PH-ACTIVATED NANOPARTICLES
20220117917 · 2022-04-21
Inventors
Cpc classification
A61K47/10
HUMAN NECESSITIES
A61K31/4745
HUMAN NECESSITIES
A61K31/155
HUMAN NECESSITIES
C12N2320/32
CHEMISTRY; METALLURGY
A61K31/4436
HUMAN NECESSITIES
A61K31/7105
HUMAN NECESSITIES
C12N2310/113
CHEMISTRY; METALLURGY
C12Y207/07048
CHEMISTRY; METALLURGY
A61K47/24
HUMAN NECESSITIES
A61K47/36
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
C12N2310/20
CHEMISTRY; METALLURGY
A61K47/34
HUMAN NECESSITIES
C12N15/1135
CHEMISTRY; METALLURGY
A61K9/127
HUMAN NECESSITIES
A61K47/6925
HUMAN NECESSITIES
A61K31/704
HUMAN NECESSITIES
A61K47/549
HUMAN NECESSITIES
A61K9/1272
HUMAN NECESSITIES
International classification
A61K31/155
HUMAN NECESSITIES
A61K31/4436
HUMAN NECESSITIES
A61K31/4745
HUMAN NECESSITIES
A61K31/704
HUMAN NECESSITIES
A61K31/7105
HUMAN NECESSITIES
A61K47/10
HUMAN NECESSITIES
A61K47/18
HUMAN NECESSITIES
A61K47/24
HUMAN NECESSITIES
A61K47/34
HUMAN NECESSITIES
A61K47/36
HUMAN NECESSITIES
A61K9/127
HUMAN NECESSITIES
Abstract
Disclosed herein is a pH activated nanoparticle that can be used to deliver labile therapeutic or diagnostic agents to the cytoplasm of cells. These nanoparticles allow the agents to escape the endosome by releasing a gas in an amount effective to disrupt the endosome and release the agents into the cytoplasm. The disclosed nanoparticles have a shell, such as a phospholipid bilayer shell, and a core containing a gas bound to a substrate by a pH sensitive interaction. Also disclosed herein is are methods for delivering a pH sensitive cargo to the cytoplasm of a cell, treating triple negative breast cancer (TNBC) in a subject, and treating HER2+ breast cancer in a subject.
Claims
1. A pH activated nanoparticle, comprising a shell comprising a phospholipid bilayer, and a core comprising a gas bound to a substrate by a pH sensitive interaction.
2. The nanoparticle of claim 1, wherein the substrate comprises chitosan-guanidine (CG) or chitosan-arginine (CA).
3. The nanoparticle of claim 1, wherein the substrate comprises metformin.
4. The nanoparticle of claim 1, wherein the substrate comprises calcium carbonate.
5. The nanoparticle of claim 1, wherein the gas comprises carbon dioxide.
6. The nanoparticle of claim 1, wherein the core further comprises a pH sensitive therapeutic or diagnostic agent.
7. The nanoparticle of claim 6, wherein the pH sensitive therapeutic or diagnostic agent is an RNA or DNA oligonucleotide.
8. The nanoparticle of claim 7, wherein the pH sensitive therapeutic or diagnostic agent is an mRNA, ncRNA, siRNA, miRNA, or shRNA oligonucleotide.
9. The nanoparticle of claim 6, wherein the pH sensitive therapeutic or diagnostic agent is peptide.
10. The nanoparticle of claim 6, wherein the pH sensitive therapeutic or diagnostic agent is a labile small molecule.
11. The nanoparticle of claim 7, wherein the pH sensitive therapeutic agent is a POLR2A-targeting siRNA (siPol2).
12. The nanoparticle of claim 7, wherein the pH sensitive therapeutic agent is an anti-miR-21 oligonucleotide.
13. The nanoparticle of claim 12, further comprising a small molecule inhibitor against WIP1.
14. The nanoparticle of claim 13, wherein the small molecule inhibitor against WIP1 comprises GSK2830371.
15. The nanoparticle of claim 1, further comprising paclitaxel, camptothecin, doxorubicin, or any combination thereof.
16. The nanoparticle of claim 1, wherein the phospholipid bilayer comprises dipalmitoyl phosphatidylcholine (DPPC) or dioleoyl phosphatidylcholine (DOPC).
17. The nanoparticle of claim 1, wherein the shell further comprises poly(lactic-co-glycolic acid) (PLGA).
18. The nanoparticle of claim 17, wherein the PLGA is PEGylated.
19. The nanoparticle of claim 1, wherein the shell further comprises a poloxamer.
20. The nanoparticle of claim 19, wherein the poloxamer is poloxamer 407.
21. A method for treating triple negative breast cancer (TNBC) in a subject, comprising administering to the subject a therapeutically effective amount of the pH activated nanoparticle of claim 11.
22. The method of claim 21, wherein the TNBC has a TP53 gene mutation or deletion.
23. A method for delivering a pH sensitive cargo to the cytoplasm of a cell, comprising loading the pH sensitive cargo into the pH activated nanoparticle of claim 1, and contacting the cell with the loaded nanoparticle.
24. A method for treating HER2+ breast cancer in a subject, comprising administering to the subject a therapeutically effective amount of an anti-miR-21 oligonucleotide and a small molecule inhibitor against WIP1.
25-32. (canceled)
Description
DESCRIPTION OF DRAWINGS
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
DETAILED DESCRIPTION
[0048] Before the present disclosure is described in greater detail, it is to be understood that this disclosure is not limited to particular embodiments described, and as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims.
[0049] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.
[0050] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described.
[0051] All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present disclosure is not entitled to antedate such publication by virtue of prior disclosure. Further, the dates of publication provided could be different from the actual publication dates that may need to be independently confirmed.
[0052] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.
[0053] Embodiments of the present disclosure will employ, unless otherwise indicated, techniques of chemistry, biology, and the like, which are within the skill of the art.
[0054] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to perform the methods and use the probes disclosed and claimed herein. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in ° C., and pressure is at or near atmospheric. Standard temperature and pressure are defined as 20° C. and 1 atmosphere.
[0055] Before the embodiments of the present disclosure are described in detail, it is to be understood that, unless otherwise indicated, the present disclosure is not limited to particular materials, reagents, reaction materials, manufacturing processes, or the like, as such can vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and is not intended to be limiting. It is also possible in the present disclosure that steps can be executed in different sequence where this is logically possible.
[0056] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise.
Nanoparticles
[0057] Disclosed herein is a pH activated nanoparticle that contains a shell and core, wherein the shell comprising a phospholipid bilayer and the core comprising a gas bound to a substrate by a pH sensitive interaction.
[0058] In some embodiments, the nanoparticle composition further comprises at least one targeting agent, wherein the targeting agent selectively targets the nanoparticle to diseased tissue/cells, thereby minimizing whole body dose. In some embodiments, the nanoparticle composition further comprises at least one targeting agent, wherein the targeting agent comprises an antibody or functional fragment thereof, a small molecule, a peptide, a carbohydrate, a siRNA, a microRNA, a protein, a nucleic acid, an aptamer, a second nanoparticle, a cytokine, a chemokine, a lymphokine, a receptor, a lipid, a lectin, a ferrous metal, a magnetic particle, a linker, an isotope and combinations thereof.
[0059] In some embodiments, the nanoparticles of the nanoparticle composition have a size of about 10 nm to about 200 nm. In some embodiments, a drug load in the nanoparticle composition is about 0.1% to about 90% by weight of the composition.
Core
[0060] In some embodiments, the core comprises a carrier for the pH sensitive agent. Chitosan-based carriers have become one of the major non-viral vectors that have received increasing interest as a reliable gene or siRNA delivery system. Chitosan has low toxicity, low immunogenicity, excellent biocompatibility (Shu & Zhu (2002) Eur. J. Pharm. Biopharm. 54: 235-243; Lee et al., (2005) Biomaterials 26: 2147-2156). Due to its positive charge, it can easily form polyelectrolyte complexes with negatively charged nucleotides by electrostatic interaction.
[0061] Chitosan is obtained by deacetylation of chitin, which is the biodegradable polysaccharide consisting of repeating D-glucosamine and N-acetyl-D-glucosamine units, linked via (1-4) glycosidic bonds. Chitosan is almost non-toxic in animals (Rao & Sharma (1997) Biomed. Mater. Res. 34: 21-28) and humans (Aspden et al., J. Pharm. Sci. 86 (1997) 509-513), with an LD50 in rats of 16 g/kg (Chandy & Sharma (1990) Biomater Artif Cells Artif Organs 18: 1-24). Chitosan can be characterized by several physicochemical properties, including molecular weight, degree of deacetylation, viscosity, and crystallinity (Kas H. S. (1997) J. Microencapsul. 14: 689-711). The desirability of chitosan as a gene delivery carrier is based on its cationic property to allow binding of negatively charged siRNA via electrostatic interactions.
[0062] Therefore, in some embodiments, the core substrate for binding the gas is a modified chitosan. For example, in some embodiments, the core substrate comprises chitosan-guanidine (CG) or chitosan-arginine (CA).
[0063] In some embodiments, the core substrate comprises metformin or calcium carbonate.
[0064] In some embodiments, the gas comprises carbon dioxide, ammonia, nitric oxide, oxygen, or hydrogen gas.
[0065] Shell
[0066] In some embodiments, the shell of the nanoparticle comprises a phospholipid bilayer. Phospholipid head groups commonly found in nature generally contain phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI), and phosphatidylserine (PS). Such phospholipids may be found in soybeans or egg yolks, though neither of these sources is commonly used in human clinical applications due to stability and contamination issues. Examples include Soybean phosphatidylcholine (SPC), hydrogenated soybean phosphatidylcholine (HSPC), egg sphingomyelin (ESM), and egg phosphatidylcholine (EPC). Synthetic phospholipid derivatives may include, but are not limited to: dipalmitoyl phosphatidylglycerol (DPPG), dimyristoyl phosphatidylglycerol (DMPG), dioleoyl phosphatidylglycerol (DOPG), distearoyl phosphatidylglycerol (DSPG), dipalmitoylphosphatidylcholine (DPPC), distearoyl phosphatidylcholine (DSPC), dimyristoyl phosphatidylcholine (DMPC), hydrogenated soy phosphatidylcholine (HSPC), dioleoyl phosphatidylcholine (DOPC), phosphatidylethanolamines, including 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), dimyristoyl phosphatidylethanolamine (DMPE), dipalmitoyl phosphatidylethanolamine (DPPE), dioleoyl phosphatidylethanolamine (DOPE), dimyristoyl phosphatidylserine (DMPS), dipalmitoyl phosphatidylserine (DPPS), and dioleoyl phosphatidylserine (DOPS).
[0067] In some embodiments, the shell comprises at least one of poly(lactic-co-glycolic acid) (PLGA) or its PEGylated form PEG-PLGA, polylactic acid (PLA) or its PEGylated form PEG-PLA, polyglycolic acid (PGA) or its PEGylated form PEG-PGA, poly-L-lactide-co-ε-caprolactone (PLCL) or its PEGylated form PEG-PLCL, Hyaluronic acid (HA), polyacrylic acid (PAA) or PEG-PAA, polyphosphate (polyP), poly(acrylic acid-co-maleic acid), poly(butylene succinate), poly(alkyl cyanoacrylate) (PAC) or its PEGylated form PEG-PAC or combinations thereof.
[0068] In some embodiments, the shell comprises a poloxamer (Pluronic®). Poloxamers are tri-block copolymers of poly(ethylene oxide) poly(propylene oxide)-poly(ethylene oxide) (PEO-PPO-PEO). This group of synthetic polymers is thermoreversible in aqueous solutions. The sol-gel transition is governed by the composition, molecular weight, and concentration of each constituent block polymer. The hydrophilic ethylene oxide and the hydrophobic propylene oxide give poloxamers an amphiphilic structure—meaning it has a polar, water-soluble group attached to a nonpolar water-insoluble hydrocarbon chain. Amphiphilic block copolymer molecules self-assemble into micelles (a packed chain of molecules) in aqueous solution. Micelle formation is temperature dependent and affects the degradation properties of the biomaterial: below a certain characteristic temperature known as the critical micelle temperature, both the ethylene and propylene oxide blocks are hydrated and the PPO block becomes soluble. Because the lengths of the polymer blocks can be customized, many different poloxamers exist that have slightly different properties. For the generic term “poloxamer”, these copolymers are commonly named with the letter “P” (for poloxamer) followed by three digits, the first two digits×100 give the approximate molecular mass of the polyoxypropylene core, and the last digit×10 gives the percentage polyoxyethylene content (e.g., P407=Poloxamer with a polyoxypropylene molecular mass of 4,000 g/mol and a 70% polyoxyethylene content). For the Pluronic® tradename, coding of these copolymers starts with a letter to define its physical form at room temperature (L=liquid, P=paste, F=flake (solid)) followed by two or three digits, The first digit (two digits in a three-digit number) in the numerical designation, multiplied by 300, indicates the approximate molecular weight of the hydrophobe; and the last digit×10 gives the percentage polyoxyethylene content (e.g., L61=Pluronic with a polyoxypropylene molecular mass of 1,800 g/mol and a 10% polyoxyethylene content). Poloxamers are commercially available, and methods for their synthesis are known to those of skill in the art.
