Modified norovirus VP1 proteins and VLPs comprising modified norovirus VP1 proteins
11759512 · 2023-09-19
Assignee
Inventors
Cpc classification
C12N15/8257
CHEMISTRY; METALLURGY
A61K9/0034
HUMAN NECESSITIES
A61K9/0019
HUMAN NECESSITIES
A61K9/0053
HUMAN NECESSITIES
C12N15/8258
CHEMISTRY; METALLURGY
C12N2770/16022
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
C12N2770/16034
CHEMISTRY; METALLURGY
C07K14/085
CHEMISTRY; METALLURGY
International classification
C07K14/085
CHEMISTRY; METALLURGY
Abstract
Nucleic acids encoding modified norovirus VP1 proteins, and VLPs comprising one or more of the modified norovirus VP1 proteins are provided. Methods for modified norovirus VP1 protein, and norovirus VLP, production in plants, portions of the plant or a plant cell, are also described.
Claims
1. A modified norovirus VP1 protein comprising an S domain and a P domain, wherein the S domain comprises an amino acid sequence of the S domain of a first wild type norovirus VP1 protein, wherein said sequence comprises one or more amino acid substitutions selected from the group consisting of substitutions at a position in sequence alignment with amino acids 39, 53 and 80 of a reference sequence of SEQ ID NO: 1; wherein the P domain comprises an amino acid sequence of the P domain of a second wild type norovirus VP1 protein, wherein said sequence comprises one or more amino acid substitutions selected from the group consisting of substitutions at a position in sequence alignment with amino acids 333 and 368 of the reference sequence of SEQ ID NO: 1; or a combination thereof, and wherein the amino acid substitution at the position in sequence alignment with amino acid 39 is to valine, isoleucine, leucine or methionine; the amino substitution at the position in sequence alignment with amino acid 53 is to isoleucine, leucine, valine, alanine or methionine; the amino substitution at the position in sequence alignment with amino acid 80 is to serine, asparagine, cysteine or threonine; the amino substitution at the position in sequence alignment with amino acid 333 is to valine, isoleucine or leucine; and the amino substitution at the position in sequence alignment with amino acid 368 is to glutamate, asparagine or aspartate.
2. The modified norovirus VP1 protein of claim 1, wherein the first and the second wild type norovirus VP1 proteins are norovirus GII.4 VP1 proteins.
3. The modified norovirus VP1 protein of claim 1, wherein: the S domain comprises the amino acid sequence of the S domain of Hu/GII.4/Sydney/2015 or Hu/GII.4/Sydney/NSW0514/2012/AU, and wherein the one or more amino acid substitutions in the S domain are: an amino acid substitution at a position in sequence alignment with amino acid 80 of the reference sequence of SEQ ID NO:1; two amino acid substitutions at positions in sequence alignment with amino acids 39 and 80 of the reference sequence of SEQ ID NO:1; two amino acid substitutions at positions in sequence alignment with amino acids 53 and 80 of the reference sequence of SEQ ID NO:1; or three amino acid substitutions at positions in sequence alignment with amino acids 39, 53 and 80 of the reference sequence of SEQ ID NO:1.
4. The modified norovirus VP1 protein of claim 3, wherein the one or more amino acid substitution in the P domain are: an amino acid substitution at a position in sequence alignment with amino acid 333 of the reference sequence of SEQ ID NO: 1; an amino acid substitution at a position in sequence alignment with amino acid 368 of the reference sequence of SEQ ID NO: 1; or two amino acid substitutions at positions in sequence alignment with amino acids 333 and 368 of the reference sequence of SEQ ID NO: 1.
5. A recombinant nucleic acid encoding the modified norovirus VP1 protein of claim 1.
6. The recombinant nucleic acid of claim 5, wherein codon usage is optimized to human codon usage, increased GC content, or a combination thereof.
7. A vector comprising the nucleic acid of claim 5.
8. A virus-like particle (VLP) comprising the modified norovirus VP1 of claim 1.
9. A method of producing a modified norovirus VP1 protein, or a norovirus virus like particle (VLP), in a plant, portion of a plant or a plant cell, comprising: introducing the nucleic acid of claim 5 into the plant, portion of the plant or the plant cell; and incubating the plant, the portion of the plant or the plant cell under conditions that permit expression of the modified norovirus VP1 protein.
10. The modified norovirus VP1 protein or the norovirus VLP produced by the method of claim 9.
11. A plant, portion of the plant, or plant cell comprising the modified norovirus VP1 protein of claim 1.
12. A plant, portion of the plant, or plant cell comprising the VLP of claim 8.
13. A plant extract comprising the modified norovirus VP1 protein produced by the method of claim 9.
14. A plant extract comprising the norovirus VLP produced by the method of claim 9.
15. A composition for inducing an immune response comprising, an effective dose of the VLP of claim 8, and a pharmaceutically acceptable carrier, adjuvant, vehicle or excipient.
16. A vaccine comprising an effective dose of the modified norovirus VP1 protein of claim 1, for inducing an immune response.
17. A method for inducing immunity to a norovirus infection in a subject, the method comprising administering the VLP of claim 8 to the subject.
18. A method of increasing the yield of a norovirus virus like particle (VLP) in a plant, portion of a plant or a plant cell, comprising: introducing the nucleic acid of claim 5 into the plant, portion of the plant, or the plant cell; and incubating the plant, portion of the plant or the plant cell under conditions that permit expression of the modified norovirus VP1 protein, thereby producing the norovirus VLP; wherein the yield of the norovirus VLP comprising the modified norovirus VP1 protein is greater than the yield of a norovirus VLP comprising a wild type norovirus VP1 protein produced in the plant, portion of the plant or the plant cell, under the same conditions.
19. The modified norovirus VP1 protein of claim 2, wherein the first and the second wild type norovirus VP1 proteins are selected from the group consisting of GII.4/Sydney/NSW0514/2012/AU (SEQ ID NO:1), Hu/GII.4/Sydney/2015 (SEQ ID NO:3), US96/GII.4/Dresden174/1997/DE_AY741811 (SEQ ID NO:5), FH02/GII.4/FarmingtonHills/2002/US_AY502023 (SEQ ID NO:6), Hnt04:GII.4/Hunter-NSW504D/2004/AU_DQ078814 (SEQ ID NO:7), 2006b: GII.4/Shellharbour-NSW696T/2006/AU_EF684915 (SEQ ID NO:8) and NO09: GII.4/Orange-NSW001P/2008/AU_GQ845367 (SEQ ID NO:9).
20. The method of claim 9, further comprising the steps of: harvesting the plant, portion of the plant, or the plant cell; and extracting, purifying, or both extracting and purifying the modified norovirus VP1 protein or VLP from the plant, portion of the plant or the plant cell.
21. The method of claim 17, wherein the VLP is administered to the subject orally, intranasally, intramuscularly, intraperitoneally, intravenously, subcutaneously, rectally, or intravaginally.
22. A modified norovirus VP1 protein comprising an S domain and a P domain, wherein the S domain comprises an amino acid substitution at a position in a sequence alignment with amino acid 80 of the reference sequence of SEQ ID NO:1, wherein the amino acid substitution is to serine, asparagine, cysteine or threonine; and wherein the P domain comprises one or more of: an amino acid substitution at a position in a sequence alignment with amino acid 333 of the reference sequence of SEQ ID NO: 1, wherein the amino acid substitution is to valine, isoleucine or leucine; and an amino acid substitution at a position in sequence alignment with amino acid 368 of the reference sequence of SEQ ID NO: 1, wherein the amino acid substitution is to glutamate, asparagine or aspartate; or a combination thereof.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) These and other features of the invention will become more apparent from the following description in which reference is made to the appended drawings wherein:
(2)
(3)
(4)
(5)
(6)
(7) “GII.4/2015” refers to norovirus strain GII.4/Sydney/2015 (SEQ ID NO:3). Amino acids substitutions in the VP1 are indicated by wild type amino acid residue followed by the residue number and the substituted amino acid residue.
