Ebola 1b _guide_85 ACGAAGGGGACTAAAACca ggaattttctg CCCAAAAACGAA ssRNA ttgcagaggaattttctga aagccatg GGGGACTAAAAC agccatg 11b Ebola_GP LwaCas13a GATTTAGACTACCCCAAAA cacttgaacc GATTTAGACTAC Ebola 1b _guide_90 ACGAAGGGGACTAAAACca attgcagag CCCAAAAACGAA ssRNA cttgaaccattgcagagga gaattttct GGGGACTAAAAC attttct 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA ccccgggta GATTTAGACTAC ssRNA1 9a guide_01 ACGAAGGGGACTAAAACcc ccgagctcg CCCAAAAACGAA ccgggtaccgagctcgaat aattcactgg GGGGACTAAAAC tcactgg 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tccccgggt GATTTAGACTAC ssRNA1 9a guide_02 ACGAAGGGGACTAAAACtc accgagctc CCCAAAAACGAA cccgggtaccgagctcgaa gaattcactg GGGGACTAAAAC ttcactg 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA atccccggg GATTTAGACTAC ssRNA1 9a guide_03 ACGAAGGGGACTAAAACat taccgagctc CCCAAAAACGAA ccccgggtaccgagctcga gaattcact GGGGACTAAAAC attcact 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA aggatcccc GATTTAGACTAC ssRNA1 9a guide_04 ACGAAGGGGACTAAAACag gggtaccga CCCAAAAACGAA gatccccgggtaccgagct gctcgaattc GGGGACTAAAAC cgaattc 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA agaggatcc GATTTAGACTAC ssRNA1 9a guide_05 ACGAAGGGGACTAAAACag ccgggtacc CCCAAAAACGAA aggatccccgggtaccgag gagctcgaa GGGGACTAAAAC ctcgaat t 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tctagaggat GATTTAGACTAC ssRNA1 9a guide_06 ACGAAGGGGACTAAAACtc ccccgggta CCCAAAAACGAA tagaggatccccgggtacc ccgagctcg GGGGACTAAAAC gagctcg 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA ttctagagga GATTTAGACTAC ssRNA1 9a guide_07 ACGAAGGGGACTAAAACtt tccccgggt CCCAAAAACGAA ctagaggatccccgggtac accgagctc GGGGACTAAAAC cgagctc 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA atttctagag GATTTAGACTAC ssRNA1 9a guide_08 ACGAAGGGGACTAAAACat gatccccgg CCCAAAAACGAA ttctagaggatccccgggt gtaccgagc GGGGACTAAAAC accgagc 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tatttctagag GATTTAGACTAC ssRNA1 9a guide_09 ACGAAGGGGACTAAAACta gatccccgg CCCAAAAACGAA tttctagaggatccccggg gtaccgag GGGGACTAAAAC taccgag 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA ccatatttcta GATTTAGACTAC ssRNA1 9a guide_10 ACGAAGGGGACTAAAACcc gaggatccc CCCAAAAACGAA atatttctagaggatcccc cgggtacc GGGGACTAAAAC gggtacc 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tccatatttct GATTTAGACTAC ssRNA1 9a guide_11 ACGAAGGGGACTAAAACtc agaggatcc CCCAAAAACGAA catatttctagaggatccc ccgggtac GGGGACTAAAAC cgggtac 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA atccatatttc GATTTAGACTAC ssRNA1 9a guide_12 ACGAAGGGGACTAAAACat tagaggatc CCCAAAAACGAA ccatatttctagaggatcc cccgggta GGGGACTAAAAC ccgggta 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA taatccatatt GATTTAGACTAC ssRNA1 9a guide_13 ACGAAGGGGACTAAAACta tctagaggat CCCAAAAACGAA atccatatttctagaggat ccccggg GGGGACTAAAAC ccccggg 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA gtaatccata GATTTAGACTAC ssRNA1 9a guide_14 ACGAAGGGGACTAAAACgt tttctagagg CCCAAAAACGAA aatccatatttctagagga atccccgg GGGGACTAAAAC tccccgg 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA taccaagtaa GATTTAGACTAC ssRNA1 9a guide_15 ACGAAGGGGACTAAAACta tccatatttct CCCAAAAACGAA ccaagtaatccatatttct agaggat GGGGACTAAAAC agaggat 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tctaccaagt GATTTAGACTAC ssRNA1 9a guide_16 ACGAAGGGGACTAAAACtc aatccatattt CCCAAAAACGAA taccaagtaatccatattt ctagagg GGGGACTAAAAC ctagagg 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA gttctaccaa GATTTAGACTAC ssRNA1 9a guide_17 ACGAAGGGGACTAAAACgt gtaatccata CCCAAAAACGAA tctaccaagtaatccatat tttctaga GGGGACTAAAAC ttctaga 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA gctgttctac GATTTAGACTAC ssRNA1 9a guide_18 ACGAAGGGGACTAAAACgc caagtaatcc CCCAAAAACGAA tgttctaccaagtaatcca atatttct GGGGACTAAAAC tatttct 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA attgctgttct GATTTAGACTAC ssRNA1 9a guide_20 ACGAAGGGGACTAAAACat accaagtaat CCCAAAAACGAA tgctgttctaccaagtaat ccatatt GGGGACTAAAAC ccatatt 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tagattgctgt GATTTAGACTAC ssRNA1 9a guide_21 ACGAAGGGGACTAAAACta tctaccaagt CCCAAAAACGAA gattgctgttctaccaagt aatccat GGGGACTAAAAC aatccat 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA gtagattgct GATTTAGACTAC ssRNA1 9a guide_22 ACGAAGGGGACTAAAACgt gttctaccaa CCCAAAAACGAA agattgctgttctaccaag gtaatcca GGGGACTAAAAC taatcca 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA agtagattgc GATTTAGACTAC ssRNA1 9a guide_23 ACGAAGGGGACTAAAACag tgttctacca CCCAAAAACGAA tagattgctgttctaccaa agtaatcc GGGGACTAAAAC gtaatcc 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA gagtagattg GATTTAGACTAC ssRNA1 9a guide_24 ACGAAGGGGACTAAAACga ctgttctacc CCCAAAAACGAA gtagattgctgttctacca aagtaatc GGGGACTAAAAC agtaatc 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tcgagtagat GATTTAGACTAC ssRNA1 9a guide_25 ACGAAGGGGACTAAAACtc tgctgttctac CCCAAAAACGAA gagtagattgctgttctac caagtaa GGGGACTAAAAC caagtaa 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA gtcgagtag GATTTAGACTAC ssRNA1 9a guide_26 ACGAAGGGGACTAAAACgt attgctgttct CCCAAAAACGAA cgagtagattgctgttcta accaagta GGGGACTAAAAC ccaagta 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA caggtcgag GATTTAGACTAC ssRNA1 9a guide_28 ACGAAGGGGACTAAAACca tagattgctgt CCCAAAAACGAA ggtcgagtagattgctgtt tctaccaa GGGGACTAAAAC ctaccaa 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA gcaggtcga GATTTAGACTAC ssRNA1 9a guide_29 ACGAAGGGGACTAAAACgc gtagattgct CCCAAAAACGAA aggtcgagtagattgctgt gttctacca GGGGACTAAAAC tctacca 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tgcaggtcg GATTTAGACTAC ssRNA1 9a guide_30 ACGAAGGGGACTAAAACtg agtagattgc CCCAAAAACGAA caggtcgagtagattgctg tgttctacc GGGGACTAAAAC ttctacc 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA ctgcaggtc GATTTAGACTAC ssRNA1 9a guide_31 ACGAAGGGGACTAAAACct gagtagattg CCCAAAAACGAA caggtcgagtagattgctg ctgttctac GGGGACTAAAAC ttctac 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA cctgcaggt GATTTAGACTAC ssRNA1 9a guide_32 ACGAAGGGGACTAAAACcc cgagtagatt CCCAAAAACGAA tgcaggtcgagtagattgc gctgttcta GGGGACTAAAAC tgttcta 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tgcctgcag GATTTAGACTAC ssRNA1 9a guide_33 ACGAAGGGGACTAAAACtg gtcgagtag CCCAAAAACGAA cctgcaggtcgagtagatt attgctgttc GGGGACTAAAAC gctgttc 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA atgcctgca GATTTAGACTAC ssRNA1 9a guide_34 ACGAAGGGGACTAAAACat ggtcgagta CCCAAAAACGAA gcctgcaggtcgagtagat gattgctgtt GGGGACTAAAAC tgctgtt 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA catgcctgca GATTTAGACTAC ssRNA1 9a guide_35 ACGAAGGGGACTAAAACca ggtcgagta CCCAAAAACGAA tgcctgcaggtcgagtaga gattgctgt GGGGACTAAAAC ttgctgt 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tgcatgcctg GATTTAGACTAC ssRNA1 9a guide_36 ACGAAGGGGACTAAAACtg caggtcgag CCCAAAAACGAA catgcctgcaggtcgagta tagattgct GGGGACTAAAAC gattgct 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA cttgcatgcc GATTTAGACTAC ssRNA1 9a guide_38 ACGAAGGGGACTAAAACct tgcaggtcg CCCAAAAACGAA tgcatgcctgcaggtcgag agtagattg GGGGACTAAAAC tagattg 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA agcttgcatg GATTTAGACTAC ssRNA1 9a guide_40 ACGAAGGGGACTAAAACag cctgcaggt CCCAAAAACGAA cttgcatgcctgcaggtcg cgagtagat GGGGACTAAAAC agtagat 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA caagcttgca GATTTAGACTAC ssRNA1 9a guide_42 ACGAAGGGGACTAAAACca tgcctgcag CCCAAAAACGAA agcttgcatgcctgcaggt gtcgagtag GGGGACTAAAAC cgagtag 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA ccaagcttgc GATTTAGACTAC ssRNA1 9a guide_43 ACGAAGGGGACTAAAACcc atgcctgca CCCAAAAACGAA aagcttgcatgcctgcagg ggtcgagta GGGGACTAAAAC tcgagta 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA cgccaagctt GATTTAGACTAC ssRNA1 9a guide_44 ACGAAGGGGACTAAAACcg gcatgcctg CCCAAAAACGAA ccaagcttgcatgcctgca caggtcgag GGGGACTAAAAC ggtcgag 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA acgccaagc GATTTAGACTAC ssRNA1 9a guide_45 ACGAAGGGGACTAAAACac ttgcatgcct CCCAAAAACGAA gccaagcttgcatgcctgc gcaggtcga GGGGACTAAAAC aggtcga 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tacgccaag GATTTAGACTAC ssRNA1 9a guide_46 ACGAAGGGGACTAAAACta cttgcatgcc CCCAAAAACGAA cgccaagcttgcatgcctg tgcaggtcg GGGGACTAAAAC caggtcg 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA ttacgccaag GATTTAGACTAC ssRNA1 9a guide_47 ACGAAGGGGACTAAAACtt cttgcatgcc CCCAAAAACGAA acgccaagcttgcatgcct tgcaggtc GGGGACTAAAAC gcaggtc 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA attacgccaa GATTTAGACTAC ssRNA1 9a guide_48 ACGAAGGGGACTAAAACat gcttgcatgc CCCAAAAACGAA tacgccaagcttgcatgcc ctgcaggt GGGGACTAAAAC tgcaggt 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA gattacgcca GATTTAGACTAC ssRNA1 9a guide_49 ACGAAGGGGACTAAAACga agcttgcatg CCCAAAAACGAA ttacgccaagcttgcatgc cctgcagg GGGGACTAAAAC ctgcagg 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA ccatgattac GATTTAGACTAC ssRNA1 9a guide_52 ACGAAGGGGACTAAAACcc gccaagctt CCCAAAAACGAA atgattacgccaagcttgc gcatgcctg GGGGACTAAAAC atgcctg 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA accatgatta GATTTAGACTAC ssRNA1 9a guide_53 ACGAAGGGGACTAAAACac cgccaagctt CCCAAAAACGAA catgattacgccaagcttg gcatgcct GGGGACTAAAAC catgcct 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA gaccatgatt GATTTAGACTAC ssRNA1 9a guide_54 ACGAAGGGGACTAAAACga acgccaagc CCCAAAAACGAA ccatgattacgccaagctt ttgcatgcc GGGGACTAAAAC gcatgcc 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA atgaccatga GATTTAGACTAC ssRNA1 9a guide_55 ACGAAGGGGACTAAAACat ttacgccaag CCCAAAAACGAA gaccatgattacgccaagc cttgcatg GGGGACTAAAAC ttgcatg 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tatgaccatg GATTTAGACTAC ssRNA1 9a guide_56 ACGAAGGGGACTAAAACta attacgccaa CCCAAAAACGAA tgaccatgattacgccaag gcttgcat GGGGACTAAAAC cttgcat 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA agctatgacc GATTTAGACTAC ssRNA1 9a guide_57 ACGAAGGGGACTAAAACag atgattacgc CCCAAAAACGAA ctatgaccatgattacgcc caagcttg GGGGACTAAAAC aagcttg 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA cagctatgac GATTTAGACTAC ssRNA1 9a guide_58 ACGAAGGGGACTAAAACca catgattacg CCCAAAAACGAA gctatgaccatgattacgc ccaagctt GGGGACTAAAAC caagctt 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA acagctatga GATTTAGACTAC ssRNA1 9a guide_59 ACGAAGGGGACTAAAACac ccatgattac CCCAAAAACGAA agctatgaccatgattacg gccaagct GGGGACTAAAAC ccaagct 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA aacagctatg GATTTAGACTAC ssRNA1 9a guide_60 ACGAAGGGGACTAAAACaa accatgatta CCCAAAAACGAA cagctatgaccatgattac cgccaagc GGGGACTAAAAC gccaagc 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA aacacagga GATTTAGACTAC ssRNA1 9a guide_64 ACGAAGGGGACTAAAACaa aacagctatg CCCAAAAACGAA cacaggaaacagctatgac accatgatt GGGGACTAAAAC catgatt 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA taaacacag GATTTAGACTAC ssRNA1 9a guide_65 ACGAAGGGGACTAAAACta gaaacagct CCCAAAAACGAA aacacaggaaacagctatg atgaccatga GGGGACTAAAAC accatga 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA ataaacaca GATTTAGACTAC ssRNA1 9a guide_66 ACGAAGGGGACTAAAACat ggaaacagc CCCAAAAACGAA aaacacaggaaacagctat tatgaccatg GGGGACTAAAAC gaccatg 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA gataaacac GATTTAGACTAC ssRNA1 9a guide_67 ACGAAGGGGACTAAAACga aggaaacag CCCAAAAACGAA taaacacaggaaacagcta ctatgaccat GGGGACTAAAAC tgaccat 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA ggataaaca GATTTAGACTAC ssRNA1 9a guide_68 ACGAAGGGGACTAAAACgg caggaaaca CCCAAAAACGAA ataaacacaggaaacagct gctatgacca GGGGACTAAAAC atgacca 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA cggataaac GATTTAGACTAC ssRNA1 9a guide_69 ACGAAGGGGACTAAAACcg acaggaaac CCCAAAAACGAA gataaacacaggaaacagc agctatgacc GGGGACTAAAAC tatgacc 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA gcggataaa GATTTAGACTAC ssRNA1 9a guide_70 ACGAAGGGGACTAAAACgc cacaggaaa CCCAAAAACGAA ggataaacacaggaaacag cagctatgac GGGGACTAAAAC ctatgac 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA agcggataa GATTTAGACTAC ssRNA1 9a guide_71 ACGAAGGGGACTAAAACag acacaggaa CCCAAAAACGAA cggataaacacaggaaaca acagctatga GGGGACTAAAAC gctatga 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tgagcggat GATTTAGACTAC ssRNA1 9a guide_72 ACGAAGGGGACTAAAACtg aaacacagg CCCAAAAACGAA agcggataaacacaggaaa aaacagctat GGGGACTAAAAC cagctat 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tgtgagcgg GATTTAGACTAC ssRNA1 9a guide_73 ACGAAGGGGACTAAAACtg ataaacaca CCCAAAAACGAA tgagcggataaacacagga ggaaacagc GGGGACTAAAAC aacagct t 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA ttgtgagcgg GATTTAGACTAC ssRNA1 9a guide_74 ACGAAGGGGACTAAAACtt ataaacaca CCCAAAAACGAA gtgagcggataaacacagg ggaaacagc GGGGACTAAAAC aaacagc 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA ggaattgtga GATTTAGACTAC ssRNA1 9a guide_76 ACGAAGGGGACTAAAACgg gcggataaa CCCAAAAACGAA aattgtgagcggataaaca cacaggaaa GGGGACTAAAAC caggaaa 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tggaattgtg GATTTAGACTAC ssRNA1 9a guide_77 ACGAAGGGGACTAAAACtg agcggataa CCCAAAAACGAA gaattgtgagcggataaac acacaggaa GGGGACTAAAAC acaggaa 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA gtggaattgt GATTTAGACTAC ssRNA1 9a guide_78 ACGAAGGGGACTAAAACgt gagcggata CCCAAAAACGAA ggaattgtgagcggataaa aacacagga GGGGACTAAAAC cacagga 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tgtggaattg GATTTAGACTAC ssRNA1 9a guide_79 ACGAAGGGGACTAAAACtg tgagcggat CCCAAAAACGAA tggaattgtgagcggataa aaacacagg GGGGACTAAAAC acacagg 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tgtgtggaat GATTTAGACTAC ssRNA1 9a guide_80 ACGAAGGGGACTAAAACtg tgtgagcgg CCCAAAAACGAA tgtggaattgtgagcggat ataaacaca GGGGACTAAAAC aaacaca 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA ttgtgtggaa GATTTAGACTAC ssRNA1 9a guide_81 ACGAAGGGGACTAAAACtt ttgtgagcgg CCCAAAAACGAA gtgtggaattgtgagcgga ataaacac GGGGACTAAAAC taaacac 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA gttgtgtgga GATTTAGACTAC ssRNA1 9a guide_82 ACGAAGGGGACTAAAACgt attgtgagcg CCCAAAAACGAA tgtgtggaattgtgagcgg gataaaca GGGGACTAAAAC ataaaca 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA atgttgtgtg GATTTAGACTAC ssRNA1 9a guide_83 ACGAAGGGGACTAAAACat gaattgtgag CCCAAAAACGAA gttgtgtggaattgtgagc cggataaa GGGGACTAAAAC ggataaa 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tatgttgtgtg GATTTAGACTAC ssRNA1 9a guide_84 ACGAAGGGGACTAAAACta gaattgtgag CCCAAAAACGAA tgttgtgtggaattgtgag cggataa GGGGACTAAAAC cggataa 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tcgtatgttgt GATTTAGACTAC ssRNA1 9a guide_86 ACGAAGGGGACTAAAACtc gtggaattgt CCCAAAAACGAA gtatgttgtgtggaattgt gagcgga GGGGACTAAAAC gagcgga 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA ggctcgtatg GATTTAGACTAC ssRNA1 9a guide_88 ACGAAGGGGACTAAAACgg ttgtgtggaa CCCAAAAACGAA ctcgtatgttgtgtggaat ttgtgagc GGGGACTAAAAC tgtgagc 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA cggctcgtat GATTTAGACTAC ssRNA1 9a guide_89 ACGAAGGGGACTAAAACcg gttgtgtgga CCCAAAAACGAA gctcgtatgttgtgtggaa attgtgag GGGGACTAAAAC ttgtgag 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA ccggctcgt GATTTAGACTAC ssRNA1 9a guide_90 ACGAAGGGGACTAAAACcc atgttgtgtg CCCAAAAACGAA ggctcgtatgttgtgtgga gaattgtga GGGGACTAAAAC attgtga 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA ttccggctcg GATTTAGACTAC ssRNA1 9a guide_91 ACGAAGGGGACTAAAACtt tatgttgtgtg CCCAAAAACGAA ccggctcgtatgttgtgtg gaattgt GGGGACTAAAAC gaattgt 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA cttccggctc GATTTAGACTAC ssRNA1 9a guide_92 ACGAAGGGGACTAAAACct gtatgttgtgt CCCAAAAACGAA tccggctcgtatgttgtgt ggaattg GGGGACTAAAAC ggaattg 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA gcttccggct GATTTAGACTAC ssRNA1 9a guide_93 ACGAAGGGGACTAAAACgc cgtatgttgt CCCAAAAACGAA ttccggctcgtatgttgtg gtggaatt GGGGACTAAAAC tggaatt 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA atgcttccgg GATTTAGACTAC ssRNA1 9a guide_94 ACGAAGGGGACTAAAACat ctcgtatgttg CCCAAAAACGAA gcttccggctcgtatgttg tgtggaa GGGGACTAAAAC tgtggaa 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA tatgcttccg GATTTAGACTAC ssRNA1 9a guide_95 ACGAAGGGGACTAAAACta gctcgtatgtt CCCAAAAACGAA tgcttccggctcgtatgtt gtgtgga GGGGACTAAAAC gtgtgga 9a ssRNA1_ LwaCas13a GATTTAGACTACCCCAAAA ttatgcttccg GATTTAGACTAC ssRNA1 9a guide_96 ACGAAGGGGACTAAAACtt gctcgtatgtt CCCAAAAACGAA atgcttccggctcgtatgt gtgtgg GGGGACTAAAAC tgtgtgg 9a therm_00 LwaCas13a GATTTAGACTACCCCAAAA taatttaaca GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACta gtatcaccat CCCAAAAACGAA nuclease atttaacagtatcaccatc caatcgct GGGGACTAAAAC aatcgct 9a therm_01 LwaCas13a GATTTAGACTACCCCAAAA ttaatttaaca GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt gtatcaccat CCCAAAAACGAA nuclease aatttaacagtatcaccat caatcgc GGGGACTAAAAC caatcgc 9a therm_02 LwaCas13a GATTTAGACTACCCCAAAA attaatttaac GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACat agtatcacca CCCAAAAACGAA nuclease taatttaacagtatcacca tcaatcg GGGGACTAAAAC tcaatcg 9a therm_03 LwaCas13a GATTTAGACTACCCCAAAA cattaatttaa GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACca cagtatcacc CCCAAAAACGAA nuclease ttaatttaacagtatcacc atcaatc GGGGACTAAAAC atcaatc 9a therm_04 LwaCas13a GATTTAGACTACCCCAAAA acattaattta GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACac acagtatcac CCCAAAAACGAA nuclease attaatttaacagtatcac catcaat GGGGACTAAAAC catcaat 9a therm_05 LwaCas13a GATTTAGACTACCCCAAAA tacattaattt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACta aacagtatca CCCAAAAACGAA nuclease cattaatttaacagtatca ccatcaa GGGGACTAAAAC ccatcaa 9a therm_06 LwaCas13a GATTTAGACTACCCCAAAA gtacattaatt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACgt taacagtatc CCCAAAAACGAA nuclease acattaatttaacagtatc accatca GGGGACTAAAAC accatca 9a therm_07 LwaCas13a GATTTAGACTACCCCAAAA tgtacattaat GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtg ttaacagtat CCCAAAAACGAA nuclease tacattaatttaacagtat caccatc GGGGACTAAAAC caccatc 9a therm_08 LwaCas13a GATTTAGACTACCCCAAAA ttgtacattaa GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt tttaacagtat CCCAAAAACGAA nuclease gtacattaatttaacagta caccat GGGGACTAAAAC tcaccat 9a therm_09 LwaCas13a GATTTAGACTACCCCAAAA tttgtacatta GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt atttaacagt CCCAAAAACGAA nuclease tgtacattaatttaacagt atcacca GGGGACTAAAAC atcacca 9a therm_10 LwaCas13a GATTTAGACTACCCCAAAA ctttgtacatt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACct aatttaacag CCCAAAAACGAA nuclease ttgtacattaatttaacag tatcacc GGGGACTAAAAC tatcacc 9a therm_11 LwaCas13a GATTTAGACTACCCCAAAA cctttgtacat GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACcc taatttaaca CCCAAAAACGAA nuclease tttgtacattaatttaaca gtatcac GGGGACTAAAAC gtatcac 9a therm_12 LwaCas13a GATTTAGACTACCCCAAAA acctttgtac GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACac attaatttaac CCCAAAAACGAA nuclease ctttgtacattaatttaac agtatca GGGGACTAAAAC agtatca 9a therm_13 LwaCas13a GATTTAGACTACCCCAAAA gacctttgta GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACga cattaatttaa CCCAAAAACGAA nuclease cctttgtacattaatttaa cagtatc GGGGACTAAAAC cagtatc 9a therm_14 LwaCas13a GATTTAGACTACCCCAAAA tgacctttgta GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtg cattaatttaa CCCAAAAACGAA nuclease acctttgtacattaattta cagtat GGGGACTAAAAC acagtat 9a therm_15 LwaCas13a GATTTAGACTACCCCAAAA ttgacctttgt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt acattaattta CCCAAAAACGAA nuclease gacctttgtacattaattt acagta GGGGACTAAAAC aacagta 9a therm_16 LwaCas13a GATTTAGACTACCCCAAAA gttgacctttg GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACgt tacattaattt CCCAAAAACGAA nuclease tgacctttgtacattaatt aacagt GGGGACTAAAAC taacagt 9a therm_17 LwaCas13a GATTTAGACTACCCCAAAA ggttgaccttt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACgg gtacattaatt CCCAAAAACGAA nuclease ttgacctttgtacattaat taacag GGGGACTAAAAC ttaacag 9a therm_18 LwaCas13a GATTTAGACTACCCCAAAA tggttgacctt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtg tgtacattaat CCCAAAAACGAA nuclease gttgacctttgtacattaa ttaaca GGGGACTAAAAC tttaaca 9a therm_19 LwaCas13a GATTTAGACTACCCCAAAA ttggttgacct GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt ttgtacattaa CCCAAAAACGAA nuclease ggttgacctttgtacatta tttaac GGGGACTAAAAC atttaac 9a therm_20 LwaCas13a GATTTAGACTACCCCAAAA cattggttga GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACca cctttgtacat CCCAAAAACGAA nuclease ttggttgacctttgtacat taattta GGGGACTAAAAC taattta 9a therm_21 LwaCas13a GATTTAGACTACCCCAAAA gtcattggtt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACgt gacctttgta CCCAAAAACGAA nuclease cattggttgacctttgtac cattaatt GGGGACTAAAAC attaatt 9a therm_22 LwaCas13a GATTTAGACTACCCCAAAA atgtcattggt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACat tgacctttgta CCCAAAAACGAA nuclease gtcattggttgacctttgt cattaa GGGGACTAAAAC acattaa 9a therm_23 LwaCas13a GATTTAGACTACCCCAAAA gaatgtcatt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACga ggttgaccttt CCCAAAAACGAA nuclease atgtcattggttgaccttt gtacatt GGGGACTAAAAC gtacatt 9a therm_24 LwaCas13a GATTTAGACTACCCCAAAA ctgaatgtca GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACct ttggttgacct CCCAAAAACGAA nuclease gaatgtcattggttgacct ttgtaca GGGGACTAAAAC ttgtaca 9a therm_25 LwaCas13a GATTTAGACTACCCCAAAA gtctgaatgt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACgt cattggttga CCCAAAAACGAA nuclease ctgaatgtcattggttgac cctttgta GGGGACTAAAAC ctttgta 9a therm_26 LwaCas13a GATTTAGACTACCCCAAAA tagtctgaat GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACta gtcattggtt CCCAAAAACGAA nuclease gtctgaatgtcattggttg gacctttg GGGGACTAAAAC acctttg 9a therm_27 LwaCas13a GATTTAGACTACCCCAAAA aatagtctga GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACaa atgtcattggt CCCAAAAACGAA nuclease tagtctgaatgtcattggt tgacctt GGGGACTAAAAC tgacctt 9a therm_28 LwaCas13a GATTTAGACTACCCCAAAA ataatagtct GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACat gaatgtcatt CCCAAAAACGAA nuclease aatagtctgaatgtcattg ggttgacc GGGGACTAAAAC gttgacc 9a therm_29 LwaCas13a GATTTAGACTACCCCAAAA caataatagt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACca ctgaatgtca CCCAAAAACGAA nuclease ataatagtctgaatgtcat ttggttga GGGGACTAAAAC tggttga 9a therm_30 LwaCas13a GATTTAGACTACCCCAAAA accaataata GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACac gtctgaatgt CCCAAAAACGAA nuclease caataatagtctgaatgtc cattggtt GGGGACTAAAAC attggtt 9a therm_31 LwaCas13a GATTTAGACTACCCCAAAA caaccaata GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACca atagtctgaa CCCAAAAACGAA nuclease accaataatagtctgaatg tgtcattgg GGGGACTAAAAC tcattgg 9a therm_32 LwaCas13a GATTTAGACTACCCCAAAA atcaaccaat GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACat aatagtctga CCCAAAAACGAA nuclease caaccaataatagtctgaa atgtcatt GGGGACTAAAAC tgtcatt 9a therm_33 LwaCas13a GATTTAGACTACCCCAAAA gtatcaacca GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACgt ataatagtct CCCAAAAACGAA nuclease atcaaccaataatagtctg gaatgtca GGGGACTAAAAC aatgtca 9a therm_34 LwaCas13a GATTTAGACTACCCCAAAA gtgtatcaac GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACgt caataatagt CCCAAAAACGAA nuclease gtatcaaccaataatagtc ctgaatgt GGGGACTAAAAC tgaatgt 9a therm_35 LwaCas13a GATTTAGACTACCCCAAAA aggtgtatca GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACag accaataata CCCAAAAACGAA nuclease gtgtatcaaccaataatag gtctgaat GGGGACTAAAAC tctgaat 9a therm_36 LwaCas13a GATTTAGACTACCCCAAAA tcaggtgtat GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtc caaccaata CCCAAAAACGAA nuclease aggtgtatcaaccaataat atagtctga GGGGACTAAAAC agtctga 9a therm_37 LwaCas13a GATTTAGACTACCCCAAAA tttcaggtgta GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt tcaaccaata CCCAAAAACGAA nuclease tcaggtgtatcaaccaata atagtct GGGGACTAAAAC atagtct 9a therm_38 LwaCas13a GATTTAGACTACCCCAAAA tgtttcaggt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtg gtatcaacca CCCAAAAACGAA nuclease tttcaggtgtatcaaccaa ataatagt GGGGACTAAAAC taatagt 9a therm_39 LwaCas13a GATTTAGACTACCCCAAAA tttgtttcagg GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt tgtatcaacc CCCAAAAACGAA nuclease tgtttcaggtgtatcaacc aataata GGGGACTAAAAC aataata 9a therm_40 LwaCas13a GATTTAGACTACCCCAAAA gctttgtttca GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACgc ggtgtatcaa CCCAAAAACGAA nuclease tttgtttcaggtgtatcaa ccaataa GGGGACTAAAAC ccaataa 9a therm_41 LwaCas13a GATTTAGACTACCCCAAAA atgctttgttt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACat caggtgtatc CCCAAAAACGAA nuclease gctttgtttcaggtgtatc aaccaat GGGGACTAAAAC aaccaat 9a therm_42 LwaCas13a GATTTAGACTACCCCAAAA ggatgctttg GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACgg tttcaggtgta CCCAAAAACGAA nuclease atgctttgtttcaggtgta tcaacca GGGGACTAAAAC tcaacca 9a therm_43 LwaCas13a GATTTAGACTACCCCAAAA taggatgcttt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACta gtttcaggtg CCCAAAAACGAA nuclease ggatgctttgtttcaggtg tatcaac GGGGACTAAAAC tatcaac 9a therm_44 LwaCas13a GATTTAGACTACCCCAAAA GATTTAGACTAC tttaggatgct thermo- 9a ACGAAGGGGACTAAAACtt ttgtttcaggt CCCAAAAACGAA nuclease taggatgctttgtttcagg gtatca GGGGACTAAAAC tgtatca 9a therm_45 LwaCas13a GATTTAGACTACCCCAAAA tttttaggatg GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt ctttgtttcag CCCAAAAACGAA nuclease tttaggatgctttgtttca gtgtat GGGGACTAAAAC ggtgtat 9a therm_46 LwaCas13a GATTTAGACTACCCCAAAA cttttttagga GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACct tgctttgtttc CCCAAAAACGAA nuclease tttttaggatgctttgttt aggtgt GGGGACTAAAAC caggtgt 9a therm_47 LwaCas13a GATTTAGACTACCCCAAAA accttttttag GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACac gatgctttgtt CCCAAAAACGAA nuclease cttttttaggatgctttgt tcaggt GGGGACTAAAAC ttcaggt 9a therm_48 LwaCas13a GATTTAGACTACCCCAAAA acacctttttt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACac aggatgcttt CCCAAAAACGAA nuclease accttttttaggatgcttt gtttcag GGGGACTAAAAC gtttcag 9a therm_49 LwaCas13a GATTTAGACTACCCCAAAA ctacacctttt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACct ttaggatgctt CCCAAAAACGAA nuclease acaccttttttaggatgct tgtttc GGGGACTAAAAC ttgtttc 9a therm_50 LwaCas13a GATTTAGACTACCCCAAAA ctctacacctt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACct ttttaggatgc CCCAAAAACGAA nuclease ctacaccttttttaggatg tttgtt GGGGACTAAAAC ctttgtt 9a therm_51 LwaCas13a GATTTAGACTACCCCAAAA ttctctacacc GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt ttttttaggat CCCAAAAACGAA nuclease ctctacaccttttttagga gctttg GGGGACTAAAAC tgctttg 9a therm_52 LwaCas13a GATTTAGACTACCCCAAAA atttctctaca GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACat ccttttttagg CCCAAAAACGAA nuclease ttctctacaccttttttag atgctt GGGGACTAAAAC gatgctt 9a therm_53 LwaCas13a GATTTAGACTACCCCAAAA atatttctcta GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACat cacctttttta CCCAAAAACGAA nuclease atttctctacacctttttt ggatgc GGGGACTAAAAC aggatgc 9a therm_54 LwaCas13a GATTTAGACTACCCCAAAA ccatatttctc GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACcc tacacctttttt CCCAAAAACGAA nuclease atatttctctacacctttt aggat GGGGACTAAAAC ttaggat 9a therm_55 LwaCas13a GATTTAGACTACCCCAAAA gaccatattt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACga ctctacacctt CCCAAAAACGAA nuclease ccatatttctctacacctt ttttagg GGGGACTAAAAC ttttagg 9a therm_56 LwaCas13a GATTTAGACTACCCCAAAA aggaccatat GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACag ttctctacacc CCCAAAAACGAA nuclease gaccatatttctctacacc tttttta GGGGACTAAAAC tttttta 9a therm_57 LwaCas13a GATTTAGACTACCCCAAAA tcaggaccat GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtc atttctctaca CCCAAAAACGAA nuclease aggaccatatttctctaca ccttttt GGGGACTAAAAC ccttttt 9a therm_58 LwaCas13a GATTTAGACTACCCCAAAA cttcaggacc GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACct atatttctcta CCCAAAAACGAA nuclease tcaggaccatatttctcta caccttt GGGGACTAAAAC caccttt 9a therm_59 LwaCas13a GATTTAGACTACCCCAAAA tgcttcagga GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtg ccatatttctc CCCAAAAACGAA nuclease cttcaggaccatatttctc tacacct GGGGACTAAAAC tacacct 9a therm_60 LwaCas13a GATTTAGACTACCCCAAAA cttgcttcag GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACct gaccatattt CCCAAAAACGAA nuclease tgcttcaggaccatatttc ctctacac GGGGACTAAAAC tctacac 9a therm_61 LwaCas13a GATTTAGACTACCCCAAAA cacttgcttc GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACca aggaccatat CCCAAAAACGAA nuclease cttgcttcaggaccatatt ttctctac GGGGACTAAAAC tctctac 9a therm_62 LwaCas13a GATTTAGACTACCCCAAAA tgcacttgctt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtg caggaccat CCCAAAAACGAA nuclease cacttgcttcaggaccata atttctct GGGGACTAAAAC tttctct 9a therm_63 LwaCas13a GATTTAGACTACCCCAAAA aatgcacttg GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACaa cttcaggacc CCCAAAAACGAA nuclease tgcacttgcttcaggacca atatttct GGGGACTAAAAC tatttct 9a therm_64 LwaCas13a GATTTAGACTACCCCAAAA taaatgcact GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACta tgcttcagga CCCAAAAACGAA nuclease aatgcacttgcttcaggac ccatattt GGGGACTAAAAC catattt 9a therm_65 LwaCas13a GATTTAGACTACCCCAAAA gtaaatgcac GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACgt ttgcttcagg CCCAAAAACGAA nuclease aaatgcacttgcttcagga accatatt GGGGACTAAAAC ccatatt 9a therm_66 LwaCas13a GATTTAGACTACCCCAAAA cgtaaatgca GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACcg cttgcttcag CCCAAAAACGAA nuclease taaatgcacttgcttcagg gaccatat GGGGACTAAAAC accatat 9a therm_67 LwaCas13a GATTTAGACTACCCCAAAA tcgtaaatgc GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtc acttgcttca CCCAAAAACGAA nuclease gtaaatgcacttgcttcag ggaccata GGGGACTAAAAC gaccata 9a therm_68 LwaCas13a GATTTAGACTACCCCAAAA ttcgtaaatg GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt cacttgcttc CCCAAAAACGAA nuclease cgtaaatgcacttgcttca aggaccat GGGGACTAAAAC ggaccat 9a therm_69 LwaCas13a GATTTAGACTACCCCAAAA tttcgtaaatg GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt cacttgcttc CCCAAAAACGAA nuclease tcgtaaatgcacttgcttc aggacca GGGGACTAAAAC aggacca 9a therm_70 LwaCas13a GATTTAGACTACCCCAAAA GATTTAGACTAC ttttcgtaaat thermo- 9a ACGAAGGGGACTAAAACtt gcacttgctt CCCAAAAACGAA nuclease ttcgtaaatgcacttgctt caggacc GGGGACTAAAAC caggacc 9a therm_71 LwaCas13a GATTTAGACTACCCCAAAA tttttcgtaaat GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt gcacttgctt CCCAAAAACGAA nuclease tttcgtaaatgcacttgct caggac GGGGACTAAAAC tcaggac 9a therm_72 LwaCas13a GATTTAGACTACCCCAAAA ctttttcgtaa GATTTAGACTAC thermo- 9a ACGAAGGGACTAAAACct atgcacttgc CCCAAAAACGAA nuclease ttttcgtaaatgcacttgc ttcagga GGGGACTAAAAC ttcagga 9a therm_73 LwaCas13a GATTTAGACTACCCCAAAA tctttttcgtaa GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtc atgcacttgc CCCAAAAACGAA nuclease tttttcgtaaatgcacttg ttcagg GGGGACTAAAAC cttcagg 9a therm_74 LwaCas13a GATTTAGACTACCCCAAAA atctttttcgta GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACat aatgcacttg CCCAAAAACGAA nuclease ctttttcgtaaatgcactt cttcag GGGGACTAAAAC gcttcag 9a therm_75 LwaCas13a GATTTAGACTACCCCAAAA catctttttcgt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACca aaatgcactt CCCAAAAACGAA nuclease tctttttcgtaaatgcact gcttca GGGGACTAAAAC tgcttca 9a therm_76 LwaCas13a GATTTAGACTACCCCAAAA ccatctttttc GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACcc gtaaatgcac CCCAAAAACGAA nuclease atctttttcgtaaatgcac ttgcttc GGGGACTAAAAC ttgcttc 9a therm_77 LwaCas13a GATTTAGACTACCCCAAAA accatcttttt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACac cgtaaatgca CCCAAAAACGAA nuclease catctttttcgtaaatgca cttgctt GGGGACTAAAAC cttgctt 9a therm_78 LwaCas13a GATTTAGACTACCCCAAAA taccatcttttt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACta cgtaaatgca CCCAAAAACGAA nuclease ccatctttttcgtaaatgc cttgct GGGGACTAAAAC acttgct 9a therm_79 LwaCas13a GATTTAGACTACCCCAAAA ctaccatcttt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACct ttcgtaaatg CCCAAAAACGAA nuclease accatctttttcgtaaatg cacttgc GGGGACTAAAAC cacttgc 9a therm_80 LwaCas13a GATTTAGACTACCCCAAAA tctaccatctt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtc tttcgtaaatg CCCAAAAACGAA nuclease taccatctttttcgtaaat cacttg GGGGACTAAAAC gcacttg 9a therm_81 LwaCas13a GATTTAGACTACCCCAAAA ttctaccatct GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt ttttcgtaaat CCCAAAAACGAA nuclease ctaccatctttttcgtaaa gcactt GGGGACTAAAAC tgcactt 9a therm_82 LwaCas13a GATTTAGACTACCCCAAAA tttctaccatc GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt tttttcgtaaat CCCAAAAACGAA nuclease tctaccatctttttcgtaa gcact GGGGACTAAAAC atgcact 9a therm_83 LwaCas13a GATTTAGACTACCCCAAAA ttttctaccat GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt ctttttcgtaa CCCAAAAACGAA nuclease ttctaccatctttttcgta atgcac GGGGACTAAAAC aatgcac 9a therm_84 LwaCas13a GATTTAGACTACCCCAAAA attttctacca GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACat tctttttcgtaa CCCAAAAACGAA nuclease tttctaccatctttttcgt atgca GGGGACTAAAAC aaatgca 9a therm_85 LwaCas13a GATTTAGACTACCCCAAAA cattttctacc GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACca atctttttcgta CCCAAAAACGAA nuclease ttttctaccatctttttcg aatgc GGGGACTAAAAC taaatgc 9a therm_86 LwaCas13a GATTTAGACTACCCCAAAA gcattttctac GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACgc catctttttcgt CCCAAAAACGAA nuclease attttctaccatctttttc aaatg GGGGACTAAAAC gtaaatg 9a therm_87 LwaCas13a GATTTAGACTACCCCAAAA tgcattttcta GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtg ccatctttttc CCCAAAAACGAA nuclease cattttctaccatcttttt gtaaat GGGGACTAAAAC cgtaaat 9a therm_88 LwaCas13a GATTTAGACTACCCCAAAA ttgcattttcta GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt ccatctttttc CCCAAAAACGAA nuclease gcattttctaccatctttt gtaaa GGGGACTAAAAC tcgtaaa 9a therm_89 LwaCas13a GATTTAGACTACCCCAAAA tttgcattttct GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt accatcttttt CCCAAAAACGAA nuclease tgcattttctaccatcttt cgtaa GGGGACTAAAAC ttcgtaa 9a therm_90 LwaCas13a GATTTAGACTACCCCAAAA ctttgcattttc GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACct CCCAAAAACGAA taccatcttttt nuclease ttgcattttctaccatctt cgta GGGGACTAAAAC tttcgta 9a therm_91 LwaCas13a GATTTAGACTACCCCAAAA tctttgcatttt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtc ctaccatcttt CCCAAAAACGAA nuclease tttgcattttctaccatct ttcgt GGGGACTAAAAC ttttcgt 9a therm_92 LwaCas13a GATTTAGACTACCCCAAAA ttctttgcattt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt tctaccatctt CCCAAAAACGAA nuclease ctttgcattttctaccatc tttcg GGGGACTAAAAC tttttcg 9a therm_93 LwaCas13a GATTTAGACTACCCCAAAA tttctttgcatt GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt ttctaccatct CCCAAAAACGAA nuclease tctttgcattttctaccat ttttc GGGGACTAAAAC ctttttc 9a therm_94 LwaCas13a GATTTAGACTACCCCAAAA ttttctttgcat GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACtt tttctaccatc CCCAAAAACGAA nuclease ttctttgcattttctacca ttttt GGGGACTAAAAC tcttttt 9a therm_95 LwaCas13a GATTTAGACTACCCCAAAA attttctttgca GATTTAGACTAC thermo- 9a ACGAAGGGGACTAAAACat ttttctaccat CCCAAAAACGAA nuclease tttctttgcattttctacc ctttt GGGGACTAAAAC atctttt 11b zika_00 LwaCas13a GATTTAGACTACCCCAAAA tgttgttccag GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtg tgtggagttc CCCAAAAACGAA ssRNA ttgttccagtgtggagttc cggtgtc GGGGACTAAAAC cggtgtc 11b zika_01 LwaCas13a GATTTAGACTACCCCAAAA ttgttgttcca GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtt gtgtggagtt CCCAAAAACGAA ssRNA gttgttccagtgtggagtt ccggtgt GGGGACTAAAAC ccggtgt 11b zika_02 LwaCas13a GATTTAGACTACCCCAAAA tttgttgttcc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtt agtgtggagt CCCAAAAACGAA ssRNA tgttgttccagtgtggagt tccggtg GGGGACTAAAAC tccggtg 11b zika_03 LwaCas13a GATTTAGACTACCCCAAAA ctttgttgttc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACct cagtgtgga CCCAAAAACGAA ssRNA ttgttgttccagtgtggag gttccggt GGGGACTAAAAC ttccggt 11b zika_04 LwaCas13a GATTTAGACTACCCCAAAA tctttgttgttc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtc cagtgtgga CCCAAAAACGAA ssRNA tttgttgttccagtgtgga gttccgg GGGGACTAAAAC gttccgg 11b zika_05 LwaCas13a GATTTAGACTACCCCAAAA ttctttgttgtt GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtt ccagtgtgg CCCAAAAACGAA ssRNA ctttgttgttccagtgtgg agttccg GGGGACTAAAAC agttccg 11b zika_06 LwaCas13a GATTTAGACTACCCCAAAA cttctttgagt GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACct tccagtgtgg CCCAAAAACGAA ssRNA tctttgttgttccagtgtg agttcc GGGGACTAAAAC gagttcc 11b zika_07 LwaCas13a GATTTAGACTACCCCAAAA gcttctttgtt GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACgc gttccagtgt CCCAAAAACGAA ssRNA ttctttgttgttccagtgt ggagttc GGGGACTAAAAC ggagttc 11b zika_08 LwaCas13a GATTTAGACTACCCCAAAA tgcttctttgtt GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtg gttccagtgt CCCAAAAACGAA ssRNA cttctttgttgttccagtg ggagtt GGGGACTAAAAC tggagtt 11b zika_09 LwaCas13a GATTTAGACTACCCCAAAA gtgcttctttg GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACgt ttgttccagtg CCCAAAAACGAA ssRNA gcttctttgttgttccagt tggagt GGGGACTAAAAC gtggagt 11b zika_10 LwaCas13a GATTTAGACTACCCCAAAA agtgcttcttt GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACag gagttccagt CCCAAAAACGAA ssRNA tgcttctttgttgttccag gtggag GGGGACTAAAAC tgtggag 11b zika_11 LwaCas13a GATTTAGACTACCCCAAAA cagtgcttctt GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACca tgttgttccag CCCAAAAACGAA ssRNA gtgcttctttgttgttcca tgtgga GGGGACTAAAAC gtgtgga 11b zika_12 LwaCas13a GATTTAGACTACCCCAAAA ccagtgcttc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACcc tttgagacc CCCAAAAACGAA ssRNA agtgcttctttgttgttcc agtgtgg GGGGACTAAAAC agtgtgg 11b zika_13 LwaCas13a GATTTAGACTACCCCAAAA accagtgctt GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACac ctttgagttc CCCAAAAACGAA ssRNA cagtgcttctttgttgttc cagtgtg GGGGACTAAAAC cagtgtg 11b zika_14 LwaCas13a GATTTAGACTACCCCAAAA taccagtgct GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACta tctttgttgttc CCCAAAAACGAA ssRNA ccagtgcttctttgttgtt cagtgt GGGGACTAAAAC ccagtgt 11b zika_15 LwaCas13a GATTTAGACTACCCCAAAA ctaccagtgc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACct ttctttgttgtt CCCAAAAACGAA ssRNA accagtgcttctttgttgt ccagtg GGGGACTAAAAC tccagtg 11b zika_16 LwaCas13a GATTTAGACTACCCCAAAA tctaccagtg GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtc cttctttgagt CCCAAAAACGAA ssRNA taccagtgcttctttgttg tccagt GGGGACTAAAAC ttccagt 11b zika_17 LwaCas13a GATTTAGACTACCCCAAAA ctctaccagt GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACct gcttctttgtt CCCAAAAACGAA ssRNA ctaccagtgcttctttgtt gttccag GGGGACTAAAAC gttccag 11b zika_18 LwaCas13a GATTTAGACTACCCCAAAA actctaccag GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACac tgcttctttgtt CCCAAAAACGAA ssRNA tctaccagtgcttctttgt gttcca GGGGACTAAAAC tgttcca 11b zika_19 LwaCas13a GATTTAGACTACCCCAAAA aactctacca GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACaa gtgcttctttg CCCAAAAACGAA ssRNA ctctaccagtgcttctttg ttgttcc GGGGACTAAAAC ttgttcc 11b zika_20 LwaCas13a GATTTAGACTACCCCAAAA tgaactctac GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtg cagtgcttctt CCCAAAAACGAA ssRNA aactctaccagtgcttctt tgttgtt GGGGACTAAAAC tgttgtt 11b zika_21 LwaCas13a GATTTAGACTACCCCAAAA cttgaactct GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACct accagtgctt CCCAAAAACGAA ssRNA tgaactctaccagtgcttc ctttgttg GGGGACTAAAAC tttgttg 11b zika_22 LwaCas13a GATTTAGACTACCCCAAAA tccttgaact GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtc ctaccagtgc CCCAAAAACGAA ssRNA cttgaactctaccagtgct ttctttgt GGGGACTAAAAC tctttgt 11b zika_23 LwaCas13a GATTTAGACTACCCCAAAA cgtccttgaa GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACcg ctctaccagt CCCAAAAACGAA ssRNA tccttgaactctaccagtg gcttcttt GGGGACTAAAAC cttcttt 11b zika_24 LwaCas13a GATTTAGACTACCCCAAAA tgcgtccttg GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtg aactctacca CCCAAAAACGAA ssRNA cgtccttgaactctaccag gtgcttct GGGGACTAAAAC tgcttct 11b zika_25 LwaCas13a GATTTAGACTACCCCAAAA tgtgcgtcctt GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtg gaactctacc CCCAAAAACGAA ssRNA tgcgtccttgaactctacc agtgctt GGGGACTAAAAC agtgctt 11b zika_26 LwaCas13a GATTTAGACTACCCCAAAA catgtgcgtc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACca cttgaactct CCCAAAAACGAA ssRNA tgtgcgtccttgaactcta accagtgc GGGGACTAAAAC ccagtgc 11b zika_27 LwaCas13a GATTTAGACTACCCCAAAA ggcatgtgc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACgg gtccttgaac CCCAAAAACGAA ssRNA catgtgcgtccttgaactc tctaccagt GGGGACTAAAAC taccagt 11b zika_28 LwaCas13a GATTTAGACTACCCCAAAA ttggcatgtg GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtt cgtccttgaa CCCAAAAACGAA ssRNA ggcatgtgcgtccttgaac ctctacca GGGGACTAAAAC tctacca 11b zika_29 LwaCas13a GATTTAGACTACCCCAAAA ttttggcatgt GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtt gcgtccttga CCCAAAAACGAA ssRNA ttggcatgtgcgtccttga actctac GGGGACTAAAAC actctac 11b zika_30 LwaCas13a GATTTAGACTACCCCAAAA ccttttggcat GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACcc gtgcgtcctt CCCAAAAACGAA ssRNA ttttggcatgtgcgtcctt gaactct GGGGACTAAAAC gaactct 11b zika_31 LwaCas13a GATTTAGACTACCCCAAAA tgccttttggc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtg atgtgcgtcc CCCAAAAACGAA ssRNA ccttttggcatgtgcgtcc ttgaact GGGGACTAAAAC ttgaact 11b zika_32 LwaCas13a GATTTAGACTACCCCAAAA tttgccttttg GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtt gcatgtgcgt CCCAAAAACGAA ssRNA tgccttttggcatgtgcgt ccttgaa GGGGACTAAAAC ccttgaa 11b zika_33 LwaCas13a GATTTAGACTACCCCAAAA agtttgccttt GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACag tggcatgtgc CCCAAAAACGAA ssRNA tttgccttttggcatgtgc gtccttg GGGGACTAAAAC gtccttg 11b zika_34 LwaCas13a GATTTAGACTACCCCAAAA acagtttgcc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACac ttttggcatgt CCCAAAAACGAA ssRNA agtttgccttttggcatgt gcgtcct GGGGACTAAAAC gcgtcct 11b zika_35 LwaCas13a GATTTAGACTACCCCAAAA cgacagtttg GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACcg ccttttggcat CCCAAAAACGAA ssRNA acagtttgccttttggcat gtgcgtc GGGGACTAAAAC gtgcgtc 11b zika_36 LwaCas13a GATTTAGACTACCCCAAAA cacgacagtt GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACca tgccttttggc CCCAAAAACGAA ssRNA cgacagtttgccttttggc atgtgcg GGGGACTAAAAC atgtgcg 11b zika_37 LwaCas13a GATTTAGACTACCCCAAAA accacgaca GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACac gtttgcctttt CCCAAAAACGAA ssRNA cacgacagtttgccttttg ggcatgtg GGGGACTAAAAC gcatgtg 11b zika_38 LwaCas13a GATTTAGACTACCCCAAAA gaaccacga GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACga cagtttgcctt CCCAAAAACGAA ssRNA accacgacagtttgccttt ttggcatg GGGGACTAAAAC tggcatg 11b zika_39 LwaCas13a GATTTAGACTACCCCAAAA tagaaccac GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACta gacagtttgc CCCAAAAACGAA ssRNA gaaccacgacagtttgcct cttttggca GGGGACTAAAAC tttggca 11b zika_40 LwaCas13a GATTTAGACTACCCCAAAA cctagaacc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACcc acgacagttt CCCAAAAACGAA ssRNA tagaaccacgacagtttgc gccttttgg GGGGACTAAAAC cttttgg 11b zika_41 LwaCas13a GATTTAGACTACCCCAAAA tccctagaac GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtc cacgacagtt CCCAAAAACGAA ssRNA cctagaaccacgacagttt tgcctttt GGGGACTAAAAC gcctttt 11b zika_42 LwaCas13a GATTTAGACTACCCCAAAA actccctaga GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACac accacgaca CCCAAAAACGAA ssRNA tccctagaaccacgacagt gtttgcctt GGGGACTAAAAC ttgcctt 11b zika_43 LwaCas 13a GATTTAGACTACCCCAAAA tgactcccta GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtg gaaccacga CCCAAAAACGAA ssRNA actccctagaaccacgaca cagtttgcc GGGGACTAAAAC gtttgcc 11b zika_44 LwaCas13a GATTTAGACTACCCCAAAA cttgactccc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACct tagaaccac CCCAAAAACGAA ssRNA tgactccctagaaccacga gacagtttg GGGGACTAAAAC cagtttg 11b zika_45 LwaCas13a GATTTAGACTACCCCAAAA ttcttgactcc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtt ctagaacca CCCAAAAACGAA ssRNA cttgactccctagaaccac cgacagtt GGGGACTAAAAC gacagtt 11b zika_46 LwaCas13a GATTTAGACTACCCCAAAA ccttcttgact GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACcc ccctagaac CCCAAAAACGAA ssRNA ttcttgactccctagaacc cacgacag GGGGACTAAAAC acgacag 11b zika_47 LwaCas13a GATTTAGACTACCCCAAAA ctccttcttga GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACct ctccctagaa CCCAAAAACGAA ssRNA ccttcttgactccctagaa ccacgac GGGGACTAAAAC ccacgac 11b zika_48 LwaCas13a GATTTAGACTACCCCAAAA tgctccttctt GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtg gactccctag CCCAAAAACGAA ssRNA ctccttcttgactccctag aaccacg GGGGACTAAAAC aaccacg 11b zika_49 LwaCas13a GATTTAGACTACCCCAAAA actgctcctt GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACac cttgactccc CCCAAAAACGAA ssRNA tgctccttcttgactccct tagaacca GGGGACTAAAAC agaacca 11b zika_50 LwaCas13a GATTTAGACTACCCCAAAA gaactgctcc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACga ttcttgactcc CCCAAAAACGAA ssRNA actgctccttcttgactcc ctagaac GGGGACTAAAAC ctagaac 11b zika_51 LwaCas13a GATTTAGACTACCCCAAAA gtgaactgct GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACgt ccttcttgact CCCAAAAACGAA ssRNA gaactgctccttcttgact ccctaga GGGGACTAAAAC ccctaga 11b zika_52 LwaCas13a GATTTAGACTACCCCAAAA gtgtgaactg GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACgt ctccttcttga CCCAAAAACGAA ssRNA gtgaactgctccttcttga ctcccta GGGGACTAAAAC ctcccta 11b zika_53 LwaCas13a GATTTAGACTACCCCAAAA ccgtgtgaa GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACcc ctgctccttct CCCAAAAACGAA ssRNA gtgtgaactgctccttctt tgactccc GGGGACTAAAAC gactccc 11b zika_54 LwaCas13a GATTTAGACTACCCCAAAA ggccgtgtg GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACgg aactgctcct CCCAAAAACGAA ssRNA ccgtgtgaactgctccttc tcttgactc GGGGACTAAAAC ttgactc 11b zika_55 LwaCas13a GATTTAGACTACCCCAAAA agggccgtg GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACag tgaactgctc CCCAAAAACGAA ssRNA ggccgtgtgaactgctcct cttcttgac GGGGACTAAAAC tcttgac 11b zika_56 LwaCas13a GATTTAGACTACCCCAAAA caagggccg GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACca tgtgaactgc CCCAAAAACGAA ssRNA agggccgtgtgaactgctc tccttcttg GGGGACTAAAAC cttcttg 11b zika_57 LwaCas13a GATTTAGACTACCCCAAAA agcaagggc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACag cgtgtgaact CCCAAAAACGAA ssRNA caagggccgtgtgaactgc gctccttct GGGGACTAAAAC tccttct 11b zika_58 LwaCas13a GATTTAGACTACCCCAAAA ccagcaagg GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACcc gccgtgtga CCCAAAAACGAA ssRNA agcaagggccgtgtgaact actgctcctt GGGGACTAAAAC gctcctt 11b zika_59 LwaCas13a GATTTAGACTACCCCAAAA ctccagcaa GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACct gggccgtgt CCCAAAAACGAA ssRNA ccagcaagggccgtgtgaa gaactgctcc GGGGACTAAAAC ctgctcc 11b zika_60 LwaCas13a GATTTAGACTACCCCAAAA agctccagc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACag aagggccgt CCCAAAAACGAA ssRNA ctccagcaagggccgtgtg gtgaactgct GGGGACTAAAAC aactgct 11b zika_61 LwaCas13a GATTTAGACTACCCCAAAA agagctcca GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACag gcaagggcc CCCAAAAACGAA ssRNA agctccagcaagggccgtg gtgtgaactg GGGGACTAAAAC tgaactg 11b zika_62 LwaCas13a GATTTAGACTACCCCAAAA ccagagctc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACcc cagcaaggg CCCAAAAACGAA ssRNA agagctccagcaagggccg ccgtgtgaa GGGGACTAAAAC tgtgaac c 11b zika_63 LwaCas13a GATTTAGACTACCCCAAAA ctccagagct GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACct ccagcaagg CCCAAAAACGAA ssRNA ccagagctccagcaagggc gccgtgtga GGGGACTAAAAC cgtgtga 11b zika_64 LwaCas13a GATTTAGACTACCCCAAAA gcctccaga GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACgc gctccagca CCCAAAAACGAA ssRNA ctccagagctccagcaagg agggccgtg GGGGACTAAAAC gccgtgt t 11b zika_65 LwaCas13a GATTTAGACTACCCCAAAA cagcctcca GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACca gagctccag CCCAAAAACGAA ssRNA gcctccagagctccagcaa caagggccg GGGGACTAAAAC gggccgt t 11b zika_66 LwaCas13a GATTTAGACTACCCCAAAA ctcagcctcc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACct agagctcca CCCAAAAACGAA ssRNA cagcctccagagctccagc gcaagggcc GGGGACTAAAAC aagggcc 11b zika_67 LwaCas13a GATTTAGACTACCCCAAAA atctcagcct GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACat ccagagctc CCCAAAAACGAA ssRNA ctcagcctccagagctcca cagcaaggg GGGGACTAAAAC gcaaggg 11b zika_68 LwaCas13a GATTTAGACTACCCCAAAA catctcagcc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACca tccagagctc CCCAAAAACGAA ssRNA tctcagcctccagagctcc cagcaagg GGGGACTAAAAC agcaagg 11b zika_69 LwaCas13a GATTTAGACTACCCCAAAA ccatctcagc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACcc ctccagagct CCCAAAAACGAA ssRNA atctcagcctccagagctc ccagcaag GGGGACTAAAAC cagcaag 11b zika_70 LwaCas13a GATTTAGACTACCCCAAAA tccatctcag GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtc cctccagag CCCAAAAACGAA ssRNA catctcagcctccagagct ctccagcaa GGGGACTAAAAC ccagcaa 11b zika_71 LwaCas13a GATTTAGACTACCCCAAAA atccatctca GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACat gcctccaga CCCAAAAACGAA ssRNA ccatctcagcctccagagc gctccagca GGGGACTAAAAC tccagca 11b zika_72 LwaCas13a GATTTAGACTACCCCAAAA catccatctc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACca agcctccag CCCAAAAACGAA ssRNA tccatctcagcctccagag agctccagc GGGGACTAAAAC ctccagc 11b zika_73 LwaCas13a GATTTAGACTACCCCAAAA ccatccatct GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACcc cagcctcca CCCAAAAACGAA ssRNA atccatctcagcctccaga gagctccag GGGGACTAAAAC gctccag 11b zika_74 LwaCas13a GATTTAGACTACCCCAAAA accatccatc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACac tcagcctcca CCCAAAAACGAA ssRNA catccatctcagcctccag gagctcca GGGGACTAAAAC agctcca 11b zika_75 LwaCas13a GATTTAGACTACCCCAAAA caccatccat GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACca ctcagcctcc CCCAAAAACGAA ssRNA ccatccatctcagcctcca agagctcc GGGGACTAAAAC gagctcc 11b zika_76 LwaCas13a GATTTAGACTACCCCAAAA gcaccatcc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACgc atctcagcct CCCAAAAACGAA ssRNA accatccatctcagcctcc ccagagctc GGGGACTAAAAC agagctc 11b zika_77 LwaCas13a GATTTAGACTACCCCAAAA tgcaccatcc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtg atctcagcct CCCAAAAACGAA ssRNA caccatccatctcagcctc ccagagct GGGGACTAAAAC cagagct 11b zika_78 LwaCas13a GATTTAGACTACCCCAAAA ttgcaccatc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtt catctcagcc CCCAAAAACGAA ssRNA gcaccatccatctcagcct tccagagc GGGGACTAAAAC ccagagc 11b zika_79 LwaCas13a GATTTAGACTACCCCAAAA tttgcaccat GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtt ccatctcagc CCCAAAAACGAA ssRNA tgcaccatccatctcagcc ctccagag GGGGACTAAAAC tccagag 11b zika_80 LwaCas13a GATTTAGACTACCCCAAAA ctttgcacca GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACct tccatctcag CCCAAAAACGAA ssRNA ttgcaccatccatctcagc cctccaga GGGGACTAAAAC ctccaga 11b zika_81 LwaCas13a GATTTAGACTACCCCAAAA cctttgcacc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACcc atccatctca CCCAAAAACGAA ssRNA tttgcaccatccatctcag gcctccag GGGGACTAAAAC cctccag 11b zika_82 LwaCas13a GATTTAGACTACCCCAAAA ccctttgcac GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACcc catccatctc CCCAAAAACGAA ssRNA ctttgcaccatccatctca agcctcca GGGGACTAAAAC gcctcca 11b zika_83 LwaCas13a GATTTAGACTACCCCAAAA tccctttgca GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtc ccatccatct CCCAAAAACGAA ssRNA cctttgcaccatccatctc cagcctcc GGGGACTAAAAC agcctcc 11b zika_84 LwaCas13a GATTTAGACTACCCCAAAA ttccctttgca GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACtt ccatccatct CCCAAAAACGAA ssRNA ccctttgcaccatccatct cagcctc GGGGACTAAAAC cagcctc 11b zika_85 LwaCas13a GATTTAGACTACCCCAAAA cttccctttgc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACct accatccatc CCCAAAAACGAA ssRNA tccctttgcaccatccatc tcagcct GGGGACTAAAAC tcagcct 11b zika_86 LwaCas13a GATTTAGACTACCCCAAAA ccttccctttg GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACcc caccatccat CCCAAAAACGAA ssRNA ttccctttgcaccatccat ctcagcc GGGGACTAAAAC ctcagcc 11b zika_87 LwaCas13a GATTTAGACTACCCCAAAA gccttcccttt GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACgc gcaccatcc CCCAAAAACGAA ssRNA cttccctttgcaccatcca atctcagc GGGGACTAAAAC tctcagc 11b zika_88 LwaCas13a GATTTAGACTACCCCAAAA agccttccct GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACag ttgcaccatc CCCAAAAACGAA ssRNA ccttccctttgcaccatcc catctcag GGGGACTAAAAC atctcag 11b zika_89 LwaCas13a GATTTAGACTACCCCAAAA cagccttccc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACca tttgcaccat CCCAAAAACGAA ssRNA gccttccctttgcaccatc ccatctca GGGGACTAAAAC catctca 11b zika_90 LwaCas13a GATTTAGACTACCCCAAAA acagccttcc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACac ctttgcacca CCCAAAAACGAA ssRNA agccttccctttgcaccat tccatctc GGGGACTAAAAC ccatctc 11b zika_91 LwaCas13a GATTTAGACTACCCCAAAA gacagccttc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACga cctttgcacc CCCAAAAACGAA ssRNA cagccttccctttgcacca atccatct GGGGACTAAAAC tccatct 11b zika_92 LwaCas13a GATTTAGACTACCCCAAAA ggacagcct GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACgg tccctttgca CCCAAAAACGAA ssRNA acagccttccctttgcacc ccatccatc GGGGACTAAAAC atccatc 11b zika_93 LwaCas13a GATTTAGACTACCCCAAAA aggacagcc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACag ttccctttgca CCCAAAAACGAA ssRNA gacagccttccctttgcac ccatccat GGGGACTAAAAC catccat 11b zika_94 LwaCas13a GATTTAGACTACCCCAAAA gaggacagc GATTTAGACTAC Zika 1b ACGAAGGGGACTAAAACga cttccctttgc CCCAAAAACGAA ssRNA ggacagccttccctttgca accatcca GGGGACTAAAAC ccatcca 11b zika_0 CcaCas13b tttgttgttccagtgtgga tttgttgttcc GTTGGAACTGCT Zika 1b gttccggtgtcGT agtgtggagt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tccggtgtc GTAATCACAAC GAGGGTAATCACAAC 11b zika_1 CcaCas13b ctttgttgttccagtgtgg ctttgttgttc GTTGGAACTGCT Zika 1b agttccggtgtGT cagtgtgga CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gttccggtgt GTAATCACAAC GAGGGTAATCACAAC 11b zika_2 CcaCas13b tctttgttgttccagtgtg tctttgttgttc GTTGGAACTGCT Zika 1b gagttccggtgGT cagtgtgga CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gttccggtg GTAATCACAAC GAGGGTAATCACAAC 11b zika_3 CcaCas13b ttctttgttgttccagtgt ttctttgttgtt GTTGGAACTGCT Zika 1b ggagttccggtGT ccagtgtgg CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG agttccggt GTAATCACAAC GAGGGTAATCACAAC 11b zika_4 CcaCas13b cttctttgttgttccagtg cttctttgttgt GTTGGAACTGCT Zika 1b tggagttccggGT tccagtgtgg CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG agttccgg GTAATCACAAC GAGGGTAATCACAAC 11b zika_5 CcaCas13b gcttctttgttgttccagt gcttctttgtt GTTGGAACTGCT Zika 1b gtggagttccgGT gttccagtgt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ggagttccg GTAATCACAAC GAGGGTAATCACAAC 11b zika_6 CcaCas13b tgcttctttgttgttccag tgcttctttgtt GTTGGAACTGCT Zika 1b tgtggagttccGT gttccagtgt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ggagttcc GTAATCACAAC GAGGGTAATCACAAC 11b zika_7 CcaCas13b gtgcttctttgttgttcca gtgcttctttg GTTGGAACTGCT Zika 1b gtgtggagttcGT ttgttccagtg CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tggagttc GTAATCACAAC GAGGGTAATCACAAC 11b zika_8 CcaCas13b agtgcttctttgttgttcc agtgcttcttt GTTGGAACTGCT Zika 1b agtgtggagttGT gttgttccagt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gtggagtt GTAATCACAAC GAGGGTAATCACAAC 11b zika_9 CcaCas13b cagtgcttctttgttgttc cagtgcttctt GTTGGAACTGCT Zika 1b cagtgtggagtGT tgttgttccag CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tgtggagt GTAATCACAAC GAGGGTAATCACAAC 11b zika_10 CcaCas13b ccagtgcttctttgttgtt ccagtgcttc GTTGGAACTGCT Zika 1b ccagtgtggagGT tttgttgttcc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG agtgtggag GTAATCACAAC GAGGGTAATCACAAC 11b zika_11 CcaCas13b accagtgcttctttgttgt accagtgctt GTTGGAACTGCT Zika 1b tccagtgtggaGT ctttgttgttc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG cagtgtgga GTAATCACAAC GAGGGTAATCACAAC 11b zika_12 CcaCas13b taccagtgcttctttgttg taccagtgct GTTGGAACTGCT Zika 1b ttccagtgtggGT tctttgttgttc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG cagtgtgg GTAATCACAAC GAGGGTAATCACAAC 11b zika_13 CcaCas13b ctaccagtgcttctttgtt ctaccagtgc GTTGGAACTGCT Zika 1b gttccagtgtgGT ttctttgttgtt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ccagtgtg GTAATCACAAC GAGGGTAATCACAAC 11b zika_14 CcaCas13b tctaccagtgcttctttgt tctaccagtg GTTGGAACTGCT Zika 1b tgttccagtgtGT cttctttgttgt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tccagtgt GTAATCACAAC GAGGGTAATCACAAC 11b zika_15 CcaCas13b ctctaccagtgcttctttg ctctaccagt GTTGGAACTGCT Zika 1b ttgttccagtgGT gcttctttgtt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gttccagtg GTAATCACAAC GAGGGTAATCACAAC 11b zika_16 CcaCas13b actctaccagtgcttcttt actctaccag GTTGGAACTGCT Zika 1b gttgttccagtGT tgcttctttgtt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gttccagt GTAATCACAAC GAGGGTAATCACAAC 11b zika_17 CcaCas13b aactctaccagtgcttctt aactctacca GTTGGAACTGCT Zika 1b tgttgttccagGT gtgcttctttg CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ttgttccag GTAATCACAAC GAGGGTAATCACAAC 11b zika_18 CcaCas13b gaactctaccagtgcttct gaactctacc GTTGGAACTGCT Zika 1b ttgttgttccaGT agtgcttcttt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gttgttcca GTAATCACAAC GAGGGTAATCACAAC 11b zika_19 CcaCas13b tgaactctaccagtgcttc tgaactctac GTTGGAACTGCT Zika 1b tttgttgttccGT cagtgcttctt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tgttgttcc GTAATCACAAC GAGGGTAATCACAAC 11b zika_20 CcaCas13b cttgaactctaccagtgct cttgaactct GTTGGAACTGCT Zika 1b tctttgttgttGTT accagtgctt CTCATTTTGGAGG ssRNA GGAACTGCTCTCATTTTGG ctttgttgtt GTAATCACAAC AGGGTAATCACAAC 11b zika_21 CcaCas13b tccttgaactctaccagtg tccttgaact GTTGGAACTGCT Zika 1b cttctttgttgGT ctaccagtgc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ttctttgttg GTAATCACAAC GAGGGTAATCACAAC 11b zika_22 CcaCas13b cgtccttgaactctaccag cgtccttgaa GTTGGAACTGCT Zika 1b tgcttctttgtGT ctctaccagt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gcttctttgt GTAATCACAAC GAGGGTAATCACAAC 11b zika_23 CcaCas13b tgcgtccttgaactctacc tgcgtccttg GTTGGAACTGCT Zika 1b agtgcttctttGT aactctacca CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gtgcttcttt GTAATCACAAC GAGGGTAATCACAAC 11b zika_24 CcaCas13b tgtgcgtccttgaactcta tgtgcgtcctt GTTGGAACTGCT Zika 1b ccagtgcttctGT gaactctacc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG agtgcttct GTAATCACAAC GAGGGTAATCACAAC 11b zika_25 CcaCas13b catgtgcgtccttgaactc catgtgcgtc GTTGGAACTGCT Zika 1b taccagtgcttGT cttgaactct CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG accagtgctt GTAATCACAAC GAGGGTAATCACAAC 11b zika_26 CcaCas13b ggcatgtgcgtccttgaac ggcatgtgc GTTGGAACTGCT Zika 1b tctaccagtgcGT gtccttgaac CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tctaccagtg GTAATCACAAC GAGGGTAATCACAAC c 11b zika_27 CcaCas13b ttggcatgtgcgtccttga ttggcatgtg GTTGGAACTGCT Zika 1b actctaccagtGT cgtccttgaa CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ctctaccagt GTAATCACAAC GAGGGTAATCACAAC 11b zika_28 CcaCas13b ttttggcatgtgcgtcctt ttttggcatgt GTTGGAACTGCT Zika 1b gaactctaccaGT gcgtccttga CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG actctacca GTAATCACAAC GAGGGTAATCACAAC 11b zika_29 CcaCas13b ccttttggcatgtgcgtcc ccttttggcat GTTGGAACTGCT Zika 1b ttgaactctacGT gtgcgtcctt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gaactctac GTAATCACAAC GAGGGTAATCACAAC 11b zika_30 CcaCas13b tgccttttggcatgtgcgt tgccttttggc GTTGGAACTGCT Zika 1b ccttgaactctGT atgtgcgtcc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ttgaactct GTAATCACAAC GAGGGTAATCACAAC 11b zika_31 CcaCas13b tttgccttttggcatgtgc tttgccttttg GTTGGAACTGCT Zika 1b gtccttgaactGT