[0069] In some embodiments, the phospholipids present in the nanoparticle composition is 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE-PEG). In some embodiments, the phospholipids present in the nanoparticle composition is L-α-phosphatidylcholine (L-α-PC) and 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE-PEG). In some embodiments, the one or more phospholipids present in the nanoparticle composition is 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP).
[0070] In some embodiments, the phospholipids present in the nanoparticle composition is 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP) and the polymer is polyphosphate (polyP). In some embodiments, the one or more phospholipids present in the nanoparticle composition is 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP) and the polymer is PEG polyacrylic acid (PAA).
[0071] In some embodiments, a molar ratio of the lipid(s) to a PEGylated lipid(s) in the nanoparticle composition is about 100:0 to about 50:50. In some embodiments, a molar ratio of a saturated lipid(s) to an unsaturated lipid(s) in the nanoparticle composition is about 100:0 to about 25:75. In some embodiments, a molar ratio of capecitabine to lipid(s) in the nanoparticle composition is about 90:10 to about 10:90. In some embodiments, a molar ratio of lipid(s) to polymer in the nanoparticle composition is about 100:0 to about 10:80. In some embodiments, a molar ratio of capecitabine to polymer in the nanoparticle composition is about 100:0 to about 10:90. In some embodiments, the nanoparticle composition exhibits a zeta potential of from about −80 mV to about 80 mV.
PH-Sensitive Agents
[0072] In some embodiments, the core further comprises a pH sensitive therapeutic or diagnostic agent. The disclosed nanoparticle assists in endosomal escape of the pH sensitive agent so it can reach the cytoplasm with minimal degradation.
[0073] In some embodiments, the pH sensitive therapeutic or diagnostic agent is an RNA or DNA oligonucleotide. For example, the oligonucleotides can be an mRNA, siRNA, miRNA, shRNA, or antisense oligonucleotide. In some embodiments, the RNA is a short or long noncoding RNA (ncRNA). In some embodiments, the therapeutic or diagnostic agent is a peptide or protein. In some embodiments, the therapeutic or diagnostic agent is an aptamer, such as a DNA, RNA or peptide aptamer. In some embodiments, the therapeutic or diagnostic agent is a labile small molecule.
Methods for Delivering pH Sensitive Cargo
[0074] Disclosed herein is a method for delivering a pH sensitive cargo to the cytoplasm of a cell that involves loading the pH sensitive cargo into the disclosed pH activated nanoparticle and contacting the cell with the loaded nanoparticle.
Methods of Treating TNBC
[0075] Also disclosed herein is a method for treating triple negative breast cancer (TNBC), such as TNBC with mutated or deleted TP53, in a subject that involves administering to the subject a therapeutically effective amount of the pH activated nanoparticle disclosed herein loaded with a POLR2A inhibitor. In some embodiments, the POLR2A inhibitor is an siRNA (siPol2). POLR2A siRNA are commercially available (e.g., Millipore Sigma, ThermoFisher Scientific) and can be designed using routine methods from the POLR2A gene sequence. In some embodiments, the siPol2 has the nucleic acid sequence CCAACAUGCUGACAGAUAU (SEQ ID NO:1), AUAUCUGUCAGCAUGUUGG (SEQ ID NO:2), CCAAGAAGCGGCUCACACA (SEQ ID NO:3), or UGUGUGAGCCGCUUCUUGG (SEQ ID NO:4).
Methods of Treating HER2+ Breast Cancer
[0076] Also disclosed herein is a method for treating HER2+ breast cancer in a subject that involves administering to the subject a therapeutically effective amount of an miR-21 inhibitor and a WIP1 inhibitor. In some embodiments, the HER2+ breast cancer is trastuzumab-resistant and the method provides an alternative or addition to trastuzumab therapy. In some embodiments, the miR-21 inhibitor and a WIP1 inhibitor are loaded in a pH activated nanoparticle disclosed herein.
[0077] WIP1 Inhibitor
[0078] In some embodiments, the WIP1 inhibitor is a small molecule inhibitor. For example, the WIP1 inhibitor can be GSK2830371, shown below:
##STR00001##
The wild-type p53-induced phosphatase Wip1, also known as protein phosphatase magnesium-dependent 1 delta (PPM1D) or PP2Cdelta, modulates cell cycling and may contribute to some forms of cancer. GSK2830371 is a potent inhibitor of Wip1 (IC.sub.50=6 nM). It displays selectivity for Wip1 over 21 other phosphatases. GSK2830371 increases phosphorylation of Wip1 substrates and blocks cell cycling in hematopoietic cancer cells and in Wip1-amplified cancer cells with wild-type p53.
[0079] MIR-21 Inhibitor
[0080] In some embodiments, the miR-21 inhibitor is an anti-miR-21 oligonucleotide. In some embodiments, the anti-miR-21 oligonucleotide has the nucleic acid sequence
TABLE-US-00001 (SEQ ID NO: 5) UCAACAUCAGUCUGAUAAGCUAG.
[0081] The disclosed miRNA antagonists are single-stranded, double stranded, partially double stranded or hairpin structured oligonucleotides that include a nucleotide sequence sufficiently complementary to hybridize to a selected miRNA or pre-miRNA target sequence. As used herein, the term “partially double stranded” refers to double stranded structures that contain less nucleotides than the complementary strand. In general, partially double stranded oligonucleotides will have less than 75% double stranded structure, preferably less than 50%, and more preferably less than 25%, 20% or 15% double stranded structure.
[0082] An miRNA or pre-miRNA can be 18-100 nucleotides in length, and more preferably from 18-80 nucleotides in length. Mature miRNAs can have a length of 19-30 nucleotides, preferably 21-25 nucleotides, particularly 21, 22, 23, 24, or 25 nucleotides. MicroRNA precursors typically have a length of about 70-100 nucleotides and have a hairpin conformation.
[0083] Given the sequence of an miRNA or a pre-miRNA, an miRNA antagonist that is sufficiently complementary to a portion of the miRNA or a pre-miRNA can be designed according to the rules of Watson and Crick base pairing. As used herein, the term “sufficiently complementary” means that two sequences are sufficiently complementary such that a duplex can be formed between them under physiologic conditions. An miRNA antagonist sequence that is sufficiently complementary to an miRNA or pre-miRNA target sequence can be 70%, 80%, 90%, or more identical to the miRNA or pre-miRNA sequence.
[0084] In one embodiment, the miRNA antagonist contains no more than 1, 2 or 3 nucleotides that are not complementary to the miRNA or pre-miRNA target sequence. In a preferred embodiment, the miRNA antagonist is 100% complementary to an miRNA or pre-miRNA target sequence.
[0085] Useful miRNA antagonists include oligonucleotides have at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more contiguous nucleotides substantially complementary to an endogenous miRNA or pre-miRNA. The disclosed miRNA antagonists preferably include a nucleotide sequence sufficiently complementary to hybridize to an miRNA target sequence of about 12 to 25 nucleotides, preferably about 15 to 23 nucleotides.
[0086] In some embodiments, there will be nucleotide mismatches in the region of complementarity. In a preferred embodiment, the region of complementarity will have no more than 1, 2, 3, 4, or 5 mismatches.
[0087] In some embodiments, the miRNA antagonist is “exactly complementary” to a human miRNA. Thus, in one embodiment, the miRNA antagonist can anneal to the miRNA to form a hybrid made exclusively of Watson-Crick base pairs in the region of exact complementarity. Thus, in some embodiments, the miRNA antagonist specifically discriminates a single-nucleotide difference. In this case, the miRNA antagonist only inhibits miRNA activity if exact complementarity is found in the region of the single-nucleotide difference.
[0088] In one embodiment, the miRNA antagonists are oligomers or polymers of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or modifications thereof. miRNA antagonists include oligonucleotides that contain naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages.
[0089] In some embodiments, the miRNA inhibitor is an antagomir. Antagomirs are a specific class of miRNA antagonists that are described, for example, in US2007/0213292 to Stoffel et al. Antagomirs are RNA-like oligonucleotides that contain various modifications for RNase protection and pharmacologic properties such as enhanced tissue and cellular uptake. Antagomirs differ from normal RNA by having complete 2′-O-methylation of sugar, phosphorothioate backbone and a cholesterol-moiety at 3′-end.
[0090] Antagomirs can include a phosphorothioate at least the first, second, or third internucleotide linkage at the 5′ or 3′ end of the nucleotide sequence. In one embodiment, antagomirs contain six phosphorothioate backbone modifications; two phosphorothioates are located at the 5′-end and four at the 3′-end. Phosphorothioate modifications provide protection against RNase activity and their lipophilicity contributes to enhanced tissue uptake.
[0091] Examples of antagomirs and other miRNA inhibitors are described in WO2009/020771, WO2008/091703, WO2008/046911, WO2008/074328, WO2007/090073, WO2007/027775, WO2007/027894, WO2007/021896, WO2006/093526, WO2006/112872, WO2007/112753, WO2007/112754, WO2005/023986, or WO2005/013901, all of which are hereby incorporated by reference.
[0092] Custom designed Anti-miR™ molecules are commercially available from Applied Biosystems. Thus, in some embodiments, the antagomir is an Ambion® Anti-miR™ inhibitor. These molecules are chemically modified and optimized single-stranded nucleic acids designed to specifically inhibit naturally occurring mature miRNA molecules in cells.
[0093] Custom designed Dharmacon Meridian™ microRNA Hairpin Inhibitors are also commercially available from Thermo Scientific. These inhibitors include chemical modifications and secondary structure motifs. For example, Vermeulen et al. reports in US2006/0223777 the identification of secondary structural elements that enhance the potency of these molecules. Specifically, incorporation of highly structured, double-stranded flanking regions around the reverse complement core significantly increases inhibitor function and allows for multi-miRNA inhibition at subnanomolar concentrations. Other such improvements in antagomir design are contemplated for use in the disclosed methods.
[0094] Anti-HER2 Antibody
[0095] In some embodiments, the method further involves administering to the subject a therapeutically effective amount of an anti-HER2 antibody, such as trastuzumab. Trastuzumab, sold under the brand name Herceptin® among others, is a monoclonal antibody used to treat breast cancer that is HER2 receptor positive. It may be used by itself or together with other chemotherapy medication. Trastuzumab is given by slow injection into a vein and injection just under the skin.
[0096] Trastuzumab inhibits the effects of overexpression of HER2. If the breast cancer does not overexpress HER2, trastuzumab will have no beneficial effect (and may cause harm). Doctors use laboratory tests to discover whether HER2 is overexpressed. In the routine clinical laboratory, the most commonly employed methods for this are immunohistochemistry (IHC) and either silver, chromogenic or fluorescent in situ hybridisation (SISH/CISH/FISH). HER2 amplification can be detected by virtual karyotyping of formalin-fixed paraffin embedded tumor. Virtual karyotyping has the added advantage of assessing copy number changes throughout the genome, in addition to detecting HER2 amplification (but not overexpression). Numerous PCR-based methodologies have also been described in the literature. It is also possible to estimate HER2 copy number from microarray data.
[0097] There are two FDA-approved commercial kits available for HER2 IHC; Dako HercepTest and Ventana Pathway. These are highly standardised, semi-quantitative assays which stratify expression levels into; 0 (<20,000 receptors per cell, no visible expression), 1+(˜100,000 receptors per cell, partial membrane staining, <10% of cells overexpressing HER2), 2+(500,000 receptors per cell, light to moderate complete membrane staining, >10% of cells overexpressing HER2), and 3+(2,000,000 receptors per cell, strong complete membrane staining, >10% of cells overexpressing HER2). The presence of cytoplasmic expression is disregarded. Treatment with trastuzumab is indicated in cases where HER2 expression has a score of 3+. However, IHC has been shown to have numerous limitations, both technical and interpretative, which have been found to impact on the reproducibility and accuracy of results, especially when compared with ISH methodologies. It is also true, however, that some reports have stated that IHC provides excellent correlation between gene copy number and protein expression.
[0098] Fluorescent in situ hybridization (FISH) is viewed as being the “gold standard” technique in identifying patients who would benefit from trastuzumab, but it is expensive and requires fluorescence microscopy and an image capture system. The main expense involved with CISH is in the purchase of FDA-approved kits, and as it is not a fluorescent technique it does not require specialist microscopy and slides may be kept permanently. Comparative studies of CISH and FISH have shown that these two techniques show excellent correlation. The lack of a separate chromosome 17 probe on the same section is an issue with regards to acceptance of CISH. The DDISH (Dual-chromagen/Dual-hapten In-situ hybridization) cocktail uses both HER2 and Chromosome 17 hybridization probes for chromagenic visualization on the same tissue section. The detection can be achieved by using a combination of ultraView SISH (silver in-situ hybridization) and ultraView Red ISH for deposition of distinct chromgenic precipitates at the site of DNP or DIG labeled probes.
[0099] In some embodiments, HER2 detection a combination of IHC and FISH, whereby IHC scores of 0 and 1+ are negative (no trastuzumab treatment), scores of 3+ are positive (trastuzumab treatment), and score of 2+(equivocal case) is referred to FISH for a definitive treatment decision.