(8) “GII.4/2015” refers to norovirus strain GII.4/Sydney/2015 (SEQ ID NO:3). Amino acids substitutions in the VP1 are indicated by wild type amino acid residue followed by the residue number and the substituted amino acid residue.
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
DETAILED DESCRIPTION
(26) The following description is of a preferred embodiment.
(27) As used herein, the terms “comprising,” “having,” “including” and “containing,” and grammatical variations thereof, are inclusive or open-ended and do not exclude additional, un-recited elements and/or method steps. The term “consisting essentially of” when used herein in connection with a use or method, denotes that additional elements and/or method steps may be present, but that these additions do not materially affect the manner in which the recited method or use functions. The term “consisting of” when used herein in connection with a use or method, excludes the presence of additional elements and/or method steps. A use or method described herein as comprising certain elements and/or steps may also, in certain embodiments, consist essentially of those elements and/or steps, and in other embodiments consist of those elements and/or steps, whether or not these embodiments are specifically referred to. In addition, the use of the singular includes the plural, and “or” means “and/or” unless otherwise stated. The term “plurality” as used herein means more than one, for example, two or more, three or more, four or more, and the like. Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. As used herein, the term “about” refers to an approximately +/−10% variation from a given value. It is to be understood that such a variation is always included in any given value provided herein, whether or not it is specifically referred to. The use of the word “a” or “an” when used herein in conjunction with the term “comprising” may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one” and “one or more than one.”
(28) The term “plant”, “portion of a plant”, “plant portion”, “plant matter”, “plant biomass”, “plant material”, plant extract”, or “plant leaves”, as used herein, may comprise an entire plant, tissue (e.g. leaves, stem, root) cells, or any fraction thereof, intracellular plant components, extracellular plant components, liquid or solid extracts of plants, or a combination thereof, that are capable of providing the transcriptional, translational, and post-translational machinery for expression of one or more than one nucleic acids described herein, and/or from which an expressed protein or VLP may be extracted and purified. Plants may include, but are not limited to, agricultural crops including for example canola, Brassica spp., maize, Nicotiana spp., (tobacco) for example, Nicotiana benthamiana, Nicotiana rustica, Nicotiana, tabacum, Nicotiana alata, Arabidopsis thaliana, alfalfa, potato, sweet potato (Ipomoea batatus), ginseng, pea, oat, rice, soybean, wheat, barley, sunflower, cotton, corn, rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), safflower (Carthamus tinctorius).
(29) The term “plant portion”, as used herein, refers to any part of the plant including but not limited to leaves, stem, root, flowers, fruits, a plant cell obtained from leaves, stem, root, flowers, fruits, a plant extract obtained from leaves, stem, root, flowers, fruits, or a combination thereof. The term “plant extract”, as used herein, refers to a plant-derived product that is obtained following treating a plant, a portion of a plant, a plant cell, or a combination thereof, physically (for example by freezing followed by extraction in a suitable buffer), mechanically (for example by grinding or homogenizing the plant or portion of the plant followed by extraction in a suitable buffer), enzymatically (for example using cell wall degrading enzymes), chemically (for example using one or more chelators or buffers), or a combination thereof. A plant extract may be further processed to remove undesired plant components for example cell wall debris. A plant extract may be obtained to assist in the recovery of one or more components from the plant, portion of the plant or plant cell, for example a protein (including protein complexes, protein suprastructures and/or VLPs), a nucleic acid, a lipid, a carbohydrate, or a combination thereof from the plant, portion of the plant, or plant cell. If the plant extract comprises proteins, then it may be referred to as a protein extract. A protein extract may be a crude plant extract, a partially purified plant or protein extract, or a purified product, that comprises one or more proteins, protein complexes, protein suprastructures, and/or VLPs, from the plant tissue. If desired a protein extract, or a plant extract, may be partially purified using techniques known to one of skill in the art, for example, the extract may be subjected to salt or pH precipitation, centrifugation, gradient density centrifugation, filtration, chromatography, for example, size exclusion chromatography, ion exchange chromatography, affinity chromatography, or a combination thereof. A protein extract may also be purified, using techniques that are known to one of skill in the art.
(30) The term “nucleic acid segment” as used herein refers to a sequence of nucleic acids that encodes a protein of interest. In addition to the sequence of nucleic acids, the nucleic acid segment comprise a regulatory region and a terminator that are operatively linked to the sequence of nucleic acids. The regulatory region may for example comprise a promoter, and optionally, an enhancer element operatively linked to the promoter.
(31) The term “nucleic acid complex” as used herein refers to a combination of two or more than two nucleic acid segments. The two or more than two nucleic acid segments may be present in a single nucleic acid, so that the nucleic acid complex comprises two, or more than two nucleic acid segments, with each nucleic acid segment under the control of a regulatory region and a terminator. Alternatively, the nucleic acid complex may comprise two or more separate nucleic acids, each of the nucleic acids comprising one or more than one nucleic acid segment, where each nucleic acid segment is under the control of a regulatory region and a terminator. For example a nucleic acid complex may comprise one nucleic acid that comprises two nucleic acid segments, a nucleic acid complex may comprise two nucleic acids, each nucleic acid comprising one nucleic acid segment, or a nucleic acid complex may comprise two or more than two nucleic acids, with each nucleic acid comprising one or more than one nucleic acid segment.
(32) The term “vector” or “expression vector”, as used herein, refers to a recombinant nucleic acid for transferring exogenous nucleic acid sequences into host cells (e.g. plant cells) and directing expression of the exogenous nucleic acid sequences in the host cells. “Expression cassette” refers to a nucleotide sequence comprising a nucleic acid of interest under the control of, and operably (or operatively) linked to, an appropriate promoter or other regulatory elements for transcription of the nucleic acid of interest in a host cell. As one of skill in the art would appreciate, the expression cassette may comprise a termination (terminator) sequence that is any sequence that is active in the plant host. For example the termination sequence may be derived from the RNA-2 genome segment of a bipartite RNA virus, e.g. a comovirus, the termination sequence may be a NOS terminator, or terminator sequence may be obtained from the 3′UTR of the alfalfa plastocyanin gene.
(33) The constructs of the present disclosure may further comprise a 3′ untranslated region (UTR). A 3′ untranslated region contains a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by effecting the addition of polyadenylic acid tracks to the 3′ end of the mRNA precursor. Polyadenylation signals are commonly recognized by the presence of homology to the canonical form 5′ AATAAA-3′ although variations are not uncommon. Non-limiting examples of suitable 3′ regions are the 3′ transcribed non-translated regions containing a polyadenylation signal of Agrobacterium tumor inducing (Ti) plasmid genes, such as the nopaline synthase (Nos gene) and plant genes such as the soybean storage protein genes, the small subunit of the ribulose-1,5-bisphosphate carboxylase gene (ssRUBISCO; U.S. Pat. No. 4,962,028; which is incorporated herein by reference), the terminator used in regulating plastocyanin expression.