gcatgtgcgt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ccttgaact GTAATCACAAC GAGGGTAATCACAAC 11b zika_32 CcaCas13b agtttgccttttggcatgt agtttgccttt GTTGGAACTGCT Zika 1b gcgtccttgaaGT tggcatgtgc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gtccttgaa GTAATCACAAC GAGGGTAATCACAAC 11b zika_33 CcaCas13b acagtttgccttttggcat acagtttgcc GTTGGAACTGCT Zika 1b gtgcgtccttgGT ttttggcatgt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gcgtccttg GTAATCACAAC GAGGGTAATCACAAC 11b zika_34 CcaCas13b cgacagtttgccttttggc cgacagtttg GTTGGAACTGCT Zika 1b atgtgcgtcctGT ccttttggcat CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gtgcgtcct GTAATCACAAC GAGGGTAATCACAAC 11b zika_35 CcaCas13b cacgacagtttgccttttg cacgacagtt GTTGGAACTGCT Zika 1b gcatgtgcgtcGT tgccttttggc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG atgtgcgtc GTAATCACAAC GAGGGTAATCACAAC 11b zika_36 CcaCas13b accacgacagtttgccttt accacgaca GTTGGAACTGCT Zika 1b tggcatgtgcgGT gtttgcctttt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ggcatgtgc GTAATCACAAC GAGGGTAATCACAAC g 11b zika_37 CcaCas13b gaaccacgacagtttgcct gaaccacga GTTGGAACTGCT Zika 1b tttggcatgtgGT cagtttgcctt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ttggcatgtg GTAATCACAAC GAGGGTAATCACAAC 11b zika_38 CcaCas13b tagaaccacgacagtttgc tagaaccac GTTGGAACTGCT Zika 1b cttttggcatgGT gacagtttgc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG cttttggcatg GTAATCACAAC GAGGGTAATCACAAC 11b zika_39 CcaCas13b cctagaaccacgacagttt cctagaacc GTTGGAACTGCT Zika 1b gccttttggcaGT acgacagttt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gccttttggc GTAATCACAAC GAGGGTAATCACAAC a 11b zika_40 CcaCas13b tccctagaaccacgacagt tccctagaac GTTGGAACTGCT Zika 1b ttgccttttggGT cacgacagtt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tgccttttgg GTAATCACAAC GAGGGTAATCACAAC 11b zika_41 CcaCas13b actccctagaaccacgaca actccctaga GTTGGAACTGCT Zika 1b gtttgccttttGT accacgaca CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gtttgcctttt GTAATCACAAC GAGGGTAATCACAAC 11b zika_42 CcaCas13b tgactccctagaaccacga tgactcccta GTTGGAACTGCT Zika 1b cagtttgccttGT gaaccacga CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG cagtttgcctt GTAATCACAAC GAGGGTAATCACAAC 11b zika_43 CcaCas13b cttgactccctagaaccac cttgactccc GTTGGAACTGCT Zika 1b gacagtttgccGT tagaaccac CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gacagtttgc GTAATCACAAC GAGGGTAATCACAAC c 11b zika_44 CcaCas13b ttcttgactccctagaacc ttcttgactcc GTTGGAACTGCT Zika 1b acgacagtttgGT ctagaacca CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG cgacagtttg GTAATCACAAC GAGGGTAATCACAAC 11b zika_45 CcaCas13b ccttcttgactccctagaa ccttcttgact GTTGGAACTGCT Zika 1b ccacgacagttGT ccctagaac CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG cacgacagtt GTAATCACAAC GAGGGTAATCACAAC 11b zika_46 CcaCas13b ctccttcttgactccctag ctccttcttga GTTGGAACTGCT Zika 1b aaccacgacagGT ctccctagaa CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ccacgacag GTAATCACAAC GAGGGTAATCACAAC 11b zika_47 CcaCas13b tgctccttcttgactccct tgctccttctt GTTGGAACTGCT Zika 1b agaaccacgacGT gactccctag CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG aaccacgac GTAATCACAAC GAGGGTAATCACAAC 11b zika_48 CcaCas13b actgctccttcttgactcc actgctcctt GTTGGAACTGCT Zika 1b ctagaaccacgGT cttgactccc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tagaaccac GTAATCACAAC GAGGGTAATCACAAC g 11b zika_49 CcaCas13b gaactgctccttcttgact gaactgctcc GTTGGAACTGCT Zika 1b ccctagaaccaGT ttcttgactcc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ctagaacca GTAATCACAAC GAGGGTAATCACAAC 11b zika_50 CcaCas13b gtgaactgctccttcttga gtgaactgct GTTGGAACTGCT Zika 1b ctccctagaacGT ccttcttgact CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ccctagaac GTAATCACAAC GAGGGTAATCACAAC 11b zika_51 CcaCas13b gtgtgaactgctccttctt gtgtgaactg GTTGGAACTGCT Zika 1b gactccctagaGT ctccttcttga CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ctccctaga GTAATCACAAC GAGGGTAATCACAAC 11b zika_52 CcaCas13b ccgtgtgaactgctccttc ccgtgtgaa GTTGGAACTGCT Zika 1b ttgactccctaGT ctgctccttct CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tgactcccta GTAATCACAAC GAGGGTAATCACAAC 11b zika_53 CcaCas13b ggccgtgtgaactgctcct ggccgtgtg GTTGGAACTGCT Zika 1b tcttgactcccGT aactgctcct CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tcttgactcc GTAATCACAAC GAGGGTAATCACAAC c 11b zika_54 CcaCas13b agggccgtgtgaactgctc agggccgtg GTTGGAACTGCT Zika 1b cttcttgactcGT tgaactgctc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG cttcttgactc GTAATCACAAC GAGGGTAATCACAAC 11b zika_55 CcaCas13b caagggccgtgtgaactgc caagggccg GTTGGAACTGCT Zika 1b tccttcttgacGT tgtgaactgc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tccttcttgac GAGGGTAATCACAAC GTAATCACAAC 11b zika_56 CcaCas13b agcaagggccgtgtgaact agcaagggc GTTGGAACTGCT Zika 1b gctccttcttgGT cgtgtgaact CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gctccttcttg GTAATCACAAC GAGGGTAATCACAAC 11b zika_57 CcaCas13b ccagcaagggccgtgtgaa ccagcaagg GTTGGAACTGCT Zika 1b ctgctccttctG gccgtgtga CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT actgctcctt GTAATCACAAC GGAGGGTAATCACAAC ct 11b zika_58 CcaCas13b ctccagcaagggccgtgtg ctccagcaa GTTGGAACTGCT Zika 1b aactgctccttG gggccgtgt CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT gaactgctcc GTAATCACAAC GGAGGGTAATCACAAC tt 11b zika_59 CcaCas13b agctccagcaagggccgtg agctccagc GTTGGAACTGCT Zika 1b tgaactgctccG aagggccgt CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT gtgaactgct GTAATCACAAC GGAGGGTAATCACAAC cc 11b zika_60 CcaCas13b agagctccagcaagggccg agagctcca GTTGGAACTGCT Zika 1b tgtgaactgctG gcaagggcc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT gtgtgaactg GTAATCACAAC GGAGGGTAATCACAAC ct 11b zika_61 CcaCas13b ccagagctccagcaagggc ccagagctc GTTGGAACTGCT Zika 1b cgtgtgaactgG cagcaaggg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT ccgtgtgaa GTAATCACAAC GGAGGGTAATCACAAC ctg 11b zika_62 CcaCas13b ctccagagctccagcaagg ctccagagct GTTGGAACTGCT Zika 1b gccgtgtgaacG ccagcaagg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT gccgtgtga GTAATCACAAC GGAGGGTAATCACAAC ac 11b zika_63 CcaCas13b gcctccagagctccagcaa gcctccaga GTTGGAACTGCT Zika 1b gggccgtgtgaG gctccagca CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT agggccgtg GTAATCACAAC GGAGGGTAATCACAAC tga 11b zika_64 CcaCas13b cagcctccagagctccagc cagcctcca GTTGGAACTGCT Zika 1b aagggccgtgt gagctccag CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTT caagggccg GTAATCACAAC TGGAGGGTAATCACAAC tgt 11b zika_65 CcaCas13b ctcagcctccagagctcca ctcagcctcc GTTGGAACTGCT Zika 1b gcaagggccgt agagctcca CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTT gcaagggcc GTAATCACAAC TGGAGGGTAATCACAAC gt 11b zika_66 CcaCas13b atctcagcctccagagctc atctcagcct GTTGGAACTGCT Zika 1b cagcaagggcc ccagagctc CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTT cagcaaggg GTAATCACAAC TGGAGGGTAATCACAAC cc 11b zika_67 CcaCas13b ccatctcagcctccagagc ccatctcagc GTTGGAACTGCT Zika 1b tccagcaaggg ctccagagct CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTT ccagcaagg GTAATCACAAC TGGAGGGTAATCACAAC g 11b zika_68 CcaCas13b tccatctcagcctccagag tccatctcag GTTGGAACTGCT Zika 1b ctccagcaagg cctccagag CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTT ctccagcaa GTAATCACAAC TGGAGGGTAATCACAAC gg 11b zika_69 CcaCas13b atccatctcagcctccaga atccatctca GTTGGAACTGCT Zika 1b gctccagcaag gcctccaga CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTT gctccagca GTAATCACAAC TGGAGGGTAATCACAAC ag 11b zika_70 CcaCas13b catccatctcagcctccag catccatctc GTTGGAACTGCT Zika 1b agctccagcaa agcctccag CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTT agctccagc GTAATCACAAC TGGAGGGTAATCACAAC aa 11b zika_71 CcaCas13b ccatccatctcagcctcca ccatccatct GTTGGAACTGCT Zika 1b gagctccagca cagcctcca CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTT gagctccag GTAATCACAAC TGGAGGGTAATCACAAC ca 11b zika_72 CcaCas13b accatccatctcagcctcc accatccatc GTTGGAACTGCT Zika 1b agagctccagc tcagcctcca CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTT gagctccag GTAATCACAAC TGGAGGGTAATCACAAC c 11b zika_73 CcaCas13b caccatccatctcagcctc caccatccat GTTGGAACTGCT Zika 1b cagagctccag ctcagcctcc CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTT agagctcca GTAATCACAAC TGGAGGGTAATCACAAC g 11b zika_74 CcaCas13b gcaccatccatctcagcct gcaccatcc GTTGGAACTGCT Zika 1b ccagagctcca atctcagcct CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTT ccagagctc GTAATCACAAC TGGAGGGTAATCACAAC ca 11b zika_75 CcaCas13b tgcaccatccatctcagcc tgcaccatcc GTTGGAACTGCT Zika 1b tccagagctcc atctcagcct CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTT ccagagctc GTAATCACAAC TGGAGGGTAATCACAAC c 11b zika_76 CcaCas13b ttgcaccatccatctcagc ttgcaccatc GTTGGAACTGCT Zika 1b ctccagagctcG catctcagcc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT tccagagctc GTAATCACAAC GGAGGGTAATCACAAC 11b zika_77 CcaCas13b tttgcaccatccatctcag tttgcaccat GTTGGAACTGCT Zika 1b cctccagagctG ccatctcagc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT ctccagagct GTAATCACAAC GGAGGGTAATCACAAC 11b zika_78 CcaCas13b ctttgcaccatccatctca ctttgcacca GTTGGAACTGCT Zika 1b gcctccagagcG tccatctcag CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT cctccagag GTAATCACAAC GGAGGGTAATCACAAC c 11b zika_79 CcaCas13b cctttgcaccatccatctc cctttgcacc GTTGGAACTGCT Zika 1b agcctccagagG atccatctca CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT gcctccaga GTAATCACAAC GGAGGGTAATCACAAC g 11b zika_80 CcaCas13b ccctttgcaccatccatct ccctttgcac GTTGGAACTGCT Zika 1b cagcctccagaG catccatctc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT agcctccag GTAATCACAAC GGAGGGTAATCACAAC a 11b zika_81 CcaCas13b tccctttgcaccatccatc tccctttgca GTTGGAACTGCT Zika 1b tcagcctccagG ccatccatct CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT cagcctcca GTAATCACAAC GGAGGGTAATCACAAC g 11b zika_82 CcaCas13b ttccctttgcaccatccat ttccctttgca GTTGGAACTGCT Zika 1b ctcagcctccaG ccatccatct CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT cagcctcca GTAATCACAAC GGAGGGTAATCACAAC 11b zika_83 CcaCas13b cttccctttgcaccatcca cttccctttgc GTTGGAACTGCT Zika 1b tctcagcctccG accatccatc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT tcagcctcc GTAATCACAAC GGAGGGTAATCACAAC 11b zika_84 CcaCas13b ccttccctttgcaccatcc ccttccctttg GTTGGAACTGCT Zika 1b atctcagcctcG caccatccat CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT ctcagcctc GTAATCACAAC GGAGGGTAATCACAAC 11b zika_85 CcaCas13b gccttccctttgcaccatc gccttcccttt GTTGGAACTGCT Zika 1b catctcagcctG gcaccatcc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT atctcagcct GTAATCACAAC GGAGGGTAATCACAAC 11b zika_86 CcaCas13b agccttccctttgcaccat agccttccct GTTGGAACTGCT Zika 1b ccatctcagccG ttgcaccatc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT catctcagcc GTAATCACAAC GGAGGGTAATCACAAC 11b zika_87 CcaCas13b cagccttccctttgcacca cagccttccc GTTGGAACTGCT Zika 1b tccatctcagcG tttgcaccat CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT ccatctcagc GTAATCACAAC GGAGGGTAATCACAAC 11b zika_88 CcaCas13b acagccttccctttgcacc acagccttcc GTTGGAACTGCT Zika 1b atccatctcagG ctttgcacca CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT tccatctcag GTAATCACAAC GGAGGGTAATCACAAC 11b zika_89 CcaCas13b gacagccttccctttgcac gacagccttc GTTGGAACTGCT Zika 1b catccatctcaG cctttgcacc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT atccatctca GTAATCACAAC GGAGGGTAATCACAAC 11b zika_90 CcaCas13b ggacagccttccctttgca ggacagcct GTTGGAACTGCT Zika 1b ccatccatctcG tccctttgca CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT ccatccatct GTAATCACAAC GGAGGGTAATCACAAC c 11b zika_91 CcaCas13b aggacagccttccctttgc aggacagcc GTTGGAACTGCT Zika 1b accatccatctG ttccctttgca CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT ccatccatct GTAATCACAAC GGAGGGTAATCACAAC 11b zika_92 CcaCas13b gaggacagccttccctttg gaggacagc GTTGGAACTGCT Zika 1b caccatccatcG cttccctttgc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT accatccatc GTAATCACAAC GGAGGGTAATCACAAC 11b zika_93 CcaCas13b agaggacagccttcccttt agaggacag GTTGGAACTGCT Zika 1b gcaccatccatG ccttccctttg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT caccatccat GTAATCACAAC GGAGGGTAATCACAAC 11b zika_94 CcaCas13b cagaggacagccttccctt cagaggaca GTTGGAACTGCT Zika 1b tgcaccatcca gccttcccttt CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTT gcaccatcc GTAATCACAAC TGGAGGGTAATCACAAC a 9a dengue_0 CcaCas13b tgttgagaggttggcccct tgttgagagg GTTGGAACTGCT Dengue 9a gaatatgtactG ttggcccctg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT aatatgtact GTAATCACAAC GGAGGGTAATCACAAC 9a dengue_1 CcaCas13b ttgttgagaggttggcccc ttgttgagag GTTGGAACTGCT Dengue 9a tgaatatgtacG gttggcccct CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT gaatatgtac GTAATCACAAC GGAGGGTAATCACAAC 9a dengue_2 CcaCas13b attgttgagaggttggccc attgttgaga GTTGGAACTGCT Dengue 9a ctgaatatgtaG ggttggccc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT ctgaatatgt GTAATCACAAC GGAGGGTAATCACAAC a 9a dengue_3 CcaCas13b cattgttgagaggttggcc cattgttgag GTTGGAACTGCT Dengue 9a cctgaatatgtG aggttggcc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTT cctgaatatg GTAATCACAAC GGAGGGTAATCACAAC t 9a dengue_4 CcaCas13b tcattgttgagaggttggc tcattgttgag GTTGGAACTGCT Dengue 9a ccctgaatatgG aggttggcc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG cctgaatatg GTAATCACAAC GAGGGTAATCACAAC 9a dengue_5 CcaCas13b gtcattgttgagaggttgg gtcattgttga GTTGGAACTGCT Dengue 9a cccctgaatatG gaggttggc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ccctgaatat GTAATCACAAC GAGGGTAATCACAAC 9a dengue_6 CcaCas13b cgtcattgttgagaggttg cgtcattgttg GTTGGAACTGCT Dengue 9a gcccctgaataG agaggttgg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG cccctgaata GTAATCACAAC GAGGGTAATCACAAC 9a dengue_7 CcaCas13b tcgtcattgttgagaggtt tcgtcattgtt GTTGGAACTGCT Dengue 9a ggcccctgaatG gagaggttg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gcccctgaat GTAATCACAAC GAGGGTAATCACAAC 9a dengue_8 CcaCas13b ttcgtcattgttgagaggt ttcgtcattgt GTTGGAACTGCT Dengue 9a tggcccctgaaG tgagaggttg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gcccctgaa GTAATCACAAC GAGGGTAATCACAAC 9a dengue_9 CcaCas13b cttcgtcattgttgagagg cttcgtcattg GTTGGAACTGCT Dengue 9a ttggcccctgaG ttgagaggtt CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ggcccctga GTAATCACAAC GAGGGTAATCACAAC 9a dengue_1 CcaCas13b tcttcgtcattgttgagag tcttcgtcatt GTTGGAACTGCT Dengue 9a 0 gttggcccctgG gttgagaggt CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG tggcccctg GTAATCACAAC GAGGGTAATCACAAC 9a dengue_1 CcaCas13b gtcttcgtcattgttgaga gtcttcgtcat GTTGGAACTGCT Dengue 9a 1 ggttggcccctG tgttgagagg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ttggcccct GTAATCACAAC GAGGGTAATCACAAC 9a dengue_1 CcaCas13b ggtcttcgtcattgttgag ggtcttcgtc GTTGGAACTGCT Dengue 9a 2 aggttggccccG attgttgaga CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ggttggccc GTAATCACAAC GAGGGTAATCACAAC c 9a dengue_1 CcaCas13b tggtcttcgtcattgttga tggtcttcgtc GTTGGAACTGCT Dengue 9a 3 gaggttggcccG attgttgaga CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ggttggccc GTAATCACAAC GAGGGTAATCACAAC 9a dengue_1 CcaCas13b atggtcttcgtcattgttg atggtcttcgt GTTGGAACTGCT Dengue 9a 4 agaggttggccG cattgttgag CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG aggttggcc GTAATCACAAC GAGGGTAATCACAAC 9a dengue_1 CcaCas13b catggtcttcgtcattgtt catggtcttc GTTGGAACTGCT Dengue 9a 5 gagaggttggcG gtcattgttga CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gaggttggc GTAATCACAAC GAGGGTAATCACAAC 9a dengue_1 CcaCas13b gcatggtcttcgtcattgt gcatggtctt GTTGGAACTGCT Dengue 9a 6 tgagaggttggG cgtcattgttg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG agaggttgg GTAATCACAAC GAGGGTAATCACAAC 9a dengue_1 CcaCas13b agcatggtcttcgtcattg agcatggtct GTTGGAACTGCT Dengue 9a 7 ttgagaggttgG tcgtcattgtt CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gagaggttg GTAATCACAAC GAGGGTAATCACAAC 9a dengue_1 CcaCas13b gagcatggtcttcgtcatt gagcatggt GTTGGAACTGCT Dengue 9a 8 gttgagaggttG cttcgtcattg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ttgagaggtt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_1 CcaCas13b tgagcatggtcttcgtcat tgagcatggt GTTGGAACTGCT Dengue 9a 9 tgttgagaggtG cttcgtcattg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ttgagaggt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_2 CcaCas13b agtgagcatggtcttcgtc agtgagcat GTTGGAACTGCT Dengue 9a 0 attgttgagagG ggtcttcgtc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG attgttgaga GTAATCACAAC GAGGGTAATCACAAC g 9a dengue_2 CcaCas13b ccagtgagcatggtcttcg ccagtgagc GTTGGAACTGCT Dengue 9a 1 tcattgttgagG atggtcttcgt CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG cattgttgag GTAATCACAAC GAGGGTAATCACAAC 9a dengue_2 CcaCas13b gtccagtgagcatggtctt gtccagtga GTTGGAACTGCT Dengue 9a 2 cgtcattgttgG gcatggtctt CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG cgtcattgttg GTAATCACAAC GAGGGTAATCACAAC 9a dengue_2 CcaCas13b ctgtccagtgagcatggtc ctgtccagtg GTTGGAACTGCT Dengue 9a 3 ttcgtcattgtG agcatggtct CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG tcgtcattgt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_2 CcaCas13b ttctgtccagtgagcatgg ttctgtccagt GTTGGAACTGCT Dengue 9a 4 tcttcgtcattGT gagcatggt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG cttcgtcatt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_2 CcaCas13b gcttctgtccagtgagcat gcttctgtcc GTTGGAACTGCT Dengue 9a 5 ggtcttcgtcaG agtgagcat CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ggtcttcgtc GTAATCACAAC GAGGGTAATCACAAC a 9a dengue_2 CcaCas13b ttgcttctgtccagtgagc ttgcttctgtc GTTGGAACTGCT Dengue 9a 6 atggtcttcgtGT cagtgagca CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tggtcttcgt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_2 CcaCas13b ttttgcttctgtccagtga ttttgcttctgt GTTGGAACTGCT Dengue 9a 7 gcatggtcttcGT ccagtgagc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG atggtcttc GTAATCACAAC GAGGGTAATCACAAC 9a dengue_2 CcaCas13b atttttgcttctgtccagt atttttgcttct GTTGGAACTGCT Dengue 9a 8 gagcatggtctGT gtccagtga CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gcatggtct GTAATCACAAC GAGGGTAATCACAAC 9a dengue_2 CcaCas13b gcatttttgcttctgtcca gcatttttgct GTTGGAACTGCT Dengue 9a 9 gtgagcatggtGT tctgtccagt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gagcatggt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_3 CcaCas13b cagcatttttgcttctgtc cagcatttttg GTTGGAACTGCT Dengue 9a 0 cagtgagcatgGT cttctgtcca CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gtgagcatg GTAATCACAAC GAGGGTAATCACAAC 9a dengue_3 CcaCas13b agcagcatttttgcttctg agcagcattt GTTGGAACTGCT Dengue 9a 1 tccagtgagcaG ttgcttctgtc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG cagtgagca GTAATCACAAC GAGGGTAATCACAAC 9a dengue_3 CcaCas13b ccagcagcatttttgcttc ccagcagca GTTGGAACTGCT Dengue 9a 2 tgtccagtgagG tttttgcttctg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG tccagtgag GTAATCACAAC GAGGGTAATCACAAC 9a dengue_3 CcaCas13b gtccagcagcatttttgct gtccagcag GTTGGAACTGCT Dengue 9a 3 tctgtccagtgGT catttttgcttc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tgtccagtg GTAATCACAAC GAGGGTAATCACAAC 9a dengue_3 CcaCas13b ttgtccagcagcatttttg ttgtccagca GTTGGAACTGCT Dengue 9a 4 cttctgtccagGT gcatttttgct CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tctgtccag GTAATCACAAC GAGGGTAATCACAAC 9a dengue_3 CcaCas13b tgttgtccagcagcatttt tgttgtccag GTTGGAACTGCT Dengue 9a 5 tgcttctgtccGT cagcatttttg CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG cttctgtcc GTAATCACAAC GAGGGTAATCACAAC 9a dengue_3 CcaCas13b gatgttgtccagcagcatt gatgttgtcc GTTGGAACTGCT Dengue 9a 6 tttgcttctgtGT agcagcattt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ttgcttctgt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_3 CcaCas13b ttgatgttgtccagcagca ttgatgttgtc GTTGGAACTGCT Dengue 9a 7 tttttgcttctGT cagcagcatt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tttgcttct GTAATCACAAC GAGGGTAATCACAAC 9a dengue_3 CcaCas13b tgttgatgttgtccagcag tgttgatgttg GTTGGAACTGCT Dengue 9a 8 catttttgcttGT tccagcagc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG atttttgctt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_3 CcaCas13b tgtgttgatgttgtccagc tgtgttgatgt GTTGGAACTGCT Dengue 9a 9 agcatttttgcGT tgtccagca CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gcatttttgc GTAATCACAAC GAGGGTAATCACAAC 9a dengue_4 CcaCas13b ggtgtgttgatgttgtcca ggtgtgttga GTTGGAACTGCT Dengue 9a 0 gcagcatttttGT tgttgtccag CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG cagcattttt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_4 CcaCas13b ctggtgtgttgatgttgtc ctggtgtgtt GTTGGAACTGCT Dengue 9a 1 cagcagcatttGT gatgttgtcc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG agcagcattt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_4 CcaCas13b ttctggtgtgttgatgttg ttctggtgtgt GTTGGAACTGCT Dengue 9a 2 tccagcagcatGT tgatgttgtcc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG agcagcat GTAATCACAAC GAGGGTAATCACAAC 9a dengue_4 CcaCas13b ccttctggtgtgttgatgt ccttctggtgt GTTGGAACTGCT Dengue 9a 3 tgtccagcagcG gttgatgttgt CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ccagcagc GTAATCACAAC GAGGGTAATCACAAC 9a dengue_4 CcaCas13b tcccttctggtgtgttgat tcccttctggt GTTGGAACTGCT Dengue 9a 4 gttgtccagcaGT gtgttgatgtt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gtccagca GTAATCACAAC GAGGGTAATCACAAC 9a dengue_4 CcaCas13b aatcccttctggtgtgttg aatcccttct GTTGGAACTGCT Dengue 9a 5 atgttgtccagGT ggtgtgttga CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tgttgtccag GTAATCACAAC GAGGGTAATCACAAC 9a dengue_4 CcaCas13b ataatcccttctggtgtgt ataatcccttc GTTGGAACTGCT Dengue 9a 6 tgatgttgtccGT tggtgtgttg CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG atgttgtcc GTAATCACAAC GAGGGTAATCACAAC 9a dengue_4 CcaCas13b gtataatcccttctggtgt gtataatccc GTTGGAACTGCT Dengue 9a 7 gttgatgttgtGT CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ttctggtgtgt GTAATCACAAC GAGGGTAATCACAAC tgatgttgt 9a dengue_4 CcaCas13b tggtataatcccttctggt tggtataatc GTTGGAACTGCT Dengue 9a 8 gtgttgatgttGT ccttctggtgt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gttgatgtt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_4 CcaCas13b gctggtataatcccttctg gctggtataa GTTGGAACTGCT Dengue 9a 9 gtgtgttgatgGT tcccttctggt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gtgttgatg GTAATCACAAC GAGGGTAATCACAAC 9a dengue_5 CcaCas13b gagctggtataatcccttc gagctggtat GTTGGAACTGCT Dengue 9a 0 tggtgtgttgaG aatcccttct CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ggtgtgttga GTAATCACAAC GAGGGTAATCACAAC 9a dengue_5 CcaCas13b gagagctggtataatccct gagagctgg GTTGGAACTGCT Dengue 9a 1 tctggtgtgttG tataatccctt CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ctggtgtgtt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_5 CcaCas13b aagagagctggtataatcc aagagagct GTTGGAACTGCT Dengue 9a 2 cttctggtgtgG ggtataatcc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG cttctggtgt GTAATCACAAC GAGGGTAATCACAAC g 9a dengue_5 CcaCas13b caaagagagctggtataat caaagagag GTTGGAACTGCT Dengue 9a 3 cccttctggtgG ctggtataat CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG cccttctggt GTAATCACAAC GAGGGTAATCACAAC g 9a dengue_5 CcaCas13b ttcaaagagagctggtata ttcaaagaga GTTGGAACTGCT Dengue 9a 4 atcccttctggG gctggtataa CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG tcccttctgg GTAATCACAAC GAGGGTAATCACAAC 9a dengue_5 CcaCas13b ggttcaaagagagctggta ggttcaaag GTTGGAACTGCT Dengue 9a 5 taatcccttctG agagctggt CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ataatcccttc GTAATCACAAC GAGGGTAATCACAAC t 9a dengue_5 CcaCas13b ctggttcaaagagagctgg ctggttcaaa GTTGGAACTGCT Dengue 9a 6 tataatcccttG gagagctgg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG tataatccctt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_5 CcaCas13b ttctggttcaaagagagct ttctggttcaa GTTGGAACTGCT Dengue 9a 7 ggtataatcccG agagagctg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gtataatccc GTAATCACAAC GAGGGTAATCACAAC 9a dengue_5 CcaCas13b ctttctggttcaaagagag ctttctggttc GTTGGAACTGCT Dengue 9a 8 ctggtataatcG aaagagagc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG tggtataatc GTAATCACAAC GAGGGTAATCACAAC 9a dengue_5 CcaCas13b ccctttctggttcaaagag ccctttctggt GTTGGAACTGCT Dengue 9a 9 agctggtataaG tcaaagaga CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gctggtataa GTAATCACAAC GAGGGTAATCACAAC 9a dengue_6 CcaCas13b ctccctttctggttcaaag ctccctttctg GTTGGAACTGCT Dengue 9a 0 agagctggtatG gttcaaaga CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gagctggtat GTAATCACAAC GAGGGTAATCACAAC 9a dengue_6 CcaCas13b ttctccctttctggttcaa ttctccctttct GTTGGAACTGCT Dengue 9a 1 agagagctggtGT ggttcaaag CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG agagctggt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_6 CcaCas13b acttctccctttctggttca acttctccctt GTTGGAACTGCT Dengue 9a 2 aagagagctgG tctggttcaa CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG agagagctg GTAATCACAAC GAGGGTAATCACAAC 9a dengue_6 CcaCas13b tgacttctccctttctggtt tgacttctcc GTTGGAACTGCT Dengue 9a 3 caaagagagcG ctttctggttc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG aaagagagc GTAATCACAAC GAGGGTAATCACAAC 9a dengue_6 CcaCas13b gctgacttctccctttctgg gctgacttct GTTGGAACTGCT Dengue 9a 4 ttcaaagagaG ccctttctggt CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG tcaaagaga GTAATCACAAC GAGGGTAATCACAAC 9a dengue_6 CcaCas13b ggctgacttctccctttctg ggctgacttc GTTGGAACTGCT Dengue 9a 5 gttcaaagagG tccctttctgg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ttcaaagag GTAATCACAAC GAGGGTAATCACAAC 9a dengue_6 CcaCas13b cggctgacttctccctttct cggctgactt GTTGGAACTGCT Dengue 9a 6 ggttcaaagaG ctccctttctg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gttcaaaga GTAATCACAAC GAGGGTAATCACAAC 9a dengue_6 CcaCas13b gcggctgacttctccctttc gcggctgac GTTGGAACTGCT Dengue 9a 7 tggttcaaagG ttctccctttct CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ggttcaaag GTAATCACAAC GAGGGTAATCACAAC 9a dengue_6 CcaCas13b ggcggctgacttctcccttt ggcggctga GTTGGAACTGCT Dengue 9a 8 ctggttcaaaG cttctcccttt CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ctggttcaaa GTAATCACAAC GAGGGTAATCACAAC 9a dengue_6 CcaCas13b tggcggctgacttctccctt t tggcggctg GTTGGAACTGCT Dengue 9a 9 ctggttcaaGT acttctccctt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tctggttcaa GTAATCACAAC GAGGGTAATCACAAC 9a dengue_7 CcaCas13b atggcggctgacttctccct atggcggct GTTGGAACTGCT Dengue 9a 0 ttctggttcaGT gacttctccc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tttctggttca GTAATCACAAC GAGGGTAATCACAAC 9a dengue_7 CcaCas13b tatggcggctgacttctccc tatggcggct GTTGGAACTGCT Dengue 9a 1 tttctggttcGT gacttctccc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tttctggttc GTAATCACAAC GAGGGTAATCACAAC 9a dengue_7 CcaCas13b ctatggcggctgacttctcc ctatggcgg GTTGGAACTGCT Dengue 9a 2 ctttctggttGT ctgacttctc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG cctttctggtt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_7 CcaCas13b tctatggcggctgacttctc tctatggcgg GTTGGAACTGCT Dengue 9a 3 cctttctggtGT ctgacttctc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG cctttctggt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_7 CcaCas13b gtctatggcggctgacttct gtctatggcg GTTGGAACTGCT Dengue 9a 4 ccctttctggG gctgacttct CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ccctttctgg GTAATCACAAC GAGGGTAATCACAAC 9a dengue_7 CcaCas13b cgtctatggcggctgacttc cgtctatggc GTTGGAACTGCT Dengue 9a 5 tccctttctgGT ggctgacttc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tccctttctg GTAATCACAAC GAGGGTAATCACAAC 9a dengue_7 CcaCas13b ccgtctatggcggctgactt ccgtctatgg GTTGGAACTGCT Dengue 9a 6 ctccctttctGT cggctgactt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ctccctttct GTAATCACAAC GAGGGTAATCACAAC 9a dengue_7 CcaCas13b accgtctatggcggctgact accgtctatg GTTGGAACTGCT Dengue 9a 7 tctccctttcG gcggctgac CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ttctccctttc GTAATCACAAC GAGGGTAATCACAAC 9a dengue_7 CcaCas13b caccgtctatggcggctgac caccgtctat GTTGGAACTGCT Dengue 9a 8 ttctccctttG ggcggctga CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG cttctcccttt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_7 CcaCas 13b tcaccgtctatggcggctga tcaccgtcta GTTGGAACTGCT Dengue 9a 9 cttctcccttG tggcggctg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG acttctccctt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_8 CcaCas13b ttcaccgtctatggcggctg ttcaccgtct GTTGGAACTGCT Dengue 9a 0 acttctccctG atggcggct CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gacttctccc GTAATCACAAC GAGGGTAATCACAAC t 9a dengue_8 CcaCas13b attcaccgtctatggcggct attcaccgtc GTTGGAACTGCT Dengue 9a 1 gacttctcccG tatggcggct CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gacttctccc GTAATCACAAC GAGGGTAATCACAAC 9a dengue_8 CcaCas13b tattcaccgtctatggcggc tattcaccgt GTTGGAACTGCT Dengue 9a 2 tgacttctccG ctatggcgg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ctgacttctc GTAATCACAAC GAGGGTAATCACAAC c 9a dengue_8 CcaCas13b gtattcaccgtctatggcgg gtattcaccg GTTGGAACTGCT Dengue 9a 3 ctgacttctcG tctatggcgg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ctgacttctc GTAATCACAAC GAGGGTAATCACAAC 9a dengue_8 CcaCas13b ggtattcaccgtctatggcg ggtattcacc GTTGGAACTGCT Dengue 9a 4 gctgacttctG gtctatggcg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gctgacttct GTAATCACAAC GAGGGTAATCACAAC 9a dengue_8 CcaCas13b cggtattcaccgtctatggc cggtattcac GTTGGAACTGCT Dengue 9a 5 ggctgacttcG cgtctatggc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ggctgacttc GTAATCACAAC GAGGGTAATCACAAC 9a dengue_8 CcaCas13b gcggtattcaccgtctatgg gcggtattca GTTGGAACTGCT Dengue 