Oligonucleotides
[0100] Disclosed herein are oligonucleotides for use in the disclosed compositions and methods. Compositions and methods for increasing stability of nucleic acid half-life and nuclease resistance are known in the art, and can include one or more modifications or substitutions to the nucleobases, sugars, or linkages of the polynucleotide. For example, the polynucleotide can be custom synthesized to contain properties that are tailored to fit a desired use. Common modifications include, but are not limited to use of locked nucleic acids, unlocked nucleic acids (UNA's), morpholinos, peptide nucleic acids (PNA), phosphorothioate linkages, phosphonoacetate, linkages, propyne analogs, 2′-O-methyl RNA, 5-Me-dC, 2′-5′ linked phosphodiester linage, Chimeric Linkages (Mixed phosphorothioate and phosphodiester linkages and modifications), conjugation with lipid and peptides, and combinations thereof.
[0101] In some embodiment, the polynucleotide includes internucleotide linkage modifications such as phosphate analogs having achiral and uncharged intersubunit linkages (e.g., Sterchak, E. P. et al., Organic Chem., 52:4202, (1987)), or uncharged morpholino-based polymers having achiral intersubunit linkages (see, e.g., U.S. Pat. No. 5,034,506). Some internucleotide linkage analogs include morpholidate, acetal, and polyamide-linked heterocycles. Locked nucleic acids (LNA) are modified RNA nucleotides (see, for example, Braasch, et al., Chem. Biol., 8(1):1-7 (2001)). Commercial nucleic acid synthesizers and standard phosphoramidite chemistry are used to make LNAs. Other backbone and linkage modifications include, but are not limited to, phosphorothioates, peptide nucleic acids, tricyclo-DNA, decoy oligonucleotide, ribozymes, spiegelmers (containing L nucleic acids, an apatamer with high binding affinity), or CpG oligomers.
[0102] Phosphorothioates (or S-oligos) are a variant of normal DNA in which one of the nonbridging oxygens is replaced by a sulfur. The sulfurization of the internucleotide bond dramatically reduces the action of endo- and exonucleases including 5′ to 3′ and 3′ to 5′ DNA POL 1 exonuclease, nucleases S1 and P1, RNases, serum nucleases and snake venom phosphodiesterase. In addition, the potential for crossing the lipid bilayer increases. Because of these important improvements, phosphorothioates have found increasing application in cell regulation. Phosphorothioates are made by two principal routes: by the action of a solution of elemental sulfur in carbon disulfide on a hydrogen phosphonate, or by the more recent method of sulfurizing phosphite triesters with either tetraethylthiuram disulfide (TETD) or 3H-1,2-bensodithiol-3-one 1,1-dioxide (BDTD). The latter methods avoid the problem of elemental sulfur's insolubility in most organic solvents and the toxicity of carbon disulfide. The TETD and BDTD methods also yield higher purity phosphorothioates. (See generally Uhlmann and Peymann, 1990, Chemical Reviews 90, at pages 545-561 and references cited therein, Padmapriya and Agrawal, 1993, Bioorg. & Med. Chem. Lett. 3, 761).
[0103] Peptide nucleic acids (PNA) are molecules in which the phosphate backbone of oligonucleotides is replaced in its entirety by repeating N-(2-aminoethyl)-glycine units and phosphodiester bonds are replaced by peptide bonds. The various heterocyclic bases are linked to the backbone by methylene carbonyl bonds. PNAs maintain spacing of heterocyclic bases that is similar to oligonucleotides, but are achiral and neutrally charged molecules. Peptide nucleic acids are typically comprised of peptide nucleic acid monomers. The heterocyclic bases can be any of the standard bases (uracil, thymine, cytosine, adenine and guanine) or any of the modified heterocyclic bases described below. A PNA can also have one or more peptide or amino acid variations and modifications. Thus, the backbone constituents of PNAs may be peptide linkages, or alternatively, they may be non-peptide linkages. Examples include acetyl caps, amino spacers such as 8-amino-3,6-dioxaoctanoic acid (referred to herein as 0-linkers), and the like. Methods for the chemical assembly of PNAs are well known. See, for example, U.S. Pat. Nos. 5,539,082, 5,527,675, 5,623,049, 5,714,331, 5,736,336, 5,773,571 and 5,786,571.
[0104] In some embodiments, the polynucleotide includes one or more chemically-modified heterocyclic bases including, but are not limited to, inosine, 5-(1-propynyl) uracil (pU), 5-(1-propynyl) cytosine (pC), 5-methylcytosine, 8-oxo-adenine, pseudocytosine, pseudoisocytosine, 5- and 2-amino-5-(2′-deoxy-D-ribofuranosyl)pyridine (2-aminopyridine), and various pyrrolo- and pyrazolopyrimidine derivatives, 4-acetylcytosine, 8-hydroxy-N-6-methyladenosine, aziridinylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methyl guanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxy-aminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5′-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N-uracil-5-oxyacetic acid methylester, 2,6-diaminopurine, and 2′-modified analogs such as, but not limited to O-methyl, amino-, and fluoro-modified analogs. Inhibitory RNAs modified with 2′-fluoro (2′-F) pyrimidines appear to have favorable properties in vitro (Chiu and Rana 2003; Harborth et al. 2003). Moreover, one report recently suggested 2′-F modified siRNAs have enhanced activity in cell culture as compared to 2′-OH containing siRNAs (Chiu and Rana 2003). 2′-F modified siRNAs are functional in mice but that they do not necessarily have enhanced intracellular activity over 2′-OH siRNAs.
[0105] In some embodiments the polynucleotide include one or more sugar moiety modifications, including, but are not limited to, 2′-O-aminoethoxy, 2′-O-amonioethyl (2′-OAE), 2′-O-methoxy, 2′-O-methyl, 2-guanidoethyl (2′-OGE), 2′-0,4′-C-methylene (LNA), 2′-O-(methoxyethyl) (2′-OME) and 2′-O—(N-(methyl)acetamido) (2′-OMA).
Pharmaceutical Compositions
[0106] Disclosed is a pharmaceutical compositions containing therapeutically effective amounts of one or more of the disclosed agents and a pharmaceutically acceptable carrier. Pharmaceutical carriers suitable for administration of the agents provided herein include any such carriers known to those skilled in the art to be suitable for the particular mode of administration. In addition, the agents may be formulated as the sole pharmaceutically active ingredient in the agents or may be combined with other active ingredients.
[0107] The disclosed agents can be formulated into suitable pharmaceutical preparations such as solutions, suspensions, tablets, dispersible tablets, pills, capsules, powders, sustained release formulations or elixirs, for oral administration or in sterile solutions or suspensions for parenteral administration, as well as transdermal patch preparation and dry powder inhalers. In some embodiments, the agents described above are formulated into pharmaceutical compositions using techniques and procedures well known in the art.
[0108] In one embodiment, the compositions are formulated for single dosage administration. To formulate a composition, the weight fraction of compound is dissolved, suspended, dispersed or otherwise mixed in a selected carrier at an effective concentration such that the treated condition is relieved or one or more symptoms are ameliorated.
[0109] The active agents is included in the pharmaceutically acceptable carrier in an amount sufficient to exert a therapeutically useful effect in the absence of undesirable side effects on the patient treated. The therapeutically effective concentration may be determined empirically by testing the compounds in in vitro, ex vivo and in vivo systems, and then extrapolated therefrom for dosages for humans.
[0110] The concentration of active agents in the pharmaceutical composition will depend on absorption, inactivation and excretion rates of the active compound, the physicochemical characteristics of the agents, the dosage schedule, and amount administered as well as other factors known to those of skill in the art.
[0111] Pharmaceutical dosage unit forms are prepared to provide from about 0.01 mg, 0.1 mg or 1 mg to about 500 mg, 1000 mg or 2000 mg, and in one embodiment from about 10 mg to about 500 mg of the active ingredient or a combination of essential ingredients per dosage unit form.
[0112] In instances in which the agents exhibit insufficient solubility, methods for solubilizing compounds may be used. Such methods are known to those of skill in this art, and include, but are not limited to, using cosolvents, such as dimethylsulfoxide (DMSO), using surfactants, such as TWEEN®, or dissolution in aqueous sodium bicarbonate.
[0113] Liquid pharmaceutically administrable compositions can, for example, be prepared by dissolving, dispersing, or otherwise mixing an active compound as defined above and optional pharmaceutical adjuvants in a carrier, such as, for example, water, saline, aqueous dextrose, glycerol, glycols, ethanol, and the like, to thereby form a solution or suspension. If desired, the pharmaceutical composition to be administered may also contain minor amounts of nontoxic auxiliary substances such as wetting agents, emulsifying agents, solubilizing agents, pH buffering agents and the like, for example, acetate, sodium citrate, cyclodextrin derivatives, sorbitan monolaurate, triethanolamine sodium acetate, triethanolamine oleate, and other such agents.
[0114] Dosage forms or compositions containing active ingredient in the range of 0.005% to 100% with the balance made up from non-toxic carrier may be prepared. Methods for preparation of these compositions are known to those skilled in the art. The contemplated compositions may contain 0.001%-100% active ingredient, or in one embodiment 0.1-95%.
Methods of Administration
[0115] The herein disclosed compositions, including pharmaceutical composition, may be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. For example, the disclosed compositions can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intracavity, or transdermally. The compositions may be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, extracorporeally, ophthalmically, vaginally, rectally, intranasally, topically or the like, including topical intranasal administration or administration by inhalant.
[0116] Parenteral administration of the composition, if used, is generally characterized by injection. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions. A revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained.
[0117] The compositions disclosed herein may be administered prophylactically to patients or subjects who are at risk for a disease or condition. Thus, the method can further comprise identifying a subject at risk for a disease or condition, such as cancer, prior to administration of the herein disclosed compositions.
[0118] The exact amount of the compositions required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the allergic disorder being treated, the particular nucleic acid or vector used, its mode of administration and the like. Thus, it is not possible to specify an exact amount for every composition. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein. For example, effective dosages and schedules for administering the compositions may be determined empirically, and making such determinations is within the skill in the art. The dosage ranges for the administration of the compositions are those large enough to produce the desired effect in which the symptoms disorder are effected. The dosage should not be so large as to cause adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, and the like. Generally, the dosage will vary with the age, condition, sex and extent of the disease in the patient, route of administration, or whether other drugs are included in the regimen, and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any counterindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. In some embodiments, a typical daily dosage of the agent might range from about 1 μg/kg to up to 100 mg/kg of body weight or more per day, depending on the factors mentioned above.
[0119] In some embodiments, the disclosed agents are administered in a dose equivalent to parenteral administration of about 0.1 ng to about 100 g per kg of body weight, about 10 ng to about 50 g per kg of body weight, about 100 ng to about 1 g per kg of body weight, from about 1 μg to about 100 mg per kg of body weight, from about 1 μg to about 50 mg per kg of body weight, from about 1 mg to about 500 mg per kg of body weight; and from about 1 mg to about 50 mg per kg of body weight. Alternatively, the amount of agent administered to achieve a therapeutic effective dose is about 0.1 ng, 1 ng, 10 ng, 100 ng, 1 μg, 10 μg, 100 μg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 500 mg per kg of body weight or greater.
[0120] The agent may be administered once or several times a day, and the duration of the treatment may be once per day for a period of about 1, 2, 3, 4, 5, 6, 7 days or more. The agent can also be administered as a single dose in the form of an individual dosage unit or several smaller dosage units or by multiple administration of subdivided dosages at certain intervals. For instance, a dosage unit can be administered from about 0 hours to about 1 hour, about 1 hour to about 24 hours, about 1 to about 72 hours, about 1 to about 120 hours, or about 24 hours to at least about 120 hours. Alternatively, the dosage unit can be administered from about 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 30, 40, 48, 72, 96, 120 hours. Subsequent dosage units can be administered any time following the initial administration such that a therapeutic effect is achieved. Treatment can include a multi-level dosing regimen wherein the agent(s) are administered during two or more time periods, such as having a combined duration of about 12 hours to about 7 days, including, 1, 2, 3, 4, or 5 days or about 15, 15, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, or 144 hours or about 1 to 24 hours, about 12 to 36 hours, about 24 to 48 hours, about 36 to 60 hours, about 48 to 72 hours, about 60 to 96 hours, about 72 to 108 hours, about 96 to 120 hours, or about 108 to 136 hours.
[0121] A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.