(34) By “regulatory region” “regulatory element” or “promoter” it is meant a portion of nucleic acid typically, but not always, upstream of the protein coding region of a gene, which may be comprised of either DNA or RNA, or both DNA and RNA. When a regulatory region is active, and in operative association, or operatively linked, with a nucleotide sequence of interest, this may result in expression of the nucleotide sequence of interest. A regulatory element may be capable of mediating organ specificity, or controlling developmental or temporal gene activation. A “regulatory region” includes promoter elements, core promoter elements exhibiting a basal promoter activity, elements that are inducible in response to an external stimulus, elements that mediate promoter activity such as negative regulatory elements or transcriptional enhancers. “Regulatory region”, as used herein, also includes elements that are active following transcription, for example, regulatory elements that modulate gene expression such as translational and transcriptional enhancers, translational and transcriptional repressors, upstream activating sequences, and mRNA instability determinants. Several of these latter elements may be located proximal to the coding region.
(35) In the context of this disclosure, the term “regulatory element” or “regulatory region” typically refers to a sequence of DNA, usually, but not always, upstream (5′) to the coding sequence of a structural gene, which controls the expression of the coding region by providing the recognition for RNA polymerase and/or other factors required for transcription to start at a particular site. However, it is to be understood that other nucleotide sequences, located within introns, or 3′ of the sequence may also contribute to the regulation of expression of a coding region of interest. An example of a regulatory element that provides for the recognition for RNA polymerase or other transcriptional factors to ensure initiation at a particular site is a promoter element. Most, but not all, eukaryotic promoter elements contain a TATA box, a conserved nucleic acid sequence comprised of adenosine and thymidine nucleotide base pairs usually situated approximately 25 base pairs upstream of a transcriptional start site. A promoter element may comprise a basal promoter element, responsible for the initiation of transcription, as well as other regulatory elements that modify gene expression.
(36) There are several types of regulatory regions, including those that are developmentally regulated, inducible or constitutive. A regulatory region that is developmentally regulated or controls the differential expression of a gene under its control, is activated within certain organs or tissues of an organ at specific times during the development of that organ or tissue. However, some regulatory regions that are developmentally regulated may preferentially be active within certain organs or tissues at specific developmental stages, they may also be active in a developmentally regulated manner, or at a basal level in other organs or tissues within the plant as well. Examples of tissue-specific regulatory regions, for example see-specific a regulatory region, include the napin promoter, and the cruciferin promoter (Rask et al., 1998, J. Plant Physiol. 152: 595-599; Bilodeau et al., 1994, Plant Cell 14: 125-130). An example of a leaf-specific promoter includes the plastocyanin promoter (see U.S. Pat. No. 7,125,978, which is incorporated herein by reference).
(37) An inducible regulatory region is one that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer the DNA sequences or genes will not be transcribed. Typically, the protein factor that binds specifically to an inducible regulatory region to activate transcription may be present in an inactive form, which is then directly or indirectly converted to the active form by the inducer. However, the protein factor may also be absent. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, herbicide or phenolic compound or a physiological stress imposed directly by heat, cold, salt, or toxic elements or indirectly through the action of a pathogen or disease agent such as a virus. A plant cell containing an inducible regulatory region may be exposed to an inducer by externally applying the inducer to the cell or plant such as by spraying, watering, heating or similar methods. Inducible regulatory elements may be derived from either plant or non-plant genes (e.g. Gatz, C. and Lenk, I. R. P., 1998, Trends Plant Sci. 3, 352-358). Examples, of potential inducible promoters include, but not limited to, tetracycline-inducible promoter (Gatz, C., 1997, Ann. Rev. Plant Physiol. Plant Mol. Biol. 48, 89-108), steroid inducible promoter (Aoyama, T. and Chua, N. H., 1997, Plant J. 2, 397-404) and ethanol-inducible promoter (Salter, M. G., et al, 1998, Plant Journal 16, 127-132; Caddick, M. X., et al, 1998, Nature Biotech. 16, 177-180) cytokinin inducible IB6 and CKI1 genes (Brandstatter, I. and Kieber, J. J., 1998, Plant Cell 10, 1009-1019; Kakimoto, T., 1996, Science 274, 982-985) and the auxin inducible element, DR5 (Ulmasov, T., et al., 1997, Plant Cell 9, 1963-1971).
(38) A constitutive regulatory region directs the expression of a gene throughout the various parts of a plant and continuously throughout plant development. Examples of known constitutive regulatory elements include promoters associated with the CaMV 35S transcript. (p35S; Odell et al., 1985, Nature, 313: 810-812; which is incorporated herein by reference), the rice actin 1 (Zhang et al, 1991, Plant Cell, 3: 1155-1165), actin 2 (An et al., 1996, Plant J., 10: 107-121), or tms 2 (U.S. Pat. No. 5,428,147), and triosephosphate isomerase 1 (Xu et. al., 1994, Plant Physiol. 106: 459-467) genes, the maize ubiquitin 1 gene (Cornejo et al, 1993, Plant Mol. Biol. 29: 637-646), the Arabidopsis ubiquitin 1 and 6 genes (Holtorf et al, 1995, Plant Mol. Biol. 29: 637-646), the tobacco translational initiation factor 4A gene (Mandel et al, 1995 Plant Mol. Biol. 29: 995-1004); the Cassava Vein Mosaic Virus promoter, pCAS, (Verdaguer et al., 1996); the promoter of the small subunit of ribulose biphosphate carboxylase, pRbcS: (Outchkourov et al., 2003), the pUbi (for monocots and dicots).
(39) The term “constitutive” as used herein does not necessarily indicate that a nucleotide sequence under control of the constitutive regulatory region is expressed at the same level in all cell types, but that the sequence is expressed in a wide range of cell types even though variation in abundance is often observed.
(40) The expression constructs as described above may be present in a vector. The vector may comprise border sequences which permit the transfer and integration of the expression cassette into the genome of the organism or host. The construct may be a plant binary vector, for example a binary transformation vector based on pPZP (Hajdukiewicz, et al. 1994). Other example constructs include pBin19 (see Frisch, D. A., L. W. Harris-Haller, et al. 1995, Plant Molecular Biology 27: 405-409).
(41) The term “native”, “native protein” or “native domain”, as used herein, refers to a protein or domain having a primary amino acid sequence identical to the amino acid sequence of the wild type protein or domain. Native proteins or domains may be encoded by nucleotide sequences having 100% sequence similarity to the wild type sequence. A native amino acid sequence may also be encoded by a human codon (hCod) optimized nucleotide sequence or a nucleotide sequence comprising an increased GC content when compared to the wild type nucleotide sequence provided that the amino acid sequence encoded by the hCod-nucleotide sequence exhibits 100% sequence identity with the native amino acid sequence.
(42) When it is stated that an amino acid, an amino acid sequence, or a protein is “modified” it is meant that the amino acid, amino acid sequence, or protein is altered in some manner when compared to the corresponding native or wild type amino acid, amino acid sequence, or protein from which the modified amino acid, amino acid sequence, or protein is derived. For example, a modified amino acid, amino acid sequence, or protein may include the replacement of one or more amino acids by substitution (i.e. replacement) or mutation. A modified amino sequence or a modified protein may also comprise one or more deleted amino acids, or there may be one or more inserted amino acids. Techniques to carry out such modification are well known to one of skill in the art.
(43) By a nucleotide sequence that is “human codon optimized” or a “hCod” nucleotide sequence, it is meant the selection of appropriate DNA nucleotides for the synthesis of an oligonucleotide sequence or fragment thereof that approaches the codon usage generally found within an oligonucleotide sequence of a human nucleotide sequence. By “increased GC content” it is meant the selection of appropriate DNA nucleotides for the synthesis of an oligonucleotide sequence or fragment thereof in order to approach codon usage that, when compared to the corresponding native oligonucleotide sequence, comprises an increase of GC content, for example, from about 1 to about 30%, or any amount therebetween, over the length of the coding portion of the oligonucleotide sequence. For example, from about 1, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30%, or any amount therebetween, over the length of the coding portion of the oligonucleotide sequence. As described below, a human codon optimized nucleotide sequence, or a nucleotide sequence comprising an increased GC content (when compared to the wild type nucleotide sequence) exhibits increased expression within a plant, portion of a plant, or a plant cell, when compared to expression of the non-human optimized (or lower GC content) nucleotide sequence.