9a 6 cggctgacttG ccgtctatgg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG cggctgactt GTAATCACAAC GAGGGTAATCACAAC 9a dengue_8 CcaCas13b ggcggtattcaccgtctatg ggcggtattc GTTGGAACTGCT Dengue 9a 7 gcggctgact accgtctatg CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT gcggctgac GTAATCACAAC GGAGGGTAATCACAAC t 9a dengue_8 CcaCas13b aggcggtattcaccgtctat aggcggtatt GTTGGAACTGCT Dengue 9a 8 ggcggctgac caccgtctat CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT ggcggctga GTAATCACAAC GGAGGGTAATCACAAC c 9a dengue_8 CcaCas13b caggcggtattcaccgtcta caggcggta GTTGGAACTGCT Dengue 9a 9 tggcggctga ttcaccgtct CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT atggcggct GTAATCACAAC GGAGGGTAATCACAAC ga 9a dengue_9 CcaCas13b tcaggcggtattcaccgtct tcaggcggt GTTGGAACTGCT Dengue 9a 0 atggcggctg attcaccgtc CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT tatggcggct GTAATCACAAC GGAGGGTAATCACAAC g 9a dengue_9 CcaCas13b ttcaggcggtattcaccgtc ttcaggcggt GTTGGAACTGCT Dengue 9a 1 tatggcggctG attcaccgtc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG tatggcggct GTAATCACAAC GAGGGTAATCACAAC 9a dengue_9 CcaCas13b cttcaggcggtattcaccgt cttcaggcg GTTGGAACTGCT Dengue 9a 2 ctatggcggcG gtattcaccg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG tctatggcgg GTAATCACAAC GAGGGTAATCACAAC c 9a dengue_9 CcaCas13b ccttcaggcggtattcaccg ccttcaggc GTTGGAACTGCT Dengue 9a 3 tctatggcggG ggtattcacc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gtctatggcg GTAATCACAAC GAGGGTAATCACAAC g 9a dengue_9 CcaCas13b cccttcaggcggtattcacc cccttcaggc GTTGGAACTGCT Dengue 9a 4 gtctatggcgG ggtattcacc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gtctatggcg GTAATCACAAC GAGGGTAATCACAAC 9a thermo_0 CcaCas13b attaatttaacagtatcacc attaatttaac GTTGGAACTGCT Thermo- 9a atcaatcgctGT agtatcacca CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG tcaatcgct GTAATCACAAC GAGGGTAATCACAAC 9a thermo_1 CcaCas13b cattaatttaacagtatcac cattaatttaa GTTGGAACTGCT Thermo- 9a catcaatcgcG cagtatcacc CTCATTTTGGAGG nuclease TTGGAACTGCTCTCATTTTG atcaatcgc GTAATCACAAC GAGGGTAATCACAAC 9a thermo_2 CcaCas13b acattaatttaacagtatca acattaattta GTTGGAACTGCT Thermo- 9a ccatcaatcgG acagtatcac CTCATTTTGGAGG nuclease TTGGAACTGCTCTCATTTTG catcaatcg GTAATCACAAC GAGGGTAATCACAAC 9a thermo_3 CcaCas13b tacattaatttaacagtatc tacattaattt GTTGGAACTGCT Thermo- 9a accatcaatcGT aacagtatca CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG ccatcaatc GTAATCACAAC GAGGGTAATCACAAC 9a thermo_4 CcaCas13b gtacattaatttaacagtat gtacattaatt GTTGGAACTGCT Thermo- 9a caccatcaatGT taacagtatc CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG accatcaat GTAATCACAAC GAGGGTAATCACAAC 9a thermo_5 CcaCas13b tgtacattaatttaacagta tgtacattaat GTTGGAACTGCT Thermo- 9a tcaccatcaaGT ttaacagtat CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG caccatcaa GTAATCACAAC GAGGGTAATCACAAC 9a thermo_6 CcaCas13b ttgtacattaatttaacagt ttgtacattaa GTTGGAACTGCT Thermo- 9a atcaccatcaGT tttaacagtat CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG caccatca GTAATCACAAC GAGGGTAATCACAAC 9a thermo_7 CcaCas13b tttgtacattaatttaacag tttgtacatta GTTGGAACTGCT Thermo- 9a tatcaccatcGT atttaacagt CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG atcaccatc GTAATCACAAC GAGGGTAATCACAAC 9a thermo_8 CcaCas13b ctttgtacattaatttaaca ctttgtacatt GTTGGAACTGCT Thermo- 9a gtatcaccatGT aatttaacag CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG tatcaccat GTAATCACAAC GAGGGTAATCACAAC 9a thermo_9 CcaCas13b cctttgtacattaatttaac cctttgtacat GTTGGAACTGCT Thermo- 9a agtatcaccaGT taatttaaca CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG gtatcacca GTAATCACAAC GAGGGTAATCACAAC 9a thermo_1 CcaCas13b acctttgtacattaatttaa acctttgtac GTTGGAACTGCT Thermo- 9a 0 cagtatcaccGT attaatttaac CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG agtatcacc GTAATCACAAC GAGGGTAATCACAAC 9a thermo_1 CcaCas13b gacctttgtacattaattta gacctttgta GTTGGAACTGCT Thermo- 9a 1 acagtatcacGT cattaatttaa CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG cagtatcac GTAATCACAAC GAGGGTAATCACAAC 9a thermo_1 CcaCas13b tgacctttgtacattaattt tgacctttgta GTTGGAACTGCT Thermo- 9a 2 aacagtatcaGT cattaatttaa CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG cagtatca GTAATCACAAC GAGGGTAATCACAAC 9a thermo_1 CcaCas13b ttgacctttgtacattaatt ttgacctttgt GTTGGAACTGCT Thermo- 9a 3 taacagtatcGT acattaattta CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG acagtatc GTAATCACAAC GAGGGTAATCACAAC 9a thermo_1 CcaCas13b gttgacctttgtacattaat gttgacctttg GTTGGAACTGCT Thermo- 9a 4 ttaacagtatGT tacattaattt CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG aacagtat GTAATCACAAC GAGGGTAATCACAAC 9a thermo_1 CcaCas13b ggttgacctttgtacattaa ggttgaccttt GTTGGAACTGCT Thermo- 9a 5 tttaacagtaGT CTCATTTTGGAGG gtacattaatt nuclease TGGAACTGCTCTCATTTTG taacagta GTAATCACAAC GAGGGTAATCACAAC 9a thermo_1 CcaCas13b tggttgacctttgtacatta tggttgacctt GTTGGAACTGCT Thermo- 9a 6 atttaacagtGT tgtacattaat CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG ttaacagt GTAATCACAAC GAGGGTAATCACAAC 9a thermo_1 CcaCas13b ttggttgacctttgtacatt ttggttgacct GTTGGAACTGCT Thermo- 9a 7 aatttaacagGT ttgtacattaa CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG tttaacag GTAATCACAAC GAGGGTAATCACAAC 9a thermo_1 CcaCas13b attggttgacctttgtacat attggttgac GTTGGAACTGCT Thermo- 9a 8 taatttaacaGT ctttgtacatt CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG aatttaaca GTAATCACAAC GAGGGTAATCACAAC 9a thermo_1 CcaCas13b cattggttgacctttgtaca cattggttga GTTGGAACTGCT Thermo- 9a 9 ttaatttaacGT cctttgtacat CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG taatttaac GTAATCACAAC GAGGGTAATCACAAC 9a thermo_2 CcaCas13b gtcattggttgacctttgta gtcattggtt GTTGGAACTGCT Thermo- 9a 0 cattaatttaGTT gacctttgta CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG cattaattta GTAATCACAAC AGGGTAATCACAAC 9a thermo_2 CcaCas13b atgtcattggttgacctttg atgtcattggt GTTGGAACTGCT Thermo- 9a 1 tacattaattGTT tgacctttgta CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG cattaatt GTAATCACAAC AGGGTAATCACAAC 9a thermo_2 CcaCas13b gaatgtcattggttgacctt gaatgtcatt GTTGGAACTGCT Thermo- 9a 2 tgtacattaaGT ggttgaccttt CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG gtacattaa GTAATCACAAC GAGGGTAATCACAAC 9a thermo_2 CcaCas13b ctgaatgtcattggttgacc ctgaatgtca GTTGGAACTGCT Thermo- 9a 3 tttgtacattGT ttggttgacct CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG ttgtacatt GTAATCACAAC GAGGGTAATCACAAC 9a thermo_2 CcaCas13b gtctgaatgtcattggttga gtctgaatgt GTTGGAACTGCT Thermo- 9a 4 cctttgtacaGT cattggttga CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG cctttgtaca GTAATCACAAC GAGGGTAATCACAAC 9a thermo_2 CcaCas13b tagtctgaatgtcattggtt tagtctgaat GTTGGAACTGCT Thermo- 9a 5 gacctttgtaGT gtcattggtt CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG gacctttgta GTAATCACAAC GAGGGTAATCACAAC 9a thermo_2 CcaCas13b aatagtctgaatgtcattgg aatagtctga GTTGGAACTGCT Thermo- 9a 6 ttgacctttgGT atgtcattggt CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG tgacctttg GTAATCACAAC GAGGGTAATCACAAC 9a thermo_2 CcaCas13b ataatagtctgaatgtcatt ataatagtct GTTGGAACTGCT Thermo- 9a 7 ggttgaccttGT gaatgtcatt CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG ggttgacctt GTAATCACAAC GAGGGTAATCACAAC 9a thermo_2 CcaCas13b caataatagtctgaatgtca caataatagt GTTGGAACTGCT Thermo- 9a 8 ttggttgaccG ctgaatgtca CTCATTTTGGAGG nuclease TTGGAACTGCTCTCATTTTG ttggttgacc GTAATCACAAC GAGGGTAATCACAAC 9a thermo_2 CcaCas13b accaataatagtctgaatgt accaataata GTTGGAACTGCT Thermo- 9a 9 cattggttgaG gtctgaatgt CTCATTTTGGAGG nuclease TTGGAACTGCTCTCATTTTG cattggttga GTAATCACAAC GAGGGTAATCACAAC 9a thermo_3 CcaCas13b caaccaataatagtctgaat caaccaata GTTGGAACTGCT Thermo- 9a 0 gtcattggttG atagtctgaa CTCATTTTGGAGG nuclease TTGGAACTGCTCTCATTTTG tgtcattggtt GTAATCACAAC GAGGGTAATCACAAC 9a thermo_3 CcaCas13b atcaaccaataatagtctga atcaaccaat GTTGGAACTGCT Thermo- 9a 1 atgtcattggG aatagtctga CTCATTTTGGAGG nuclease TTGGAACTGCTCTCATTTTG atgtcattgg GTAATCACAAC GAGGGTAATCACAAC 9a thermo_3 CcaCas13b gtatcaaccaataatagtct gtatcaacca GTTGGAACTGCT Thermo- 9a 2 gaatgtcattGT ataatagtct CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG gaatgtcatt GTAATCACAAC GAGGGTAATCACAAC 9a thermo_3 CcaCas13b gtgtatcaaccaataatagt gtgtatcaac GTTGGAACTGCT Thermo- 9a 3 ctgaatgtcaG caataatagt CTCATTTTGGAGG nuclease TTGGAACTGCTCTCATTTTG ctgaatgtca GTAATCACAAC GAGGGTAATCACAAC 9a thermo_3 CcaCas13b aggtgtatcaaccaataata aggtgtatca GTTGGAACTGCT Thermo- 9a 4 gtctgaatgtG accaataata CTCATTTTGGAGG nuclease TTGGAACTGCTCTCATTTTG gtctgaatgt GTAATCACAAC GAGGGTAATCACAAC 9a thermo_3 CcaCas13b tcaggtgtatcaaccaataa tcaggtgtat GTTGGAACTGCT Thermo- 9a 5 tagtctgaatG caaccaata CTCATTTTGGAGG nuclease TTGGAACTGCTCTCATTTTG atagtctgaa GTAATCACAAC GAGGGTAATCACAAC t 9a thermo_3 CcaCas13b tttcaggtgtatcaaccaat tttcaggtgta GTTGGAACTGCT Thermo- 9a 6 aatagtctgaG tcaaccaata CTCATTTTGGAGG nuclease TTGGAACTGCTCTCATTTTG atagtctga GTAATCACAAC GAGGGTAATCACAAC 9a thermo_3 CcaCas13b tgtttcaggtgtatcaacca tgtttcaggt GTTGGAACTGCT Thermo- 9a 7 ataatagtctGT gtatcaacca CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG ataatagtct GTAATCACAAC GAGGGTAATCACAAC 9a thermo_3 CcaCas13b tttgtttcaggtgtatcaac tttgtttcagg GTTGGAACTGCT Thermo- 9a 8 caataatagtGT tgtatcaacc CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG aataatagt GTAATCACAAC GAGGGTAATCACAAC 9a thermo_3 CcaCas13b gctttgtttcaggtgtatca gctttgtttca GTTGGAACTGCT Thermo- 9a 9 accaataataGT ggtgtatcaa CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG ccaataata GTAATCACAAC GAGGGTAATCACAAC 9a thermo_4 CcaCas13b atgctttgtttcaggtgtat atgctttgttt GTTGGAACTGCT Thermo- 9a 0 caaccaataaGT caggtgtatc CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG aaccaataa GTAATCACAAC GAGGGTAATCACAAC 9a thermo_4 CcaCas13b ggatgctttgtttcaggtgt ggatgctttg GTTGGAACTGCT Thermo- 9a 1 atcaaccaatGT tttcaggtgta CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG tcaaccaat GTAATCACAAC GAGGGTAATCACAAC 9a thermo_4 CcaCas13b taggatgctttgtttcaggt taggatgcttt GTTGGAACTGCT Thermo- 9a 2 gtatcaaccaGT gtttcaggtg CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG tatcaacca GTAATCACAAC GAGGGTAATCACAAC 9a thermo_4 CcaCas13b tttaggatgctttgtttcag tttaggatgct GTTGGAACTGCT Thermo- 9a 3 gtgtatcaacGT ttgtttcaggt CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG gtatcaac GTAATCACAAC GAGGGTAATCACAAC 9a thermo_4 CcaCas13b tttttaggatgctttgtttc tttttaggatg GTTGGAACTGCT Thermo- 9a 4 aggtgtatcaGTT ctttgtttcag CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG gtgtatca GTAATCACAAC AGGGTAATCACAAC 9a thermo_4 CcaCas13b cttttttaggatgctttgtt cttttttagga GTTGGAACTGCT Thermo- 9a 5 tcaggtgtatGTT tgctttgtttc CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG aggtgtat GTAATCACAAC AGGGTAATCACAAC 9a thermo_4 CcaCas13b accttttttaggatgctttg accttttttag GTTGGAACTGCT Thermo- 9a 6 tttcaggtgtGTT gatgctttgtt CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG tcaggtgt GTAATCACAAC AGGGTAATCACAAC 9a thermo_4 CcaCas13b acaccttttttaggatgctt acacctttttt GTTGGAACTGCT Thermo- 9a 7 tgtttcaggtGT aggatgcttt CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG gtttcaggt GTAATCACAAC GAGGGTAATCACAAC 9a thermo_4 CcaCas13b ctacaccttttttaggatgc ctacacctttt GTTGGAACTGCT Thermo- 9a 8 tttgtttcagGTT ttaggatgctt CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG tgtttcag GTAATCACAAC AGGGTAATCACAAC 9a thermo_4 CcaCas13b ctctacaccttttttaggat ctctacacctt GTTGGAACTGCT Thermo- 9a 9 gctttgtttcGTT ttttaggatgc CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG tttgtttc GTAATCACAAC AGGGTAATCACAAC 9a thermo_5 CcaCas13b ttctctacaccttttttagg ttctctacacc GTTGGAACTGCT Thermo- 9a 0 atgctttgttGTT ttttttaggat CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG gctttgtt GTAATCACAAC AGGGTAATCACAAC 9a thermo_5 CcaCas13b atttctctacacctttttta atttctctaca GTTGGAACTGCT Thermo- 9a 1 ggatgctttgGTT ccttttttagg CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG atgctttg GTAATCACAAC AGGGTAATCACAAC 9a thermo_5 CcaCas13b atatttctctacaccttttt atatttctcta GTTGGAACTGCT Thermo- 9a 2 taggatgcttGTT cacctttttta CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG ggatgctt GTAATCACAAC AGGGTAATCACAAC 9a thermo_5 CcaCas13b ccatatttctctacaccttt ccatatttctc GTTGGAACTGCT Thermo- 9a 3 tttaggatgcGT tacacctttttt CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG aggatgc GTAATCACAAC GAGGGTAATCACAAC 9a thermo_5 CcaCas13b gaccatatttctctacacct gaccatattt GTTGGAACTGCT Thermo- 9a 4 tttttaggatGT ctctacacctt CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG ttttaggat GTAATCACAAC GAGGGTAATCACAAC 9a thermo_5 CcaCas13b aggaccatatttctctacac aggaccatat GTTGGAACTGCT Thermo- 9a 5 cttttttaggGT ttctctacacc CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG ttttttagg GTAATCACAAC GAGGGTAATCACAAC 9a thermo_5 CcaCas13b tcaggaccatatttctctac tcaggaccat GTTGGAACTGCT Thermo- 9a 6 accttttttaGTT atttctctaca CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG cctttttta GTAATCACAAC AGGGTAATCACAAC 9a thermo_5 CcaCas13b cttcaggaccatatttctct cttcaggacc GTTGGAACTGCT Thermo- 9a 7 acacctttttGTT atatttctcta CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG caccttttt GTAATCACAAC AGGGTAATCACAAC 9a thermo_5 CcaCas13b tgcttcaggaccatatttct tgcttcagga GTTGGAACTGCT Thermo- 9a 8 ctacacctttGT ccatatttctc CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG tacaccttt GTAATCACAAC GAGGGTAATCACAAC 9a thermo_5 CcaCas13b cttgcttcaggaccatattt cttgcttcag GTTGGAACTGCT Thermo- 9a 9 ctctacacctGT gaccatattt CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG ctctacacct GTAATCACAAC GAGGGTAATCACAAC 9a thermo_6 CcaCas13b cacttgcttcaggaccatat cacttgcttc GTTGGAACTGCT Thermo- 9a 0 ttctctacacGT aggaccatat CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG ttctctacac GTAATCACAAC GAGGGTAATCACAAC 9a thermo_6 CcaCas13b tgcacttgcttcaggaccat tgcacttgctt GTTGGAACTGCT Thermo- 9a 1 atttctctacGT caggaccat CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG atttctctac GTAATCACAAC GAGGGTAATCACAAC 9a thermo_6 CcaCas13b aatgcacttgcttcaggacc aatgcacttg GTTGGAACTGCT Thermo- 9a 2 atatttctctGT cttcaggacc CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG atatttctct GTAATCACAAC GAGGGTAATCACAAC 9a thermo_6 CcaCas13b taaatgcacttgcttcagga taaatgcact GTTGGAACTGCT Thermo- 9a 3 ccatatttctGT tgcttcagga CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG GAGGGTAATCACAAC ccatatttct GTAATCACAAC 9a thermo_6 CcaCas13b cgtaaatgcacttgcttcag cgtaaatgca GTTGGAACTGCT Thermo- 9a 4 gaccatatttG cttgcttcag CTCATTTTGGAGG nuclease TTGGAACTGCTCTCATTTTG gaccatattt GTAATCACAAC GAGGGTAATCACAAC 9a thermo_6 CcaCas13b tcgtaaatgcacttgcttca tcgtaaatgc GTTGGAACTGCT Thermo- 9a 5 ggaccatattG acttgcttca CTCATTTTGGAGG nuclease TTGGAACTGCTCTCATTTTG ggaccatatt GTAATCACAAC GAGGGTAATCACAAC 9a thermo_6 CcaCas13b ttcgtaaatgcacttgcttc ttcgtaaatg GTTGGAACTGCT Thermo- 9a 6 aggaccatatG cacttgcttc CTCATTTTGGAGG nuclease TTGGAACTGCTCTCATTTTG aggaccatat GTAATCACAAC GAGGGTAATCACAAC 9a thermo_6 CcaCas13b tttcgtaaatgcacttgctt tttcgtaaatg GTTGGAACTGCT Thermo- 9a 7 caggaccataG cacttgcttc CTCATTTTGGAGG nuclease TTGGAACTGCTCTCATTTTG aggaccata GTAATCACAAC GAGGGTAATCACAAC 9a thermo_6 CcaCas13b ttttcgtaaatgcacttgct ttttcgtaaat GTTGGAACTGCT Thermo- 9a 8 tcaggaccatGT gcacttgctt CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG caggaccat GTAATCACAAC GAGGGTAATCACAAC 9a thermo_6 CcaCas13b tttttcgtaaatgcacttgc tttttcgtaaat GTTGGAACTGCT Thermo- 9a 9 ttcaggaccaGT gcacttgctt CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG caggacca GTAATCACAAC GAGGGTAATCACAAC 9a thermo_7 CcaCas13b ctttttcgtaaatgcacttg ctttttcgtaa GTTGGAACTGCT Thermo- 9a 0 cttcaggaccGT atgcacttgc CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG ttcaggacc GTAATCACAAC GAGGGTAATCACAAC 9a thermo_7 CcaCas13b tctttttcgtaaatgcactt tctttttcgtaa GTTGGAACTGCT Thermo- 9a 1 gcttcaggacGT atgcacttgc CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG ttcaggac GTAATCACAAC GAGGGTAATCACAAC 9a thermo_7 CcaCas13b atctttttcgtaaatgcact atctttttcgta GTTGGAACTGCT Thermo- 9a 2 tgcttcaggaGT aatgcacttg CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG cttcagga GTAATCACAAC GAGGGTAATCACAAC 9a thermo_7 CcaCas13b catctttttcgtaaatgcac catctttttcgt GTTGGAACTGCT Thermo- 9a 3 ttgcttcaggGT aaatgcactt CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG gcttcagg GTAATCACAAC GAGGGTAATCACAAC 9a thermo_7 CcaCas13b ccatctttttcgtaaatgca ccatctttttc GTTGGAACTGCT Thermo- 9a 4 cttgcttcagGT gtaaatgcac CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG ttgcttcag GTAATCACAAC GAGGGTAATCACAAC 9a thermo_7 CcaCas13b accatctttttcgtaaatgc accatcttttt GTTGGAACTGCT Thermo- 9a 5 acttgcttcaGT cgtaaatgca CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG cttgcttca GTAATCACAAC GAGGGTAATCACAAC 9a thermo_7 CcaCas13b taccatctttttcgtaaatg taccatcttttt GTTGGAACTGCT Thermo- 9a 6 cacttgcttcGT cgtaaatgca CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG cttgcttc GTAATCACAAC GAGGGTAATCACAAC 9a thermo_7 CcaCas13b ctaccatctttttcgtaaat ctaccatcttt GTTGGAACTGCT Thermo- 9a 7 gcacttgcttGT ttcgtaaatg CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG cacttgctt GTAATCACAAC GAGGGTAATCACAAC 9a thermo_7 CcaCas13b tctaccatctttttcgtaaa tctaccatctt GTTGGAACTGCT Thermo- 9a 8 tgcacttgctGT tttcgtaaatg CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG cacttgct GTAATCACAAC GAGGGTAATCACAAC 9a thermo_7 CcaCas13b ttctaccatctttttcgtaa ttctaccatct GTTGGAACTGCT Thermo- 9a 9 atgcacttgcGT ttttcgtaaat CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG gcacttgc GTAATCACAAC GAGGGTAATCACAAC 9a thermo_8 CcaCas13b tttctaccatctttttcgta tttctaccatc GTTGGAACTGCT Thermo- 9a 0 aatgcacttgGTT tttttcgtaaat CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG gcacttg GTAATCACAAC AGGGTAATCACAAC 9a thermo_8 CcaCas13b ttttctaccatctttttcgt ttttctaccat GTTGGAACTGCT Thermo- 9a 1 aaatgcacttGTT ctttttcgtaa CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG atgcactt GTAATCACAAC AGGGTAATCACAAC 9a thermo_8 CcaCas13b attttctaccatctttttcg attttctacca GTTGGAACTGCT Thermo- 9a 2 taaatgcactGTT tctttttcgtaa CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG atgcact GTAATCACAAC AGGGTAATCACAAC 9a thermo_8 CcaCas13b cattttctaccatctttttc cattttctacc GTTGGAACTGCT Thermo- 9a 3 gtaaatgcacGTT atctttttcgta CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG aatgcac GTAATCACAAC AGGGTAATCACAAC 9a thermo_8 CcaCas13b gcattttctaccatcttttt gcattttctac GTTGGAACTGCT Thermo- 9a 4 cgtaaatgcaGT catctttttcgt CTCATTTTGGAGG nuclease TGGAACTGCTCTCATTTTG aaatgca GTAATCACAAC GAGGGTAATCACAAC 9a thermo_8 CcaCas13b tgcattttctaccatctttt tgcattttcta GTTGGAACTGCT Thermo- 9a 5 tcgtaaatgcGTT ccatctttttc CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG gtaaatgc GTAATCACAAC AGGGTAATCACAAC 9a thermo_8 CcaCas13b ttgcattttctaccatcttt ttgcattttcta GTTGGAACTGCT Thermo- 9a 6 ttcgtaaatgGTT ccatctttttc CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG gtaaatg GTAATCACAAC AGGGTAATCACAAC 9a thermo_8 CcaCas13b tttgcattttctaccatctt tttgcattttct GTTGGAACTGCT Thermo- 9a 7 tttcgtaaatGTT accatcttttt CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG cgtaaat GTAATCACAAC AGGGTAATCACAAC 9a thermo_8 CcaCas13b ctttgcattttctaccatct ctttgcattttc GTTGGAACTGCT Thermo- 9a 8 ttttcgtaaaGTT taccatcttttt CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG cgtaaa GTAATCACAAC AGGGTAATCACAAC 9a thermo_8 CcaCas13b tctttgcattttctaccatc tctttgcatttt GTTGGAACTGCT Thermo- 9a 9 tttttcgtaaGTT ctaccatcttt CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG ttcgtaa GTAATCACAAC AGGGTAATCACAAC 9a thermo_9 CcaCas13b ttctttgcattttctaccat ttctttgcattt GTTGGAACTGCT Thermo- 9a 0 ctttttcgtaGTT tctaccatctt CTCATTTTGGAGG nuclease GGAACTGCTCTCATTTTGG tttcgta GTAATCACAAC AGGGTAATCACAAC 9a thermo_9 CcaCas13b tttctttgcattttctacca tttctttgcatt GTTGGAACTGCT Thermo- 9a 1 tctttttcgtGTTG ttctaccatct CTCATTTTGGAGG nuclease GAACTGCTCTCATTTTGGA ttttcgt GTAATCACAAC GGGTAATCACAAC 9a thermo_9 CcaCas13b ttttctttgcattttctacc ttttctttgcat GTTGGAACTGCT Thermo- 9a 2 atctttttcgGTTG tttctaccatc CTCATTTTGGAGG nuclease GAACTGCTCTCATTTTGGA tttttcg GTAATCACAAC GGGTAATCACAAC 9a thermo_9 CcaCas13b attttctttgcattttctac attttctttgca GTTGGAACTGCT Thermo- 9a 3 catctttttcGTTG ttttctaccat CTCATTTTGGAGG nuclease GAACTGCTCTCATTTTGGA ctttttc GTAATCACAAC GGGTAATCACAAC 9a thermo_9 CcaCas13b aattttctttgcattttcta aattttctttgc GTTGGAACTGCT Thermo- 9a 4 ccatctttttGTTG attttctacca CTCATTTTGGAGG nuclease GAACTGCTCTCATTTTGGA tcttttt GTAATCACAAC GGGTAATCACAAC 9a thermo_9 CcaCas13b caattttctttgcattttct caattttctttg GTTGGAACTGCT Thermo- 9a 5 accatcttttGTTG cattttctacc CTCATTTTGGAGG nuclease GAACTGCTCTCATTTTGGA atctttt GTAATCACAAC GGGTAATCACAAC 9a ssrna1_0 CcaCas13b atccccgggtaccgagctcg atccccggg GTTGGAACTGCT ssRNA1 9a aattcactgg taccgagctc CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT gaattcactg GTAATCACAAC GGAGGGTAATCACAAC g 9a ssrna1_1 CcaCas13b gatccccgggtaccgagctc gatccccgg GTTGGAACTGCT ssRNA1 9a gaattcactg gtaccgagc CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT tcgaattcac GTAATCACAAC GGAGGGTAATCACAAC tg 9a ssrna1_2 CcaCas13b ggatccccgggtaccgagct ggatccccg GTTGGAACTGCT ssRNA1 9a cgaattcact ggtaccgag CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT ctcgaattca GTAATCACAAC GGAGGGTAATCACAAC ct 9a ssrna1_3 CcaCas13b agaggatccccgggtaccga agaggatcc GTTGGAACTGCT ssRNA1 9a gctcgaattc ccgggtacc CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT gagctcgaa GTAATCACAAC GGAGGGTAATCACAAC ttc 9a ssrna1_4 CcaCas13b ctagaggatccccgggtacc ctagaggat GTTGGAACTGCT ssRNA1 9a gagctcgaat ccccgggta CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT ccgagctcg GTAATCACAAC GGAGGGTAATCACAAC aat 9a ssrna1_5 CcaCas13b tttctagaggatccccgggt tttctagagg GTTGGAACTGCT ssRNA1 9a accgagctcg atccccggg CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT taccgagctc GTAATCACAAC GGAGGGTAATCACAAC g 9a ssrna1_6 CcaCas13b atttctagaggatccccggg atttctagag GTTGGAACTGCT ssRNA1 9a taccgagctc gatccccgg CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT gtaccgagc GTAATCACAAC GGAGGGTAATCACAAC tc 9a ssrna1_7 CcaCas13b atatttctagaggatccccg atatttctaga GTTGGAACTGCT ssRNA1 9a ggtaccgagc ggatccccg CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT ggtaccgag GTAATCACAAC GGAGGGTAATCACAAC c 9a ssrna1_8 CcaCas13b catatttctagaggatcccc catatttctag GTTGGAACTGCT ssRNA1 9a gggtaccgag aggatcccc CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT gggtaccga GTAATCACAAC GGAGGGTAATCACAAC g 9a ssrna1_9 CcaCas13b atccatatttctagaggatc atccatatttc GTTGGAACTGCT ssRNA1 9a cccgggtaccG tagaggatc CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG cccgggtac GTAATCACAAC GAGGGTAATCACAAC c 9a ssrna1_10 CcaCas13b aatccatatttctagaggat aatccatattt GTTGGAACTGCT ssRNA1 9a ccccgggtacG ctagaggat CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG ccccgggta GTAATCACAAC GAGGGTAATCACAAC c 9a ssrna1_11 CcaCas13b taatccatatttctagagga taatccatatt GTTGGAACTGCT ssRNA1 9a tccccgggtaG tctagaggat CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG ccccgggta GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_12 CcaCas13b agtaatccatatttctagag agtaatccat GTTGGAACTGCT ssRNA1 9a gatccccgggG atttctagag CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG gatccccgg GTAATCACAAC GAGGGTAATCACAAC g 9a ssrna1_13 CcaCas13b aagtaatccatatttctaga aagtaatcca GTTGGAACTGCT ssRNA1 9a ggatccccggG tatttctagag CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG gatccccgg GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_14 CcaCas13b tctaccaagtaatccatatt tctaccaagt GTTGGAACTGCT ssRNA1 9a tctagaggatGT aatccatattt CTCATTTTGGAGG TGGAACTGCTCTCATTTTG ctagaggat GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_15 CcaCas13b gttctaccaagtaatccata gttctaccaa GTTGGAACTGCT ssRNA1 9a tttctagaggG gtaatccata CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG tttctagagg GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_16 CcaCas13b ctgttctaccaagtaatcca ctgttctacc GTTGGAACTGCT ssRNA1 9a tatttctagaGT aagtaatcca CTCATTTTGGAGG TGGAACTGCTCTCATTTTG tatttctaga GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_17 CcaCas13b ttgctgttctaccaagtaat ttgctgttcta GTTGGAACTGCT ssRNA1 9a ccatatttctGT ccaagtaatc CTCATTTTGGAGG TGGAACTGCTCTCATTTTG catatttct GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_18 CcaCas13b gattgctgttctaccaagta gattgctgttc GTTGGAACTGCT ssRNA1 9a atccatatttGT taccaagtaa CTCATTTTGGAGG TGGAACTGCTCTCATTTTG tccatattt GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_19 CcaCas13b agattgctgttctaccaagt agattgctgtt GTTGGAACTGCT ssRNA1 9a aatccatattGT ctaccaagta CTCATTTTGGAGG TGGAACTGCTCTCATTTTG atccatatt GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_20 CcaCas13b agtagattgctgttctacca agtagattgc GTTGGAACTGCT ssRNA1 9a agtaatccatG tgttctacca CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG agtaatccat GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_21 CcaCas13b gagtagattgctgttctacc gagtagattg GTTGGAACTGCT ssRNA1 9a aagtaatccaG ctgttctacc CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG aagtaatcca GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_22 CcaCas13b cgagtagattgctgttctac cgagtagatt GTTGGAACTGCT ssRNA1 9a caagtaatccG gctgttctac CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG caagtaatcc GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_23 CcaCas13b tcgagtagattgctgttcta tcgagtagat GTTGGAACTGCT ssRNA1 9a ccaagtaatcG tgctgttctac CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG caagtaatc GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_24 CcaCas13b ggtcgagtagattgctgttc ggtcgagta GTTGGAACTGCT ssRNA1 9a taccaagtaaG gattgctgttc CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG taccaagtaa GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_25 CcaCas13b aggtcgagtagattgctgtt aggtcgagt GTTGGAACTGCT ssRNA1 9a ctaccaagtaG agattgctgtt CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG ctaccaagta GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_26 CcaCas13b gcaggtcgagtagattgctg gcaggtcga GTTGGAACTGCT ssRNA1 9a ttctaccaagG gtagattgct CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG gttctaccaa GTAATCACAAC GAGGGTAATCACAAC g 9a ssrna1_27 CcaCas13b tgcaggtcgagtagattgct tgcaggtcg GTTGGAACTGCT ssRNA1 9a gttctaccaaG agtagattgc CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG tgttctacca GTAATCACAAC GAGGGTAATCACAAC a 9a ssrna1_28 CcaCas13b ctgcaggtcgagtagattgc ctgcaggtc GTTGGAACTGCT ssRNA1 9a tgttctaccaG gagtagattg CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG ctgttctacc GTAATCACAAC GAGGGTAATCACAAC a 9a ssrna1_29 CcaCas13b cctgcaggtcgagtagattg cctgcaggt GTTGGAACTGCT ssRNA1 9a ctgttctaccG cgagtagatt CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG gctgttctac GTAATCACAAC GAGGGTAATCACAAC c 9a ssrna1_30 CcaCas13b gcctgcaggtcgagtagatt gcctgcagg GTTGGAACTGCT ssRNA1 9a gctgttctacG tcgagtagat CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG tgctgttctac GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_31 CcaCas13b tgcctgcaggtcgagtagat tgcctgcag GTTGGAACTGCT ssRNA1 9a tgctgttctaG gtcgagtag CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG attgctgttct GTAATCACAAC GAGGGTAATCACAAC a 9a ssrna1_32 CcaCas13b catgcctgcaggtcgagtag catgcctgca GTTGGAACTGCT ssRNA1 9a attgctgttcG ggtcgagta CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG gattgctgttc GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_33 CcaCas13b gcatgcctgcaggtcgagta gcatgcctg GTTGGAACTGCT ssRNA1 9a gattgctgttG caggtcgag CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG tagattgctgt GTAATCACAAC GAGGGTAATCACAAC t 9a ssrna1_34 CcaCas13b tgcatgcctgcaggtcgagt tgcatgcctg GTTGGAACTGCT ssRNA1 9a agattgctgtG caggtcgag CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG tagattgctgt GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_35 CcaCas13b cttgcatgcctgcaggtcga cttgcatgcc GTTGGAACTGCT ssRNA1 9a gtagattgctG tgcaggtcg CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG agtagattgc GTAATCACAAC GAGGGTAATCACAAC t 9a ssrna1_36 CcaCas13b gcttgcatgcctgcaggtcg gcttgcatgc GTTGGAACTGCT ssRNA1 9a agtagattgc ctgcaggtc CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT gagtagattg GTAATCACAAC GGAGGGTAATCACAAC c 9a ssrna1_37 CcaCas13b agcttgcatgcctgcaggtc agcttgcatg GTTGGAACTGCT ssRNA1 9a gagtagattg cctgcaggt CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT cgagtagatt GTAATCACAAC GGAGGGTAATCACAAC g 9a ssrna1_38 CcaCas13b aagcttgcatgcctgcaggt aagcttgcat GTTGGAACTGCT ssRNA1 9a cgagtagattG gcctgcagg CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG tcgagtagat GTAATCACAAC GAGGGTAATCACAAC t 9a ssrna1_39 CcaCas13b caagcttgcatgcctgcagg caagcttgca GTTGGAACTGCT ssRNA1 9a tcgagtagat tgcctgcag CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT gtcgagtag GTAATCACAAC GGAGGGTAATCACAAC at 9a ssrna1_40 CcaCas13b ccaagcttgcatgcctgcag ccaagcttgc GTTGGAACTGCT ssRNA1 9a gtcgagtaga atgcctgca CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT ggtcgagta GTAATCACAAC GGAGGGTAATCACAAC ga 9a ssrna1_41 CcaCas13b gccaagcttgcatgcctgca gccaagctt GTTGGAACTGCT ssRNA1 9a ggtcgagtag gcatgcctg CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT caggtcgag GTAATCACAAC GGAGGGTAATCACAAC tag 9a ssrna1_42 CcaCas13b cgccaagcttgcatgcctgc cgccaagctt GTTGGAACTGCT ssRNA1 9a aggtcgagta gcatgcctg CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT caggtcgag GTAATCACAAC GGAGGGTAATCACAAC ta 9a ssrna1_43 CcaCas13b tacgccaagcttgcatgcct tacgccaag GTTGGAACTGCT ssRNA1 9a gcaggtcgag cttgcatgcc CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT tgcaggtcg GTAATCACAAC GGAGGGTAATCACAAC ag 9a ssrna1_44 CcaCas13b ttacgccaagcttgcatgcc ttacgccaag GTTGGAACTGCT ssRNA1 9a tgcaggtcga cttgcatgcc CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT tgcaggtcg GTAATCACAAC GGAGGGTAATCACAAC a 9a ssrna1_45 CcaCas13b attacgccaagcttgcatgc attacgccaa GTTGGAACTGCT ssRNA1 9a ctgcaggtcg gcttgcatgc CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT ctgcaggtc GTAATCACAAC GGAGGGTAATCACAAC g 9a ssrna1_46 CcaCas13b gattacgccaagcttgcatg gattacgcca GTTGGAACTGCT ssRNA1 9a cctgcaggtc agcttgcatg CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT cctgcaggt GTAATCACAAC GGAGGGTAATCACAAC c 9a ssrna1_47 CcaCas13b tgattacgccaagcttgcat tgattacgcc GTTGGAACTGCT ssRNA1 9a gcctgcaggtG aagcttgcat CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG gcctgcagg GTAATCACAAC GAGGGTAATCACAAC t 9a ssrna1_48 CcaCas13b atgattacgccaagcttgca atgattacgc GTTGGAACTGCT ssRNA1 9a tgcctgcagg caagcttgca CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT tgcctgcag GTAATCACAAC GGAGGGTAATCACAAC g 9a ssrna1_49 CcaCas13b catgattacgccaagcttgc catgattacg GTTGGAACTGCT ssRNA1 9a atgcctgcag ccaagcttgc CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT atgcctgca GTAATCACAAC GGAGGGTAATCACAAC g 9a ssrna1_50 CcaCas13b accatgattacgccaagctt accatgatta GTTGGAACTGCT ssRNA1 9a gcatgcctgcG cgccaagctt CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG gcatgcctg GTAATCACAAC GAGGGTAATCACAAC c 9a ssrna1_51 CcaCas13b gaccatgattacgccaagct gaccatgatt GTTGGAACTGCT ssRNA1 9a tgcatgcctg acgccaagc CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT ttgcatgcct GTAATCACAAC GGAGGGTAATCACAAC g 9a ssrna1_52 CcaCas13b tgaccatgattacgccaagc tgaccatgat GTTGGAACTGCT ssRNA1 9a ttgcatgcctG tacgccaag CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG cttgcatgcc GTAATCACAAC GAGGGTAATCACAAC t 9a ssrna1_53 CcaCas13b atgaccatgattacgccaag atgaccatga GTTGGAACTGCT ssRNA1 9a cttgcatgccG ttacgccaag CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG cttgcatgcc GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_54 CcaCas13b ctatgaccatgattacgcca ctatgaccat GTTGGAACTGCT ssRNA1 9a agcttgcatgG gattacgcca CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG agcttgcatg GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_55 CcaCas13b gctatgaccatgattacgcc gctatgacca GTTGGAACTGCT ssRNA1 9a aagcttgcatG tgattacgcc CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG aagcttgcat GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_56 CcaCas13b acagctatgaccatgattac acagctatga GTTGGAACTGCT ssRNA1 9a gccaagcttgG ccatgattac CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG gccaagctt GTAATCACAAC GAGGGTAATCACAAC g 9a ssrna1_57 CcaCas13b aacagctatgaccatgatta aacagctatg GTTGGAACTGCT ssRNA1 9a cgccaagcttG accatgatta CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG cgccaagctt GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_58 CcaCas13b aaacagctatgaccatgatt aaacagctat GTTGGAACTGCT ssRNA1 9a acgccaagct gaccatgatt CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT acgccaagc GTAATCACAAC GGAGGGTAATCACAAC t 9a ssrna1_59 CcaCas13b gaaacagctatgaccatgat gaaacagct GTTGGAACTGCT ssRNA1 9a tacgccaagc atgaccatga CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT ttacgccaag GTAATCACAAC GGAGGGTAATCACAAC c 9a ssrna1_60 CcaCas13b caggaaacagctatgaccat caggaaaca GTTGGAACTGCT ssRNA1 9a gattacgcca gctatgacca CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT tgattacgcc GTAATCACAAC GGAGGGTAATCACAAC a 9a ssrna1_61 CcaCas13b acaggaaacagctatgacca acaggaaac GTTGGAACTGCT ssRNA1 9a tgattacgcc agctatgacc CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT atgattacgc GTAATCACAAC GGAGGGTAATCACAAC c 9a ssrna1_62 CcaCas13b cacaggaaacagctatgacc cacaggaaa GTTGGAACTGCT ssRNA1 9a atgattacgc cagctatgac CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT catgattacg GTAATCACAAC GGAGGGTAATCACAAC c 9a ssrna1_63 CcaCas13b taaacacaggaaacagctat taaacacag GTTGGAACTGCT ssRNA1 9a gaccatgatt gaaacagct CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT atgaccatga GTAATCACAAC GGAGGGTAATCACAAC tt 9a ssrna1_64 CcaCas13b gataaacacaggaaacagct gataaacac GTTGGAACTGCT ssRNA1 9a atgaccatga aggaaacag CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT ctatgaccat GTAATCACAAC GGAGGGTAATCACAAC ga 9a ssrna1_65 CcaCas13b ggataaacacaggaaacagc ggataaaca GTTGGAACTGCT ssRNA1 9a tatgaccatg caggaaaca CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT gctatgacca GTAATCACAAC GGAGGGTAATCACAAC tg 9a ssrna1_66 CcaCas13b cggataaacacaggaaacag cggataaac GTTGGAACTGCT ssRNA1 9a ctatgaccat acaggaaac CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT agctatgacc GTAATCACAAC GGAGGGTAATCACAAC at 9a ssrna1_67 CcaCas13b gcggataaacacaggaaaca gcggataaa GTTGGAACTGCT ssRNA1 9a gctatgacca cacaggaaa CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT cagctatgac GTAATCACAAC GGAGGGTAATCACAAC ca 9a ssrna1_68 CcaCas13b agcggataaacacaggaaac agcggataa GTTGGAACTGCT ssRNA1 9a agctatgacc acacaggaa CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT acagctatga GTAATCACAAC GGAGGGTAATCACAAC cc 9a ssrna1_69 CcaCas13b gagcggataaacacaggaaa gagcggata GTTGGAACTGCT ssRNA1 9a cagctatga aacacagga CTCATTTTGGAGG cGTTGGAACTGCTCTCATTT aacagctatg GTAATCACAAC TGGAGGGTAATCACAAC ac 9a ssrna1_70 CcaCas13b tgagcggataaacacaggaa tgagcggat GTTGGAACTGCT ssRNA1 9a acagctatga aaacacagg CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT aaacagctat GTAATCACAAC GGAGGGTAATCACAAC ga 9a ssrna1_71 CcaCas13b tgtgagcggataaacacagg tgtgagcgg GTTGGAACTGCT ssRNA1 9a aaacagctat ataaacaca CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT ggaaacagc GTAATCACAAC GGAGGGTAATCACAAC tat 9a ssrna1_72 CcaCas13b attgtgagcggataaacaca attgtgagcg GTTGGAACTGCT ssRNA1 9a ggaaacagct gataaacac CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT aggaaacag GTAATCACAAC GGAGGGTAATCACAAC ct 9a ssrna1_73 CcaCas13b aattgtgagcggataaacac aattgtgagc GTTGGAACTGCT ssRNA1 9a aggaaacagc ggataaaca CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT caggaaaca GTAATCACAAC GGAGGGTAATCACAAC gc 9a ssrna1_74 CcaCas13b gaattgtgagcggataaaca gaattgtgag GTTGGAACTGCT ssRNA1 9a caggaaacag cggataaac CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT acaggaaac GTAATCACAAC GGAGGGTAATCACAAC ag 9a ssrna1_75 CcaCas13b gtggaattgtgagcggataa gtggaattgt GTTGGAACTGCT ssRNA1 9a acacaggaaa gagcggata CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT aacacagga GTAATCACAAC GGAGGGTAATCACAAC aa 9a ssrna1_76 CcaCas13b tgtggaattgtgagcggata tgtggaattg GTTGGAACTGCT ssRNA1 9a aacacaggaa tgagcggat CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT aaacacagg GTAATCACAAC GGAGGGTAATCACAAC aa 9a ssrna1_77 CcaCas13b gtgtggaattgtgagcggat gtgtggaatt GTTGGAACTGCT ssRNA1 9a aaacacagga gtgagcgga CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT taaacacag GTAATCACAAC GGAGGGTAATCACAAC ga 9a ssrna1_78 CcaCas13b tgtgtggaattgtgagcgga tgtgtggaat GTTGGAACTGCT ssRNA1 9a taaacacagg tgtgagcgg CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT ataaacaca GTAATCACAAC GGAGGGTAATCACAAC gg 9a ssrna1_79 CcaCas13b gttgtgtggaattgtgagcg gttgtgtgga GTTGGAACTGCT ssRNA1 9a gataaacaca attgtgagcg CTCATTTTGGAGG GTTGGAACTGCTCTCATTTT gataaacac GTAATCACAAC GGAGGGTAATCACAAC a 9a ssrna1_80 CcaCas13b tgttgtgtggaattgtgagc tgttgtgtgg GTTGGAACTGCT ssRNA1 9a ggataaacacG aattgtgagc CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG ggataaaca GTAATCACAAC GAGGGTAATCACAAC c 9a ssrna1_81 CcaCas13b atgttgtgtggaattgtgag atgttgtgtg GTTGGAACTGCT ssRNA1 9a cggataaacaG gaattgtgag CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG cggataaac GTAATCACAAC GAGGGTAATCACAAC a 9a ssrna1_82 CcaCas13b gtatgttgtgtggaattgtg gtatgttgtgt GTTGGAACTGCT ssRNA1 9a agcggataaaG ggaattgtga CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG gcggataaa GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_83 CcaCas13b cgtatgttgtgtggaattgt cgtatgttgt GTTGGAACTGCT ssRNA1 9a gagcggataaG gtggaattgt CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG gagcggata GTAATCACAAC GAGGGTAATCACAAC a 9a ssrna1_84 CcaCas13b tcgtatgttgtgtggaattg tcgtatgttgt GTTGGAACTGCT ssRNA1 9a tgagcggataG gtggaattgt CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG gagcggata GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_85 CcaCas13b gctcgtatgttgtgtggaat gctcgtatgtt GTTGGAACTGCT ssRNA1 9a tgtgagcggaG gtgtggaatt CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG gtgagcgga GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_86 CcaCas13b ggctcgtatgttgtgtggaa ggctcgtatg GTTGGAACTGCT ssRNA1 9a ttgtgagcggG ttgtgtggaa CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG ttgtgagcgg GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_87 CcaCas13b ccggctcgtatgttgtgtgg ccggctcgt GTTGGAACTGCT ssRNA1 9a aattgtgagcG atgttgtgtg CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG gaattgtgag GTAATCACAAC GAGGGTAATCACAAC c 9a ssrna1_88 CcaCas13b tccggctcgtatgttgtgtg tccggctcgt GTTGGAACTGCT ssRNA1 9a gaattgtgagG atgttgtgtg CTCATTTTGGAGG TTGGAACTGCTCTCATTTTG gaattgtgag GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_89 CcaCas13b ttccggctcgtatgttgtgt ttccggctcg GTTGGAACTGCT ssRNA1 9a ggaattgtgaGT tatgttgtgtg CTCATTTTGGAGG TGGAACTGCTCTCATTTTG gaattgtga GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_90 CcaCas13b gcttccggctcgtatgttgt gcttccggct GTTGGAACTGCT ssRNA1 9a gtggaattgtGT cgtatgttgt CTCATTTTGGAGG TGGAACTGCTCTCATTTTG gtggaattgt GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_91 CcaCas13b tgcttccggctcgtatgttg tgcttccggc GTTGGAACTGCT ssRNA1 9a tgtggaattgGT tcgtatgttgt CTCATTTTGGAGG TGGAACTGCTCTCATTTTG gtggaattg GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_92 CcaCas13b atgcttccggctcgtatgtt atgcttccgg GTTGGAACTGCT ssRNA1 9a gtgtggaattGT ctcgtatgttg CTCATTTTGGAGG TGGAACTGCTCTCATTTTG tgtggaatt GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_93 CcaCas13b ttatgcttccggctcgtatg ttatgcttccg GTTGGAACTGCT ssRNA1 9a ttgtgtggaaGT gctcgtatgtt CTCATTTTGGAGG TGGAACTGCTCTCATTTTG gtgtggaa GTAATCACAAC GAGGGTAATCACAAC 9a ssrna1_94 CcaCas13b tttatgcttccggctcgtat tttatgcttcc GTTGGAACTGCT ssRNA1 9a gttgtgtggaGT ggctcgtatg CTCATTTTGGAGG TGGAACTGCTCTCATTTTG ttgtgtgga GTAATCACAAC GAGGGTAATCACAAC 11b ebola_0 CcaCas13b aactgtgaaagacaactctt aactgtgaaa GTTGGAACTGCT Ebola 11b cactgcgaatG gacaactctt CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG cactgcgaat GTAATCACAAC GAGGGTAATCACAAC 11b ebola_1 CcaCas13b caactgtgaaagacaactct caactgtgaa GTTGGAACTGCT Ebola 11b tcactgcgaa agacaactct CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT tcactgcgaa GTAATCACAAC GGAGGGTAATCACAAC 11b ebola_2 CcaCas13b acaactgtgaaagacaactc acaactgtga GTTGGAACTGCT Ebola 11b ttcactgcga aagacaact CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT cttcactgcg GTAATCACAAC GGAGGGTAATCACAAC a 11b ebola_3 CcaCas13b atacaactgtgaaagacaac atacaactgt GTTGGAACTGCT Ebola 11b tcttcactgcG gaaagacaa CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ctcttcactg GTAATCACAAC GAGGGTAATCACAAC c 11b ebola_4 CcaCas13b gatacaactgtgaaagacaa gatacaactg GTTGGAACTGCT Ebola 11b ctcttcactgG tgaaagaca CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG actcttcact GTAATCACAAC GAGGGTAATCACAAC g 11b ebola_5 CcaCas13b ttgatacaactgtgaaagac ttgatacaac GTTGGAACTGCT Ebola 11b aactcttcacG tgtgaaaga CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG caactcttca GTAATCACAAC GAGGGTAATCACAAC c 11b ebola_6 CcaCas13b tttgatacaactgtgaaaga tttgatacaa GTTGGAACTGCT Ebola 11b caactcttcaG ctgtgaaag CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG acaactcttc GTAATCACAAC GAGGGTAATCACAAC a 11b ebola_7 CcaCas13b cgtttgatacaactgtgaaa cgtttgatac GTTGGAACTGCT Ebola 11b gacaactcttG aactgtgaaa CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gacaactctt GTAATCACAAC GAGGGTAATCACAAC 11b ebola_8 CcaCas13b ccgtttgatacaactgtgaa ccgtttgata GTTGGAACTGCT Ebola 11b agacaactctG caactgtgaa CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG agacaactct GTAATCACAAC GAGGGTAATCACAAC 11b ebola_9 CcaCas13b ctccgtttgatacaactgtg ctccgtttgat GTTGGAACTGCT Ebola 11b aaagacaactG acaactgtga CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG aagacaact GTAATCACAAC GAGGGTAATCACAAC 11b ebola_10 CcaCas13b gctccgtttgatacaactgt gctccgtttg GTTGGAACTGCT Ebola 11b gaaagacaacG atacaactgt CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gaaagacaa GTAATCACAAC GAGGGTAATCACAAC c 11b ebola_11 CcaCas13b tggctccgtttgatacaact tggctccgttt GTTGGAACTGCT Ebola 11b gtgaaagacaG gatacaactg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG tgaaagaca GTAATCACAAC GAGGGTAATCACAAC 11b ebola_12 CcaCas13b ttggctccgtttgatacaac ttggctccgtt GTTGGAACTGCT Ebola 11b tgtgaaagacG tgatacaact CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gtgaaagac GTAATCACAAC GAGGGTAATCACAAC 11b ebola_13 CcaCas13b tttggctccgtttgatacaa tttggctccgt GTTGGAACTGCT Ebola 11b ctgtgaaagaG ttgatacaac CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG tgtgaaaga GTAATCACAAC GAGGGTAATCACAAC 11b ebola_14 CcaCas13b tttttggctccgtttgatac tttttggctcc GTTGGAACTGCT Ebola 11b aactgtgaaaGT gtttgataca CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG actgtgaaa GTAATCACAAC GAGGGTAATCACAAC 11b ebola_15 CcaCas13b gatgtttttggctccgtttg gatgtttttgg GTTGGAACTGCT Ebola 11b atacaactgtGT ctccgtttgat CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG acaactgt GTAATCACAAC GAGGGTAATCACAAC 11b ebola_16 CcaCas13b tgatgtttttggctccgttt tgatgtttttg GTTGGAACTGCT Ebola 11b gatacaactgGT gctccgtttg CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG atacaactg GTAATCACAAC GAGGGTAATCACAAC 11b ebola_17 CcaCas13b ctgatgtttttggctccgtt ctgatgttttt GTTGGAACTGCT Ebola 11b tgatacaactGT ggctccgttt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gatacaact GTAATCACAAC GAGGGTAATCACAAC 11b ebola_18 CcaCas13b actgatgtttttggctccgt actgatgtttt GTTGGAACTGCT Ebola 11b ttgatacaacGT tggctccgttt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gatacaac GTAATCACAAC GAGGGTAATCACAAC 11b ebola_19 CcaCas13b gaccactgatgtttttggct gaccactgat GTTGGAACTGCT Ebola 11b ccgtttgataGT gtttttggctc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG cgtttgata GTAATCACAAC GAGGGTAATCACAAC 11b ebola_20 CcaCas13b tgaccactgatgtttttggc tgaccactga GTTGGAACTGCT Ebola 11b tccgtttgatGT tgtttttggct CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ccgtttgat GTAATCACAAC GAGGGTAATCACAAC 11b ebola_21 CcaCas13b ctgaccactgatgtttttgg ctgaccactg GTTGGAACTGCT Ebola 11b ctccgtttgaGT atgtttttggc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tccgtttga GTAATCACAAC GAGGGTAATCACAAC 11b ebola_22 CcaCas13b ctctgaccactgatgttttt ctctgaccac GTTGGAACTGCT Ebola 11b ggctccgtttGT tgatgtttttg CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gctccgttt GTAATCACAAC GAGGGTAATCACAAC 11b ebola_23 CcaCas13b actctgaccactgatgtt actctgacca GTTGGAACTGCT Ebola 11b tttggctccgttGT ctgatgttttt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ggctccgtt GTAATCACAAC GAGGGTAATCACAAC 11b ebola_24 CcaCas13b gactctgaccactgatgttt gactctgacc GTTGGAACTGCT Ebola 11b ttggctccgtGT actgatgtttt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tggctccgt GTAATCACAAC GAGGGTAATCACAAC 11b ebola_25 CcaCas13b cggactctgaccactgatgt cggactctg GTTGGAACTGCT Ebola 11b ttttggctccG accactgatg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG tttttggctcc GTAATCACAAC GAGGGTAATCACAAC 11b ebola_26 CcaCas13b gccggactctgaccactgat gccggactc GTTGGAACTGCT Ebola 11b gtttttggctG tgaccactga CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG tgtttttggct GTAATCACAAC GAGGGTAATCACAAC 11b ebola_27 CcaCas13b cgccggactctgaccactga cgccggact GTTGGAACTGCT Ebola 11b tgtttttggcG ctgaccactg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG atgtttttggc GTAATCACAAC GAGGGTAATCACAAC 11b ebola_28 CcaCas13b gcgccggactctgaccactg gcgccggac GTTGGAACTGCT Ebola 11b atgtttttggG tctgaccact CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gatgtttttgg GTAATCACAAC GAGGGTAATCACAAC 11b ebola_29 CcaCas13b cgcgccggactctgaccact cgcgccgga GTTGGAACTGCT Ebola 11b gatgtttttgG ctctgaccac CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG tgatgtttttg GTAATCACAAC GAGGGTAATCACAAC 11b ebola_30 CcaCas13b ttcgcgccggactctgacca ttcgcgccg GTTGGAACTGCT Ebola 11b ctgatgttttG gactctgacc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG actgatgtttt GTAATCACAAC GAGGGTAATCACAAC 11b ebola_31 CcaCas13b agttcgcgccggactctgac agttcgcgc GTTGGAACTGCT Ebola 11b cactgatgttG cggactctg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG accactgatg GTAATCACAAC GAGGGTAATCACAAC tt 11b ebola_32 CcaCas13b aagttcgcgccggactctga aagttcgcg GTTGGAACTGCT Ebola 11b ccactgatgt ccggactct CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT gaccactgat GTAATCACAAC GGAGGGTAATCACAAC gt 11b ebola_33 CcaCas13b gaagttcgcgccggactctg gaagttcgc GTTGGAACTGCT Ebola 11b accactgatg gccggactc CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT tgaccactga GTAATCACAAC GGAGGGTAATCACAAC tg 11b ebola_34 CcaCas13b agaagttcgcgccggactct agaagttcg GTTGGAACTGCT Ebola 11b gaccactgat cgccggact CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT ctgaccactg GTAATCACAAC GGAGGGTAATCACAAC at 11b ebola_35 CcaCas13b gaagaagttcgcgccggact gaagaagtt GTTGGAACTGCT Ebola 11b ctgaccactg cgcgccgga CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT ctctgaccac GTAATCACAAC GGAGGGTAATCACAAC tg 11b ebola_36 CcaCas13b ggaagaagttcgcgccggac ggaagaagt GTTGGAACTGCT Ebola 11b tctgaccact tcgcgccgg CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT actctgacca GTAATCACAAC GGAGGGTAATCACAAC ct 11b ebola_37 CcaCas13b tcggaagaagttcgcgccgg tcggaagaa GTTGGAACTGCT Ebola 11b actctgacca gttcgcgcc CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT ggactctga GTAATCACAAC GGAGGGTAATCACAAC cca 11b ebola_38 CcaCas13b gtcggaagaagttcgcgccg gtcggaaga GTTGGAACTGCT Ebola 11b gactctgacc agttcgcgc CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT cggactctg GTAATCACAAC GGAGGGTAATCACAAC acc 11b ebola_39 CcaCas13b ggtcggaagaagttcgcgcc ggtcggaag GTTGGAACTGCT Ebola 11b ggactctgac aagttcgcg CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT ccggactct GTAATCACAAC GGAGGGTAATCACAAC gac 11b ebola_40 CcaCas13b gggtcggaagaagttcgcgc gggtcggaa GTTGGAACTGCT Ebola 11b cggactctga gaagttcgc CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT gccggactc GTAATCACAAC GGAGGGTAATCACAAC tga 11b ebola_41 CcaCas13b tgggtcggaagaagttcgcg tgggtcgga GTTGGAACTGCT Ebola 11b ccggactctg agaagttcg CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT cgccggact GTAATCACAAC GGAGGGTAATCACAAC ctg 11b ebola_42 CcaCas13b ccctgggtcggaagaagttc ccctgggtc GTTGGAACTGCT Ebola 11b gcgccggact ggaagaagt CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT tcgcgccgg GTAATCACAAC GGAGGGTAATCACAAC act 11b ebola_43 CcaCas13b tccctgggtcggaagaagtt tccctgggtc GTTGGAACTGCT Ebola 11b cgcgccggac ggaagaagt CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT tcgcgccgg GTAATCACAAC GGAGGGTAATCACAAC ac 11b ebola_44 CcaCas13b gtccctgggtcggaagaagt gtccctgggt GTTGGAACTGCT Ebola 11b tcgcgccgga cggaagaag CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT ttcgcgccg GTAATCACAAC GGAGGGTAATCACAAC ga 11b ebola_45 CcaCas13b ggtccctgggtcggaagaag ggtccctgg GTTGGAACTGCT Ebola 11b ttcgcgccgg gtcggaaga CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT agttcgcgc GTAATCACAAC GGAGGGTAATCACAAC cgg 11b ebola_46 CcaCas13b tggtccctgggtcggaagaa tggtccctgg GTTGGAACTGCT Ebola 11b gttcgcgccg gtcggaaga CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT agttcgcgc GTAATCACAAC GGAGGGTAATCACAAC cg 11b ebola_47 CcaCas13b ttggtccctgggtcggaaga ttggtccctg GTTGGAACTGCT Ebola 11b agttcgcgcc ggtcggaag CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT aagttcgcg GTAATCACAAC GGAGGGTAATCACAAC cc 11b ebola_48 CcaCas13b gtgttggtccctgggtcgga gtgttggtcc GTTGGAACTGCT Ebola 11b agaagttcgc ctgggtcgg CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT aagaagttc GTAATCACAAC GGAGGGTAATCACAAC gc 11b ebola_49 CcaCas13b tgtgttggtccctgggtcgg tgtgttggtc GTTGGAACTGCT Ebola 11b aagaagttcgG cctgggtcg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gaagaagtt GTAATCACAAC GAGGGTAATCACAAC cg 11b ebola_50 CcaCas13b ttgtgttggtccctgggtcg ttgtgttggtc GTTGGAACTGCT Ebola 11b gaagaagttcG cctgggtcg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gaagaagtt GTAATCACAAC GAGGGTAATCACAAC c 11b ebola_51 CcaCas13b tgttgtgttggtccctgggt tgttgtgttgg GTTGGAACTGCT Ebola 11b cggaagaagtG tccctgggtc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ggaagaagt GTAATCACAAC GAGGGTAATCACAAC 11b ebola_52 CcaCas13b ttgttgtgttggtccctggg ttgttgtgttg GTTGGAACTGCT Ebola 11b tcggaagaagG gtccctgggt CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG cggaagaag GTAATCACAAC GAGGGTAATCACAAC 11b ebola_53 CcaCas13b gttgttgtgttggtccctgg gttgttgtgtt GTTGGAACTGCT Ebola 11b gtcggaagaaG ggtccctgg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gtcggaaga GTAATCACAAC GAGGGTAATCACAAC a 11b ebola_54 CcaCas13b tcagttgttgtgttggtccc tcagttgttgt GTTGGAACTGCT Ebola 11b tgggtcggaaG gttggtccct CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gggtcggaa GTAATCACAAC GAGGGTAATCACAAC 11b ebola_55 CcaCas13b ttcagttgttgtgttggtcc ttcagttgttg GTTGGAACTGCT Ebola 11b ctgggtcggaG tgttggtccct CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gggtcgga GTAATCACAAC GAGGGTAATCACAAC 11b ebola_56 CcaCas13b cttcagttgttgtgttggtc cttcagttgtt GTTGGAACTGCT Ebola 11b cctgggtcggG gtgttggtcc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ctgggtcgg GTAATCACAAC GAGGGTAATCACAAC 11b ebola_57 CcaCas13b tcttcagttgttgtgttggt tcttcagttgt GTTGGAACTGCT Ebola 11b ccctgggtcgGT tgtgttggtc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG cctgggtcg GTAATCACAAC GAGGGTAATCACAAC 11b ebola_58 CcaCas13b gtcttcagttgttgtgttgg gtcttcagttg GTTGGAACTGCT Ebola 11b tccctgggtcGT ttgtgttggtc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG cctgggtc GTAATCACAAC GAGGGTAATCACAAC 11b ebola_59 CcaCas13b ggtcttcagttgttgtgttg ggtcttcagtt GTTGGAACTGCT Ebola 11b gtccctgggtGT gttgtgttggt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ccctgggt GTAATCACAAC GAGGGTAATCACAAC 11b ebola_60 CcaCas13b tgtggtcttcagttgttgtg tgtggtcttca GTTGGAACTGCT Ebola 11b ttggtccctgGT gttgttgtgtt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ggtccctg GTAATCACAAC GAGGGTAATCACAAC 11b ebola_61 CcaCas13b ttgtggtcttcagttgttgt ttgtggtcttc GTTGGAACTGCT Ebola 11b gttggtccctGT agttgttgtgt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tggtccct GTAATCACAAC GAGGGTAATCACAAC 11b ebola_62 CcaCas13b tttgtggtcttcagttgttg tttgtggtctt GTTGGAACTGCT Ebola 11b tgttggtcccGT cagttgttgt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gttggtccc GTAATCACAAC GAGGGTAATCACAAC 11b ebola_63 CcaCas13b ttttgtggtcttcagttgtt ttttgtggtctt GTTGGAACTGCT Ebola 11b gtgttggtccGTT cagttgttgt CTCATTTTGGAGG ssRNA GGAACTGCTCTCATTTTGG gttggtcc GTAATCACAAC AGGGTAATCACAAC 11b ebola_64 CcaCas13b gattttgtggtcttcagttg gattttgtggt GTTGGAACTGCT Ebola 11b ttgtgttggtGTT cttcagttgtt CTCATTTTGGAGG ssRNA GGAACTGCTCTCATTTTGG gtgttggt GTAATCACAAC AGGGTAATCACAAC 11b ebola_65 CcaCas13b tgattttgtggtcttcagtt tgattttgtgg GTTGGAACTGCT Ebola 11b gttgtgttggGTT tcttcagttgt CTCATTTTGGAGG ssRNA GGAACTGCTCTCATTTTGG tgtgttgg GTAATCACAAC AGGGTAATCACAAC 11b ebola_66 CcaCas13b atgattttgtggtcttcagt atgattttgtg GTTGGAACTGCT Ebola 11b tgttgtgttgGTT gtcttcagttg CTCATTTTGGAGG ssRNA GGAACTGCTCTCATTTTGG ttgtgttg GTAATCACAAC AGGGTAATCACAAC 11b ebola_67 CcaCas13b ccatgattttgtggtcttca ccatgattttg GTTGGAACTGCT Ebola 11b gttgttgtgtGTT tggtcttcagt CTCATTTTGGAGG ssRNA GGAACTGCTCTCATTTTGG tgttgtgt GTAATCACAAC AGGGTAATCACAAC 11b ebola_68 CcaCas13b agccatgattttgtggtctt agccatgatt GTTGGAACTGCT Ebola 11b cagttgttgtGT ttgtggtcttc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG agttgttgt GTAATCACAAC GAGGGTAATCACAAC 11b ebola_69 CcaCas13b aagccatgattttgtggtct aagccatgat GTTGGAACTGCT Ebola 11b tcagttgttgGT tttgtggtctt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG cagttgttg GTAATCACAAC GAGGGTAATCACAAC 11b ebola_70 CcaCas13b gaagccatgattttgtggtc gaagccatg GTTGGAACTGCT Ebola 11b ttcagttgttGT attttgtggtc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ttcagttgtt GTAATCACAAC GAGGGTAATCACAAC 11b ebola_71 CcaCas13b tgaagccatgattttgtggt tgaagccat GTTGGAACTGCT Ebola 11b cttcagttgtGT gattttgtggt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG cttcagttgt GTAATCACAAC GAGGGTAATCACAAC 11b ebola_72 CcaCas13b ttctgaagccatgattttgt ttctgaagcc GTTGGAACTGCT Ebola 11b ggtcttcagtGT atgattttgtg CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gtcttcagt GTAATCACAAC GAGGGTAATCACAAC 11b ebola_73 CcaCas13b tttctgaagccatgattttg tttctgaagc GTTGGAACTGCT Ebola 11b tggtcttcagGT catgattttgt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ggtcttcag GTAATCACAAC GAGGGTAATCACAAC 11b ebola_74 CcaCas13b attttctgaagccatgattt attttctgaag GTTGGAACTGCT Ebola 11b tgtggtcttcGT ccatgattttg CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG tggtcttc GTAATCACAAC GAGGGTAATCACAAC 11b ebola_75 CcaCas13b aattttctgaagccatgatt aattttctgaa GTTGGAACTGCT Ebola 11b ttgtggtcttGT gccatgatttt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG gtggtctt GTAATCACAAC GAGGGTAATCACAAC 11b ebola_76 CcaCas13b gaattttctgaagccatgat gaattttctga GTTGGAACTGCT Ebola 11b tttgtggtctGT agccatgatt CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ttgtggtct GTAATCACAAC GAGGGTAATCACAAC 11b ebola_77 CcaCas13b aggaattttctgaagccatg aggaattttct GTTGGAACTGCT Ebola 11b attttgtggtGT gaagccatg CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG attttgtggt GTAATCACAAC GAGGGTAATCACAAC 11b ebola_78 CcaCas13b agaggaattttctgaagcca agaggaattt GTTGGAACTGCT Ebola 11b tgattttgtgG tctgaagcca CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG tgattttgtg GTAATCACAAC GAGGGTAATCACAAC 11b ebola_79 CcaCas13b cagaggaattttctgaagcc cagaggaat GTTGGAACTGCT Ebola 11b atgattttgtGT tttctgaagc CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG catgattttgt GTAATCACAAC GAGGGTAATCACAAC 11b ebola_80 CcaCas13b gcagaggaattttctgaagc gcagaggaa GTTGGAACTGCT Ebola 11b catgattttgG ttttctgaagc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG catgattttg GTAATCACAAC GAGGGTAATCACAAC 11b ebola_81 CcaCas13b tgcagaggaattttctgaag tgcagagga GTTGGAACTGCT Ebola 11b ccatgattttGT attttctgaag CTCATTTTGGAGG ssRNA TGGAACTGCTCTCATTTTG ccatgatttt GTAATCACAAC GAGGGTAATCACAAC 11b ebola_82 CcaCas13b cattgcagaggaattttctg cattgcaga GTTGGAACTGCT Ebola 11b aagccatgatG ggaattttctg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG aagccatgat GTAATCACAAC GAGGGTAATCACAAC 11b ebola_83 CcaCas13b ccattgcagaggaattttct ccattgcaga GTTGGAACTGCT Ebola 11b gaagccatgaG ggaattttctg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG aagccatga GTAATCACAAC GAGGGTAATCACAAC 11b ebola_84 CcaCas13b accattgcagaggaattttc accattgcag GTTGGAACTGCT Ebola 11b tgaagccatgG aggaattttct CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gaagccatg GTAATCACAAC GAGGGTAATCACAAC 11b ebola_85 CcaCas13b aaccattgcagaggaatttt aaccattgca GTTGGAACTGCT Ebola 11b ctgaagccatG gaggaatttt CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ctgaagccat GTAATCACAAC GAGGGTAATCACAAC 11b ebola_86 CcaCas13b ttgaaccattgcagaggaat ttgaaccatt GTTGGAACTGCT Ebola 11b tttctgaagcG gcagaggaa CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ttttctgaagc GTAATCACAAC GAGGGTAATCACAAC 11b ebola_87 CcaCas13b acttgaaccattgcagagga acttgaacca GTTGGAACTGCT Ebola 11b attttctgaaG ttgcagagg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG aattttctgaa GTAATCACAAC GAGGGTAATCACAAC 1b ebola_88 CcaCas13b cacttgaaccattgcagagg cacttgaacc GTTGGAACTGCT Ebola 11b aattttctgaG attgcagag CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG gaattttctga GTAATCACAAC GAGGGTAATCACAAC 11b ebola_89 CcaCas13b tgcacttgaaccattgcaga tgcacttgaa GTTGGAACTGCT Ebola 11b ggaattttctG ccattgcaga CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ggaattttct GTAATCACAAC GAGGGTAATCACAAC 11b ebola_90 CcaCas13b gtgcacttgaaccattgcag gtgcacttga GTTGGAACTGCT Ebola 11b aggaattttcG accattgcag CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG aggaattttc GTAATCACAAC GAGGGTAATCACAAC 11b ebola_91 CcaCas13b ctgtgcacttgaaccattgc ctgtgcactt GTTGGAACTGCT Ebola 11b agaggaatttG gaaccattgc CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG agaggaattt GTAATCACAAC GAGGGTAATCACAAC 11b ebola_92 CcaCas13b actgtgcacttgaaccattg actgtgcact GTTGGAACTGCT Ebola 11b cagaggaattG tgaaccattg CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG cagaggaat GTAATCACAAC GAGGGTAATCACAAC t 11b ebola_93 CcaCas13b tgactgtgcacttgaaccat tgactgtgca GTTGGAACTGCT Ebola 11b tgcagaggaa cttgaaccat CTCATTTTGGAGG ssRNA GTTGGAACTGCTCTCATTTT tgcagagga GTAATCACAAC GGAGGGTAATCACAAC a 11b ebola_94 CcaCas13b ttgactgtgcacttgaacca ttgactgtgc GTTGGAACTGCT Ebola 11b ttgcagaggaG acttgaacca CTCATTTTGGAGG ssRNA TTGGAACTGCTCTCATTTTG ttgcagagg GTAATCACAAC GAGGGTAATCACAAC a 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA TATCAA GATTTAGACTAC thermonu- 6a nuclease ACGAAGGGGACTAAAACT CCAATA CCCAAAAACGAA clease validation ATCAACCAATAATAGTCTG ATAGTC GGGGACTAAAAC LwaCas13 AATGTCAT TGAATG a 1 TCAT 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA ATGTCA GATTTAGACTAC thermonu- 6a nuclease ACGAAGGGGACTAAAACA TTGGTT CCCAAAAACGAA clease validation TGTCATTGGTTGACCTTTGT GACCTT GGGGACTAAAAC LwaCas13 ACATTAA TGTACA a 2 TTAA 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA TTAGGA GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACTT TGCTTT CCCAAAAACGAA nuclease validation AGGATGCTTTGTTTCAGGT GTTTCA GGGGACTAAAAC LwaCas13 GTATCAA GGTGTA a 3 TCAA 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA TTTCTC GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACTT TACACC CCCAAAAACGAA nuclease validation TCTCTACACCTTTTTTAGGA TTTTTT GGGGACTAAAAC LwaCas13 TGCTTT AGGATG a 4 CTTT 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA TGTCAT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACT TGGTTG CCCAAAAACGAA nuclease validation GTCATTGGTTGACCTTTGT ACCTTT GGGGACTAAAAC LwaCas13 ACATTAAT GTACAT a 5 TAAT 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA ATAGTC GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACA TGAATG CCCAAAAACGAA nuclease validation TAGTCTGAATGTCATTGGT TCATTG GGGGACTAAAAC LwaCas13 TGACCTTT GTTGAC a 6 CTTT 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA AGTCTG GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACA AATGTC CCCAAAAACGAA nuclease validation GTCTGAATGTCATTGGTTG ATTGGT GGGGACTAAAAC LwaCas13 ACCTTTGT TGACCT a 7 TTGT 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA TACATT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACT AATTTA CCCAAAAACGAA nuclease validation ACATTAATTTAACAGTATC ACAGTA GGGGACTAAAAC LwaCas13 ACCATCAA TCACCA a 8 TCAA 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA ATGCTT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACA TGTTTC CCCAAAAACGAA nuclease validation TGCTTTGTTTCAGGTGTATC AGGTGT GGGGACTAAAAC LwaCas13 AACCAAT ATCAAC a 9 CAAT 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA AGGATG GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACA CTTTGT CCCAAAAACGAA nuclease validation GGATGCTTTGTTTCAGGTG TTCAGG GGGGACTAAAAC LwaCas13 TATCAACC TGTATC a 10 AACC 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA CATATT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACC TCTCTA CCCAAAAACGAA nuclease validation ATATTTCTCTACACCTTTTT CACCTT GGGGACTAAAAC LwaCas13 TAGGATG TTTTAG a 11 GATG 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA ACCATA GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACA TTTCTC CCCAAAAACGAA nuclease validation CCATATTTCTCTACACCTTT TACACC GGGGACTAAAAC LwaCas13 TTTAGGA TTTTTT a 12 AGGA 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA CTTTTT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACC TAGGAT CCCAAAAACGAA nuclease validation TTTTTTAGGATGCTTTGTTT GCTTTG GGGGACTAAAAC LwaCas13 CAGGTGT TTTCAG a 13 GTGT 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA TACACC GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACT TTTTTT CCCAAAAACGAA nuclease validation ACACCTTTTTTAGGATGCTT AGGATG GGGGACTAAAAC LwaCas13 TGTTTCA CTTTGT a 14 TTCA 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA TCTTTT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACT TCGTAA CCCAAAAACGAA nuclease validation CTTTTTCGTAAATGCACTTG ATGCAC GGGGACTAAAAC LwaCas13 CTTCAGG TTGCTT a 15 CAGG 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA TTTTCT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACTT TTGCAT CCCAAAAACGAA nuclease validation TTCTTTGCATTTTCTACCAT TTTCTA GGGGACTAAAAC LwaCas13 CTTTTT CCATCT a 16 TTTT 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA TGAATG GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACT TCATTG CCCAAAAACGAA nuclease validation GAATGTCATTGGTTGACCT GTTGAC GGGGACTAAAAC LwaCas13 TTGTACAT CTTTGT a 17 ACAT 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA TTTTTT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACTT AGGATG CCCAAAAACGAA nuclease validation TTTTAGGATGCTTTGTTTCA CTTTGT GGGGACTAAAAC LwaCas13 GGTGTA TTCAGG a 18 TGTA 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA TTTGTT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACTT TCAGGT CCCAAAAACGAA nuclease validation TGTTTCAGGTGTATCAACC GTATCA GGGGACTAAAAC LwaCas13 AATAATA ACCAAT a 19 AATA 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA TTGCTT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACTT CAGGA CCCAAAAACGAA nuclease validation GCTTCAGGACCATATTTCT CCATAT GGGGACTAAAAC LwaCas13 CTACACC TTCTCT a 20 ACACC 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA TCAGGT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACT GTATCA CCCAAAAACGAA nuclease validation CAGGTGTATCAACCAATAA ACCAAT GGGGACTAAAAC LwaCas13 TAGTCTGA AATAGT a 21 CTGA 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA ACTTGC GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACA TTCAGG CCCAAAAACGAA nuclease validation CTTGCTTCAGGACCATATT ACCATA GGGGACTAAAAC LwaCas13 TCTCTACA TTTCTC a 22 TACA 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA TTTGTT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACTT TCAGGT CCCAAAAACGAA nuclease validation TGTTTCAGGTGTATCAACC GTATCA GGGGACTAAAAC LwaCas13 AATAATA ACCAAT a 23 AATA 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA TCTACA GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACT CCTTTT CCCAAAAACGAA nuclease validation CTACACCTTTTTTAGGATG TTAGGA GGGGACTAAAAC LwaCas13 CTTTGTTT TGCTTT a 24 GTTT 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA CTTCAG GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACC GACCAT CCCAAAAACGAA nuclease validation TTCAGGACCATATTTCTCT ATTTCT GGGGACTAAAAC LwaCas13 ACACCTTT CTACAC a 25 CTTT 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA TGACCT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACT TTGTAC CCCAAAAACGAA nuclease validation GACCTTTGTACATTAATTT ATTAAT GGGGACTAAAAC LwaCas13 AACAGTAT TTAACA a 26 GTAT 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA ATTGGT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACA TGACCT CCCAAAAACGAA nuclease validation TTGGTTGACCTTTGTACATT TTGTAC GGGGACTAAAAC LwaCas13 AATTTAA ATTAAT a 27 TTAA 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA GTCATT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACG GGTTGA CCCAAAAACGAA nuclease validation TCATTGGTTGACCTTTGTAC CCTTTG GGGGACTAAAAC LwaCas13 ATTAATT TACATT a 28 AATT 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA TTCTCT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACTT ACACCT CCCAAAAACGAA nuclease validation CTCTACACCTTTTTTAGGAT TTTTTA GGGGACTAAAAC LwaCas13 GCTTTG GGATGC a 29 TTTG 6a thermo- LwaCas13a GATTTAGACTACCCCAAAA GCATTT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACG TCTACC CCCAAAAACGAA nuclease validation CATTTTCTACCATCTTTTTC ATCTTT GGGGACTAAAAC LwaCas13 GTAAATG TTCGTA a 30 AATG 6a APML LwaCas13a GATTTAGACTACCCCAAAA GCGCCA GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACG CTGGCC CCCAAAAACGAA long validation CGCCACTGGCCACGTGGTT ACGTGG GGGGACTAAAAC LwaCas13 GCTGTTGG TTGCTG a 1 TTGG 6a APML LwaCas13a GATTTAGACTACCCCAAAA TGGCTG GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACT CCTCCC CCCAAAAACGAA long validation GGCTGCCTCCCCGGCGCCA CGGCGC GGGGACTAAAAC LwaCas13 CTGGCCAC CACTGG a 2 CCAC 6a APML LwaCas13a GATTTAGACTACCCCAAAA CTGCCT GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACC CCCCGG CCCAAAAACGAA long validation TGCCTCCCCGGCGCCACTG CGCCAC GGGGACTAAAAC LwaCas13 GCCACGTG TGGCCA a 3 CGTG 6a APML LwaCas13a GATTTAGACTACCCCAAAA GGCTGC GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACG CTCCCC CCCAAAAACGAA long validation GCTGCCTCCCCGGCGCCAC GGCGCC GGGGACTAAAAC LwaCas13 TGGCCACG ACTGGC a 4 CACG 6a APML LwaCas13a GATTTAGACTACCCCAAAA CCCCGG GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACC CGCCAC CCCAAAAACGAA long validation CCCGGCGCCACTGGCCACG TGGCCA GGGGACTAAAAC LwaCas13 TGGTTGCT CGTGGT a 5 TGCT 6a APML LwaCas13a GATTTAGACTACCCCAAAA GCTGCC GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACG TCCCCG CCCAAAAACGAA long validation CTGCCTCCCCGGCGCCACT GCGCCA GGGGACTAAAAC LwaCas13 GGCCACGT CTGGCC a 6 ACGT 6a APML LwaCas13a GATTTAGACTACCCCAAAA CGCCAC GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACC TGGCCA CCCAAAAACGAA long validation GCCACTGGCCACGTGGTTG CGTGGT GGGGACTAAAAC LwaCas13 CTGTTGGG TGCTGT a 7 TGGG 6a APML LwaCas13a GATTTAGACTACCCCAAAA CGGCGC GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACC CACTGG CCCAAAAACGAA long validation GGCGCCACTGGCCACGTGG CCACGT GGGGACTAAAAC LwaCas13 TTGCTGTT GGTTGC a 8 TGTT 6a APML LwaCas13a GATTTAGACTACCCCAAAA ATGGCT GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACA GCCTCC CCCAAAAACGAA long validation TGGCTGCCTCCCCGGCGCC CCGGCG GGGGACTAAAAC LwaCas13 ACTGGCCA CCACTG a 9 GCCA 6a APML LwaCas13a GATTTAGACTACCCCAAAA CCCGGC GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACC GCCACT CCCAAAAACGAA long validation CCGGCGCCACTGGCCACGT GGCCAC GGGGACTAAAAC LwaCas13 GGTTGCTG GTGGTT a 10 GCTG 6a APML LwaCas13a GATTTAGACTACCCCAAAA AATGGC GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACA TGCCTC CCCAAAAACGAA long validation ATGGCTGCCTCCCCGGCGC CCCGGC GGGGACTAAAAC LwaCas13 CACTGGCC GCCACT a 11 GGCC 6a APML LwaCas13a GATTTAGACTACCCCAAAA CTCCCC GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACC GGCGCC CCCAAAAACGAA long validation TCCCCGGCGCCACTGGCCA ACTGGC GGGGACTAAAAC LwaCas13 CGTGGTTG CACGTG a 12 GTTG 6a APML LwaCas13a GATTTAGACTACCCCAAAA CCTCCC GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACC CGGCGC CCCAAAAACGAA long validation CTCCCCGGCGCCACTGGCC CACTGG GGGGACTAAAAC LwaCas13 ACGTGGTT CCACGT a 13 GGTT 6a APML LwaCas13a GATTTAGACTACCCCAAAA TCAATG GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACT GCTGCC CCCAAAAACGAA long validation CAATGGCTGCCTCCCCGGC TCCCCG GGGGACTAAAAC LwaCas13 GCCACTGG GCGCCA a 14 CTGG 6a APML LwaCas13a GATTTAGACTACCCCAAAA CCGGCG GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACC CCACTG CCCAAAAACGAA long validation CGGCGCCACTGGCCACGTG GCCACG GGGGACTAAAAC LwaCas13 GTTGCTGT TGGTTG a 15 CTGT 6a APML LwaCas13a GATTTAGACTACCCCAAAA CAATGG GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACC CTGCCT CCCAAAAACGAA long validation AATGGCTGCCTCCCCGGCG CCCCGG GGGGACTAAAAC LwaCas13 CCACTGGC CGCCAC a 16 TGGC 6a APML LwaCas13a GATTTAGACTACCCCAAAA TGCCTC GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACT CCCGGC CCCAAAAACGAA long validation GCCTCCCCGGCGCCACTGG GCCACT GGGGACTAAAAC LwaCas13 CCACGTGG GGCCAC a 17 GTGG 6a APML LwaCas13a GATTTAGACTACCCCAAAA TCCCCG GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACT GCGCCA CCCAAAAACGAA long validation CCCCGGCGCCACTGGCCAC CTGGCC GGGGACTAAAAC LwaCas13 GTGGTTGC ACGTGG a 18 TTGC 6a APML LwaCas13a GATTTAGACTACCCCAAAA GGCGCC GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACG ACTGGC CCCAAAAACGAA long validation GCGCCACTGGCCACGTGGT CACGTG GGGGACTAAAAC LwaCas13 TGCTGTTG GTTGCT a 19 GTTG 6a APML LwaCas13a GATTTAGACTACCCCAAAA GCCTCC GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACG CCGGCG CCCAAAAACGAA long validation CCTCCCCGGCGCCACTGGC CCACTG GGGGACTAAAAC LwaCas13 CACGTGGT GCCACG a 20 TGGT 6a APML LwaCas13a GATTTAGACTACCCCAAAA TCTCAA GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACT TGGCTT CCCAAAAACGAA short validation CTCAATGGCTTTCCCCTGG TCCCCT GGGGACTAAAAC LwaCas13 GTGATGCA GGGTGA a 1 TGCA 6a APML LwaCas13a GATTTAGACTACCCCAAAA ATGGCT GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACA TTCCCC CCCAAAAACGAA short validation TGGCTTTCCCCTGGGTGAT TGGGTG GGGGACTAAAAC LwaCas13 GCAAGAGC ATGCAA a 2 GAGC 6a APML LwaCas13a GATTTAGACTACCCCAAAA AATGGC GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACA TTTCCC CCCAAAAACGAA short validation ATGGCTTTCCCCTGGGTGA CTGGGT GGGGACTAAAAC LwaCas13 TGCAAGAG GATGCA a 3 AGAG 6a APML LwaCas13a GATTTAGACTACCCCAAAA GGGTGA GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACG TGCAAG CCCAAAAACGAA short validation GGTGATGCAAGAGCTGAG AGCTGA GGGGACTAAAAC LwaCas13 GTCCTGCAG GGTCCT a 4 GCAG 6a APML LwaCas13a GATTTAGACTACCCCAAAA TGGCTT GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACT TCCCCT CCCAAAAACGAA short validation GGCTTTCCCCTGGGTGATG GGGTGA GGGGACTAAAAC LwaCas13 CAAGAGCT TGCAAG a 5 AGCT 6a APML LwaCas13a GATTTAGACTACCCCAAAA CTCAAT GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACC GGCTTT CCCAAAAACGAA short validation TCAATGGCTTTCCCCTGGG CCCCTG GGGGACTAAAAC LwaCas13 TGATGCAA GGTGAT a 6 GCAA 6a APML LwaCas13a GATTTAGACTACCCCAAAA TTCCCC GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACTT TGGGTG CCCAAAAACGAA short validation CCCCTGGGTGATGCAAGAG ATGCAA GGGGACTAAAAC LwaCas13 CTGAGGT GAGCTG a 7 AGGT 6a APML LwaCas13a GATTTAGACTACCCCAAAA GCTTTC GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACG CCCTGG CCCAAAAACGAA short validation CTTTCCCCTGGGTGATGCA GTGATG GGGGACTAAAAC LwaCas13 AGAGCTGA CAAGA a 8 GCTGA 6a APML LwaCas13a GATTTAGACTACCCCAAAA TCCCCT GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACT GGGTGA CCCAAAAACGAA short validation CCCCTGGGTGATGCAAGAG TGCAAG GGGGACTAAAAC LwaCas13 CTGAGGTC AGCTGA a 9 GGTC 6a APML LwaCas13a GATTTAGACTACCCCAAAA CTTTCC GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACC CCTGGG CCCAAAAACGAA short validation TTTCCCCTGGGTGATGCAA TGATGC GGGGACTAAAAC LwaCas13 GAGCTGAG AAGAG a 10 CTGAG 6a APML LwaCas13a GATTTAGACTACCCCAAAA CAATGG GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACC CTTTCC CCCAAAAACGAA short validation AATGGCTTTCCCCTGGGTG CCTGGG GGGGACTAAAAC LwaCas13 ATGCAAGA TGATGC a 11 AAGA 6a APML LwaCas13a GATTTAGACTACCCCAAAA CCTGGG GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACC TGATGC CCCAAAAACGAA short validation CTGGGTGATGCAAGAGCTG AAGAG GGGGACTAAAAC LwaCas13 AGGTCCTG CTGAGG a 12 TCCTG 6a APML LwaCas13a GATTTAGACTACCCCAAAA GGTCTC GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACG AATGGC CCCAAAAACGAA short validation GTCTCAATGGCTTTCCCCT TTTCCC GGGGACTAAAAC LwaCas13 GGGTGATG CTGGGT a 13 GATG 6a APML LwaCas13a GATTTAGACTACCCCAAAA GGGTCT GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACG CAATGG CCCAAAAACGAA short validation GGTCTCAATGGCTTTCCCC CTTTCC GGGGACTAAAAC LwaCas13 TGGGTGAT CCTGGG a 14 TGAT 6a APML LwaCas13a GATTTAGACTACCCCAAAA GGCTTT GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACG CCCCTG CCCAAAAACGAA short validation GCTTTCCCCTGGGTGATGC GGTGAT GGGGACTAAAAC LwaCas13 AAGAGCTG GCAAG a 15 AGCTG 6a APML LwaCas13a GATTTAGACTACCCCAAAA TTTCCC GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACTT CTGGGT CCCAAAAACGAA short validation TCCCCTGGGTGATGCAAGA GATGCA GGGGACTAAAAC LwaCas13 GCTGAGG AGAGCT a 16 GAGG 6a APML LwaCas13a GATTTAGACTACCCCAAAA CCCCTG GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACC GGTGAT CCCAAAAACGAA short validation CCCTGGGTGATGCAAGAGC GCAAG GGGGACTAAAAC LwaCas13 TGAGGTCC AGCTGA a 17 GGTCC 6a APML LwaCas13a GATTTAGACTACCCCAAAA TGGGTG GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACT ATGCAA CCCAAAAACGAA short validation GGGTGATGCAAGAGCTGA GAGCTG GGGGACTAAAAC LwaCas13 GGTCCTGCA AGGTCC a 18 TGCA 6a APML LwaCas13a GATTTAGACTACCCCAAAA GTCTCA GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACG ATGGCT CCCAAAAACGAA short validation TCTCAATGGCTTTCCCCTG TTCCCC GGGGACTAAAAC LwaCas13 GGTGATGC TGGGTG a 19 ATGC 6a APML LwaCas13a GATTTAGACTACCCCAAAA CTGGGT GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACC GATGCA CCCAAAAACGAA short validation TGGGTGATGCAAGAGCTGA AGAGCT GGGGACTAAAAC LwaCas13 GGTCCTGC GAGGTC a 20 CTGC 6a APML LwaCas13a GATTTAGACTACCCCAAAA CCCTGG GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACC GTGATG CCCAAAAACGAA short validation CCTGGGTGATGCAAGAGCT CAAGA GGGGACTAAAAC LwaCas13 GAGGTCCT GCTGAG a 21 GTCCT 6a APML LwaCas13a GATTTAGACTACCCCAAAA TCAATG GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACT GCTTTC CCCAAAAACGAA short validation CAATGGCTTTCCCCTGGGT CCCTGG GGGGACTAAAAC LwaCas13 GATGCAAG GTGATG a 22 CAAG 6a APML LwaCas13a GATTTAGACTACCCCAAAA TGGGTC GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACT TCAATG CCCAAAAACGAA short validation GGGTCTCAATGGCTTTCCC GCTTTC GGGGACTAAAAC LwaCas13 CTGGGTGA CCCTGG a 23 GTGA 6b APML CcaCas13b cggcgccactggccacgtg cggcgccac GTTGGAACTGCT APML 6b long gttgctgttgg tggccacgt CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT ggttgctgtt GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC gg b 1 6b APML CcaCas13b ccggcgccactggccacgt ccggcgcca GTTGGAACTGCT APML 6b long ggttgctgttg ctggccacg CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT tggttgctgtt GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC g b 2 6b APML CcaCas13b cccggcgccactggccacg GTTGGAACTGCT cccggcgcc APML 6b long tggttgctgtt actggccac CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT gtggttgctg GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC tt b 3 6b APML CcaCas13b ccccggcgccactggccac ccccggcgc GTTGGAACTGCT APML 6b long gtggttgctgt cactggcca CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT cgtggttgct GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC gt b 4 6b APML CcaCas13b tccccggcgccactggcca tccccggcg GTTGGAACTGCT APML 6b long cgtggttgctg ccactggcc CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT acgtggttgc GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC tg b 5 6b APML CcaCas13b ctccccggcgccactggcc ctccccggc GTTGGAACTGCT APML 6b long acgtggttgct gccactggc CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT cacgtggttg GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC ct b 6 6b APML CcaCas13b cctccccggcgccactggc cctccccgg GTTGGAACTGCT APML 6b long cacgtggttgc cgccactgg CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT ccacgtggtt GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC gc b 7 6b APML CcaCas13b gcctccccggcgccactgg gcctccccg GTTGGAACTGCT APML 6b long ccacgtggttg gcgccactg CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT gccacgtgg GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC ttg b 8 6b APML CcaCas13b tgcctccccggcgccactg tgcctccccg GTTGGAACTGCT APML 6b long gccacgtggtt gcgccactg CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT gccacgtgg GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC tt b 9 6b APML CcaCas13b ctgcctccccggcgccact ctgcctcccc GTTGGAACTGCT APML 6b long ggccacgtggt ggcgccact CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT ggccacgtg GTAATCACAAC CcaCas 13 GGAGGGTAATCACAAC gt b 10 6b APML CcaCas13b gctgcctccccggcgccac gctgcctccc GTTGGAACTGCT APML 6b long tggccacgtgg cggcgccac CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT tggccacgt GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC gg b 11 6b APML CcaCas13b ggctgcctccccggcgcca ggctgcctc GTTGGAACTGCT APML 6b long ctggccacgtg cccggcgcc CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT actggccac GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC gtg b 12 6b APML CcaCas13b tggctgcctccccggcgcc tggctgcctc GTTGGAACTGCT APML 6b long actggccacgt cccggcgcc CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT actggccac GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC gt b 13 6b APML CcaCas13b atggctgcctccccggcgc atggctgcct GTTGGAACTGCT APML 6b long cactggccacg ccccggcgc CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT cactggcca GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC cg b 14 6b APML CcaCas13b aatggctgcctccccggcg aatggctgc GTTGGAACTGCT APML 6b long ccactggccac ctccccggc CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT gccactggc GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC cac b 15 6b APML CcaCas13b caatggctgcctccccggc caatggctg GTTGGAACTGCT APML 6b long gccactggcca cctccccgg CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT cgccactgg GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC cca b 16 6b APML CcaCas13b ctgggtgatgcaagagctg ctgggtgatg GTTGGAACTGCT APML 6b short aggtcctgcag caagagctg CTCATTTTGGAGG short validation GTTGGAACTGCTCTCATTTT aggtcctgc GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC ag b 1 6b APML CcaCas13b cctgggtgatgcaagagct cctgggtgat GTTGGAACTGCT APML 6b short gaggtcctgca gcaagagct CTCATTTTGGAGG short validation GTTGGAACTGCTCTCATTTT gaggtcctg GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC ca b 2 6b APML CcaCas13b ccctgggtgatgcaagagc ccctgggtg GTTGGAACTGCT APML 6b short tgaggtcctgc atgcaagag CTCATTTTGGAGG short validation GTTGGAACTGCTCTCATTTT ctgaggtcct GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC gc b 3 6b APML CcaCas13b cccctgggtgatgcaagag cccctgggt GTTGGAACTGCT APML 6b short ctgaggtcctg gatgcaaga CTCATTTTGGAGG short validation GTTGGAACTGCTCTCATTTT gctgaggtc GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC ctg b 4 6b APML CcaCas13b tcccctgggtgatgcaaga tcccctgggt GTTGGAACTGCT APML 6b short gctgaggtcct gatgcaaga CTCATTTTGGAGG short validation GTTGGAACTGCTCTCATTTT gctgaggtc GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC ct b 5 6b APML CcaCas13b ttcccctgggtgatgcaag ttcccctggg GTTGGAACTGCT APML 6b short agctgaggtcc tgatgcaag CTCATTTTGGAGG short validation GTTGGAACTGCTCTCATTTT agctgaggt GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC cc b 6 6b APML CcaCas13b tttcccctgggtgatgcaa gagctgaggtc GTTGGAACTGCT APML 6b short tttcccctgg gtgatgcaa CTCATTTTGGAGG short validation GTTGGAACTGCTCTCATTTT gagctgagg GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC tc b 7 6b APML CcaCas13b ctttcccctgggtgatgca ctttcccctg GTTGGAACTGCT APML 6b short agagctgaggt ggtgatgca CTCATTTTGGAGG short validation GTTGGAACTGCTCTCATTTT agagctgag GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC gt b 8 6b APML CcaCas13b gctttcccctgggtgatgc gctttcccct GTTGGAACTGCT APML 6b short aagagctgagg gggtgatgc CTCATTTTGGAGG short validation GTTGGAACTGCTCTCATTTT aagagctga GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC gg b 9 6b APML CcaCas13b ggctttcccctgggtgatg ggctttcccc GTTGGAACTGCT APML 6b short caagagctgag tgggtgatgc CTCATTTTGGAGG short validation GTTGGAACTGCTCTCATTTT aagagctga GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC g b 10 6b APML CcaCas13b tggctttcccctgggtgat tggctttccc GTTGGAACTGCT APML 6b short gcaagagctga ctgggtgatg CTCATTTTGGAGG short validation GTTGGAACTGCTCTCATTTT caagagctg GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC a b 11 6b APML CcaCas13b atggctttcccctgggtga atggctttcc GTTGGAACTGCT APML 6b short tgcaagagctg cctgggtgat CTCATTTTGGAGG short validation GTTGGAACTGCTCTCATTTT gcaagagct GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC g b 12 6b APML CcaCas13b aatggctttcccctgggtg aatggctttc GTTGGAACTGCT APML 6b short atgcaagagctG ccctgggtg CTCATTTTGGAGG short validation TTGGAACTGCTCTCATTTTG atgcaagag GTAATCACAAC CcaCas13 GAGGGTAATCACAAC ct b 13 6b APML CcaCas13b caatggctttcccctgggt caatggcttt GTTGGAACTGCT APML 6b short gatgcaagagc cccctgggt CTCATTTTGGAGG short validation GTTGGAACTGCTCTCATTTT gatgcaaga GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC gc b 14 6b APML CcaCas13b tcaatggctttcccctggg tcaatggcttt GTTGGAACTGCT APML 6b short tgatgcaagagG cccctgggt CTCATTTTGGAGG short validation TTGGAACTGCTCTCATTTTG gatgcaaga GTAATCACAAC CcaCas13 GAGGGTAATCACAAC g b 15 6b APML CcaCas13b ctcaatggctttcccctgg ctcaatggct GTTGGAACTGCT APML 6b short gtgatgcaagaG ttcccctggg CTCATTTTGGAGG short validation TTGGAACTGCTCTCATTTTG tgatgcaag GTAATCACAAC CcaCas13 GAGGGTAATCACAAC a b 16 6b APML CcaCas13b tctcaatggctttcccctg tctcaatggc GTTGGAACTGCT APML 6b short ggtgatgcaagG tttcccctgg CTCATTTTGGAGG short validation TTGGAACTGCTCTCATTTTG gtgatgcaa GTAATCACAAC CcaCas13 GAGGGTAATCACAAC g b 17 6b APML CcaCas13b gtctcaatggctttcccct gtctcaatgg GTTGGAACTGCT APML 6b short gggtgatgcaaG ctttcccctg CTCATTTTGGAGG short validation TTGGAACTGCTCTCATTTTG ggtgatgca GTAATCACAAC CcaCas13 GAGGGTAATCACAAC a b 18 6b APML CcaCas13b ggtctcaatggctttcccc ggtctcaatg GTTGGAACTGCT APML 6b short tgggtgatgcaG gctttcccct CTCATTTTGGAGG short validation TTGGAACTGCTCTCATTTTG gggtgatgc GTAATCACAAC CcaCas13 GAGGGTAATCACAAC a b 19 6b APML CcaCas13b gggtctcaatggctttccc gggtctcaat GTTGGAACTGCT APML 6b short ctgggtgatgcG ggctttcccc CTCATTTTGGAGG short validation TTGGAACTGCTCTCATTTTG tgggtgatgc GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 20 6b APML CcaCas13b tgggtctcaatggctttcc tgggtctcaa GTTGGAACTGCT APML 6b short cctgggtgatgG tggctttccc CTCATTTTGGAGG short validation TTGGAACTGCTCTCATTTTG ctgggtgatg GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 21 6b APML CcaCas13b ctgggtctcaatggctttc ctgggtctca GTTGGAACTGCT APML 6b short ccctgggtgatG atggctttcc CTCATTTTGGAGG short validation TTGGAACTGCTCTCATTTTG cctgggtgat GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 22 6b Thermo- CcaCas13b tcattggttgacctttgta tcattggttga GTTGGAACTGCT Thermo- 6b nuclease cattaatttaaGTT cctttgtacat CTCATTTTGGAGG nuclease validation GGAACTGCTCTCATTTTGG taatttaa GTAATCACAAC CcaCas13 AGGGTAATCACAAC b 1 6b Thermo- CcaCas13b tgtcattggttgacctttg tgtcattggtt GTTGGAACTGCT Thermo- 6b nuclease tacattaatttGTT gacctttgta CTCATTTTGGAGG nuclease validation GGAACTGCTCTCATTTTGG cattaattt GTAATCACAAC CcaCas13 AGGGTAATCACAAC b 2 6b Thermo- CcaCas13b aatgtcattggttgacctt aatgtcattg GTTGGAACTGCT Thermo- 6b nuclease tgtacattaatGT gttgacctttg CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG tacattaat GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 3 6b Thermo- CcaCas13b tgaatgtcattggttgacc tgaatgtcatt GTTGGAACTGCT Thermo- 6b nuclease tttgtacattaGT ggttgaccttt CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG gtacatta GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 4 6b Thermo- CcaCas13b tctgaatgtcattggttga tctgaatgtc GTTGGAACTGCT Thermo- 6b nuclease cctttgtacatGT attggttgac CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG ctttgtacat GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 5 6b Thermo- CcaCas13b agtctgaatgtcattggtt agtctgaatg GTTGGAACTGCT Thermo- 6b nuclease gacctttgtacGT tcattggttga CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG cctttgtac GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 6 6b Thermo- CcaCas13b atagtctgaatgtcattgg atagtctgaa GTTGGAACTGCT Thermo- 6b nuclease ttgacctttgtGT tgtcattggtt CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG gacctttgt GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 7 6b Thermo- CcaCas13b taatagtctgaatgtcatt taatagtctg GTTGGAACTGCT Thermo- 6b nuclease ggttgacctttGT aatgtcattg CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG gttgaccttt GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 8 6b Thermo- CcaCas13b aataatagtctgaatgtca aataatagtc GTTGGAACTGCT Thermo- 6b nuclease ttggttgacctGT tgaatgtcatt CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG ggttgacct GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 9 6b Thermo- CcaCas13b ccaataatagtctgaatgt ccaataatag GTTGGAACTGCT Thermo- 6b nuclease cattggttgacG tctgaatgtc CTCATTTTGGAGG nuclease validation TTGGAACTGCTCTCATTTTG attggttgac GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 10 6b Thermo- CcaCas13b aaccaataatagtctgaat aaccaataat GTTGGAACTGCT Thermo- 6b nuclease gtcattggttgG agtctgaatg CTCATTTTGGAGG nuclease validation TTGGAACTGCTCTCATTTTG tcattggttg GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 11 6b Thermo- CcaCas13b tcaaccaataatagtctga tcaaccaata GTTGGAACTGCT Thermo- 6b nuclease atgtcattggtG atagtctgaa CTCATTTTGGAGG nuclease validation TTGGAACTGCTCTCATTTTG tgtcattggt GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 12 6b Thermo- CcaCas13b tatcaaccaataatagtct tatcaaccaa GTTGGAACTGCT Thermo- 6b nuclease gaatgtcattgGT taatagtctg CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG aatgtcattg GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 13 6b Thermo- CcaCas13b tgtatcaaccaataatagt tgtatcaacc GTTGGAACTGCT Thermo- 6b nuclease ctgaatgtcatGT aataatagtc CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG tgaatgtcat GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 14 6b Thermo- CcaCas13b ggtgtatcaaccaataata ggtgtatcaa GTTGGAACTGCT Thermo- 6b nuclease gtctgaatgtcG ccaataatag CTCATTTTGGAGG nuclease validation TTGGAACTGCTCTCATTTTG tctgaatgtc GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 15 6b Thermo- CcaCas13b caggtgtatcaaccaataa caggtgtatc GTTGGAACTGCT Thermo- 6b nuclease tagtctgaatgG aaccaataat CTCATTTTGGAGG nuclease validation TTGGAACTGCTCTCATTTTG agtctgaatg GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 16 6b Thermo- CcaCas13b ttcaggtgtatcaaccaat ttcaggtgtat GTTGGAACTGCT Thermo- 6b nuclease aatagtctgaaG caaccaata CTCATTTTGGAGG nuclease validation TTGGAACTGCTCTCATTTTG atagtctgaa GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 17 6b Thermo- CcaCas13b gtttcaggtgtatcaacca gtttcaggtg GTTGGAACTGCT Thermo- 6b nuclease ataatagtctgG tatcaaccaa CTCATTTTGGAGG nuclease validation TTGGAACTGCTCTCATTTTG taatagtctg GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 18 6b Thermo- CcaCas13b ttgtttcaggtgtatcaac ttgtttcaggt GTTGGAACTGCT Thermo- 6b nuclease caataatagtcGT gtatcaacca CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG ataatagtc GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 19 6b Thermo- CcaCas13b ctttgtttcaggtgtatca ctttgtttcag GTTGGAACTGCT Thermo- 6b nuclease accaataatagGT gtgtatcaac CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG caataatag GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 20 6b Thermo- CcaCas13b tgctttgtttcaggtgtat tgctttgtttc GTTGGAACTGCT Thermo- 6b nuclease caaccaataatGT aggtgtatca CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG accaataat GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 21 6b Thermo- CcaCas13b gatgctttgtttcaggtgt gatgctttgtt GTTGGAACTGCT Thermo- 6b nuclease atcaaccaataGT tcaggtgtat CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG caaccaata GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 22 6b Thermo- CcaCas13b aggatgctttgtttcaggt aggatgcttt GTTGGAACTGCT Thermo- 6b nuclease gtatcaaccaaG gtttcaggtg CTCATTTTGGAGG nuclease validation TTGGAACTGCTCTCATTTTG tatcaaccaa GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 23 6b Thermo- CcaCas13b ttaggatgctttgtttcag ttaggatgctt GTTGGAACTGCT Thermo- 6b nuclease gtgtatcaaccGT tgtttcaggt CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG gtatcaacc GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 24 6b Thermo- CcaCas13b ttttaggatgctttgtttc ttttaggatgc GTTGGAACTGCT Thermo- 6b nuclease aggtgtatcaaGT tttgtttcagg CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG tgtatcaa GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 25 6b Thermo- CcaCas13b