EXAMPLES
Example 1: Precise Targeting of POLR2A as a Therapeutic Strategy for Human Triple Negative Breast Cancer
[0122] Cancer genomes are characterized by the accumulation of somatic genetic alterations within a cell, such as inactivation of tumour suppressor genes (Chin, L, et al. Gene Dev. 2011 25(6):534-555; Vogelstein, B, et al. 2013 Science 339(6127):1546-1558; Taylor, B S, et al. Cancer Cell 2010 18(1):11-22). TP53 is the most frequently deleted or mutated tumour suppressor gene in TNBC (Shah, S P, et al. Nature 2012 486(7403):395-399; Bianchini, G, et al. Nat. Rev. Clin. Oncol. 2016 13(11):674-690; Weisman, P S, et al. Mod. Pathol. 2016 29:476), which results in the loss of p53's tumour suppressor function (Ventura, A, et al. Nature 2007 445(7128):661-665; Olivier, M, et al. Hum. Mutat. 2002 19(6):607-614). Although restoration of p53 activity is a promising strategy and tremendous efforts have been made to harness it as an anticancer approach, no such therapy has been translated into the clinic owing to the complexity of p53 signalling (Joerger, A C, et al. Annu. Rev. Biochem. 2016 85(1):375-404). Because genomic alterations are large regional events, most cancers that exhibit copy number loss of tumour suppressor genes, especially TP53, also show loss of essential neighbouring genes (Liu, Y, et al. Nature 2015 520(7549):697-701). POLR2A is an essential neighbouring gene of TP53 that encodes the largest subunit of RNA polymerase II complex (Clark, V E, et al. Nat. Genet. 2016 48:1253). Although hemizygous (partial) loss of POLR2A (POLR2A.sup.loss) has minimal impact on cells because one allele of POLR2A is sufficient to maintain cell survival, cancer cells containing such genomic defect should be more vulnerable than normal cells to the inhibition of POLR2A. Therefore, this Example precisely targets POLR2A instead of TP53 for treating TNBC harbouring hemizygous loss of TP53 (TP53.sup.loss).
[0123] In addition, with the aim of enhancing bioavailability and improving endo/lysosomal escape of siRNA, low pH-activated “nano-bomb” nanoparticles were designed to deliver POLR2A siRNA (siPol2) and precisely target POLR2A in TP53.sup.loss TNBC. Carbon dioxide (CO.sub.2) can be generated from the nanoparticles under the reduced pH in endo/lysosomes to give the “nano-bomb” effect, which triggers endo/lysosomal escape for enhanced cytosolic siRNA delivery. The disclosed data show that POLR2A suppression with the siPol2-laden nanoparticles (siPol2@NPs) leads to an enhanced reduction of the growth of POLR2A.sup.loss tumour with no evident systemic toxicity.
[0124] Methods
[0125] The Cancer Genome Atlas analysis. The Cancer Genome Atlas primary (origin: METABRIC Nature 2012 & Nat Commun 2016, and Cell 2015) and metastatic (origin: France 2016) breast cancer data were downloaded from cBioPortal, which included copy number variation at segment levels in log-ratio, copy number variation at gene levels estimated by using the GISTIC2 algorithm, RNA-seq for gene expression in base-2 log scale, and patient information on oestrogen receptor, progesterone receptor, and HER-2/neu status. The correlation between gene copy number and the corresponding gene expression was analysed as previously described (Liu, Y., et al. Nature 2015 520(7549):697-701). The triple-negative breast cancer (TNBC) subtypes, defined by PAM50 profiling test, included all the basal-like and claudin-low groups.
[0126] Materials. PLGA (lactide:glycolide: 75:25, M.sub.w: 4,000-15,000 Da), and organic solvents were purchased from Sigma (St. Louis, Mo., USA). Agarose, ethidium bromide and loading buffer were purchased from Thermo Fisher Scientific (Grand Island, N.Y., USA). DPPC was purchased from Anatrace (Maumee, Ohio, USA). Chitosan oligosaccharide of pharmaceutical grade (M.sub.w: 1.2 kDa, 95% deacetylation) was purchased from Zhejiang Golden Schell Biochemical Co. Ltd (Zhejiang, China). Methyl aminomethanimidothioate hydroiodide was purchased from Santa Cruz Biotechnology (Dallas, Tex., USA). Anti-POLR2A antibody (sc-47701, dilution of 1:10000 for western blot and 1:200 for immunofluorescence staining), HRP-anti-rabbit IgG (sc-2030, dilution of 1:5000), HRP-anti-mouse IgG (sc-516102, dilution of 1:5000) antibodies were purchased from Santa Cruz (Dallas, Tex., USA). Anti-β-actin (AM1829B, dilution of 1:5000) antibody was purchased from Abgent (San Diego, Calif., USA). Alexa Fluor 488-labeled anti-mouse IgG (A11001, dilution of 1:250) antibody was purchased from Life Technologies (Waltham, Mass., USA). Cell counting kit-8 (CCK-8) was purchased from Dojindo Molecular Technologies (Rockville, Md., USA). Mouse Inflammation Kit (#552364) was purchased from BD Biosciences (San Jose, Calif., USA). Alanine Transaminase (ALT) Activity Assay Kit (ab105134) and Aspartate Aminotransferase (AST) Activity Assay Kit (ab105135) were purchased from Abcam (Cambridge, Mass., USA).
[0127] Nanoparticle synthesis. The double-emulsion method (Wang, H, et al. Chem. Commun. 2015 51(36):7733-7736) with slight modification was used to synthesize nanoparticles in this example. First, the chitosan-guanidinate (CG) was synthesized by modifying chitosan with the guanidine group (
[0128] Nanoparticle characterization. Both dynamic light scattering (DLS) and transmission electron microscopy (TEM) were used to characterize the nanoparticles. The nanoparticles were soaked for 6 h in either acetate buffer (pH 5.0) or phosphate buffer (for pH 6.0 and pH 7.4). For TEM study, uranyl acetate solution (2%, w/w) was used to negatively stain the nanoparticles before examining them with the Tecnai G2 Spirit transmission electron microscope from FEI (Moorestown, N.J., USA). The size distribution of the nanoparticles was studied using a 90 Plus/BI-MAS DLS instrument from Brookhaven (Holtsville, N.Y., USA). The encapsulation efficiency of the siRNA was 68.6±7.2%, which was calculated as the ratio of the amount of the siRNA encapsulated in the nanoparticles to that the total amount of the siRNA fed for encapsulation. The loading content of the siRNA in the nanoparticles was 0.73±0.25%, which calculated as the ratio of the amount of the siRNA encapsulated in the nanoparticles to that the total amount of the nanoparticles including the siRNA. Both the encapsulation efficiency and loading content were quantified by using Cy5.5-siPol2 for encapsulation. The amount of Cy5.5-siPol2 in a sample was measured spectrophotometrically using a Beckman Coulter (Indianapolis, Ind., USA) DU 800 UV-vis Spectrophotometer based on its absorbance peak at 670 nm. A standard curve of free Cy5.5-siPol2 (absorbance vs. concentration) was used for converting the measured absorbance into the concentration of Cy5.5-siPol2 in a sample.
[0129] Electrophoretic gel assay. Free POLR2A siRNA (siPol2) and siPol2@NPs (in phosphate buffered saline or serum) were mixed with loading buffer, and then loaded into 2% wt agarose gel with 0.5 mg ml.sup.−1 ethidium bromide. Electrophoresis was conducted in 1×tris-acetate-EDTA (TAE) buffer at 80 V for 10 min. The resulting gels were analysed using a UV illuminator (FluorChem™ E System, CA, USA) to show the location of siPol2.
[0130] Cell culture. MDA-MB-231, MDA-MB-453, and HCC1937 cell lines were purchased from the American Type Culture Collection (ATCC, Manassas, Va., USA) and cultured under the standard conditions specified by ATCC. HER18 cells (stably overexpress HER2) were a gift from Dr. Mong-Hong Lee (MD Anderson Cancer Centre). The cells were maintained in Dulbecco's Modified Eagle Medium (DMEM) with 10% fetal bovine serum at 37° C. in 5% CO.sub.2. Cell identity was confirmed by validating the STR DNA fingerprinting using the AmpFLSTR Identifiler Kit (Applied Biosystems, Foster City, Calif., USA) according to the manufacturer's instructions.
[0131] Generation of POLR2A-heterozygous cell lines. The generation of POLR2A.sup.loss isogenic cell lines was conducted using CRISPR/Cas9 as described previously (Liu, Y., et al. Nature 2015 520(7549):697-701). Briefly, 2×10.sup.6 of HCC1937 or HER18 cells were transfected with 2 μg of Cas9/sgRNA-expressing vector DNA using a Nucleofector kit (Lonza, Walkersville, Md., USA). Genome editing efficacy was tested by the Surveyor assay. Single colonies were isolated and the PCR products from positive clones were ligated to the pGEM-T Easy Vector (Promega, Madison, Wis., USA) and further confirmed by Sanger DNA sequencing.
[0132] Cellular uptake and intracellular distribution. The nanoparticles were encapsulated with Cy5.5-siPol2 using the aforementioned double-emulsion method. For the nanoparticles without CO.sub.2, CG was used instead of CG-CO.sub.2. MDA-MB-453 cells were then treated with the Cy5.5-siPol2@NPs at 37° C. for up to 6 h. Afterward, the cells were incubated at 37° C. for 30 min with 50 nM DAPI and 90 nM LysoTracker Green in cell culture medium. The cells were then fixed with 4% paraformaldehyde and examined using a FluoView FV1000 confocal microscope from Olympus (Centre Valley, Pa., USA). For quantitative analysis of the co-localization between Cy5.5-siPol2 and LysoTracker Green inside cells, the Manders' co-localization coefficients between the fluorescence signals of Cy5.5-siPol2 and LysoTracker Green were calculated using ImageJ (ImageJ bundled with 64-bit Jave 1.8.0_112) with the JACoP co-localization plugin module. The two Manders' coefficients M1 and M2 were calculated as follows:
where the subscript i represents the ith pixel in the fluorescence image, R represents red fluorescence intensity, G represents green fluorescence intensity, T.sub.1 represents the threshold for red channel, and T.sub.2 represents the threshold for green channel. The two fluorescence intensities and thresholds were determined by the built-in algorithm of the JACoP co-localization plugin module of ImageJ for both the green and red channels.
[0133] Immunoblotting. Immunoblotting was performed as described previously (Liu, Y., et al. Nature 2015 520(7549):697-701). Briefly, cell lysates were made in lysis buffer (pH 7.5) containing 1 mM EDTA, 50 mM Tris, 150 mM NaCl, 0.5% Triton X-100, 0.5% NP-40, 1 mM sodium fluoride, 1 mM phenylmethylsulfonyl fluoride, 5 mM sodium vanadate, and 1 μg/ml leupeptin, aprotinin, and pepstatin. Proteins were then separated by SDS-PAGE gels and further transferred to the membranes of polyvinylidene difluoride (Bio-Rad, Hercules, Calif., USA). After blocking the membranes with 5% nonfat milk for 1 h at room temperature, they were incubated with primary antibodies as indicated. The membranes were then washed and incubated at room temperature with peroxidase-conjugated secondary antibodies for 1 h. After 5 times of washing, immunodetected bands on the membranes were visualized by taking chemiluminescent images on X-ray films with the enhanced chemiluminescence (ECL) system (PerkinElmer, Waltham, Mass., USA) as per the manufacturer's instructions.
[0134] Cell viability and cell colony formation assays. Equal numbers of cells were plated in 96 well plates in triplicate. After incubation with indicated treatments for 72 hours, cell viability was quantified using the CCK-8 according to the manufacturer's instructions. For the cell colony formation assay, cell colonies were visualized using crystal violet (Fisher scientific, Pittsburgh, Pa., USA) according to the manufacturer's instructions.
[0135] Animals. Female NU/NU nude mice (6 weeks old) were purchased from either Charles River (Wilmington, Mass., USA) for the TNBC tumour models or The Jackson Laboratory (Bar Harbour, Me., USA) for the HER2+ tumour model. Wild type C57BL/6J mice (6 weeks old) were purchased from The Jackson Laboratory. All animals were maintained 16:8 h of light-dark cycle. All animal studies were conducted by following protocols approved by the Institutional Animal Care and Use Committee (IACUC) at The Ohio State University and Indiana University School of Medicine. The animal protocols are compliant with all relevant ethical regulations.
[0136] Orthotopic xenograft breast tumour models and treatments. For wild type POLR2A.sup.loss/POLR2A.sup.neutral orthotopic xenograft TNBC model, nude mice were injected with 1×10.sup.6 MDA-MB-453 cancer cells into the 4.sup.th inguinal mammary fat pad on the left and 1×10.sup.6 MDA-MB-231 cancer cells into the 4.sup.th inguinal mammary fat pad on the right on the same day. For isogenic POLR2A.sup.loss/POLR2A.sup.neutral orthotopic xenograft TNBC model, nude mice were injected with 1×10.sup.6 HCC1937 (POLR2A.sup.loss) cancer cells into the 4.sup.th inguinal mammary fat pad on the left and HCC1937 (POLR2A.sup.neutral) cancer cells into the 4.sup.th inguinal mammary fat pad on the right on the same day. For isogenic POLR2A.sup.loss/POLR2A.sup.neutral orthotopic xenograft HER2+ breast cancer model, nude mice were injected with 5×10.sup.6 HER18 (POLR2A.sup.loss) cancer cells into the 4.sup.th inguinal mammary fat pad on the left and HER18 (POLR2A.sup.neutral) cancer cells into the 4.sup.th inguinal mammary fat pad on the right. The nude mice were supplemented with weekly subcutaneous oestradiol cypionate injections (3 mg kg.sup.−1 per week), starting 1 week prior to injection of tumour cells. After initial tumour establishment (˜100 mm.sup.3), mice were randomly grouped and treated with indicated formulations. Treatment formulations were administered twice weekly by intravenous injection via the tail vein, and tumour size and body weight were monitored biweekly. The dose of siPol2 for any formulations with the siRNA was 0.3 mg kg.sup.−1 body weight. Tumour size was measured using a calliper, and tumour volume was calculated using the standard formula: 0.5×L×W.sup.2, where L is the long diameter and W is the short diameter. Mice were euthanized when they met the institutional euthanasia criteria for tumour size and overall health condition. Tumours were removed, photographed, and weighed. The freshly dissected tumour tissues were either used for western blot analysis or fixed in 10% buffered formalin overnight, transferred to 70% ethanol, embedded in paraffin, sectioned and stained with hematoxylin and eosin (H&E) and indicated antibodies.