(44) Norovirus VP1 mutant proteins (also termed modified VP1 protein, modified norovirus VP1 protein, variants of norovirus VP1 protein, GII.4 VP1 mutant protein, modified GII.4 VP1 protein, modified norovirus GII.4 VP1 protein, variants of norovirus GII.4 VP1 protein, and the like) and methods of producing norovirus modified VP1 proteins in plants are described herein. Several of the modified norovirus VP1 proteins comprise specific modifications, for example substitutions or mutations, in the S domain and/or P domain of GII.4 VP1's, and are variants of the norovirus GII.4 genotype VP1 protein. Furthermore, the modified norovirus VP1 protein may be norovirus VP1 fusion protein, wherein the S-domain is derived from a first norovirus genotype variant fused to a P domain, or a portion of the P domain, derived from a second norovirus genotype variant. It has been observed that in norovirus GII.4 genotypes, modifying specific amino acids results in improved VP1 characteristics as compared to the wild type VP1. Examples of improved characteristics of the VP1 include, increased VP1 protein yield when expressed in plant cells as compared to the wild type VP1 of the same genotype that does not comprise the modification or substitution(s); increased density of VLPs comprised of the modified VP1 proteins (for example as determined using density gradient separation, and optionally SDS-PAGE and/or Western analysis) as compared to the wild type VP1 of the same genotype that does not comprise the modification or substitution(s); improved integrity, stability, or both integrity and stability, of VLPs that are comprised of the modified VP1 proteins as compared to the integrity, stability or both of VLPs comprising wild type VP1 of the same genotype that does not comprise the modification or substitution(s); increased VLP yield when expressed in plant cells as compared to the wild type level of VLP production of the same genotype that does not comprise the modification or substitution(s); a greater proportion of VLPs that assemble into 38 nm VLPs as opposed to 23 nm VLPs as compared to the wild type VP1 of the same genotype that does not comprise the modification or substitution(s); and a combination thereof.
(45) As shown in
(46) TABLE-US-00001 TABLE 1 Amino acid differences between GII.4/Sydney/2012/K4LM89 (GII.4/2012; SEQ ID NO:1; FIG. 5A) and GII.4/Sydney/2015 (GII.4/2015; SEQ ID NO:3; FIG. 5C) S domain P Domain aa 119 144 145 174 297 310 333 339 368 373 393 2012 V I V P R D V R E R G 2015 I M I S H N M K Q H N
S Domain Equivalents
(47) One of skill in the art would understand that the S domain of GII.4/2012, comprising an isoleucine at positions 119 and 145, a methionine at position 144, and a serine at position 174 (V119I, I144M, V145I and P174S) is structurally and functionally equivalent to the S domain from GII.4/2015, and for example, that a GII.4/2012 S domain comprising a serine at position 80 (P80S) is structurally and functionally equivalent to a GII.4/2015 S domain comprising P80S, 1119V, M144I, I145V and S174P substitutions. As a result: GII.4/2012 (P80S) S domain may be used as short hand for GII.4/2015 (P80S, I119V, M144I, I145V, S174P) S domain as these S domains comprise the same sequence; GII.4/2012 (A39V, P80S) S domain may be used as short hand for GII.4/2015 (A39V, P80S, I119V, M144I, I145V, S174P) S domain as these S domains comprise the same sequence; GII.4/2012 (R53I, P80S) S domain may be used as short hand for “GII.4/2015 (R53I, P80S, I119V, M144I, I145V, S174P) S domain as these S domains comprise the same sequence; and GII.4/2012 (A39V, R53I, P80S) S domain may be used as short hand for GII.4/2015 (A39V, R53I, P80S, 1119V, M144I, I145V, S174P) S domain as these S domains comprise the same sequence.
P Domain Equivalents
(48) In a similar manner, one of skill in the art would understand that the P domain of GII.4/2012 comprising substitutions R297H, D310N, V333M, R339K, E368Q, R373H, G393N is structurally and functionally equivalent to the P domain from GII.4/2015, and for example, that a GII.4/2015 P domain comprising an M333V substitution is the same as stating a GII.4/2012 P domain comprising the following substitutions: H297R, N310D, K339R, Q368E, H373R, N393G (the amino acid at position 333 is already “V” in GII.4/2012, see Table 1). As a result: GII.4/2015 (M333V) P domain may be used as short hand for GII.4/2012 (R297H, D310N, R339K, E368Q, R373H, G393N) P domain as these P domains comprise the same sequence; GII.4/2015 (Q368E) P domain may be used as short hand for “GII.4/2012 (R297H, D310N, V333M, R339K, R373H, G393N)” P domain (the amino acid at position 368 is already “E” in GII.4/2012) as these P domains comprise the same sequence; and GII.4/2015 (M333V, Q368E) P domain may be used as shorthand for “GII.4/2012 (R297H, D310N, R339K, R373H, G393N)” P domain as these P domains comprise the same sequence.
S+P Domain Equivalents
(49) As one of skill would appreciate, the modified GII.4 VP1 proteins described herein may be obtained by making the appropriate amino acid substitutions to achieve the defined GII.4 VP1 modifications, or for example, the S domain from a GII.4/2012 may be fused to a P domain from a GII.4/2015 along with the desired amino acid substitutions to produce the modified GII.4 VP1 protein described herein. For example, the following modified GII.4 VP1 proteins are structurally and functionally equivalent:
(50) i) GII.4/2012 (P80S) S domain+GII.4/2015(M333V) P domain (a fusion GII.4 VP1);
(51) ii) GII.4/2015 (P80S, 1119V, M144I, I145V, S174P) S domain+GII.4/2015 (M333V) P domain (using a GII.4/2015 reference sequence); and
(52) iii) GII.4/2012 (P80S) S domain+GII.4/2012 (R297H, D310N, R339K, E368Q, R373H, G393N) P domain (using a GII.4/2012 reference sequence).
(53) Other modified GII.4 VP1 proteins described herein may also be produced, defined, or both produced and defined, in a manner analogous to that as outlined above using a GII.4/2012, a GII.4/2015, or a GII.4/2012+G11.4/2015 fusion, as a reference sequence.
(54) Therefore, the present disclosure provides modified norovirus GII.4 VP1 proteins, and methods of producing the modified norovirus GII.4 VP1 proteins. The modified GII.4 VP1 protein may include a nucleotide sequence encoding a GII.4 VP1 protein comprising: an S domain substitution, mutation, or modification, at any one or more amino acid residues 39, 53 and 80 of norovirus VP1 genotype GII.4/Sydney/2012/K4LM89 (GII.4/2012; SEQ ID NO:1; see
The sequence encoding the modified norovirus GII.4 VP1 protein as described above may be optimized for human codon usage, for increased GC content, or a combination thereof.
(55) As described herein, amino acids in the GII.4 VP1 proteins may be substituted, mutated or modified to produce a modified GII.4 VP1 protein. The substitutions, modifications, or mutations at specific positions are not limited to the amino acid substitutions exemplified herewith or as given in the examples as one of skill in the art would understand that amino acids with similar properties may be substituted for the amino acids at the identified positions. For example, the modified GII.4 VP1 protein may contain conserved or conservative substitutions of the amino acid.
(56) The term “residue” refers to an amino acid, and this term may be used interchangeably with the term “amino acid” and “amino acid residue”.