ttttttaggatgctttgtt ttttttaggat GTTGGAACTGCT Thermo- 6b nuclease tcaggtgtatcGTT gctttgtttca CTCATTTTGGAGG nuclease validation GGAACTGCTCTCATTTTGG ggtgtatc GTAATCACAAC CcaCas13 AGGGTAATCACAAC b 26 6b Thermo- CcaCas13b ccttttttaggatgctttg ccttttttagg GTTGGAACTGCT Thermo- 6b nuclease tttcaggtgtaGTT atgctttgttt CTCATTTTGGAGG nuclease validation GGAACTGCTCTCATTTTGG caggtgta GTAATCACAAC CcaCas13 AGGGTAATCACAAC b 27 6b Thermo- CcaCas13b caccttttttaggatgctt cacctttttta GTTGGAACTGCT Thermo- 6b nuclease tgtttcaggtgGT ggatgctttg CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG tttcaggtg GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 28 6b Thermo- CcaCas13b tacaccttttttaggatgc tacacctttttt GTTGGAACTGCT Thermo- 6b nuclease tttgtttcaggGT aggatgcttt CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG gtttcagg GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 29 6b Thermo- CcaCas13b tctacaccttttttaggat tctacaccttt GTTGGAACTGCT Thermo- 6b nuclease gctttgtttcaGTT tttaggatgct CTCATTTTGGAGG nuclease validation GGAACTGCTCTCATTTTGG ttgtttca GTAATCACAAC CcaCas13 AGGGTAATCACAAC b 30 6b Thermo- CcaCas13b tctctacaccttttttagg tctctacacct GTTGGAACTGCT Thermo- 6b nuclease atgctttgtttGTT tttttaggatg CTCATTTTGGAGG nuclease validation GGAACTGCTCTCATTTTGG ctttgttt GTAATCACAAC CcaCas13 AGGGTAATCACAAC b 31 6b Thermo- CcaCas13b tttctctacacctttttta tttctctacac GTTGGAACTGCT Thermo- 6b nuclease ggatgctttgtGTT cttttttagga CTCATTTTGGAGG nuclease validation GGAACTGCTCTCATTTTGG tgctttgt GTAATCACAAC CcaCas13 AGGGTAATCACAAC b 32 6b Thermo- CcaCas13b tatttctctacaccttttt tatttctctac GTTGGAACTGCT Thermo- 6b nuclease taggatgctttGTT accttttttag CTCATTTTGGAGG nuclease validation GGAACTGCTCTCATTTTGG gatgcttt GTAATCACAAC CcaCas13 AGGGTAATCACAAC b 33 6b Thermo- CcaCas13b catatttctctacaccttt catatttctct GTTGGAACTGCT Thermo- 6b nuclease tttaggatgctGTT acacctttttt CTCATTTTGGAGG nuclease validation GGAACTGCTCTCATTTTGG aggatgct GTAATCACAAC CcaCas13 AGGGTAATCACAAC b 34 6b Thermo- CcaCas13b accatatttctctacacct accatatttct GTTGGAACTGCT Thermo- 6b nuclease tttttaggatgGT ctacacctttt CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG ttaggatg GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 35 6b Thermo- CcaCas13b ggaccatatttctctacac ggaccatatt GTTGGAACTGCT Thermo- 6b nuclease cttttttaggaGT tctctacacct CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG tttttagga GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 36 6b Thermo- CcaCas13b caggaccatatttctctac caggaccat GTTGGAACTGCT Thermo- 6b nuclease accttttttagGT atttctctaca CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG ccttttttag GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 37 6b Thermo- CcaCas13b ttcaggaccatatttctct ttcaggacca GTTGGAACTGCT Thermo- 6b nuclease acaccttttttGTT tatttctctac CTCATTTTGGAGG nuclease validation GGAACTGCTCTCATTTTGG acctttttt GTAATCACAAC CcaCas13 AGGGTAATCACAAC b 38 6b Thermo- CcaCas13b gcttcaggaccatatttct gcttcagga GTTGGAACTGCT Thermo- 6b nuclease ctacaccttttGT ccatatttctc CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG tacacctttt GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 39 6b Thermo- CcaCas13b ttgcttcaggaccatattt ttgcttcagg GTTGGAACTGCT Thermo- 6b nuclease ctctacaccttGT accatatttct CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG ctacacctt GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 40 6b Thermo- CcaCas13b acttgcttcaggaccatat acttgcttca GTTGGAACTGCT Thermo- 6b nuclease ttctctacaccGT ggaccatatt CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG tctctacacc GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 41 6b Thermo- CcaCas13b gcacttgcttcaggaccat gcacttgctt GTTGGAACTGCT Thermo- 6b nuclease atttctctacaGT caggaccat CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG atttctctaca GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 42 6b Thermo- CcaCas13b atgcacttgcttcaggacc atgcacttgc GTTGGAACTGCT Thermo- 6b nuclease atatttctctaGT ttcaggacca CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG tatttctcta GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 43 6b Thermo- CcaCas13b aaatgcacttgcttcagga aaatgcactt GTTGGAACTGCT Thermo- 6b nuclease ccatatttctcGT gcttcagga CTCATTTTGGAGG nuclease validation TGGAACTGCTCTCATTTTG ccatatttctc GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 44 6b Thermo- CcaCas13b gtaaatgcacttgcttcag gtaaatgcac GTTGGAACTGCT Thermo- 6b nuclease gaccatatttcG ttgcttcagg CTCATTTTGGAGG nuclease validation TTGGAACTGCTCTCATTTTG accatatttc GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 45 6b Thermo- CcaCas13b tcaattttctttgcatttt tcaattttcttt GTTGGAACTGCT Thermo- 6b nuclease ctaccatctttGTTG gcattttctac CTCATTTTGGAGG nuclease validation GAACTGCTCTCATTTTGGA catcttt GTAATCACAAC CcaCas13 GGGTAATCACAAC b 46 6b Thermo- CcaCas13b ttcaattttctttgcattt ttcaattttctt GTTGGAACTGCT Thermo- 6b nuclease tctaccatcttGTTG tgcattttcta CTCATTTTGGAGG nuclease validation GAACTGCTCTCATTTTGGA ccatctt GTAATCACAAC CcaCas13 GGGTAATCACAAC b 47 6b Thermo- CcaCas13b cttcaattttctttgcatt cttcaattttct GTTGGAACTGCT Thermo- 6b nuclease ttctaccatctGTT ttgcattttcta CTCATTTTGGAGG nuclease validation GGAACTGCTCTCATTTTGG ccatct GTAATCACAAC CcaCas13 AGGGTAATCACAAC b 48 6c thermo- LwaCas13a GATTTAGACTACCCCAAAA TATCAA GATTTAGACTAC thermo- 6a nulease ACGAAGGGGACTAAAACT CCAATA CCCAAAAACGAA nuclease validation ATCAACCAATAATAGTCTG ATAGTC GGGGACTAAAAC LwaCas13 AATGTCAT TGAATG a 1 (top TCAT predicted) 6c thermo- LwaCas13a GATTTAGACTACCCCAAAA TTGCTT GATTTAGACTAC thermo- 6a nulease ACGAAGGGGACTAAAACTT CAGGA CCCAAAAACGAA nuclease validation GCTTCAGGACCATATTTCT CCATAT GGGGACTAAAAC LwaCas13 CTACACC TTCTCT a 20 ACACC (bottom predicted) 6c APML LwaCas13a GATTTAGACTACCCCAAAA GCGCCA GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACG CTGGCC CCCAAAAACGAA long validation CGCCACTGGCCACGTGGTT ACGTGG GGGGACTAAAAC LwaCas13 GCTGTTGG TTGCTG a 1 (top TTGG predicted) 6c APML LwaCas13a GATTTAGACTACCCCAAAA TCCCCG GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACT GCGCCA CCCAAAAACGAA long validation CCCCGGCGCCACTGGCCAC CTGGCC GGGGACTAAAAC LwaCas13 GTGGTTGC ACGTGG a 18 TTGC (bottom predicted) 6c APML LwaCas13a GATTTAGACTACCCCAAAA TCTCAA GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACT TGGCTT CCCAAAAACGAA short validation CTCAATGGCTTTCCCCTGG TCCCCT GGGGACTAAAAC LwaCas13 GTGATGCA GGGTGA a 1 (top TGCA predicted) 6c APML LwaCas13a GATTTAGACTACCCCAAAA TGGGTC GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACT TCAATG CCCAAAAACGAA short validation GGGTCTCAATGGCTTTCCC GCTTTC GGGGACTAAAAC LwaCas13 CTGGGTGA CCCTGG a23 GTGA (bottom predicted) 6d Thermo- CcaCas13b caggtgtatcaaccaataat caggtgtatc GTTGGAACTGCT Thermo- 6b nuclease agtctgaatgG aaccaataat CTCATTTTGGAGG nuclease validation TTGGAACTGCTCTCATTTTG agtctgaatg GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 16 (top predicted) 6d Thermo- CcaCas13b cttcaattttctttgcattt cttcaattttct GTTGGAACTGCT Thermo- 6b nuclease tctaccatctGTT ttgcattttcta CTCATTTTGGAGG nuclease validation GGAACTGCTCTCATTTTGG ccatct GTAATCACAAC CcaCas13 AGGGTAATCACAAC b 48 (bottom predicted) 6d APML CcaCas13b atggctgcctccccggcgcc atggctgcct GTTGGAACTGCT APML 6b long actggccacg ccccggcgc CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT cactggcca GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC cg b 14 (top predicted) 6d APML CcaCas13b tggctgcctccccggcgcca tggctgcctc GTTGGAACTGCT APML 6b long ctggccacgt cccggcgcc CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT actggccac GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC gt b 13 (bottom predicted) 6d APML CcaCas13b cccctgggtgatgcaagagc cccctgggt GTTGGAACTGCT APML 6b short tgaggtcctg gatgcaaga CTCATTTTGGAGG short validation GTTGGAACTGCTCTCATTTT gctgaggtc GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC ctg b 4 (top predicted) 6d APML CcaCas13b ctcaatggctttcccctggg ctcaatggct GTTGGAACTGCT APML 6b short tgatgcaagaG ttcccctggg CTCATTTTGGAGG short validation TTGGAACTGCTCTCATTTTG tgatgcaag GTAATCACAAC CcaCas13 GAGGGTAATCACAAC a b 16 (bottom predicted) 6e thermo- LwaCas13a GATTTAGACTACCCCAAAA TATCAA GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACT CCAATA CCCAAAAACGAA nuclease validation ATCAACCAATAATAGTCTG ATAGTC GGGGACTAAAAC LwaCas13 AATGTCAT TGAATG a 1 (top TCAT predicted) 6e thermo- LwaCas13a GATTTAGACTACCCCAAAA TTGCTT GATTTAGACTAC thermo- 6a nuclease ACGAAGGGGACTAAAACTT CAGGA CCCAAAAACGAA nuclease validation GCTTCAGGACCATATTTCT CCATAT GGGGACTAAAAC LwaCas13 CTACACC TTCTCT a20 ACACC (bottom predicted) 6e APML LwaCas13a GATTTAGACTACCCCAAAA GCGCCA GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACG CTGGCC CCCAAAAACGAA long validation CGCCACTGGCCACGTGGTT ACGTGG GGGGACTAAAAC LwaCas13 GCTGTTGG TTGCTG a 1 (top TTGG predicted) 6e APML LwaCas13a GATTTAGACTACCCCAAAA TCCCCG GATTTAGACTAC APML 6a long ACGAAGGGGACTAAAACT GCGCCA CCCAAAAACGAA long validation CCCCGGCGCCACTGGCCAC CTGGCC GGGGACTAAAAC LwaCas13 GTGGTTGC ACGTGG a 18 TTGC (bottom predicted) 6e APML LwaCas13a GATTTAGACTACCCCAAAA TCTCAA GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACT TGGCTT CCCAAAAACGAA short validation CTCAATGGCTTTCCCCTGG TCCCCT GGGGACTAAAAC LwaCas13 GTGATGCA GGGTGA a 1 (top TGCA predicted) 6e APML LwaCas13a GATTTAGACTACCCCAAAA TGGGTC GATTTAGACTAC APML 6a short ACGAAGGGGACTAAAACT TCAATG CCCAAAAACGAA short validation GGGTCTCAATGGCTTTCCC GCTTTC GGGGACTAAAAC LwaCas13 CTGGGTGA CCCTGG a 23 GTGA (bottom predicted) 6f Thermo- CcaCas13b caggtgtatcaaccaataat caggtgtatc GTTGGAACTGCT Thermo- 6b nuclease agtctgaatgG aaccaataat CTCATTTTGGAGG nuclease validation TTGGAACTGCTCTCATTTTG agtctgaatg GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 16 (top predicted) 6f Thermo- CcaCas13b cttcaattttctttgcattt cttcaattttct GTTGGAACTGCT Thermo- 6b nuclease tctaccatctGTT ttgcattttcta CTCATTTTGGAGG nuclease validation GGAACTGCTCTCATTTTGG ccatct GTAATCACAAC CcaCas13 AGGGTAATCACAAC b 48 (bottom predicted) 6f APML CcaCas13b atggctgcctccccggcgcc atggctgcct GTTGGAACTGCT APML 6b long actggccacg ccccggcgc CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT cactggcca GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC cg b 14 (top predicted) 6f APML CcaCas13b tggctgcctccccggcgcca tggctgcctc GTTGGAACTGCT APML 6b long ctggccacgt cccggcgcc CTCATTTTGGAGG long validation GTTGGAACTGCTCTCATTTT actggccac GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC gt b 13 (bottom predicted) 6f APML CcaCas13b cccctgggtgatgcaagagc cccctgggt GTTGGAACTGCT APML 6b short tgaggtcctg gatgcaaga CTCATTTTGGAGG short validation GTTGGAACTGCTCTCATTTT gctgaggtc GTAATCACAAC CcaCas13 GGAGGGTAATCACAAC ctg b 4 (top predicted) 6f APML CcaCas13b ctcaatggctttcccctggg ctcaatggct GTTGGAACTGCT APML 6b short tgatgcaagaG ttcccctggg CTCATTTTGGAGG short validation TTGGAACTGCTCTCATTTTG tgatgcaag GTAATCACAAC CcaCas13 GAGGGTAATCACAAC a b 16 (bottom predicted) 7b Acyltrans- LwaCas13a GATTTAGACTACCCCAAAA GCACGC GATTTAGACTAC Acyl- 7b ferase ACGAAGGGGACTAAAACgc TGGAGG CCCAAAAACGAA trans- LwaCas13 acgctggaggggtcgagcac GGTCGA GGGGACTAAAAC ferase atop gctcac GCACGC predicted TCAC crRNA 7c Acyltrans- LwaCas13a GATTTAGACTACCCCAAAA CATCGC GATTTAGACTAC Acyl- 7c ferase ACGAAGGGGACTAAAACcat AGAGC CCCAAAAACGAA trans- LwaCas13 cgcagagcacgctggagggg ACGCTG GGGGACTAAAAC ferase a bottom tcgag GAGGG predicted GTCGAG crRNA 7d- Acyltrans- LwaCas13a GATTTAGACTACCCCAAAA GCACGC GATTTAGACTAC Acyl- 7b f ferase ACGAAGGGGACTAAAACgc TGGAGG CCCAAAAACGAA trans- LwaCas13 acgctggaggggtcgagca GGTCGA GGGGACTAAAAC ferase a top cgctcac GCACGC predicted TCAC crRNA 7d- Acyltrans- LwaCas13a GATTTAGACTACCCCAAAA CATCGC GATTTAGACTAC Acyl- 7c f ferase ACGAAGGGGACTAAAACcat AGAGC CCCAAAAACGAA trans- LwaCas13 cgcagagcacgctggagggg ACGCTG GGGGACTAAAAC ferase a bottom tcgag GAGGG predicted GTCGAG crRNA 7h Thermo- CcaCas13b caggtgtatcaaccaataat caggtgtatc GTTGGAACTGCT Thermo- 6b nuclease agtctgaatgG aaccaataat CTCATTTTGGAGG nuclease validation TTGGAACTGCTCTCATTTTG agtctgaatg GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 16 (top predicted) 7i Thermo- CcaCas13b cttcaattttctttgcattt cttcaattttct GTTGGAACTGCT Thermo- 6b nuclease tctaccatctGTT ttgcattttcta CTCATTTTGGAGG nuclease validation GGAACTGCTCTCATTTTGG ccatct GTAATCACAAC CcaCas13 AGGGTAATCACAAC b 48 (bottom predicted) 7j- Thermo- CcaCas13b caggtgtatcaaccaataat caggtgtatc GTTGGAACTGCT Thermo- 6b l nuclease agtctgaatgG aaccaataat CTCATTTTGGAGG nuclease validation TTGGAACTGCTCTCATTTTG agtctgaatg GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 16 (top predicted) 7j- Thermo- CcaCas13b cttcaattttctttgcattt cttcaattttct GTTGGAACTGCT Thermo- 6b l nuclease tctaccatctGTT ttgcattttcta CTCATTTTGGAGG nuclease validation GGAACTGCTCTCATTTTGG ccatct GTAATCACAAC CcaCas13 AGGGTAATCACAAC b 48 (bottom predicted) 8b Ea175 LwaCas13a GATTTAGACTACCCCAAAA AAGATG GATTTAGACTAC Ea175 8b LwaCas13 ACGAAGGGGACTAAAACA TGGATT CCCAAAAACGAA a top AGATGTGGATTTTTACATA TTTACA GGGGACTAAAAC predicted GTAAAAAT TAGTAA AAAT 8b Thermo- CcaCas13b caggtgtatcaaccaataat caggtgtatc GTTGGAACTGCT Thermo- 6b nuclease agtctgaatgG aaccaataat CTCATTTTGGAGG nuclease validation TTGGAACTGCTCTCATTTTG agtctgaatg GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 16 (top predicted) 8d-e Ea175 LwaCas13a GATTTAGACTACCCCAAAA AAGATG GATTTAGACTAC Ea175 8b LwaCas13 ACGAAGGGGACTAAAACA TGGATT CCCAAAAACGAA a top AGATGTGGATTTTTACATA TTTACA GGGGACTAAAAC predicted GTAAAAAT TAGTAA AAAT 8d-e Thermo- CcaCas13b caggtgtatcaaccaataat caggtgtatc GTTGGAACTGCT Thermo- 6b nuclease agtctgaatgG aaccaataat CTCATTTTGGAGG nuclease validation TTGGAACTGCTCTCATTTTG agtctgaatg GTAATCACAAC CcaCas13 GAGGGTAATCACAAC b 16 (top predicted) 12a- Ea175 LwaCas13a GATTTAGACTACCCCAAAA AAGATG GATTTAGACTAC Ea175 8b c LwaCas13 ACGAAGGGGACTAAAACA TGGATT CCCAAAAACGAA a top AGATGTGGATTTTTACATA TTTACA GGGGACTAAAAC predicted GTAAAAAT TAGTAA AAAT 12d- Ea81 LwaCas13a GATTTAGACTACCCCAAAA ATTTCT GATTTAGACTAC Ea81 12d f LwaCas13 ACGAAGGGGACTAAAACA AGAATT CCCAAAAACGAA a top TTTCTAGAATTGAAGGAAT GAAGG GGGGACTAAAAC predicted TAAACCAA AATTAA ACCAA 10d- Ea175 LwaCas13a GATTTAGACTACCCCAAAA AAGATG GATTTAGACTAC Ea175 8b e LwaCas13 ACGAAGGGGACTAAAACA TGGATT CCCAAAAACGAA a top AGATGTGGATTTTTACATA TTTACA GGGGACTAAAAC predicted GTAAAAAT TAGTAA AAAT 1b-c Lectin LwaCas13a GATTTAGACTACCCCAAAA ggggtggag GATTTAGACTAC Lectin 1b LwaCas13 ACGAAGGGGACTAAAACgg tagagggcg CCCAAAAACGAA a crRNA ggtggagtagagggcgcga cgaccaaga GGGGACTAAAAC ccaagag g 1b-c ssDN1 CcaCas13b acgccaagcttgcatgcct acgccaagc GTTGGAACTGCT ssDNA 1 1b CcaCas13 gcaggtcgagt ttgcatgcct CTCATTTTGGAGG b crRNA GTTGGAACTGCTCTCATTTT gcaggtcga GTAATCACAAC GGAGGGTAATCACAAC gt 1e-f Zika LwaCas13a GATTTAGACTACCCCAAAA actccctaga GATTTAGACTAC Zika 1e LwaCas13 ACGAAGGGGACTAAAACact accacgaca CCCAAAAACGAA a crRNA ccctagaaccacgacagttt gtttgcctt GGGGACTAAAAC gcctt 1e-f Dengue CcaCas13b tttgcttctgtccagtgag tttgcttctgt GTTGGAACTGCT Dengue 1e CcaCas13 catggtcttcgGT ccagtgagc CTCATTTTGGAGG b crRNA TGGAACTGCTCTCATTTTG atggtcttcg GTAATCACAAC GAGGGTAATCACAAC 1e-f ssDNA 1 AsCas12a TAATTTCTACTCTTGTAGAT ctgtgtttatc TAATTTCTACTCT ssDNA1 1e AsCas12a ctgtgtttatccgctcacaa cgctcacaa TGTAGAT crRNA
TABLE-US-00002 TABLE 2 Target sequences used in this study DNA/ FIG. Name Target sequence RNA 11b Ebola attcgcagtgaagagttgtctttcacagttgtatcaaacggagccaaaaacatcagt RNA (SEQ ID No: 3279) ggtcagagtccggcgcgaacttcttccgacccagggaccaacacaacaactgaagac cacaaaatcatggcttcagaaaattcctctgcaatggttcaagtgcacagtcaa 11b Zika gacaccggaactccacactggaacaacaaagaagcactggtagagttcaaggacgca RNA (SEQ ID No: 3280) catgccaaaaggcaaactgtcgtggttctagggagtcaagaaggagcagttcacacg gcccttgctggagctctggaggctgagatggatggtgcaaagggaaggctgtcctct ggc 6a-f Thermonuclease agcgattgatggtgatactgttaaattaatgtacaaaggtcaaccaatgacattcag RNA (SEQ ID No: 3281) actattattggttgatacacctgaaacaaagcatcctaaaaaaggtgtagagaaata tggtcctgaagcaagtgcatttacgaaaaagatggtagaaaatgcaaagaaaattga ag 6a-f APML long cacctggatggaccgcctagccccaggagccccgtcataggaagtgaggtcttcctg RNA (SEQ ID No: 3282) cccaacagcaaccacgtggccagtggcgccggggaggcagccattgagacccagagc agcagttctgaagagatagtgcccagccctccctcgccaccccctctaccccgcatc taca 6a-f APML short ggaggagccccagagcctgcaagctgccgtgcgcaccgatggcttcgacgagttcaa RNA (SEQ ID No: 3283) ggtgcgcctgcaggacctcagctcttgcatcacccaggggaaagccattgagaccca gagcagcagttctgaagagatagtgcccagccctccctcgccaccccctctaccccg catc 7b-f Acyltransferase gtcgggcgcgcacgttttcccttcgctgagcacgctgcgcgcgtcgcctacgtgaat DNA (SEQ ID No: 3284) gcgctgttcgatgcgttggccgaaggcaacccgcgggtgagcgtgctcgacccctcc agcgtgctctgcgatggcctggattgtttcgccgaacgtgatggctggtcgctgtac atgg 7h-l Thermonuclease agcgattgatggtgatactgttaaattaatgtacaaaggtcaaccaatgacattcag DNA (SEQ ID No: 3285) actattattggttgatacacctgaaacaaagcatcctaaaaaaggtgtagagaaata tggtcctgaagcaagtgcatttacgaaaaagatggtagaaaatgcaaagaaaattga ag 8b Thermonuclease agcgattgatggtgatactgttaaattaatgtacaaaggtcaaccaatgacattcag DNA (SEQ ID No: 3286) actattattggttgatacacctgaaacaaagcatcctaaaaaaggtgtagagaaata tggtcctgaagcaagtgcatttacgaaaaagatggtagaaaatgcaaagaaaattga ag 8b Ea175 GGCCAGTTTGAATAAGACAATGAATTATTTTTACTATGTAAAAATCCACATCTTTCA DNA (SEQ ID No: 3287) CATTTCCATTCTTGTGTTTCA 8d-e Thermonuclease agcgattgatggtgatactgttaaattaatgtacaaaggtcaaccaatgacattcag DNA (SEQ ID No: 3288) actattattggttgatacacctgaaacaaagcatcctaaaaaaggtgtagagaaata tggtcctgaagcaagtgcatttacgaaaaagatggtagaaaatgcaaagaaaattga ag 8d-e Ea175 GGCCAGTTTGAATAAGACAATGAATTATTTTTACTATGTAAAAATCCACATCTTTCA DNA (SEQ ID No: 3289) CATTTCCATTCTTGTGTTTCA 9a ssRNA 1 GGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAAATATGGATTACTTGgt RNA (SEQ ID No: 3290) AGAACAGCAATCTACTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAG CTGTTTCCTGTGTTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAA AG 9a Thermonuclease agcgattgatggtgatactgttaaattaatgtacaaaggtcaaccaatgacattcag RNA (SEQ ID No: 3291) actattattggttgatacacctgaaacaaagcatcctaaaaaaggtgtagagaaata tggtcctgaagcaagtgcatttacgaaaaagatggtagaaaatgcaaagaaaattga ag 9a Dengue agtacatattcaggggccaacctctcaacaatgacgaagaccatgctcactggacag RNA (SEQ ID No: 3292) aagcaaaaatgctgctggacaacatcaacacaccagaagggattataccagctctct ttgaaccagaaagggagaagtcagccgccatagacggtgaataccgcctgaagggt 12a-c Ea175 GGCCAGTTTGAATAAGACAATGAATTATTTTTACTATGTAAAAATCCACATCTTTCA DNA (SEQ ID No: 3293) CATTTCCATTCTTGTGTTTCA 12d-f Ea81 ATTGTTACATTGTACACATACATAAGCAACATAAGCATCATTTGGTTTAATTCCTTC DNA (SEQ ID No: 3294) AATTCTAGAAATATTTGTTTGATTTTTTACTTCACGCCTACTCAT 10d-f Ea175 GGCCAGTTTGAATAAGACAATGAATTATTTTTACTATGTAAAAATCCACATCTTTCA DNA (SEQ ID No: 3295) CATTTCCATTCTTGTGTTTCA 1b-c Lectin aagttacaactcaataaggttgacgaaaacggcaccccaaaaccctcgtctcttggt DNA (SEQ ID No: 3296) cgcgccctctactccacccccatccacatttgggacaaagaaaccggtagcgttgcc agcttcgccgcttccttcaacttcaccttctatgcccctgacacaaaaaggcttgca gatgggcttgccttctttctcgc 1b-c ssDNA 1 GGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAAATATGGATTACTTGgt DNA (SEQ ID No: 3297) AGAACAGCAATCTACTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAG CTGTTTCCTGTGTTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAA AG 1e-f Zika gacaccggaactccacactggaacaacaaagaagcactggtagagttcaaggacgca RNA (SEQ ID No: 3298) catgccaaaaggcaaactgtcgtggttctagggagtcaagaaggagcagttcacacg gcccttgctggagctctggaggctgagatggatggtgcaaagggaaggctgtcctct ggc 1e-f Dengue agtacatattcaggggccaacctctcaacaatgacgaagaccatgctcactggacag RNA (SEQ ID No: 3299) aagcaaaaatgctgctggacaacatcaacacaccagaagggattataccagctctct ttgaaccagaaagggagaagtcagccgccatagacggtgaataccgcctgaagggt 1e-f ssDNA 1 GGCCAGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAAATATGGATTACTTGgt DNA (SEQ ID No: 3300) AGAACAGCAATCTACTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAG CTGTTTCCTGTGTTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAA AG
TABLE-US-00003 TABLE 3 RPA primers used in this study (SEQ ID Nos: 3301-3342) FIG. Name Sequence Target 7b RPA Acyltransferase F gaaatTAATACGACTCACTATAGGGCTACGTGAA acyltransferase with T7 TGCGCTGTTCGATG 7b RPA Acyltransferase R CATCACGTTCGGCGAAACAATCCAG acyltransferase 7c RPA Acyltransferase F gaaatTAATACGACTCACTATAGGGCTACGTGAA acyltransferase with T7 TGCGCTGTTCGATG 7c RPA Acyltransferase R CATCACGTTCGGCGAAACAATCCAG acyltransferase 7e RPA Acyltransferase F gaaatTAATACGACTCACTATAGGGCTACGTGAA acyltransferase with T7 TGCGCTGTTCGATG 7e RPA Acyltransferase R CATCACGTTCGGCGAAACAATCCAG acyltransferase 7h RPA Thermonuclease F gaaatTAATACGACTCACTATAGGGTGTACAAAG thermonuclease with T7 GTCAACCAATGACATTCAG 7h RPA Thermonuclease R TGCACTTGCTTCAGGACCATATTTC thermonuclease 7i RPA Thermonuclease F gaaatTAATACGACTCACTATAGGGTGTACAAAG thermonuclease with T7 GTCAACCAATGACATTCAG 7i RPA Thermonuclease R TGCACTTGCTTCAGGACCATATTTC thermonuclease 7k RPA Thermonuclease F gaaatTAATACGACTCACTATAGGGTGTACAAAG thermonuclease with T7 GTCAACCAATGACATTCAG 7k RPA Thermonuclease R TGCACTTGCTTCAGGACCATATTTC thermonuclease 8b Multiplexing RPA gaaatTAATACGACTCACTATAGGGAGCGATTGA thermonuclease Thermonuclease F TGGTGATACTGTTAAA with T7 8b Multiplexing RPA TCGTAAATGCACTTGCTTCAGGACC thermonuclease Thermonuclease R 8b RPA Ea175 F with T7 gaaattaatacgactcactatagggGGCCAGTTT Ea175 GAATAAGACAATG 8b RPA Ea175 R GGCCAGTTTGAATAAGACAATG Ea175 8d Multiplexing RPA gaaatTAATACGACTCACTATAGGGAGCGATTGA thermonuclease Thermonuclease F TGGTGATACTGTTAAA with T7 8d Multiplexing RPA TCGTAAATGCACTTGCTTCAGGACC thermonuclease Thermonuclease R 8d RPA Ea175 F with T7 gaaattaatacgactcactatagggGGCCAGTTT Ea175 GAATAAGACAATG 8d RPA Ea175 R GGCCAGTTTGAATAAGACAATG Ea175 8d Multiplexing RPA gaaatTAATACGACTCACTATAGGGAGCGATTGA thermonuclease Thermonuclease F TGGTGATACTGTTAAA with T7 8d Multiplexing RPA TCGTAAATGCACTTGCTTCAGGACC thermonuclease Thermonuclease R 8d RPA Ea175 F with T7 gaaattaatacgactcactatagggGGCCAGTTT Ea175 GAATAAGACAATG 8d RPA Ea175 R GGCCAGTTTGAATAAGACAATG Ea175 12a RPA Ea175 F with T7 gaaattaatacgactcactatagggGGCCAGTTT Ea175 GAATAAGACAATG 12a RPA Ea175 R GGCCAGTTTGAATAAGACAATG Ea175 12c RPA Ea175 F with T7 gaaattaatacgactcactatagggGGCCAGTTT Ea175 GAATAAGACAATG 12c RPA Ea175 R GGCCAGTTTGAATAAGACAATG Ea175 12d RPA Ea81 F with T7 gaaattaatacgactcactatagggATTGTTACA Ea81 TTGTACACATACA 12d RPA Ea81 R ATTGTTACATTGTACACATACA Ea81 12f RPA Ea81 F with T7 gaaattaatacgactcactatagggATTGTTACA Ea81 TTGTACACATACA 12f RPA Ea81 R ATTGTTACATTGTACACATACA Ea81 10e RPA Ea175 F with T7 gaaattaatacgactcactatagggGGCCAGTTT Ea175 GAATAAGACAATG 10e RPA Ea175 R TGAAACACAAGAATGGAAATGT Ea175 1b RPA ssDNA1 F with T7 gaaattaatacgactcactatagggGATCCTCTA ssDNA1 GAAATATGGATTACTTGGTAGAACAG 1b RPA ssDNA1 R GATAAACACAGGAAACAGCTATGACCATGATTAC ssDNA1 G 1b RPA lectin F with T7 gaaatTAATACGACTCACTATAGGGTCAATAAGG Lectin TTGACGAAAACGGCAC 1b RPA lectin R TAGAAGGTGAAGTTGAAGGAAGCGG Lectin 1c RPA ssDNA1 F with T7 gaaattaatacgactcactatagggCATCCTCTA ssDNA1 GAAATATGGATTACTTGGTAGAACAG 1c RPA ssDNA1 R GATAAACACAGGAAACAGCTATGACCATGATTAC ssDNA1 G 1c RPA lectin F with T7 gaaatTAATACGACTCACTATAGGGTCAATAAGG Lectin TTGACGAAAACGGCAC 1c RPA lectin R TAGAAGGTGAAGTTGAAGGAAGCGG Lectin
TABLE-US-00004 TABLE 4 HDA primers used in this study (SEQ ID No. 3343 and 3344) FIG. Name Sequence Target 10e HDA Ea175 F gaaattaatacgactcactatagg Ea175 with T7 gGGCCAGTTTGAATAAGACAATG 10e HDA Ea175 R TGAAACACAAGAATGGAAATGT Ea175
TABLE-US-00005 TABLE 5 Reporter sequences used in this study Antigen/ Compatible FIG. Name Sequence Flurorphore quencher enzyme 11b Rnase Alert v2 N/A N/A N/A LwaCas13a/ CcaCas13b 6a Rnase Alert v2 N/A N/A N/A LwaCas13a/ CcaCas13b 6b Rnase Alert v2 N/A N/A N/A LwaCas13a/ CcaCas13b 6c Rnase Alert v2 N/A N/A N/A LwaCas13a/ CcaCas13b 6d Rnase Alert v2 N/A N/A N/A LwaCas13a/ CcaCas13b 6e Single-plex lateral /56-FAM/rUrUrUrUrUrU/3Bio/ FAM Biotin LwaCas13a/ flow reporter CcaCas13b 6f Single-plex lateral /56-FAM/rUrUrUrUrUrU/3Bio/ FAM Biotin LwaCas13a/ flow reporter CcaCas13b 7b Ranse Alert v2 N/A N/A N/A LwaCas13a/ CcaCas13b 7c Ranse Alert v2 N/A N/A N/A LwaCas13a/ CcaCas13b 7e Single-plex lateral /56-FAM/rUrUrUrUrUrU/3Bio/ FAM Biotin LwaCas13a/ flow reporter CcaCas13b 7h Poly-U reporter /56-FAM/rUrUrUrUrU/3IABkFQ/ FAM Iowa Black LwaCas13a/ FQ CcaCas13b 7i Poly-U reporter /56-FAM/rUrUrUrUrU/3IABkFQ/ FAM Iowa Black LwaCas13a/ FQ CcaCas13b 7k Single-plex lateral /56-FAM/rUrUrUrUrUrU/3Bio/ FAM Biotin LwaCas13a/ flow reporter CcaCas13b 8b LwaCas13a /56-FAM/TArArUGC/3IABkFQ/ FAM Iowa Black LwaCas13a Fluorescence FQ reporter 8b CcaCas13b /5HEX/TArUrAGC/3IABkFQ/ HEX Iowa Black CcaCas13b Fluorescence FQ reporter 8d LwaCas13a /5TYE665/T*A*rArUG*C*/3 TYE 665 AlexaFluor LwaCas13a Lateral Flow AlexF488N/ 488 reporter 8d CcaCas13b /5TYE665/T*A*rUrAG*C*/3 TYE 665 FAM CcaCas13b Lateral Flow 6-FAM reporter 8d LwaCas13a /5TYE665/T*A*rArUG*C*/3 TYE 665 AlexaFluor LwaCas13a Lateral Flow AlexF488N/ 488 reporter 8d CcaCas13b /5TYE665/T*A*rUrAG*C*/3 TYE 665 FAM CcaCas13b Lateral Flow 6-FAM/ reporter 9a Rnase Alert v2 N/A N/A N/A LwaCas13a/ CcaCas13b 12a Poly-U reporter /56-FAM/rUrUrUrUrU/3IABkFQ/ FAM Iowa Black LwaCas13a/ FQ CcaCas13b 12c Single-plex lateral /56-FAM/rUrUrUrUrU/3Bio/ FAM Biotin LwaCas13a/ flow reporter CcaCas13b 12d Poly-U reporter /56-FAM/rUrUrUrUrU/3IABkFQ/ FAM Iowa Black LwaCas13a/ FQ CcaCas13b 12f Single-plex lateral /56-FAM/rUrUrUrUrU/3Bio/ FAM Biotin LwaCas13a/ flow reporter CcaCas13b 10b Helicase reporter /56-FAM/CAGAGGAACGTCTATCTA FAM N/A UvrD FAM ACGGTTGGTATCTTGAATGCTCAGTC helicases (SEQ ID NO: 3345) CCTTT 10b Helicase reporter AAAGGGACTGAGCATTCAAGATACCA N/A BHQ-1 UvrD BHQ1 ACCGTTAGATAGACGTTCCTCTG/ helicases (SEQ ID NO: 3346) 3BHQ_1/ 10d Poly-U reporter /56-FAM/rUrUrUrUrU/3IABkFQ/ FAM Iowa Black LwaCas13a/ FQ CcaCas13b 10e Poly-U reporter /56-FAM/rUrUrUrUrU/3IABkFQ/ FAM Iowa Black LwaCas13a/ FQ CcaCas13b 1b FAM LwaCas13a /56-FAM/TArArUGC/3Bio/ FAM Biotin LwaCas13a Lateral Flow reporter 1b FAM CcaCas13b /56-FAM/TArUrAGC/3Dig_N/ FAM DIG CcaCas13b Lateral Flow reporter 1c FAM LwaCas13a /56-FAM/TArArUGC/3Bio/ FAM Biotin LwaCas13a Lateral Flow reporter 1c FAM CcaCas13b /56-FAM/TArUrAGC/3Dig_N/ FAM DIG CcaCas13b Lateral Flow reporter 1e LwsCas13a /5TYE665/T*A*rArUG*C*/3 TYE 665 AlexaFlour LwaCas13a Lateral Flow AlexF488N/ 488 reporter 1e CcaCas13b /5TYE665/T*A*rUrAG*C*/3 TYE 665 FAM CcaCas13b Lateral Flow 6-FAM reporter 1e AsCas12a /5TYE665/CCCCC/3Dig_N/ TYE 665 DIG AsCas12a Lateral Flow reporter 1f LwaCas13a /5TYE665/T*A*rArUG*C*/3 TYE 665 AlexaFlour LwaCas13a Lateral Flow AlexF488N/ 488 reporter 1f CcaCas13b /5TYE665/T*A*rUrAG*C*/3 TYE 665 FAM CcaCas13b Lateral Flow 6-FAM reporter 1f AsCas12a /5TYE665/CCCCC/3Dig_N/ TYE 665 DIG AsCas12a Lateral Flow reporter
TABLE-US-00006 TABLE 6 Cas13 proteins used in this study Protein Accession Abbreviation name Strain name Benchling link number Lwa LwaCas13a Leptotrichia wadei https://benchling.com/s/seq- WP_021746774.1 66CfLwu7sLMQMbcXe7Ih Cca CcaCas13b Capnocytophaga canimorsus https://benchling.com/s/seq- WP_013997271 BNVzFUQjqSnkYLARxLwE
TABLE-US-00007 TABLE 7 Helicase proteins used in this study Accession number Protein Strain Superhelicase (lacks superhelicase Abbreviation name name mutation mutations) Tte Tte-UvrD Thermoanaerobacter − AAM23874.1 tengcongensis Super Tte Super Tte-UvrD Thermoanaerobacter + AAM23874.1 tengcongensis Tet Tet-UvrD Thermoanaerobacter − WP_003870487.1 ethanolicus Super Tet Super Tet-UvrD Thermoanaerobacter + WP_003870487.1 ethanolicus Bsp Bsp-UvrD Bacillus sp. FJAT-27231 − WP_049660019.1 Super Bsp Super Bsp-UvrD Bacillus sp. FJAT-27231 + WP_049660019.1 Bme Bme-UvrD Bacillus megaterium + WP_034654680.1 Bsi Bsi-UvrD Bacillus simplex + WP_095390358.1 Pso Pso-UvrD Paeniclostridium sordellii + WP_055343022.1
EXAMPLES
Example 1—One-Pot HDA-SHERLOCK is Capable of Quantitative Detection of Different Targets
[0288] A schematic of helicase reporter for screening DNA unwinding activity is shown in
Example 2—One-Pot RPA-SHERLOCK is Capable of Rapid Detection of Different Targets
[0289] Kinetic curves were also generated of one-pot RPA detection of a restriction endonuclease gene fragment (Ea175) from Treponema denticola (
Example 3—Multiplexed Lateral Flow Detection with SHERLOCK
[0290] A schematic of the proposed multiplex lateral flow design with RPA preamplification for two probes is shown in
Example 4—SHERLOCK Guide Design Model is Capable of Predicting Highly Active crRNAs for SHERLOCK Detection
[0291] Previous tiling of SHERLOCK guides along targets has demonstrated significant variation of signal between guide RNAs with LwaCas13a and CcaCas13b (Gootenberg, 2018), which has an effect on the overall kinetics and sensitivity of the assay. While a sequence constraint known as a protospacer flanking site (PFS) exists for Cas13 targeting (Abudayyeh, 2016; Smargon, 2017), many guide RNAs without the correct PFS retain activity. Applicants therefore hypothesized that some combination of the PFS and other sequence and guide features might be driving the efficacy of Cas13 detection. A machine learning approach was applied to train a logistic regression model on the collateral activity of hundreds of guides, using a combination of guide sequence, flanking target sequence, guide position, and guide GC content as input features (
[0292] A schematic of the computational workflow of the SHERLOCK guide design tool is shown in
[0293] Given the wide variance of guide efficiencies for both LwaCas13a and CcaCas13b, Applicants designed a model that would select for the “best” performing guides for each enzyme. As a majority of LwaCas13a guides had activity above background (
[0294] To further validate the models beyond the cross-validation, a panel of new crRNAs was designed on the thermonuclease transcript, as well as two additional transcripts from the long and short isoforms of the PML/RARA fusion associated with acute promyelocytic leukaemia (APML). Applicants found that both the LwaCas13a and CcaCas13b models succeeded at predicting guide RNA activity with significance (