[0137] Biodistribution of nanoparticles in vivo. After initial tumour establishment (˜100 mm.sup.3), mice were injected with either 100 μl of saline, Cy5.5-siPol2 (50 μg) in 100 μl of saline, or Cy5.5-siPol2@NPs (nanoparticles containing 50 μg of Cy5.5-siPol2) in 100 μl of saline. Images were taken immediately before injection and at 2 and 8 h after intravenous injection via the tail vein using an in vivo imaging system (Perkin Elmer IVIS, Waltham, Mass., USA) with an excitation at 675 nm and a 690-770 nm Cy5.5-filter to collect the fluorescence emission of Cy5.5. For ex vivo imaging, the mice were sacrificed after in vivo imaging at 8 h, and tumor and main organs were harvested for further fluorescence imaging using the same in vivo imaging system.
[0138] Detection of immune response induction by nanoparticles. Wild type C57BL/6J mice (6 weeks old) purchased from The Jackson Laboratory were randomized and injected intravenously with the following treatments: 1) saline, 2) free siPol2, 3) siNT@NPs, and 4) siPol2@NPs. At indicated time points, blood was drawn from mice and the concentration of indicated cytokines in serum was measured by BD Mouse Inflammation Kit (#552364), ALT Activity Assay Kit (Abcam, ab105134), and AST Activity Assay Kit (Abcam, ab105135) according to the manufacturer's instructions.
[0139] Statistics and reproducibility. Each experiment was repeated independently for at least three times. Unless otherwise noted, data are presented as mean±standard deviation (s.d.) or standard error of mean (s.e.m.). Student's t-test (unpaired and two-tailed) was used to compare two groups of independent samples, assuming equal variance with no samples being excluded from the analysis. One-way analysis of variance (ANOVA) with Dunnett's post hoc analysis was used for multiple comparison (when more than two groups compared). One-way ANOVA with Fisher's LSD post hoc was used for tumour growth analysis. Statistical methods used for The Cancer Genome Atlas data analysis were described above. All statistical analyses were carried out with Prism (version 7.0, GraphPad Software, San Diego, Calif., USA). A p value less than 0.05 was considered statistically significant.
[0140] Results
[0141] Hemizygous Deletion of POLR2A and TP53 in Breast Cancer
[0142] Inactivation of TP53 is a frequent event in most human tumours (Liu, Y, et al. Nature 2015 520(7549):697-701). However, neither TP53 mutation nor complete deletion of TP53 is the most frequent in primary human breast cancers. There are only 36% (741 out of 2,051) and 0.5% (5 out of 2,051) cases for mutation and homozygous deletion, respectively (
[0143] Synthesis and Characterization of Nanoparticles
[0144] A core-shell nanoplatform illustrated in
[0145] Typical transmission electron microscopy images of the siPol2-laden nanoparticles (siPol2@NPs) are shown in
[0146] The migration of siPol2 into electrophoretic agarose gel is almost completely inhibited by nanoparticle encapsulation with negligible release at pH 7.4 (
[0147] To examine cellular uptake and intracellular trafficking, siPol2 was labelled with a red fluorescence probe (Cy5.5) and encapsulated in the nanoparticles. In MDA-MB-453 TNBC cells treated using nanoparticles without CO.sub.2, the red fluorescence of Cy5.5 overlaps with the green fluorescence of LysoTracker Green that stains the endo/lysosomes at all time points (
[0148] Suppression of POLR2A Inhibits POLR2A.sup.loss Cancer Cell Growth
[0149] The POLR2A targeted strategy inspired by the data shown in
[0150] To exclude potential genetic differences across cell lines, two isogenic HCC1937 cell lines were generated with hemizygous loss of POLR2A using CRISPR (clustered regularly interspaced short palindromic repeat)/Cas9 (
[0151] Suppression of POLR2A Inhibits POLR2A.sup.loss Tumour Growth
[0152] To establish orthotopic HCC1937 TNBC tumours, the isogenic POLR2A.sup.loss and wild type POLR2A.sup.neutral HCC1937 cells were injected into the 4.sup.th inguinal mammary fat pad on the left and right sides of each mouse (
[0153] To investigate the material safety and antitumor efficacy, four different treatments (saline, free siPol2, siNT@NPs, and siPol2@NPs) were applied twice a week after tumour establishment in nude mice (
[0154] Inhibiting POLR2A by siPol2@NPs significantly inhibited the POLR2A.sup.loss tumour growth by ˜80% (left panels in
[0155] To confirm the findings with tumours derived from the isogenic pairs of HCC1937 cells, wild type POLR2A.sup.loss (MDA-MB-453) and POLR2A.sup.neutral (MDA-MB-231) cells were used to establish the orthotopic tumours and did treatment injections of saline, siNT@NPs, and siPol2@NPs twice a week (
[0156] It is worth noting that the strategy of targeting POLR2A using the siPol2@NPs can also be used to selectively inhibit the growth of POLR2A.sup.loss HER2+ HER18 breast cancer cells (in vitro) and tumours (in vivo) (
[0157] As shown in
[0158] Conclusions
[0159] This study, by analysing TNBC databases, reveals that POLR2A gene is almost always co-deleted with TP53 in the Chr17p deletion region, and 53% of TNBC harbours this heterozygous deletion. Moreover, the POLR2A expression levels are highly correlated with the copy number of POLR2A, rendering cancer cells with heterozygous loss of TP53 vulnerable to POLR2A inhibition. This collateral loss of POLR2A with TP53 prompted us to use RNAi to precisely target POLR2A for TNBC treatment. To overcome the hurdles to cytosolic delivery of siRNA for RNAi, a unique nanoplatform with a low pH-activated “bomb-like” effect for endo/lysosomal escape was developed. This improves cytosolic delivery of siPol2 to inhibit POLR2A in TP53.sup.loss cells. The anticancer capability of siPol2@NPs in vivo was examined using three different orthotopic tumour models derived from both wild type and isogenic cell lines. The nanoparticles were found to preferentially accumulate in both the POLR2A.sup.neutral and POLR2A.sup.loss tumours. Importantly, the data show that, in tumours with heterozygous POLR2A loss, inhibition of POLR2A with siPol2-laden nanoparticles leads to an enhanced reduction of the tumour growth with no evident systemic toxicity. This approach also possesses several important advantages for clinical applications. Collectively, this study may provide a promising nanotechnology-based precision-targeting strategy for fighting against TNBC and potentially many other types of cancers harbouring the common TP53 genomic alteration, regardless of the TP53 status.
[0160] The hemizygous deletion of TP53, which often involves a large fragment (over several megabases), even the whole short arm of chromosome 17 (17p), is a frequent genomic event across many types of human cancers. In tumours with hemizygous loss of TP53, POLR2A is almost always co-deleted. As an example, 99.5% (575 out of 578) of human breast cancers with hemizygous loss of TP53 contain co-deletion of POLR2A. In clinical practice, the copy number of TP53 gene has been examined by fluorescence in situ hybridization (FISH). The use of archival frozen tumour tissue imprint specimens for FISH has been well established in the clinic. Quantitative PCR and SNP DNA microarrays are also feasible to detect copy number changes of TP53 and POLR2A. Based on the extensive cancer genomics data, it appears to be unnecessary to check the heterozygous deletion of POLR2A in the cancers harbouring hemizygous loss of TP53. Approximately half of human breast cancers with hemizygous loss of TP53 harbour mutant TP53 on the remaining allele, in support of the two-hit hypothesis in human cancer. However, the sensitivity of cancer cells to POLR2A inhibition appears to be primarily dependent on the status of POLR2A, regardless of TP53 status. Moreover, given the prevalence of TP53 loss in all breast cancer subtypes as well as other types of human cancer, the principle of essential lethality to POLR2A inhibition can also be applied to other human cancers including HER2+ breast cancer. Over the last a few years, the rapid development of high throughput platforms such as microarrays and next generation sequencing technologies offers a promising prospect for the translation of the POLR2A-targeted therapy.
[0161] The knowledge and arsenal of cancer nanomedicine have rapidly expanded in the past several years (Shi, J, et al. Nat. Rev. Cancer 2016 17:20). However, only few nanoparticle-based RNAi therapeutics have entered the clinical trial phase (Shi, J, et al. Nat. Rev. Cancer 2016 17:20; Wittrup, A, et al. Nat. Rev. Genet. 2015 16:543; Bobbin, M. L, et al. Annu. Rev. Pharmacol. Toxicol. 2016 56(1):103-122; Dahlman, J. E, et al. Nat. Nanotechnol. 2014 9:648). Lipid nanoparticles or liposomes-based delivery of siRNA is the most investigated approach in clinical trials (Blanco, E, el. Nat. Biotechnol. 2015 33:941). Unfortunately, this approach has not reached phase II/III stages of clinical trial. One of the major reasons is that it cannot achieve endo/lysosomal escape to allow the siRNA to reach the RNA-Induced Silencing Complex (RISC) located in the cytoplasm. Endo/lysosomal escape of siRNA is essential because the RNases inside the endo/lysosomes could quickly degrade the therapeutic agent before it can reach its target. Unlike the liposomes-based approach, the disclosed pH-activated “nano-bomb” nanoparticles were designed for enhanced cytosolic delivery of siRNA because it can respond to the low-pH environment in endo/lysosomes to quickly release most of the encapsulated siRNA into the cytosol before it is degraded. This leads to a highly efficient utilization of the siRNA, which promotes high therapeutic efficacy with minimized siRNA dose compared to the liposomes-based approach. Moreover, tumour cells harbouring hemizygous deletion of TP53, which is a common genetic alteration in cancer, are markedly sensitive to further POLR2A inhibition. In other words, low dosage of siPol2@NPs could be used to kill POLR2A.sup.loss cells (tumour cells) but not POLR2A.sup.neutral cells (healthy cells). Another major reason causing nanomedicine to fail in clinical trial (phase I) is the undesired side effects (Bobbin, M. L, et al. Annu. Rev. Pharmacol. Toxicol. 2016 56(1):103-122; Blanco, E, el. Nat. Biotechnol. 2015 33:941). The disclosed nanoparticles were synthesized using FDA-approved biocompatible materials, which should minimize the undesired side effects. Therefore, the siPol2@NPs capable of quickly escaping endo/lysosomes triggered by low pH and precisely targeting POLR2A.sup.loss cancer cells have tremendous potential for effective and safe delivery of siRNA to treat patients with cancers harbouring hemizygous loss of POLR2A regardless of the TP53 status.
Example 2: Targeting 17q23 Amplicon to Overcome the Resistance to Anti-HER2 Therapy in HER2+ Breast Cancer
[0162] Multiple trastuzumab-resistance mechanisms have been identified in preclinical studies, in which constitutive activation of the PI3K pathway owing to PTEN deficiency or PIK3CA mutations seems to be one of the most prevalent events (Nagata Y, et al. Cancer Cell 2004 6:117-127; Zhang S, et al. Nat Med 2011 17:461-469; Liang K, et al. Mol Cancer Ther 2003 2:1113-1120). The better understanding of breast cancer biology has translated into the development of novel anti-HER2 agents with varying mechanisms of action (Stern H M. Sci Transl Med 2012 4:127rv122; Zardavas D, et al. Curr Opin Oncol 2012 24:612-622). The small molecular tyrosine kinase inhibitor lapatinib has demonstrated activity in HER2+ metastatic breast cancer and in the preoperative setting (Geyer C E, et al. N Engl J Med 2006 355:2733-2743; Baselga J, et al. Nat Rev Cancer 2009 9:463-475). Pertuzumab, a monoclonal antibody with a distinct binding site from trastuzumab, inhibits receptor dimerization (Franklin M C, et al. Cancer Cell 2004 5:317-328; Swain S M, et al. N Engl J Med 2015 372:724-734). The addition of pertuzumab to combination therapy has led to improvements in progression-free survival in patients with HER2+ metastatic breast cancer and higher response rates in the preoperative setting (Swain S M, et al. N Engl J Med 2015 372:724-734).