(57) As used herein, the term “conserved substitution” or “conservative substitution” refers to the presence of an amino acid residue in the sequence of the GII.4 VP1 protein that is different from, but it is in the same class of amino acid as the described substitution. For example, a nonpolar amino acid may be used to replace a nonpolar amino acid, an aromatic amino acid to replace an aromatic amino acid, a polar-uncharged amino acid to replace a polar-uncharged amino acid, and/or a charged amino acid to replace a charged amino acid). In addition, conservative substitutions can encompass an amino acid having an interfacial hydropathy value of the same sign and generally of similar magnitude as the amino acid that is replacing the corresponding wild type amino acid.
(58) As used herein, the term “nonpolar amino acid” refers to glycine (G, Gly), alanine (A, Ala), valine (V, Val), leucine (L, Leu), isoleucine (I, Ile), and proline (P, Pro); the term “aromatic residue” (or aromatic amino acid) refers to phenylalanine (F, Phe), tyrosine (Y, Tyr), and tryptophan (W, Trp); the term “polar uncharged amino acid” refers to serine (S, Ser), threonine (T, Thr), cysteine (C, Cys), methionine (M, Met), asparagine (N, Asn) and glutamine (Q, Gln); the term “charged amino acid” refers to the negatively charged amino acids aspartic acid (D, Asp) and glutamic acid (E, Glu), as well as the positively charged amino acids lysine (K, Lys), arginine (R, Arg), and histidine (H, His). Other classification of amino acids may be as follows: amino acids with hydrophobic side chain (aliphatic): Alanine (A, Ala), Isoleucine (I, Ile), Leucine (L, Leu), Methionine (M, Met) and Valine (V, Val); amino acids with hydrophobic side chain (aromatic): Phenylalanine (F, Phe), Tryptophan (W, Trp), Tyrosine (Y, Tyr); amino acids with polar neutral side chain: Asparagine (N, Asn), Cysteine (C, Cys), Glutamine (Q, Gln), Serine (S, Ser) and Threonine (T, Thr); amino acids with electrically charged side chains (acidic): Aspartic acid (D, Asp), Glutamic acid (E, Glu); amino acids with electrically charged side chains (basic): Arginine (R, Arg); Histidine (H, His); Lysine (K, Lys), Glycine G, Gly) and Proline (P, Pro).
(59) Conservative amino acid substitutions are likely to have a similar effect on the activity of the resultant modified GII.4 VP1 protein as the original substitution or modification. Further information about conservative substitutions can be found, for example, in Ben Bassat et al. (J. Bacteriol, 169:751-757, 1987), O'Regan et al. (Gene, 77:237-251, 1989), Sahin-Toth et al. (Protein ScL, 3:240-247, 1994), Hochuli et al (Bio/Technology, 6:1321-1325, 1988).
(60) The Blosum matrices are commonly used for determining the relatedness of polypeptide sequences (Henikoff et al., Proc. Natl. Acad. Sci. USA, 89:10915-10919, 1992). A threshold of 90% identity was used for the highly conserved target frequencies of the BLOSUM90 matrix. A threshold of 65% identity was used for the BLOSUM65 matrix. Scores of zero and above in the Blosum matrices are considered “conservative substitutions” at the percentage identity sTable 2.elected. The following table shows examples of conservative amino acid substitutions: Table 2.
(61) TABLE-US-00002 TABLE 2 Exemplary conservative amino acid substitutions. Very Highly - Highly Conserved Original Conserved Substitutions (from the Conserved Substitutions Residue Substitutions Blosum90 Matrix) (from the Blosum65 Matrix) Ala Ser Gly, Ser, Thr Cys, Gly, Ser, Thr, Val Arg Lys Gln, His, Lys Asn, Gln, Glu, His, Lys Asn Gln; His Asp, Gln, His, Lys, Ser, Thr Arg, Asp, Gln, Glu, His, Lys, Ser, Thr Asp Glu Asn, Glu Asa, Gln, Glu, Ser Cys Ser None Ala Gln Asn Arg, Asn, Glu, His, Lys, Met Arg, Asn, Asp, Glu, His, Lys, Met, Ser Glu Asp Asp, Gln, Lys Arg, Asn, Asp, Gln, His, Lys, Ser Gly Pro Ala Ala, Ser His Asn; Gln Arg, Asn, Gln, Tyr Arg, Asn, Gln, Glu, Tyr Ile Leu; Val Leu, Met, Val Leu, Met, Phe, Val Leu Ile; Val Ile, Met, Phe, Val Ile, Met, Phe, Val Lys Arg; Gln; Glu Arg, Asn, Gln, Glu Arg, Asn, Gln, Glu, Ser, Met Leu; Ile Gln, Ile, Leu, Val Gln, Ile, Leu, Phe, Val Phe Met; Leu; Tyr Leu, Trp, Tyr Ile, Leu, Met, Trp, Tyr Ser Thr Ala, Asn, Thr Ala, Asn, Asp, Gln, Glu, Gly, Lys, Thr Thr Ser Ala, Asn, Ser Ala, Asn, Ser, Val Trp Tyr Phe, Tyr Phe, Tyr Tyr Trp; Phe His, Phe, Trp His, Phe, Trp Val Ile; Leu Ile, Leu, Met Ala, Ile, Leu, Met, Thr
(62) For the modifications described herein, the amino acids may be substituted using very high conserved substitutions, highly conserved substitutions or conserved substitutions as outlined in Table 2, as well as aromatic, polar, polar uncharged, polar neutral, or non-polar, negatively charged, positively charged, hydrophobic amino acids as described above.
(63) For example, the modification P80S, comprises substituting proline at position 80 with serine, an amino acid characterized as having a polar neutral side chain. The glutamine at this position may also be substituted with an alternate amino acid characterized as having a polar neutral side chain, for example either asparagine, cysteine, or threonine, i.e. P80X, where X=S, N, C or T.
(64) The modification A39V that comprises substituting an alanine with valine (an amino acid characterized as having a hydrophobic side chain) at position 39, in addition to valine, alanine may also be substituted with amino acid characterized as having a hydrophobic side chain, for example, isoleucine, leucine, or methionine i.e. A39X, where X=V, I, L or M.
(65) The modification R53I that comprises substituting an arginine with isoleucine (an amino acid characterized as having a hydrophobic side chain) at position 53, in addition to isoleucine, arginine may also be substituted with an amino acid characterized as having a hydrophobic side chain, for example, leucine, valine, alanine or methionine i.e. R53X, where X=I, L, V, A or M.
(66) The modification M333V that comprises substituting an methionine with a valine (an amino acid characterized as having a hydrophobic side chain) at position 333, in addition to valine, methionine may also be substituted with an amino acid characterized as having a hydrophobic side chain, for example, isoleucine or leucine i.e. M333V, where X=V, I L or A.
(67) The modification Q368E that comprises substituting a glutamine at position 368 with glutamic acid (an amino acid characterized as having a polar side chain), in addition to glutamic acid, glutamine may also be substituted with an amino acid characterizes as having a polar side chain, for example asparagine or aspartate i.e. Q368X, where X=E, N or D.