[0295] Applicants next attempted to combine Applicants' top predicted crRNAs with recombinase polymerase amplification (RPA)(Piepenburg, 2006) in a SHERLOCK reaction to attain single-molecule sensitivity. As previous versions of the SHERLOCK assay have been primarily two-step protocols with an initial RPA pre-amplification followed by T7 transcription and Cas13 detection, Applicants focused on enhancing the combination of these steps in order to generate a simplified SHERLOCK assay. After optimizing the relative RPA pellet amount to the overall Cas13 detection buffer, Applicants designed a one-pot SHERLOCK assay for the acyltransferase transcript derived from P. aeruginosa. Applicants found that the top predicted LwaCas13a allowed for fast and highly-sensitive (20 aM) detection of acyltransferase in a one-pot reaction format compared to the worst predicted crRNA (
[0296] Although SHERLOCK with RPA provided rapid detection of targets in the attomolar range with one-pot assays, Applicants hypothesized that alternative amplification strategies could provide less bias and result in improved quantitation. Helicase displacement amplification (HDA)(Vincent, 2004), relies on helicases to separate the DNA duplex and allow for primer invasion and amplification. To enable rapid HDA, Applicants profiled a set of UvrD helicase orthologs with a helicase reporter assay (
[0297] Finally, the one-pot RPA SHERLOCK assay was expanded to allow for multiplexing of multiple targets (
[0298] In this study, Applicants show that SHERLOCK assays can be reliably designed with high sensitivity and fast kinetics using a machine learning approach, accessible at sherlock.genome-engineering.org. This guide design tool has broad applicability for both in vitro and in vivo RNA targeting applications and can be readily extended to include other useful Cas13 and Cas12 orthologs with collateral activity, including Cas13d (Yan, 2018; Konermann, 2018), Cas12a (Zetsche, 2015; Chen, 2018; Li, 2018), Cas12b (Shmakov, 2015; Li, 2018), and many other Cas12/Cas13 family members (Yan, 2019; Shmakov, 2017). Using Applicants' design tool, Applicants generate highly sensitive assays suitable for portable lateral flow detection of one or two targets using LwaCas13a and CcaCas13b, which can be performed in a single step, reducing pipetting steps and eliminating potential contamination concerns from opening of post-amplification samples. Additionally, by augmenting with DNA collateral detection with AsCas12a, Applicants can perform multiplexing of three targets in a portable lateral flow format. Applicants also apply helicase engineering to develop a new CRISPR-detection compatible amplification method, super HDA, and demonstrate the quantitative nature of super HDA SHERLOCK. The advances here increase the accessibility of the SHERLOCK platform, bringing it closer to deployment as a simple, portable nucleic acid diagnostic.
Example 2
[0299] Applicants use the machine learning model predicts the efficiency of Cas13 transcript knockdown in mammalian cells. We apply our guide prediction model to design optimal guides for sensitive detection of chromosomal fusion rearrangements characteristic of acute promyelocytic leukemia (APML) and acute lymphoblastic leukemia (ALL) in a multiplexed lateral flow readout.
[0300] To further validate the machine learning models beyond the cross-validation, we designed a panel of new crRNAs using the machine learning model targeting either the thermonuclease transcript or two additional transcripts from the long and short isoforms of the PML/RARA fusion associated with acute promyelocytic leukemia (APML). We found that both the LwaCas13a and CcaCas13b models succeeded at predicting guide RNA activity (LwaCas13a model validation has R values of 0.79, 0.54, and 0.41; CcaCas13b model validation has R values of 0.44, 0.69, and 0.89) (
[0301] Previous versions of the SHERLOCK assay have been a two-step format with an initial recombinase polymerase amplification (RPA).sup.19 followed by T7 transcription and Cas13 detection. To simplify the SHERLOCK assay, we focused on optimizing a one-pot amplification and detection protocol by combining both steps into a single reaction with the best predicted crRNAs. We designed a one-pot SHERLOCK assay for a synthetic acyltransferase transcript derived from Pseudomonas aeruginosa, a significant human pathogen that requires rapid diagnosis. We found that the best predicted crRNA for LwaCas13a allowed for fast and highly-sensitive (20 aM) detection of acyltransferase in a one-pot reaction format compared to the worst predicted crRNA (
[0302] To achieve even higher sensitivity with one-pot assays, we explored alternative amplification strategies, which could provide less bias and result in a more quantitative assay. Helicase displacement amplification (HDA).sup.20 relies on helicases to separate the DNA duplex and allow for primer invasion and amplification, usually at high temperatures like 65° C. To enable rapid HDA, we profiled a set of UvrD helicase orthologs with engineered mutations.sup.21 with a helicase reporter assay (
[0303] We further expanded the one-pot RPA SHERLOCK assay to allow for multiplexing of multiple targets (
[0304] Lastly, we sought to apply SHERLOCK detection to a clinical setting, where using the best crRNA for a given target is essential for fast and sensitive performance. Acute promyelocytic leukaemia (APML) and acute lymphocytic leukemia (ALL) cancers are caused by chromosomal fusions in the transcribed mRNA, and distinguishing these rapidly is critical for effective treatment and prognosis.sup.23. To design robust clinical-grade SHERLOCK assays, we employed the Cas13 guide design tool to predict top guides for three fusion transcripts characteristic of APML and ALL cancers: PML-RARa Intron/exon 6 fusion, PML-RARa Intron 3 fusion, and BCR-ABL p210 b3a2 fusion.sup.23 (
[0305] Together, these results demonstrate that SHERLOCK assays can be reliably designed with high sensitivity and fast kinetics using a machine learning approach, accessible at sherlock.genome-engineering.org. This guide design tool has broad applicability for both in vitro and in vivo RNA targeting applications and can be readily extended to include other useful Cas13 and Cas12 orthologs with collateral activity, including Cas13d.sup.13,24, Cas12a.sup.8,9,11, Cas12b.sup.5,12, and many other Cas12/Cas13 family members.sup.7,25. Using our design tool, we generated highly sensitive assays suitable for portable lateral flow detection of one or two targets using LwaCas13a and CcaCas13b, which can be performed in a single step, reducing pipetting steps and eliminating potential contamination of post-amplification samples. Additionally, by utilizing DNA collateral detection with AsCas12a, we can perform multiplexing of three targets in a lateral flow format. With these improvements, SHERLOCK can now achieve multiplexing of up to four targets simultaneously by fluorescence.sup.1 and three targets by lateral flow. We also apply helicase engineering to develop a new CRISPR-detection compatible amplification method, super HDA, and demonstrate the quantitative nature of super HDA SHERLOCK. Finally, we demonstrate the facile applicability of the guide design model to develop a clinically relevant test for APML and ALL cancers with high sensitivity and performance in a portable lateral flow format. The advances here increase the accessibility of the SHERLOCK platform, deploying it as a simple, portable nucleic acid diagnostic with broad clinical utility and provide a user-friendly web tool for Cas13 guide design for both in vivo RNA targeting and SHERLOCK assays.
Methods
Protein Expression and Purification of Cas13
[0306] Expression and purification of LwaCas13a and CcaCas13b was performed as previously described.sup.1,2. In brief, we transformed bacterial expression vectors into Rosetta™ 2(DE3)pLysS Singles Competent Cells (Millipore) and scaled up bacterial growth in 4 L of Terrific Broth 4 growth media (TB). Cell pellets were lysed by high-pressure cell disruption using the LM20 Microfluidizer system at 27,000 PSI and freed protein was bound via StrepTactin Sepharose (GE) resin. After washing, protein was released from the resin via SUMO protease digestion overnight and protein was subsequently purified by cation exchange chromatography and then gel filtration purification using an AKTA PURE FPLC (GE Healthcare Life Sciences). Eluted protein was then concentrated into Storage Buffer (600 mM NaCl, 50 mM Tris-HCl pH 7.5, 5% glycerol, 2 mM DTT) and frozen at −80° C. for storage.
Nucleic Acid Target and crRNA Preparation
[0307] Nucleic acid targets and crRNAs were prepared as previously described.sup.1,2. Briefly, targets were either used as ssDNA or PCR amplified with NEBNext PCR master mix, gel extracted, and purified using MinElute gel extraction kits (Qiagen). For RNA detection reactions, RNA was prepared by using either ssDNA targets with double-stranded T7-promoter regions or fully double-stranded PCR products in T7 RNA synthesis reactions at 30° C. using the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs). RNA was then purified using MEGAclear Transcription Clean-up kit (Thermo Fisher).
[0308] crRNAs were synthesized by using ultramer ssDNA substrates (IDT) that were double stranded in the T7 promoter region through an annealed primer. Synthesized crRNAs were prepared using these templates in T7 expression assays at 37 C using the HiScribe T7 Quick High Yield RNA Synthesis kit (NEB). RNAs were then purified using RNAXP clean beads (Beckman Coulter) at 2× ratio of beads to reaction volume, with an additional 1.8× supplementation of isopropanol (Sigma).
[0309] _All crRNA and target sequences are listed in Tables 1 and 2, respectively.
Fluorescent Cleavage Assay
[0310] Cas13 detection assays were performed as previously described.sup.1,2 In brief, 45 nM Cas13 protein (either CcaCas13b or LwaCas13a), 20 nM crRNA, 1 nM target RNA, 125 nM RNAse Alert v2 (Invitrogen), and 1 unit/μL murine RNase inhibitor (NEB) were combined together in 20 μL of cleavage buffer (20 mM HEPES, 60 mM NaCl, 6 mM MgCl2, pH 6.8). Reactions were incubated at 37° C. on a Biotek plate reader for 3 hours with fluorescent kinetic measurements taken every 5 minutes.
SHERLOCK Nucleic Acid Detection with RPA
[0311] For RPA reactions, primers were designed using NCBI Primer-BLAST.sup.26 under default parameters except for (100-140 nt), primer melting temperatures (54° C.-67° C.), and primer size (30-35 nt). All primers were ordered as DNA (Integrated DNA Technologies).
[0312] One-pot SHERLOCK-RPA reactions were carried out as previously described.sup.1,2 with slight modifications. Reactions were prepared with the following reagents (added in order): 0.5×RPA rehydration and 0.5× resuspended RPA lyophilized pellet, 2 mM rNTPs, 1.1 units/μL RNAse inhibitor, 1 unit/μL T7 RNA polymerase (Lucigen), 0.96 μM total RPA primers (0.48 μM each of forward primer with T7 handle and reverse primer), 57.8 nM Cas13 protein (CcaCas13b or LwaCas13a), 23.3 nM crRNA, 136.5 nM fluorescent substrate reporter, 5 mM MgCl2, 14 mM MgAc, and varying amounts of DNA target input.
[0313] For detection with fluorescent readout, either a quenched polyU FAM reporter (TriLink) or RNAse Alert v2 (Invitrogen), were used as reporters. 20 μL reactions were incubated for 2-6 hours at 37° C. on a Biotek plate reader with kinetic measurements taken either every 2.5 or 5 minutes. All reporter sequences are listed in Table 5.
[0314] One-pot SHERLOCK-RPA reactions were modified for multiplexing by maintaining total primer concentration at 0.96 μM over all four input primers (0.24 μM each of both forward primers with T7 handle and reverse primers), maintaining crRNA concentrations at 23.3 nM (with 11.7 nM each crRNA), maintaining Cas13 total protein concentration at 57.8 nM, (28.9 nM CcaCas13b and 28.9 nM LwaCas13a), and doubling total reporter concentration (136.5 nM LwaCas13a AU-FAM reporter; 136.5 nM CcaCas13b UA-HEX reporter; see Table 5 for all reporters). 20 μL reactions were incubated for 2-6 hours at 37° C. on a Biotek plate reader with kinetic measurements in wavelengths for HEX and FAM taken every 2.5 or 5 minutes.
Protein Expression and Purification of UvrD Helicases
[0315] UvrD Helicases sequences were ordered as E. coli codon optimized gBlocks Gene Fragments (IDT) and cloned into TwinStrep-SUMO-expression plasmid via Gibson assembly. Alanine ‘Super-helicase’ mutants were generated using PIPE-site-directed mutagenesis cloning from the TwinStrep-SUMO-UvrD Helicase expression plasmids. In brief, primers with short overlapping sequences at their ends were designed to harbor the desired changes. After incomplete-extension PCR amplification (KAPA HiFi HotStart 2×PCR), reactions were treated with Dpn1 restriction endonuclease for 30 minutes at 37° C. to degrade parental plasmid. Two microliters of the reaction were directly transformed into Stble3 chemically competent E. coli cells. For expression, sequence verified plasmids were transformed into BL21(DE3)pLysE E. coli cells. For each UvrD Helicase variant, 2 L of Terrific Broth media (12 g/L tryptone, 24 g/L yeast extract, 9.4 g/L K2HPO, 2.2 g/L KH2PO4), supplemented with 100 μg/mL ampicillin, was inoculated with 20 mL of overnight starter culture and grown until OD600 0.4-0.6. Protein expression was induced with the addition of 0.5 mM IPTG and carried out for 16 hours at 21° C. with 250 RPM shaking speed. Cells were collected by centrifugation at 5,000 RPM for 10 minutes, and paste was directly used for protein purification (10-20 g total cell paste). For lysis, 10 g of bacterial paste was resuspended via stirring at 4° C. in 50 mL of lysis buffer (50 mM Tris-HCl pH 8, 500 mM NaCl, 1 mM BME (Beta-Mercapotethanol, Sigma) supplemented with 50 mg Lysozyme, 10 tablets of protease inhibitors (cOmplete, EDTA-free, Roche Diagnostics Corporation), and 500 U of Benzonase (Sigma). The suspension was passed through a LM20 microfluidizer at 25,000 psi, and lysate was cleared by centrifugation at 10,000 RPM, 4° C. for 1 hour. Lysate was incubated with 2 mL of StrepTactin superflow resin (Qiagen) for 2 hours at 4° C. on a rotary shaker. Resin bound with protein was washed three times with 10 mL of lysis buffer, followed by addition of 50 μL SUMO protease (in house) in 20 mL of IGEPAL lysis buffer (0.2% IGEPAL). Cleavage of the SUMO tag and release of native protein was carried out overnight at 4° C. in Econo-column chromatography column under gentle mixing on a table shaker. Cleaved protein was collected as flow-through, washed three times with 5 mL of lysis buffer, and checked on a SDS-PAGE gel.
[0316] Protein was diluted ion exchange buffer A containing no salt (50 mM Tris-HCl pH 8, 6 mM BME (Beta-Mercapotethanol, Sigma), 5% Glycerol, 0.1 mM EDTA) to get the starting NaCl concentration of 50 mM. Protein was then loaded onto a 5 mL Heparin HP column (GE Healthcare Life Sciences) and eluted over a NaCl gradient from 50 mM to 1 M. Fractions of eluted protein were analyzed by SDS-PAGE gel and Coomassie staining, pooled and concentrated to 1 mL using 10 MWCO centrifugal filters (Amicon). Concentrated protein was loaded in 0.5-3 mL 10 MWCO Slide-A-Lyzer Dialysis cassettes and dialyzed overnight at 4° C. against protein storage buffer (20 mM Tris-HCl, pH 7.5, 200 mM NaCl, 1 mM EDTA, 1 mM TCEP, 50% glycerol). Protein was quantified using Pierce reagent (Thermo) and stored at −20° C.
Lateral Flow Readout of Cas13 and SHERLOCK
[0317] For single-plex detection with lateral flow readout, a FAM-RNA-biotin reporter was substituted in Cas13 or SHERLOCK reactions for the fluorescent reporter at a final concentration of 1 μM (unless otherwise indicated). 20 μL reactions were incubated between 30 and 180 minutes, after which the entire reaction was resuspended in 100 μL of HybriDetect 1 assay buffer (Milenia). Visual readout was achieved with HybriDetect 1 lateral flow strips (Milenia), and strips were imaged in a light box with a α7 III with 35-mm full-frame image sensor camera (Sony) equipped with a FE2.8/90 Macro G OSS lens.
[0318] Two-pot SHERLOCK-RPA multiplexed lateral flow reactions were adapted from previously described multiplexed fluorescent reactions.sup.1,2. In brief, RPA reactions were performed with the TwistAmp® Basic (TwistDx) protocol with the exception that 280 mM MgAc was added prior to input DNA. Reactions were run with 1 μL of input for 1 hr at 37° C. Cas13 detection assays were performed with 45 nM purified Cas13, 22.5 nM crRNA, lateral flow RNA reporter (4 μM LwaCas13a multiplexed reporter; 2 μM CcaCas13b multiplexed reporter; see Table 5 for all reporters), 0.5 μL murine RNase inhibitor (New England Biolabs), and 1 μL of post-RPA input nucleic acid target in nuclease assay buffer (20 mM HEPES, 60 mM NaCl, 6 mM MgCl.sub.2, pH 6.8). 20 μL reactions were suspended in 100 μL of HybriDetect 1 assay buffer (Milenia) and run on custom multiplexed strips (DCN Diagnostics). The custom lateral flow strips were designed to have capture lines containing Anti-digoxigenin antibodies (ab64509, abcam), Streptavidin, Anti-FITC antibodies (ab19224, abcam), and Anti-Alexa 488 antibodies (A619224, Life Technologies). The strips consisted of a 25 mm CN95 Sartorius nitrocellulose membrane, an 18 mm 6614 Ahlstrom synthetic conjugate pad for sample application, and a 22 mm Ahlstrom grade 319 paper wick pad. Strips were imaged using an Azure c400 imaging system in the Cy5 channel.
[0319] One-pot multiplexed SHERLOCK-RPA was adapted for lateral flow by lowering the CcaCas13b multiplexed reporter concentration to a concentration of 78 nM and the LwaCas13a reporter concentration to 1 μM (see Table 5 for all reporters). This was to accommodate for different fluorescent intensities observed for the reporter when binding to the DCN strips. Lateral flow reactions were resuspended in buffer, run on DCN strips, and imaged as described above.
Fluorescent Helicase Activity Assay
[0320] Helicase substrate was generated by annealing 300 pmol of fluorescent 5′-FAM-top strand with 900 pmol of quencher 3′-BHQ1 bottom strand in 1× duplex buffer (30 mM HEPES, pH 7.5; 100 mM potassium acetate) for 5 minutes at 95° C., followed by slow cool down to 4° C. (1° C./5 seconds) in PCR thermocycler. After annealing, reactions were diluted 1:10 in Nuclease free water (Gibco). Helicase unwinding assays were carried out in 20 μL reactions containing 1× Thermopol buffer (NEB), 250 nM of annealed quenched helicase substrate, 3 mM ATP or 3 mM dATP (The-UvrD dATP), 200 nM UvrD Helicase and 500 nM of capture strand oligonucleotide. To determine temperature activity profiles, reactions and no helicase control were incubated at temperatures ranging from 37° C. to 62° C. with 5° C. intervals for 60 minutes in a PCR thermocycler. Reactions were immediately transferred to a 384-well plate (Corning®) and analysed on a fluorescent plate reader (BioTek) equipped with a FAM/HEX filter set.
SHERLOCK Nucleic Acid Detection with HDA
[0321] For detection with SHERLOCK-HDA, procedures for amplification were inspired by previously described isothermal helicase dependent amplification.sup.20,27 with significant modifications. Reactions were prepared with the following reagents: 1× Sau polymerase buffer (Intact Genomics), 2.5% PEG 30%, 1 mM rNTPs, 0.4 mM dNTPs, and 3 mM ATP, 1 units/μL RNAse inhibitor, 1.5 unit/μL T7 RNA polymerase (Lucigen), 0.4 μM total HDA primers (0.2 μM each of forward primer with T7 handle and reverse primer), 43.3 nM Cas13 protein (CcaCas13b or LwaCas13a), 19.8 nM crRNA, 125 nM fluorescent substrate reporter (quenched polyU FAM reporter, TriLink), 0.2 units/μL Sau polymerase, 25 ng/μL T4 gp32 protein (NEB), 6.25 ng UvrD helicase, and varying amounts of DNA target input. 20 μL reactions were incubated for 2-6 hours at 37° C. on a Biotek plate reader with kinetic measurements taken either every 2.5 or 5 minutes.
Digital Droplet PCR Quantification of Input DNA
[0322] DNA and RNA dilution series used as input target for one-pot SHERLOCK-RPA amplification reactions were quantified separately using Droplet Digital PCR (BioRad), as described before.sup.1,2. Briefly, ddPCR probes were ordered from IDT PrimeTime qPCR probes with a quenched FAM/ZEN reporter. Dilution series were mixed with either (for DNA) BioRad's Supermix for Probes (no dUTP) or with (for RNA) BioRad's One-Step RT-ddPCR Advanced Kit for Probes and the corresponding qPCR probe for the target sequence. The QX200 droplet generator (BioRad) was used to generate droplets; after transferring to a droplet digital PCR plate (BioRad), thermal cycling was carried out with conditions as described in the BioRad protocol (with the exception of the Ea175 target, for which the annealing temperature was lowered according to the lower melting temperature of the primer set). Concentrations were measured using a QX200 droplet reader (Rare Event Detection, RED).
Analysis of SHERLOCK Fluorescence Data
[0323] Fluorescent measurements were analyzed as described previously.sup.1,2. Background subtracted fluorescence was calculated by subtracting the initial measured fluorescence. All reactions were run with at least three technical replicates and a control condition containing no target input.
Analysis of Lateral Flow Results
[0324] Acquired images were converted to 8-bit grayscale using photoshop and then imported into ImageLab software (BioRad Image Lab Software 6.0.1). Images were inverted and lanes were manually adjusted to fit the lateral flow strips. Bands were picked automatically and the background was adjusted manually to allow band comparison. Width of bands and background adjustment was kept constant between all bands in the same image.
Predictive Model of Cas13 crRNA Activity
[0325] Guide activity values from the Cas13 detection tiling experiments were pre-processed by background subtracting the zero time-point fluorescence from the terminal fluorescence value. On a per-target basis, these values were further normalized to the max or median value or used as raw fluorescence values. Training was performed using a series of thresholds to classify guides into two classes (good or bad) and the best threshold was selected based on model performance. Separately, performance was also compared to separating guides into two classes based on being in the top quintile per target (good guides). For each protein (LwaCas13a or CcaCas13b), the best guide classification method was selected based on model performance.
[0326] To generate features for each guide, one-hot encoding was used to represent mono-nucleotide and di-nucleotide base identities across the guide and flanking sequence in the target. The flanking sequence length was an additional variable that was determined by measuring model performance across different flanking sequence lengths. Additional features used were normalized positions of the guide in the target and the GC content of the guide.
[0327] Logistic regressions were tested across the variable guide classification methods, flanking sequence lengths, logistic regulation tuning parameters, and regularization methods (L1 and L2). Training was performed by separating the training set into three smaller sets for training, testing, and validation. After performing three-fold cross validation on the train and test sets, a final validation of the best model was used to generate AUC curves and assay final model performance. The best performing models were then selected for the LwaCas13a and CcaCas13b datasets.
In Vivo Knockdown Experiments
[0328] To evaluate the in vivo predictive performance of the LwaCas13a guide design model, we tested guide knockdown in mammalian cell culture. Knockdown experiments were performed in HEK293FT cells (American Type Culture Collection (ATCC)), which were grown in Dulbecco's Modified Eagle Medium with high glucose, sodium pyruvate, and GlutaMAX (Thermo Fisher Scientific), additionally supplemented with 1× penicillin-streptomycin (Thermo Fisher Scientific) and 10% fetal bovine serum (VWR Seradigm). Twenty-four hours prior to transfection, cells were plated at 20,000 cells per well in 96-well poly-D-lysine plates (BD Biocoat). When cells reached ˜90% confluency, 150 ng of LwaCas13 plasmid, 300 ng of guide expression plasmid, and 40 ng of luciferase reporter plasmid were transfected using Lipofectamine 2000 (Thermo Fisher Scientific). Plasmids were combined in Opti-MEM I Reduced Serum Medium (Thermo Fisher) to a total of 25 μL and added to 25 μL of a 2% Lipofectamine 2000 mixture in Opti-MEM. After incubation for 10 minutes, the plasmid Lipofectamine solutions were added to cells. At 48 hours post transfection, supernatant was harvested to measure secreted Gaussia luciferase and Cypridina luciferase levels using assay kits (Targeting Systems) on a plate reader (Biotek Synergy Neo 2) with an injection protocol. All replicates performed are biological replicates.
Sample Collection and Acquisition from Patients with PML-RARa and BCR-ABL Fusions
[0329] Cryopreserved bone marrow samples were obtained from the Pasquerello Tissue Bank at the Dana-Farber Cancer Institute following database query for samples harboring the PML-RARa and BCR-ABL fusion transcripts. Fresh peripheral blood and bone marrow aspirate was also obtained from 3 newly diagnosed patients (samples 1, 12, 15). All patients from whom samples were obtained had consented to the institutional tissue banking IRB protocol.
Extraction of RNA from Patient Samples with PML-RARa and BCR-ABL Fusions
[0330] Cryopreserved samples were washed with PBS and pelleted. Fresh samples (samples 1, 12, 15) collected in EDTA tubes were first treated with RBC Lysis Buffer (BD Pharmlyse) followed by PBS washes and then pelleted. RNA was then extracted using the Qiagen RNeasy Kit.
RT-PCR Validation of PML-RARa and BCR-ABL Transcripts
[0331] cDNA was generated from 0.2-lug of RNA per sample using the Qiagen Quantitect Reverse Transcription kit. Nested PCR was performed using the previously validated, target specific primers and protocol described in van Dongen et al..sup.28. PCR products were visualized on a 2.5% agarose gel, shown in
Design of crRNA Targeting APML and BCR-ABL Fusion Transcripts with SHERLOCK Guide Model
[0332] Best and worst guides were predicted using the guide design web tool (sherlock.genome-engineering.org) for LwaCas13a and CcaCas13b guide design published in this study. For validation of the guide design tool, crRNAs tiling along the fusion transcript were also synthesized and tested for collateral activity (data reported in
Detection of APML and BCR-ABL Clinical RNA Samples with SHERLOCK
[0333] Two-step SHERLOCK assays were performed as previously described with slight modifications to the RPA protocol.sup.1,2. In brief, basic RPA reactions were performed with the TwistAmp® Basic (TwistDx) protocol modified to perform RT-RPA with the following changes: 10 units/uL of AMV-RT was added after resuspension of pellet and addition of primers, following which 280 mM MgAc was added, all prior to input DNA. RT-RPA reactions at a total volume of 11 uL were run with 1 μL of input RNA for 45 minutes at 42° C. RT-RPA reactions for each fusion transcript were performed with all primer sets for all three transcripts detected in this study (PML-RARa Intron/Exon 6; PML-RARa Intron 3; BCR-ABL p210 b3a2).
[0334] Cas13 detection reactions were performed as described above with LwaCas13a and the best guide determined with the machine learning model, with the exception that reactions with a final volume of 20 uL contained 0.5 uL of input from RPA reactions. Reactions were supplemented with either RNAse Alert v2 (Invitrogen) for fluorescent readout, or a FAM-RNA-biotin reporter for lateral flow readout; reactions were incubated and quantified as described above respectively.
[0335] The initial set of samples (samples 1-11, 13-14, 16-19) were blinded for both steps of SHERLOCK detection; samples 12 and 15 were run as separate experiments as new patient samples became available. Data for both fluorescence and lateral flow were normalized to make the combined figures shown in
[0336] Two-pot SHERLOCK-RPA multiplexed lateral flow reactions were carried out as described above, with the exception reporter concentrations were lowered to a final concentration of 1 uM LwaCas13a reporter and 250 nM CcaCas13b reporter (see Table 5 for all reporters). 20 μL reactions were suspended in 100 μL of HybriDetect 1 assay buffer (Milenia) and run on custom multiplexed strips (DCN Diagnostics), and were visualized and quantified as described above.
[0337] Various modifications and variations of the described methods, pharmaceutical compositions, and kits of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it will be understood that it is capable of further modifications and that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the invention. This application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure come within known customary practice within the art to which the invention pertains and may be applied to the essential features herein before set forth.