[0163] To maintain genome stability, eukaryotic cells have evolved with the ability to detect and translate the initial signals of DNA damage to proper cellular responses. The key components of the DNA damage response (DDR) are the phosphoinositide-3-kinase-related kinase (PIKK) family, which includes ATM (ataxia-telangiectasia mutated), ATR (ataxia-telangiectasia and Rad3-related), and DNA-PKcs (DNA dependent protein kinase catalytic subunit) (Shiloh Y. Nat Rev Cancer 2003 3:155-168). These kinases initiate signaling cascades upon many types of DNA breaks and activates cell cycle checkpoints and DNA repair pathways (Matsuoka S, et al. Science 2007 316:1160-1166; Paull T T. Annu Rev Biochem 2015 84:711-738). Activated oncogenes induce the stalling and collapse of DNA replication forks, leading to the formation of double-stranded breaks. Advanced tumors often show inactivation of DDR markers, suggesting that silencing of the DDR is an important prerequisite for cancer progression. Once DNA damage is repaired, the cell needs to return to a pre-stress state. The wild-type p53-induced phosphatase 1 (WIP1, also known as PPM1D) appears to be a homeostatic regulator and a master inhibitor in the DDR. It is a type 2C serine/threonine phosphatase that is induced in response to DNA damage in a p53-dependent manner. Previous studies demonstrated that WIP1 dephosphorylates multiple key proteins in the DDR, such as Chk1, Chk2, p53, Mdm2 and H2AX (Emelyanov A, et al. Oncogene 2015 34:4429-4438). Importantly, WIP1 suppresses p53 by multiple mechanisms, including dephosphorylation of p53 kinases (Chk1, Chk2), p53 itself, and Mdm2. Thus, WIP1 facilitates reversal of the DNA damage signaling cascade and reverts the cell to a pre-stress state following completion of DNA repair.
[0164] MicroRNAs (miRNAs) are small non-coding RNAs that control gene expression at the post-transcriptional level through translational inhibition and destabilization of their target mRNAs (Bartel D P. Cell 2009 136:215-233). The RNase III enzyme Drosha in the microprocessor complex cleaves pri-miRNAs to pre-miRNAs that contain a characteristic stem-loop structure (Lee Y, et al. EMBO J 2004 23:4051-4060). Pre-miRNAs are then exported to cytoplasm by RanGTP-binding nuclear transporter, Exportin-5. The final step for miRNA maturation is executed by Dicer that cleaves pre-miRNAs into their mature forms (Lin S, et al. Nat Rev Cancer 2015 15:321-333; Chendrimada T P, et al. Nature 2005 436:740-744). The association of miRNA with breast cancer pathogenesis is supported by the studies examining expression of miRNAs in breast cancer cell lines and clinical samples. Expression profiles of miRNAs reflect the lineage and differentiation status of the breast cancer (Blenkiron C, et al. Genome Biol 2007 8:R214). A number of miRNAs are differentially expressed between these molecular tumor subtypes and individual miRNAs are associated with clinicopathological factors.
[0165] Consistent with its oncogenic functions, the WIP1 gene in the 17q23 chromosome region is amplified and overexpressed in 11-18% of human breast cancer (Emelyanov A, et al. Oncogene 2015 34:4429-4438; Bulavin D V, et al. Nat Genet 2002 31:210-215). The WIP1-null mice are resistant to spontaneous and oncogene-induced tumors due to enhanced DNA damage and p53 responses (Nannenga B, et al. Mol Carcinog 2006 45:594-604; Bulavin D V, et al. Nat Genet 2004 36:343-350). However, the WIP1 transgene in mouse mammary glands fails to initiate any mammary tumors. While previous studies ruled out the possibility of any protein-coding oncogenes in the WIP1-containing 17q23 amplicon, the disclosed in-depth analysis of human breast cancer genomic DNA revealed an oncogenic miRNA gene, MIR21, in almost all the WIP1 amplicons. Moreover, approximately 81% of the WIP1/MIR21-amplified cancer samples have concurrent HER2 amplification. As disclosed herein, the chromosome 17q23 amplification in the HER2+ breast cancer results in aberrant elevation of WIP1 and miR-21, which not only contributes to breast cancer initiation and progression, but also causes intrinsic resistance to anti-HER2 therapy. Therefore, targeted inhibition of WIP1 and miR-21 could be an effective strategy for the therapy of trastuzumab-resistant HER2+ breast cancer, which has never been explored in the literature.
[0166] In this study, a new therapy of trastuzumab-resistant HER2+ breast cancer was developed with the combined use of a small molecular inhibitor against WIP1 (GSK2830371), anti-miR-21 oligonucleotides, and trastuzumab. However, GSK2830371 has poor solubility in water with poor bioavailability in vivo (Gilmartin A G, et al. Nat Chem Biol 2014 10:181-187). Although anti-miR-21 is highly soluble in water, it is relatively unstable in blood. Furthermore, neither GSK2830371 nor anti-miR-21 can efficiently enter cells by itself. To address these challenges, the nanoparticle system described above was used to co-encapsulate GSK2830371 and anti-miR-21 for targeted co-delivery into HER2+ tumor. The disclosed data show that the combined treatment with WIP1 and miR-21 inhibitors co-delivered using the nanoparticle reduces tumor growth by 95% compared to the control groups, confirming that co-inhibition of WIP1 and miR-21 is a promising therapeutic strategy for trastuzumab-resistant HER2+ breast cancer.
[0167] Methods
[0168] TCGA Analysis. The TOGA breast cancer data were downloaded, which included copy number variation (CNV) at segment level in log-ratio, CNV at gene level estimated by using the GISTIC2 algorithm, RNA-seq for gene expression in base-2 log scale, miRNA mature strand expression data in logarithm (base-2), and patient information about HER2 positive or negative. To study the amp similarity between other genes and WIP1, a focus was placed on only patients with WIP1 amplification. The ratio of patients with amplification on the gene as well was adopted to represent such similarity.
[0169] Tissue culture. MCF-7, MDA-MB453, BT474, HMC18, MDA-MB231, MCF10A cell lines were purchased from the American Type Culture Collection. HER18 cells (stably overexpress HER2, parent line MCF-7) were provided (MD Anderson Cancer Center). These cell lines were maintained in Dulbecco's Modified Eagle Medium (DMEM) with 10% FBS at 37° C. in 5% CO.sub.2. MCF10A cells were maintained in DMEM/F12 with 5% Horse Serum EGF (20 ng/ml), Hydrocortisone (0.5 mg/ml), Cholera Toxin (100 ng/ml) Insulin (10 μg/ml). BT474 and HER18 cells were grown and selected in 10 μg/ml Trastuzumab for several weeks and defined as Trastuzumab-resistant cells (HER18-R, BT474-R).
[0170] Antibodies and Reagents. Anti-WIP1 antibody (A300-664A), anti-DDX1 (A300-521A), anti-Drosha (A301-886A) and anti-DDX5 (A300-523A) were purchased from Bethyl Laboratories. Anti-HER2 antibody (15212-1-AP) was purchased from proteintech. Anti-p21 (sc-397), anti-GAPDH (sc-20357), anti-Actin (sc-1616), HRP-anti-goat IgG (#2020), HRP-anti-rabbit IgG (#2054) and HRP-anti-mouse IgG (#2055) antibodies were purchased from Santa Cruz. Anti-AKT (4691), anti-phospho-AKT (S473), anti-Chk2 (2662S), anti-phospho-Chk2 (2661S) anti-cleaved caspase3 (9661S) were purchased from Cell Signaling. Trastuzumab (Herceptin, Genentech), GSK-2830371 (Active Biochem) were used to target HER2 and WIP1 in vitro and in vivo. Antisense miR-21 miRZip (System Bioscience) were stably expressed to inhibit miR-21 function in the cells. To evaluate and measure miR-21 in the cells, pmirGLO Dual Luciferase miR-21 vector was used in the cells. mirVana miR-21 inhibitor (Ambion, Life Technology) was used for in vivo miR-21 inhibition. PLGA (lactide:glycolide=75:25, Mw: 4,000-15,000), PF127, and organic solvents were purchased from Sigma (St. Louis, Mo., USA). Agarose, ethidium bromide and loading buffer were purchased from Thermo Fisher Scientific (Grand Island, N.Y., USA). DPPC was purchased Anatrace (Maumee, Ohio, USA). Chitosan oligosaccharide of pharmaceutical grade (Mw: 1.2 kD, 95% deacetylation) was purchased from Zhejiang Golden Schell Biochemical Co. Ltd (Zhejiang, China). Methyl aminomethanimidothioate hydroiodide was purchased from Santa Cruz Biotechnology (Dallas, Tex., USA).
[0171] Generation of Doxycycline-inducible knocked-down cell lines. Lentiviral pGIPZ vector expressing non-specific silencing shRNA control, WIP1 and DDX5 shRNAs were obtained from the MD Anderson shRNA and ORFome Core Facility (originally from Open Biosystem) and sub-cloned to pTRIPZ vector according to the manufacturer's instructions. To generate Dox-inducible anti-sense miR-21 miRZip expressing cell lines, anti-microRNA expression cassette was sub-cloned to pLKO-Tet-On vector. Cells were infected with lentiviruses in the presence of polybrene (8 μg/ml). To establish stable knockdown cell line, lentiviral shRNA-transduced cells were selected with puromycin (2 μg/ml) 48 h post-infection and individual colonies were propagated and validated for expression by Western blotting (protein) and qRT-PCR (mRNA).
[0172] Genomic DNA isolation and copy number validation. Total genomic DNA was extracted from human cell lines using DNeasy Blood & Tissue Kit (Qiagen) according to the manufacturer's purification instructions. The copy number validation for HER2, WIP1, and MIR21 were determined by quantitative PCR assays using iTaq Universal SYBR Green Supermix (Bio-Rad) on an Applied Biosystems 7900HT Sequence Detection System.
[0173] Immunoblotting. Immunoblotting was performed as described previously (Liu Y, et al. Nature 2015 520:697-701). Briefly, total cell lysates were solubilized in lysis buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5% NP-40, 0.5% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, 1 mM sodium fluoride, 5 mM sodium vanadate, 1 μg each of aprotinin, leupeptin, and pepstatin per ml). Proteins were resolved by SDS-PAGE gels and then proteins were transferred to PVDF membranes (Bio-Rad). The membranes were blocked with 5% nonfat milk for 1 h at room temperature prior to incubation with indicated primary antibodies. Subsequently membranes were washed and incubated for 1 h at room temperature with peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology). Following several washes, chemiluminescent images of immunodetected bands on the membranes were recorded on X-ray films using the enhanced chemiluminescence (ECL) system (Perkinelmer) according to the manufacturer's instructions.
[0174] Cell viability assay. Equal numbers of cells were plated in 12 well plates in triplicate. After incubation with indicated reagents for 72 hours, cell viability was quantified using Vi-Cell cell viability analyzer (Beckman Coulter).
[0175] Soft agar colony formation assay. 2000 cells per well mixed in a 0.35% agarose/complete media suspension were seeded onto 0.7% agarose/complete media bottom layer. Three weeks later, 100 μl per well of p-iodonitrotetrazolium violet (1 mg/ml, Sigma) was added for 16 h before photographed.
[0176] Mammosphere culture. Mammary tumor cells were plated onto ultralow attachment plates (Corning) at a density of 20,000 viable cells/mL (to obtain primary mammospheres) in a serum-free DMEM-F12 (Invitrogen) supplemented with 5 μg/mL insulin, 20 ng/mL epidermal growth factor and 20 ng/mL basic fibroblast growth factor (Sigma), and 0.4% bovine serum albumin (Sigma). After 10 days, number and size of mammospheres were estimated.
[0177] Immunoprecipitation. Cells were lysed on ice for 30 min in IP buffer (1% NP-40, 50 mM Tris-HCl, 500 mM NaCl, 5 mM EDTA) containing protease inhibitor cocktail. Cell lysates (700 μg) were incubated overnight with 3 μg of antibodies or normal IgG at 4° C. with rotary agitation. Protein A-sepharose beads were added to the lysates and incubated for additional 4 h. Beads will be washed three times with IP buffer and boiled for 10 min in 3% SDS sample buffer. Total cell lysates and immunoprecipitates were separated by SDS-PAGE and analyzed by Western blotting.
[0178] RNA immunoprecipitation (RIP) assay. Cell were crosslinked for 20 min with 1% formaldehyde, and cell pellets were resuspended in buffer B (1% SDS, 10 mM EDTA, 50 mM Tris-HCl (pH 8.1), 1× protease inhibitor, 50 U/ml RNase inhibitor). Incubated 10 min in ice, the pellets were disrupted by sonication, and the lysates were subjected to immunoprecipitation with control IgG or anti-DDX1 or anti-Drosha antibody, followed by stringent washing, elution, and reversal of crosslinking. The RNA was resuspended in 20 μl of TE buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 50 U/ml RNase inhibitor) and incubated with DNase I for 30 min at 37° C. to remove any remaining DNA. After extraction with phenol:chloroform:isoamyl alcohol (25:24:1), RNA was precipitated with ethanol and dissolved in 20 μl of DEPC-treated water. RNA (5 μl) was used for the cDNA synthesis reaction. Quantitative PCRs were then performed on real-time PCR machine.