(68) The modified or variant norovirus GII.4 VP1 protein may further be a norovirus GII.4 VP1 fusion protein, comprising an S domain derived from a first norovirus genotype variant fused to a P domain derived from a second norovirus genotype variant, or a portion of the P domain, derived from a second norovirus genotype variant. For example, the S domain derived from a first norovirus genotype variant may be substituted, mutated or modified at any one or more amino acids, or in sequence alignment, or corresponding, with positions, 39, 53 and 80 of norovirus VP1 genotype GII.4/Sydney/2012/K4LM89 (SEQ ID NO:1; see
(69) With reference to the sequence shown in
(70) It has been observed that expression of the modified GII.4 VP1 protein as described herein is increased when compared to the yield of the wild type or native GII.4 VP1 protein obtained from GII.4/Sydney/2015 (GII.4/2015; SEQ ID NO:3), when expressed in the same plant and under the same conditions (compare for example results presented in
(71) Additionally, expression of a GII.4 VP1 fusion protein comprising a modified S domain from a VP1 protein of a first norovirus genotype variant and a modified P domain from a VP1 protein obtained from a second (different) norovirus genotype variant, may increase the yield of the VP1 fusion protein, when compared to the yield of a native GII.4 VP1 protein obtained from either the first or from the second norovirus genotype, when expressed in the same plant and under the same conditions. For example, the first norovirus genotype variant may be GII.4/2012, and the second norovirus genotype variant may be GII.4/2015.
(72) Also provided herein are methods of increasing production of GII.4 VLPs comprising modified norovirus GII.4 VP1 proteins, in plants. For example, a method may involve introducing a nucleic acid encoding a modified norovirus GII.4 VP1 protein, as described herein, into the plant, portion of the plant, or plant cell. One or more than one modified norovirus GII.4 VP1 protein may be expressed in a plant, portion of the plant, or plant cell, in order to produce a VLP comprising one or more than one modified norovirus GII.4 VP1 protein. Alternatively, the method may comprise providing a plant, portion of the plant, or plant cell that comprises the nucleic acid encoding the modified norovirus GII.4 VP1 protein as described herein, and expressing the nucleic acid encoding the modified norovirus GII.4 VP1 protein in order to produce a VLP comprising the one or more than one modified norovirus GII.4 VP1 protein.
(73) The methods of producing a VLP comprising a GII.4 VP1 modified protein may also comprise a step of co-expressing a nucleic acid sequence encoding a VP2 protein in the plant, portion of the plant, or plant cell.
(74) The term “single construct” or “single constructs”, as used herein, refers to nucleic acid vectors comprising a single nucleic acid sequence. The term “dual construct” or “dual constructs”, as used herein, refers to a nucleic acid vector comprising two nucleic acid sequences.
(75) By co-expression it is meant the introduction and expression of two or more nucleotide sequences, each of the two or more nucleotide sequences encoding a protein of interest, or a fragment of a protein of interest within a plant, portion of a plant or a plant cell. The two or more nucleotide sequences may be introduced into the plant, portion of the plant or the plant cell within one vector, so that each of the two or more nucleotide sequences is under the control of a separate regulatory region (e.g. comprising a dual construct). Alternatively, the two or more nucleotide sequences may be introduced into the plant, portion of the plant or the plant cell within separate vectors (e.g. comprising single constructs), and each vector comprising appropriate regulatory regions for the expression of the corresponding nucleic acid. For example, two nucleotide sequences, each on a separate vector and introduced into separate Agrobacterium tumefaciens hosts, may be co-expressed by mixing suspensions of each A. tumefaciens host in a desired volume (for example, an equal volume, or the ratios of each A. tumefaciens host may be altered) before vacuum infiltration. In this manner, co-infiltration of multiple A. tumifaciens suspensions permits co-expression of multiple transgenes.
(76) The nucleic acid comprising encoding a norovirus GII.4 VP1 modified or mutant protein as described herein may further comprise sequences that enhance expression of the norovirus VP1 modified protein in the plant, portion of the plant, or plant cell. Sequences that enhance expression may include, a CPMV enhancer element, or a plant-derived expression enhancer, in operative association with the nucleic acid encoding the norovirus VP1 modified protein. The sequence encoding the VP1 modified or mutant protein may also be optimized for human codon usage, increased GC content, or a combination thereof. Furthermore, a nucleic acid encoding VP2 may be co-expressed along with the sequence encoding the VP1 mutant or modified protein. The co-expression of a nucleic acid encoding VP2 may lead to an increased yield, increased density, increased integrity, or combination thereof, of VLPs that comprise the one or more than one type of VP1 modified or mutant protein.
(77) The term “CPMV enhancer element”, as used herein, refers to a nucleotide sequence encoding the 5′UTR regulating the Cowpea Mosaic Virus (CPMV) RNA2 polypeptide or a modified CPMV sequence as is known in the art. For example, a CPMV enhancer element or a CPMV expression enhancer, includes a nucleotide sequence as described in WO2015/14367; WO2015/103704; WO2007/135480; WO2009/087391; Sainsbury F., and Lomonossoff G. P., (2008, Plant Physiol. 148: pp. 1212-1218), each of which is incorporated herein by reference. A CPMV enhancer sequence can enhance expression of a downstream heterologous open reading frame (ORF) to which they are attached. The CPMV expression enhancer may include CPMV HT, CPMVX (where X=160, 155, 150, 114), for example CPMV 160, CPMVX+ (where X=160, 155, 150, 114), for example CPMV 160+, CPMV-HT+, CPMV HT+[WT115], or CPMV HT+[511] (WO2015/143567; WO2015/103704 which are incorporated herein by reference). The CPMV expression enhancer may be used within a plant expression system comprising a regulatory region that is operatively linked with the CPMV expression enhancer sequence and a nucleotide sequence of interest.
(78) The term “plant-derived expression enhancer”, as used herein, refers to a nucleotide sequence obtained from a plant, the nucleotide sequence encoding a 5′UTR. Examples of a plant derived expression enhancer are described in U.S. Provisional Patent Application No. 62/643,053 (Filed Mar. 14, 2018; which is incorporated herein by reference) or in Diamos A. G. et. al. (2016, Front Plt Sci. 7:1-15; which is incorporated herein by reference). The plant-derived expression enhancer may be selected from nbMT78, nbATL75, nbDJ46, nbCHP79, nbEN42, atHSP69, atGRP62, atPK65, atRP46, nb30S72, nbGT61, nbPV55, nbPPI43, nbPM64, and nbH2A86 as described in U.S. 62/643,053). The plant derived expression enhancer may be used within a plant expression system comprising a regulatory region that is operatively linked with the plant-derived expression enhancer sequence and a nucleotide sequence of interest.
(79) The term “5′UTR” or “5′ untranslated region” or “5′ leader sequence” refers to regions of an mRNA that are not translated. The 5′UTR typically begins at the transcription start site and ends just before the translation initiation site or start codon of the coding region. The 5′ UTR may modulate the stability and/or translation of an mRNA transcript.
(80) By “operatively linked” it is meant that the particular sequences interact either directly or indirectly to carry out an intended function, such as mediation or modulation of expression of a nucleic acid sequence. The interaction of operatively linked sequences may, for example, be mediated by proteins that interact with the operatively linked sequences.
(81) When one or more than one type of the modified norovirus GII.4 VP1 protein is expressed in the plant, portion of the plant or the plant cell, the one or more than one modified GII.4 VP1 proteins self or auto-assemble into VLPs. The plant or portion of the plant may be harvested under suitable extraction and purification conditions to maintain the integrity of the VLP, and the VLP comprising the one or more than one type of VP1 mutant (modified) protein may be purified. The one or more than one GII.4 VP1 modified or mutant protein may also be co-expressed with nucleotide sequence encoding VP2, so that the VLP may comprise both modified GII.4 VP1 protein and VP2 protein. The present disclosure also provides for the production of one or more than one type of GII.4 VP1 modified or mutant protein as described herein within a plant, portion of a plant, or plant cell, and the extraction and purification of the one or more than one type of GII.4 VP1 modified or mutant protein from the plant, the portion of the plant, or the plant cell to produce plant matter, a plant extract, or a protein extract, comprising the modified or mutant GII.4 VP1 protein.