[0179] RNA isolation, qRT-PCR, and miRNA PCR array. Total RNA was isolated using TRIzol reagent (Life Technologies) and then reverse-transcribed using iScript cDNA Synthesis Kit (Bio-Rad). The resulting cDNA was used for qPCR using iTaq Universal SYBR Green Supermix (Bio-Rad) with gene-specific primers and the results were normalized to β-actin control. To analyze miRNAs, total RNA was isolated using Trizol reagent according to the manufacturer's instructions (Life Technologies) and was then reverse transcribed with a Universal cDNA Synthesis Kit II (Exiqon). cDNA was used for qPCR using SYBR Green master mix (Exiqon) on ABI4900 real-time PCR cycler. miRNA LNA PCR primer sets (Exiqon) and gene specific primers were used for detecting miRNA and mRNA levels and data was normalized to internal control, U6 (miRNA) or GAPDH (mRNA). RT-PCR primers are shown in Table 1.
TABLE-US-00002 TABLE 1 Primer sequences for real-time PCR. pri-miR-21-forward TTTTGTTTTGCTTGGGAGGA (SEQ ID NO: 6) pri-miR-21-reverse AGCAGACAGTCAGGCAGGAT (SEQ ID NO: 7) pre-miR-21-forward ATGTTGACTGTTGAATCTCATGG (SEQ ID NO: 8) pre-miR-21-reverse TGTCAGACAGCCCATCGAC (SEQ ID NO: 9) pri-miR-200a-forward GATGCAAGGGTCAGAAGGGC (SEQ ID NO: 10) pri-miR-200a-reverse GAGCCATCTGGCCCGGACG (SEQ ID NO: 11) pri-miR-16-forward GCAATTACAGTATTTTAAGAGATGAT (SEQ ID NO: 12) pri-miR-16-reverse CATACTCTACAGTTGTGTTTTAATGT (SEQ ID NO: 13) DDX1-forward TTGATGGGAAAGTTACCTACGG (SEQ ID NO: 14) DDX1-reverese CAAGATGCAGGAAAGATGTCTG (SEQ ID NO: 15) DDX5-forward CACAGCATACACTTTCTTTACACC (SEQ ID NO: 16) DDX5-reverse TGGAACGACCTGAACCTCTG (SEQ ID NO: 17) GAPDH-forward AGCCACATCGCTCAGACAC (SEQ ID NO: 18) GAPDH-reverse GCCCAATACGACCAAATCC (SEQ ID NO: 19) WIP1-forward AGAAGCAGAAGGGTTTCACCT (SEQ ID NO: 20) WIP1-reverse CATTCCGCCAGTTTCTTCCAC (SEQ ID NO: 21) HER2-forward TGCAGGGAAACCTGGAACTC (SEQ ID NO: 22) HER2-reverse ACAGGGGTGGTATTGTTCAGC (SEQ ID NO: 23)
[0180] miR-21 in situ hybridization. Breast cancer tissue array (BR10010) was purchased from Biomax.us, containing 50 cases of breast carcinoma. As described previously (Huo L, et al. Mod Pathol 2016 29:330-346), the tissue slides were first digested with 15 μg/ml proteinase K for 10 min at room temperature, and then hybridized with the double-DIG-labeled mercury LNA microRNA probe (Exiqon) for 2 h at 50° C. on Ventana Discovery Ultra (Ventana Medical Systems). The digoxigenins were then detected with a polyclonal anti-DIG antibody and alkaline phosphatase-conjugated second antibody using NBT-BCIP as the substrate. Raw images were captured with the same exposure and gain settings from all slides and saved as TIF files, and were analyzed using intensity measurement tools of Image-Pro Plus software.
[0181] Synthesis of nanoparticles. The nanoparticles were synthesized using a double emulsion method with a slight modification (Wang H, et al. Adv Mater 2016 28:347-355). First, Chitosan was modified with guanidine group according to the literature (Bottcher T, et al. J Am Chem Soc 2013 135:2927-2930) to form chitosan-guanidine (CG). To capture carbon dioxide (CO.sub.2), CG aqueous solution was bubbled with CO.sub.2 for 1 h to form CG-CO.sub.2. PLGA (20 mg) and DPPC (10 mg) were dissolved in 2 mL dichloromethane (DCM) and 50 μL GSK2830371 in tetrahydrofuran (THF) solution (40 mg/mL) was then added, the above mixture together with 400 μL of DI water containing 500 μg/mL anti-miR21 oligonucleotide and 500 μg/mL CG-CO.sub.2 were transferred into a 50 mL centrifuge tube. Then the immiscible solutions were emulsified by sonication for 1 min using a Bransan 450 sonifier. Next, this first emulsion and 8 mL of chitosan-PF127 solution (in DI water) were emulsified by sonication for 1 min. After rotary evaporation to remove the organic solvent, the nanoparticles were collected by centrifugation at 10000 g for 10 min at room temperature and washed twice with DI water.
[0182] Characterization of nanoparticles. The nanoparticle was characterized using both transmission electron microscopy (TEM) and dynamic light scattering (DLS). First, nanoparticles were soaking in soaking in Phosphate Buffer (pH 7.4, pH 6.0) or Acetate Buffer (pH 5.0), respectively, for 6 h. For TEM study, the nanoparticles were negatively stained with uranyl acetate solution (2%, w/w) and examined using an FEI (Moorestown, N.J., USA) Tecnai G2 Spirit transmission electron microscope. The nanoparticle size was determined using a Brookhaven (Holtsville, N.Y., USA) 90 Plus/BI-MAS dynamic light scattering instrument.
[0183] Electrophoretic gel assay. Free anti-miR21 oligonucleotide and in-MW@NP (in PBS or serum) were mixed with loading buffer, and then loaded into 2% wt agarose gel with 0.5 mg/mL ethidium bromide. Electrophoresis was conducted in 1×TEA buffer at 80 V for 10 min. The result gels were analyzed using a UV illuminator (FluorChem™ E System, CA, USA) to show its location of anti-miR21 oligonucleotide.
[0184] Cell uptake and intracellular distribution of nanoparticles. Dex-Rho was encapsulated inside the nanoparticles using the same method described above. To study cellular uptake and subcellular localization of nanoparticles, HER8R cells were treated with Dex-Rho@NP or free Dex-Rho for 1-6 h at 37° C. The cells were further treated with medium containing 90 nM LysoTracker Green and 50 nm DAPI. Then, the cells were further examination using an Olympus FluoView™ FV1000 confocal microscope.
[0185] Breast tumor xenograft mouse model. Female NOD/SCID mice (6-8 weeks old) were purchased from Jackson Laboratories. All studies were approved and supervised by the Institutional Animal Care and Use Committee at the MD Anderson Cancer Center. For the breast cancer orthotopic xenograft model, nude mice were injected with 6×10.sup.6 HER18 human breast cancer cells in the mammary fat pad as described previously (McKenzie T, et al. Surgery 2004 136:437-442; Warburton C, et al. Clin Cancer Res 2004 10:2512-2524). The nude mice were supplementary with weekly subcutaneous estradiol cypionate injections (3 mg/kg/week), starting 1 week prior to injection of tumor cells. After initial establishment of tumor (50 mm.sup.3), mice were randomly grouped and treated with or without 1 μg/ml Dox in drinking water for 4 weeks. The Dox water was changed every other day. The administration of trastuzumab (5 mg/kg) was performed biweekly for 4 consecutive weeks by intraperitoneal injection.
[0186] For xenograft tumor studies using nanoparticles, mice bearing trastuzumab-resistant HER18 tumors were randomized to four groups (n=8) and received the following treatments: 1) control nanoparticles; 2) WIP1 inhibitor nanoparticles; 3) miR-21 inhibitor nanoparticles; and 4) WIP1 inhibitor+miR-21 inhibitor nanoparticles. Nanoparticles were administered twice weekly by intraperitoneal injection, and tumor size and body weight changes were monitored biweekly. Tumor size was measured using a caliper, and tumor volume was calculated using the standard formula: 0.5×L×W.sup.2, where L is the longest diameter and W is the shortest diameter. Mice were euthanized when they met the institutional euthanasia criteria for tumor size and overall health condition. Tumors were removed, photographed and weighed. The freshly dissected tumor tissues were fixed in 10% buffered formalin overnight, transferred to 70% ethanol, embedded in paraffin, sectioned and stained with hematoxylin and eosin and indicated antibodies.
[0187] Immunohistochemistry. The tumors were fixed in 10% neutral buffered formalin and embedded in paraffin and 5-μm tissue sections were serially cut and mounted on slides. The sections were de-paraffinized in xylene, re-hydrated, and boiled for 10 min in antigen retrieval buffer. After retrieval, the sections were washed with distilled water and endogenous peroxidase activity was blocked using 3% H.sub.2O.sub.2 in TBS for 15 min and then blocked with blocking solution (1% bovine serum albumin, 10% normal serum in 1×TBS). Samples were incubated with primary antibodies overnight at 4° C., washed three times with TBST buffer, and then incubated with biotinylated goat anti-rabbit or anti-mouse IgG (GR608H, BioCare Medical). A streptavidin-biotin peroxidase detection system with 3,3′-diaminobenzidine as substrate was used according to the manufacturer's instructions (DAB Peroxidase Substrate Kit, Vector Laboratory). Sections were counterstained with haematoxylin. For immunocytochemistry, cells on chamber slide were fixed in 3.7% paraformaldehyde for 10 min, and permeabilzed by 0.2% Triton X-100 for 5 min and then blocked with blocking solution. After incubation with primary antibodies, cells were washed with PBS three times and incubated with Alexa fluor 488 or 594 conjugated antibodies (Life Technologies) and counter stained with Hoechst 33258. After mounting, signals were observed under microscope. Breast cancer tissue array (BR10010) was purchased from Biomax.us.
[0188] Results
[0189] Co-Amplification of WIP1 and MIR21 in the 17q23 Amplicon of HER2+ Breast Cancers
[0190] The W/P1-containing 17q23 region is amplified in a subset (˜11%) of human breast tumors (Li J, et al. Nat Genet 2002 31:133-134). Extensive analyses of breast cancer genomics revealed that the 17q23 amplicon can span up to over 10 Mb, including a number of protein-coding and non-coding genes. But previous studies identified WIP1 as the only oncogene in the amplicon due to incomplete breast cancer genomic databases and lack of noncoding RNA information. To search for other potential genes that potentially promote breast cancer progression, the 17q23 amplicon was analyzed based on the data downloaded from the TOGA (The Cancer Genomics Atlas) breast cancer databases (Cancer Genome Atlas N. Nature 2012 490:61-70; Ciriello G, et al. Cell 2015 163:506-519). The results revealed that the amplicon region for some breast tumors focused an approximately 2.73 Mb region (
[0191] Suppression of miR-21 and WIP1 Inhibits Proliferation and Tumorigenic Potential of HER2+ Breast Cancer Cells
[0192] It has been known that both WIP1.sup.−/− and MIR21.sup.−/− mice have normal mammary gland development and functions (Bulavin D V, et al. Nat Genet 2004 36:343-350; Li J, et al. Nat Genet 2002 31:133-134; Ma X, et al. Proc Natl Acad Sci USA 2011 108:10144-10149), suggesting that WIP1 and miR-21 are dispensable for mammary development and normal physiological functions of mammary epithelial cells. To study their potential oncogenic roles, mammary tumorigenesis of MMTV-ErbB2 transgenic mice were examined in the contexts of WIP1 or MIR21 knockout (
[0193] Oncogene-induced senescence (01S) in mammary glands is a physiologically protective mechanism against breast cancer (Milanese T R, et al. J Natl Cancer Inst 2006 98:1600-1607). Accumulating evidence supports the important role of the ATM-p53 signaling pathway in OIS (Bartkova J, et al. Nature 2005 434:864-870). However, recent studies pointed out that TGF-β signaling pathway is responsible for the ATM-independent OIS in mammary glands (Cipriano R, et al. Proc Natl Acad Sci USA 2011 108:8668-8673). While WIP1 is a master inhibitor for the ATM-p53 signaling, miR-21 may suppress TGF-β signaling via negative regulation of its targets in the pathway. To identify physiological relevant miR-21 targets, several algorithms (TargetScan, PITA, microT and PicTar) were first used to predict miRNA-21 targets and binding sites. Transcripts of 18 genes were identified as potential miR-21 targets in mammary cells, which modulate crucial tumor cell activities (survival and proliferation) (
[0194] DDX5 Gene is Co-Amplified with MIR21 and DDX5 Facilitates Maturation of Pri-miR-21
[0195] While no miRNA-sequence specificity exists for Drosha and DGCR8, two core components in the microprocessor, emerging evidence has shown that regulatory RNA-binding proteins in the Drosha complexes may recruit specific primary miRNAs (pri-miRs) for processing (Wan G, et al. Antioxid Redox Signal 2014 20:655-677). A MS2-TRAP (MS2-tagged RNA affinity purification) assay was performed to identify a pri-miR-21-specific regulatory component in the Drosha microprocessor (Yoon J H, et al. Methods 2012 58:81-87). The assay is based on the addition of a specific MS2 RNA hairpin loop sequence (from bacteriophage MS2) to pri-miR-21, followed by co-expression of the MS2-tagged RNA together with GST-tagged MS2P that specifically binds the MS2 RNA sequence. In addition to those predicted proteins (Drosha and DGCR8) in the microprocessor complex, DEAD-Box helicase 5 (DDX5) was identified in the pri-miR-21-protein complex (
[0196] Inhibition of WIP1 Kills Breast Cancer Cells Carrying 17q23 Amplicon Only in the Presence of Wildtype p53
[0197] A number of studies have pointed out that p53 is an important node for the WIP1-mediated signaling network in the cell. WIP1 directly deactivates p53 by dephosphorylation of Ser15 on human p53, and promotes p53 degradation by stabilizing Mdm2. Moreover, WIP1 indirectly suppresses p53 activity by deactivating the upstream kinases including ATM, CHK1 and CHK2 in the DNA damage response. Thus, inhibiting WIP1 impacts the survival of HER2+ breast cancer cells in a p53-dependent manner. HER18 cells expressing wildtype p53 are very sensitive to the treatment of the WIP1 inhibitor GSK2830371 (
[0198] Inhibition of miR-21 Sensitizes HER2+ Breast Cancer Cells to the Treatment of Trastuzumab
[0199] The anti-HER2 antibody trastuzumab has shown considerable clinical efficacy and extended the overall survival of patients with HER2+ breast cancer. However, multiple trastuzumab resistance mechanisms have been identified in preclinical studies, in which constitutive activation of the PI3K pathway owing to PTEN deficiency or PIK3CA mutations seems to be the most prevalent. In support of the previous reports concerning the function of miR-21 in negative regulation of PTEN (Meng F, et al. Gastroenterology 2007 133:647-658), miR-21 directly targets PTEN in mammary epithelial cells (
[0200] To further test the suppressive effect of WIP1 and miR-21 inhibition on breast tumor growth in vivo, HER18R cells expressing doxycycline-inducible control, WIP1, miR-21 or DDX5 short-hairpin RNA (shRNA) (>70% knockdown efficiency) were injected to mouse mammary fat pads to establish xenograft breast tumor models in female nonobese diabetic/severe combined immunodeficiency (NOD/SCID) mice. Knockdown efficiency of WIP1, miR-21, and DDX5 shRNAs was confirmed in the HER18R cells (
[0201] Synthesis and Characterization of Nanoparticle for Encapsulation and Delivery of miR-21 and WIP1 Inhibitors
[0202] The nanoparticle was synthesized using four biocompatible materials (three polymers and one phospholipid) approved by the U.S. Food and Drug Administration (FDA) for medical use (
[0203] Typical transmission electron microscopy (TEM) images of in-MW@NP after soaking in Phosphate Buffer (pH 7.4, pH 6.0) or Acetate Buffer (pH 5.0), respectively, for 6 h are shown in
[0204] The stability of anti-miR-21 oligonucleotide encapsulated in the nanoparticles was further examined by incubating it in medium at 37° C. for up to 36 h. As shown in
[0205] To study the low pH-activated nanobomb effect of in-MW@NP, Dextran (10 kD, similar to the molecular weight of anti-miR21 oligonucleotides) labeled with Rhodamine (Dex-Rho) was used to replace the anti-miR-21 oligonucleotides for synthesizing the nanoparticle (DexRho@NP). After incubating the nanoparticles with trastuzumb-resistant HER18R breast cancer cells for 1-6 h, the intracellular distribution of the red fluorescence of Rhodamine is examined against the green fluorescence of lysotracker that stains the endo/lysosomes using confocal microscopy. As shown in
[0206] Nanoparticle-Encapsulated miR-21 and WIP1 Inhibitors Effectively Suppressed the Growth of Trastuzumb-Resistant Breast Tumors
[0207] Next examined was whether the miR-21 and WIP1 inhibitors-laden nanoparticles (in-MW@NP) can be used as a nanoplatform to achieve combined therapy for effective destruction of the trastuzumb-resistant and HER2+ breast cancer cells both in vitro and in vivo. First, the anticancer capacity of the drug-laden nanoparticles was investigated in vitro (
[0208] The tumor targeting capability of the nanoparticles was next investigated in mice. Indocyanine green (ICG) was encapsulated in the nanoparticles for in vivo imaging. Highly enhanced fluorescence of ICG was observable in tumor at 6 h after intravenous injection of the nanoparticles, compared to free ICG (
[0209] Discussion
[0210] WIP1 is a master inhibitor of the DNA damage response. Recent studies have demonstrated that WIP1 regulates the activity and stability of a number of key players in the ATM-p53 signaling pathway (Bulavin D V, et al. Nat Genet 2002 31:210-215; Bulavin D V, et al. Nat Genet 2004 36:343-350; Li J, et al. Nat Genet 2002 31:133-134). There is substantial experimental evidence to support the oncogenic properties of WIP1, but much less is known regarding the clinical significance of WIP1 aberrations in human cancers. Although the WIP1 amplification is closely correlated with poor clinical outcome in human breast cancer, WIP1 transgene itself fails to promote tumorigenesis in mice (Gilmartin A G, et al. Nat Chem Biol 2014 10:181-187; Wong E S, et al. Dev Cell 2009 17:142-149). Here, in-depth analysis of the human 17q23 amplicon revealed that miR-21 is the other potential oncogene that may cooperate with WIP1 in mammary tumor initiation and progression. This finding is important because WIP1 and miR-21 deactivate two major tumor suppression pathways: p53 and PTEN pathways, respectively. There was also a clinically significant finding that a majority of the WIP1/miR-21-amplified cancer samples had HER2 amplification, suggesting that WIP1/miR-21 aberrations cooperate with HER2 in tumors with poor prognosis. Trastuzumab-based anti-HER2 therapy is a mainstay treatment for HER2+ breast cancer patients. While it shows considerable clinical efficacy, the overall response rate to Trastuzumab-containing therapies remains modest due to development of resistance. This study identified potential new drug targets to sensitize HER2+ breast cancer cells to trastuzumab treatment.
[0211] HER2 is amplified in 21.8% of human breast tumors. In addition, a majority of tumors with amplification of WIP1/miR-21 had HER2 amplification, suggesting that WIP1 and miR-21 may functionally interact with HER2 in human breast tumors. In clinical practice, the HER2 antibody trastuzumab and the tyrosine kinase inhibitor lapatinib are currently two primary FDA-approved drugs for the treatment of HER2-positive breast cancer. Although clinically effective, many patients with HER2+ breast cancer either do not respond or eventually develop resistance, suggesting the presence of de novo and acquired mechanisms of drug resistance. Aberrant expression of WIP1 and miR-21 may promote breast tumorigenesis by inhibiting OIS in mammary epithelial cells. OIS is a key anti-cancer barrier at the early stage of tumorigenesis, which involves the ATM-p53 and TGF-β signaling pathways in mammary glands. While the importance of the ATM-p53 signaling has been extensively studied, recent evidence shows that the TGF-β signaling is responsible for the ATM-independent OIS in mammary glands (Cipriano R, et al. Proc Natl Acad Sci USA 2011 108:8668-8673). Although WIP1 is a master inhibitor in the ATM-p53 signaling, overexpression of WIP1 in transgenic mice does not induce mammary tumorigenesis, suggesting that intact TGF-β signaling needs to be overcome for breast cancer initiation. miR-21 targets a number of key genes that induces TGF-β signaling and thus miR-21 is a probably potent inhibitor in the TGF-β pathway. These results suggest that WIP1 and miR-21 cooperatively inhibit these two pathways to override OIS and promote mammary tumorigenesis.
[0212] Post-transcriptional processing of pri-miRNAs is an essential step in miRNA biogenesis. While Drosha and DGCR8 are the core components in the microprocessor, neither of them has binding specificity for individual pri-miRNAs (Bartel D P. Cell 2009 136:215-233; Lin S, et al. Nat Rev Cancer 2015 15:321-333; Chendrimada T P, et al. Nature 2005 436:740-744). DDX5 was identified as a miR-21-specific regulator in the Drosha microprocessor. Thus, co-amplification of DDX5 with MIR21 facilitates the efficient processing of primary miR-21 transcripts and results in elevated levels of miR-21. This hypothesis is also supported by the positive correlation between DDX5 copy numbers and miR-21 levels in mammary tumor tissues. In addition to its role in miRNA processing, DDX5 is an essential gene in the development as DDX5 knockout mice are embryonically lethal. By its interaction with mRNA, DDX5 is also involved in the processing, splicing and degradation of mRNA. DDX5 directly regulates DNA replication factor expression by promoting the recruitment of RNA polymerase II to E2F-regulated gene promoters. DDX5 was suggested as a promising candidate for targeted therapy of breast tumors with DDX5 amplification. Inhibiting DDX5 suppressed the growth of HER2+ tumors in vivo. In the HER18-derived breast tumor models, direct inhibition of miR-21 or WIP1 had greater effects on suppressing tumor growth, suggesting that DDX5 is likely one of the important regulators for mammary tumors induced by 17q23 amplification.
[0213] Alterations in the PTEN/PI3K/AKT pathways are cited as contributors to the development of trastuzumab resistance, however targeting these kinases as single agents has yielded less than expected clinical results. Other pathways, such as Ras/MAPK pathway, which are typically not mutationally activated in breast cancer, were shown to contribute to the trastuzumab resistance. Whereas miR-21 inhibits PTEN signaling, WIP1 is a broad inhibitor of the MAPK and ATM-p53 pathways. Herein, inhibiting miR-21 and WIP1 can be developed into a specified therapy for HER2+ breast cancer harboring 17q23 amplicon.
[0214] Although RNA interference (RNAi) has attracted a lot of attention as a promising therapeutic strategy for cancer in the past decades, few RNAi-based therapies have passed/entered Phase II/III clinical trial (Wittrup A, et al. Nature Reviews Genetics 2015 16:543; Bobbin M L, et al. Annu Rev Pharmacol Toxicol. 2016 56:103-122; Dahlman J E, et al. Nature Nanotechnology 2014 9:648). This is partly because naked RNAs such as anti-miR have poor stability in blood, do not enter cells, and are instable in the endo/lysosome inside cells (Wang H, et al. Adv Mater 2016 28:347-355). In addition, the small molecule drugs for conventional chemotherapy is either insoluble in water or can diffuse to both normal tissue and tumor, which may induce significant side effects (Wang H, et al. Nanomedicine 2016 11:103-106). Nanotechnology have demonstrated great potential for overcoming the challenges facing conventional chemo/RNAi therapy (Wang H, et al. Nanomedicine 2016 11:103-106; Cui J, et al. Nature communications 2017 8:191; Zuckerman J E, et al. Nat Rev Drug Discov. 2015 14:843). In this study, a unique nanoparticle was designed and synthesized to encapsulate both WIP1 and miR-21 inhibitors for combination therapy. It not only can improve the solubility and bioavailability of GSK2830371 for inhibiting WIP1 but also achieve cytosolic delivery of anti-miR21, to deactivate tumor suppression p53 and PTEN pathways. The nanoparticles could stabilize anti-MiR21 by preventing it from the enzymatic degradation during circulation and preferentially accumulate/target tumor. After entering tumor, it could enhance cellular uptake of the encapsulated agents. More importantly, after being taken up by cancer cells via endocytosis, the nanoparticle could generate carbon dioxide gas to break open endo/lysosomes. Moreover, the disclosed nanoparticle-based approach ensures that the dose ratio of the two agents in the tumor can be maintained to be the same as that at injection, while the dose ratio of the two agents in tumor may be very different from that at injection due to vast difference in bioavailability of the hydrophobic GSK2830371 and hydrophilic anti-miR21 oligonucleotide. This well-designed nanoparticle is an excellent vehicle for delivering the anti-miR21 (and other RNAs) to overcome both the extracellular and intracellular barrier to the use of RNAs for cancer therapy. By taking advantage of advanced nanotechnology, a strategy is presented that involves using pH-responsive nanoparticle to inhibit WIP1 and miR-21 for effective therapy of trastuzumab-resistant HER2+ breast cancer harboring 17q23 amplicon.
[0215] In summary, co-amplification of MIR21 and WIP1 in HER2+ breast cancer harboring 17q23 amplicon generates therapeutic vulnerabilities and provides an effective treatment strategy for breast cancers containing such genomic events. miR-21 and WIP1 functionally cooperate with the HER2 gene in breast tumorigenesis, and inhibiting them circumvents resistance to anti-HER2 therapies.
Example 3: Synthesis of Active CSC and Tumor Dual-Targeting, Low pH-Activated Nanobomb Co-Encapsulated with siPol2 (R) and PTX (P)
[0216] As illustrated in
[0217] First, ICG and ammonium bicarbonate (required for the NIR laser-activated bomb effect) are replaced with metformin carbonate/bicarbonate (metformin-CO.sub.2,
[0218] Second, PTX (P) is dissolved in oil (i.e, dichloromethane) during emulsion I for encapsulation into the hydrophobic shell of the resultant nanoparticles. Third, fucoidan (FCD or F) is added together with HA (H) into the aqueous phase for emulsion 11 so that it can be decorated on the nanoparticle surface together with HA, as illustrated in
[0219] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of skill in the art to which the disclosed invention belongs. Publications cited herein and the materials for which they are cited are specifically incorporated by reference.
[0220] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.