(82) Plant matter, a plant extract, or a protein extract comprising the norovirus GII.4 VP1 modified or mutant protein as described herein is also provided. The plant matter, plant extract, or protein extract may be used to induce immunity to norovirus infection in a subject. Alternatively, the GII.4 VP1 modified or mutant protein, or the VLP comprising the GII.4 VP1 modified or mutant protein (and optionally VP2), may be purified or partially purified, and the purified or partially purified preparation may be used to induce immunity to a norovirus infection in a subject.
(83) The present disclosure also provides a composition comprising an effective dose of one or more than one type of modified norovirus GII.4 VP1 protein, or VLPs comprising one or more than one modified norovirus GII.4 VP1 protein, and optionally VP2, for inducing an immune response, and a pharmaceutically acceptable carrier, adjuvant, vehicle, or excipient.
(84) Also provided herein are methods of inducing immunity to a norovirus infection in a subject comprising of administering one or more than one type of mutant (modified) norovirus GII.4 VP1 protein or VLPs comprising one or more than one types of norovirus GII.4 VP1 modified or mutant proteins to a subject orally, intranasally, intramuscularly, intraperitoneally, intravenously, subcutaneously, rectally, or intravaginally.
(85) The term “norovirus”, as used herein, refers to a non-enveloped viral strain of the genus norovirus of the family Caliciviridae that is characterized as having a single-stranded, positive-sense RNA. The norovirus genome is 7,654 nucleotides in length. The ORF1 encodes a nonstructural polyprotein that is cleaved by viral 3C-like protease into 6 proteins, including an RNA-dependent RNA polymerase. ORF2 and ORF3 encode a major (VP1) and a minor (VP2) capsid protein, respectively (see
(86) Norovirus strains as disclosed herein include any known norovirus strain of the genotype GII.4, but also modifications to known GII.4 norovirus strains that are known to develop on a regular basis over time. In this regard, the intra-genotypic variability of GII.4 is well known (see for example Parra G. I. et. al., 2017 PLOS Pathogens 13(1):e1006136, doi:10.371/journal.ppat.1006136; which is incorporated herein by reference). For example, norovirus strains may include (as described by their amino acids sequences), but are not limited to—GII.4/Sydney/2012/K4LM89 (GII.4/2012; SEQ ID NO:1;
(87) The terms “percent similarity”, “sequence similarity”, “percent identity”, or “sequence identity”, when referring to a particular sequence, are used for example as set forth in the University of Wisconsin GCG software program, or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology, Ausubel et al., eds. 1995 supplement). Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, using for example the algorithm of Smith & Waterman, (1981, Adv. Appl. Math. 2:482), by the alignment algorithm of Needleman & Wunsch, (1970, J. Mol. Biol. 48:443), by the search for similarity method of Pearson & Lipman, (1988, Proc. Natl. Acad. Sci. USA 85:2444), by computerized implementations of these algorithms (for example: GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.).
(88) An example of an algorithm suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., (1977, Nuc. Acids Res. 25:3389-3402) and Altschul et al., (1990, J. Mol. Biol. 215:403-410), respectively. BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and amino acids of the invention. For example, the BLASTN program (for nucleotide sequences) may use as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=−4 and a comparison of both strands. For amino acid sequences, the BLASTP program may use as defaults a word length of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, 1989, Proc. Natl. Acad. Sci. USA 89:10915) alignments (B) of 50, expectation (E) of 10, M=5, N=−4, and a comparison of both strands. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (see URL: ncbi.nlm.nih.gov/).
(89) The term “VP1”, as used herein, refers to the norovirus major capsid protein or polypeptide comprising an amino acid sequence similar to the protein or polypeptide encoded by ORF2 of one or more strains of norovirus as described herein. The major capsid protein folds into two principal domains, a shell (S) domain and a protruding (P) domain (see
(90) As shown in
(91) The term “virus like particle”, VLP, “virus like particles”, or “VLPs”, as used herein, refers to a norovirus virus like particle(s) that comprise one or more than one type of norovirus VP1 protein, one or more than one type of VP1 modified or mutant protein, or a combination thereof, and that self-assemble into non-replicating, non-enveloped, non-infectious viral capsid structures lacking all parts of the norovirus genome. For example, the VLP may comprise one type of a modified VP1 protein as described herein, or the VLP may comprise two or more different modified VP1 proteins described herein. Furthermore, the VLP may comprise a VP2 protein. VLPs comprising VP1 protein, VP1+VP2 protein, modified VP1 protein, or modified VP1 protein+VP2 protein are of the size from about 15 nm to 50 nm or any amount therebetween, for example 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nm, or any amount therebetween. For example, for T=1 icosahedral symmetry, VLPs may be about 23 nm, or for T=3 icosahedral symmetry, VLPs may be from about 38 to about 40 nm.
(92) As shown in the electron micrographs of
(93) Norovirus GII.4 VP1 Protein Production in Plants
(94) The VP1 protein includes any VP1 protein comprising an amino acid sequence having from about 30 to about 100%, from about 40 to about 100%, from about 50 to about 100%, from about 60 to about 100%, from about 70 to about 100%, from about 80 to about 100%, from about 85 to about 100% from about 90 to about 100%, or from about 95 to about 100% from about 98 to about 100%, or any amount therebetween, sequence identity (which may be also termed sequence similarity) with a VP1 amino acid sequence from a norovirus GII.4/Sydney/2012/K4LM89 (GII.4/2012; SEQ ID NO:1;
(95) The modified GII.4 VP1 protein may include a nucleotide sequence encoding a GII.4 VP1 protein comprising, an S domain substitution, mutation, or modification, at any one or more amino acids 39, 53 and 80 of norovirus VP1 protein GII.4/Sydney/2012/K4LM89 (GII.4/2012; SEQ ID NO:1; see
(96) The modified or variant norovirus GII.4 VP1 protein may further be a norovirus GII.4 VP1 fusion protein, comprising an S domain derived from a first norovirus genotype variant fused to a P domain derived from a second norovirus genotype variant, or a portion of the P domain, derived from a second norovirus genotype variant. For example, the S domain derived from a first norovirus genotype variant may be substituted, mutated or modified at any one or more amino acids, or in sequence alignment, or corresponding, with positions, 39, 53 and 80 of norovirus VP1 genotype GII.4/Sydney/2012/K4LM89 (SEQ ID NO:1; see
(97) The nucleotide sequence encoding the modified norovirus VP1 protein may be optimized for human codon usage, for increased GC content, or a combination thereof. The modified VP1 protein may be expressed in a plant, portion of a plant, or plant cell.
(98) Relative to the hypervariable P domain, the primary amino acid sequence of the norovirus VP1 S domain is well conserved. Similarities of 85-100% were found in the shell domain, whereas the P1 and P2 domains were characterized by lower similarities (75-95%) (Montoya et al. “Molecular Evolution of the VP1 Gene in Human Norovirus GII.4 Variants in 1974-2015”, Front. Microbiol. December 2017, Volume 8, Article 2399). These results indicated that the genetic divergence of the VP1 gene in the GII.4 strains differed among domains. For example, nucleic acid sequences described herein may exhibit from about 80 to about 99%, or any amount therebetween sequence identity to the S domain of GII.4 VP1. For example, nucleic acid sequences described herein may exhibit from about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or any amount therebetween, sequence identity to the S domain of GII.4 VP1 (GII.4/Sydney/2012/K4LM89; SEQ ID NO:1; also referred to as Hu/GII.4/Sydney/NSW0514/2012/AU). One or more amino acids in sequence alignment, or corresponding, with positions 39, 53 and 80 of norovirus VP1 protein GII.4 (GII.4/Sydney/2012/K4LM89; SEQ ID NO:1) may be modified. Furthermore, the nucleic acid sequences described herein may exhibit from about 80 to about 99%, or any amount therebetween sequence identity to the P domain of GII.4 VP1 (GII.4/Sydney/2012/K4LM89; SEQ ID NO:1). For example, nucleic acid sequences described herein may exhibit from about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or any amount therebetween, sequence identity to the P domain of GII.4 VP1 (GII.4/Sydney/2012/K4LM89; SEQ ID NO:1). Furthermore, one or more amino acids in sequence alignment, or corresponding, with positions 333 and 368 of norovirus VP1 protein GII.4/2012 (SEQ ID NO:1) may be modified.
(99) As previously shown (PCT/CA2018/050352, filed Mar. 23, 2018; which is incorporated herein by reference) wild type (also termed native) norovirus VP1 protein may be produced in plants and VLPs comprising the VP1 protein may also be produced. Vacuum infiltration of leaves (from N. benthamiana) with Agrobacterium tumefaciens comprising expression vectors encoding GI.1 VP1 as a single nucleic acid construct, GI.1 VP2 as a single nucleic acid construct, both GI.1 VP1 and VP2, with VP1 and VP2 nucleic acid sequences introduced in separate vectors (“VP1+VP2”; dual constructs), or on the same vector (“VP1/VP2” or “VP1/VP2/3′UTR”; single nucleic acid constructs) to permit co-expression of the VP1 and/or VP2 sequences and the leaves examined for VP1 and VP2 production. After 6 or 9 days post infiltration (6 DPI and 9 DPI, respectively), total crude protein extracts were prepared from leaf homogenates, separated by SDS-PAGE, and stained with Coomassie Brilliant Blue dye. Leaves infiltrated with expression vectors comprising nucleotide sequences that correspond to wild type GI.1 ORF2, encoding the VP1 protein, produced low or non-detectable levels of GI.1 VP1 as determined using Coomassie stained gels. In contrast, leaves infiltrated with expression vectors comprising GI.1 VP1 nucleotide sequences that were codon optimized for human expression (hCod), or enriched for GC content when compared to the GC content of the wild type VP1 nucleic acid sequence, produced increased amounts of GI.1 VP1 protein in Coomassie stained gels, demonstrating that hCod GI.1 VP1 may be produced in plants when VP1 is expressed on its own.
(100) Furthermore, as described in PCT/CA2018/050352 (filed Mar. 23, 2018; which is incorporated herein by reference), leaves infiltrated with vectors comprising either wild type GI.1 VP1 and VP2 or human codon optimized GI.1 VP1 and VP2 produced low levels of GI.1 VP1 protein in Coomassie stained gels, suggesting that expression of VP1 is not enhanced by the presence of VP2 when co-expressed in cis on the same vector, using the same organization as found in the viral genome (using one promoter to control expression). However, when VP1 or human codon optimized VP1 was co-expressed in trans (on a separate construct) along with VP2 or hCod VP2 (hCod VP1+VP2), respectively, an increase in VP1 protein was observed. Each of the VP1 and VP2 nucleic acid segments comprised a regulatory region and a terminator, and the constructs were introduced into the plants as a nucleic acid complex, and this resulted in a corresponding increase in VP1 protein yield.
(101) This observation is in contrast to that reported in insect and mammalian cells (Bertolotti-Ciarlet A., Crawford S. E., Hutson A. M., Estes M. K. 2003, J. Virol. 77:11603-11615), who reported that an increase in VP1 expression was only observed when VP1 and VP2 (or VP1+VP2+3′UTR) resided in cis, and were co-expressed using the same organization as that found in the viral genome, under the control of one promoter and terminator. No increase in VP1 expression was observed by Bertolotti-Ciarlet (2003) in insect or mammalian cells, when VP1 and VP2 were co-expressed in trans.
(102) The modified VP1 proteins, as described herein, can be co-expressed in plants along with VP2. Co-expression of VP2 protein may involve separate expression systems, for example, if co-expressed on separate plasmids. Alternatively, VP1 and VP2 may be expressed on the same vector but each of the sequences encoding VP1 and VP2 should be under the control of separate promoter and terminator sequences, so that they have a separate expression system.
(103) The yield, or amount of extracted, norovirus GII.4 VP1 protein and the production of VLPs comprising norovirus GII.4 VP1 proteins in a plant, may be improved by modifying one or more than one amino acid in sequence alignment, or corresponding, with amino acid 39, 53, 80, 333 or 368 of norovirus VP1 protein GII.4/2012 (SEQ ID NO:1). The norovirus VP1 proteins with modifications in amino acids 39, 53, 80, 333 and/or 368 as indicated above, formed high density VLPs, having well-formed capsids that are predominantly 38 nm in diameter (See for example
(104) For example, as shown in
(105) Furthermore, the norovirus VP1 proteins of the GII.4/2015 genotype variant with one or more modifications at position 39 (A39V), 53 (R53I), 80 (P80S), 333 (M333V) and Q368E), or combinations of these modifications, as indicated above, formed high density VLPs, having well-formed capsids that are predominantly 38 nm in diameter (
(106) Therefore, the yield, or amount of extracted, norovirus GII.4 VP1 protein and the production of VLPs comprising norovirus GII.4 VP1 proteins in a plant, may be improved by expressing a modified norovirus GII.4 VP1 protein, for example, a GII.4 VP1 fusion protein, comprises an S domain derived from a first norovirus genotype variant fused to a P domain, or a portion of the P domain, derived from a second norovirus genotype variant, wherein the S domain comprising one or more than one substitution, mutation, or modification at a position selected from amino acids in sequence alignment, or corresponding, with amino acid 39, 53 and 80 of norovirus VP1 protein GII.4 (SEQ ID NO:1); the P domain comprising one or more than one modification at a position selected from amino acids in sequence alignment, or corresponding, with amino acids 333 and 368 of norovirus VP1 protein GII.4 (SEQ ID NO:1), or a combination thereof.
(107) However, as noted above (and with reference to Table 1) a GII.4 VP1 fusion protein comprising a modified S domain from a GII.4/2012 genotype and a modified P domain from a GII.4/2015 genotype is structurally and functional equivalent to either a GII.4/2012 genotype of a GII.4/2015 genotype, comprising the corresponding substitutions. For example, an S domain of GII.4/2012, comprising an isoleucine at positions 119 and 145, a methionine at position 144, and a serine at position 174 (V119I, I144M, V145I and P174S) is structurally and functionally equivalent to the S domain from GII.4/2015, and the P domain of GII.4/2012 comprising modifications R297H, D310N, V333M, R339K, E368Q, R373H, G393N is structurally and functionally equivalent to the P domain from GII.4/2015. Therefore, the S(GII.4/2012) nomenclature and defined substitution denoted in
(108) As shown in
(109) Furthermore, the modified norovirus GII.4 VP1 proteins with substitutions in amino acids 39, 53, 80, 333 and/or 368 as indicated in
(110) In contrast, wild type VP1 of norovirus GII.4 genotype variant GII.4/Sydney/2015 (GII.4/2015;
(111) The present disclosure provides nucleic acid sequences encoding modified norovirus GII.4 VP1 proteins, wherein the modified norovirus VP1 comprises one or more than one modification, substitution or mutation at a position selected from a group consisting of amino acids in sequence alignment, or corresponding, with amino acids 39, 53, 80, 333 and 368 of norovirus VP1 protein GII.4 (SEQ ID NO:1). For example, the nucleic acid sequence encoding the modified norovirus GII.4 VP1 protein may comprise an S-domain derived from a first norovirus genotype variant fused to a P domain, or a portion of the P domain, derived from a second norovirus genotype variant, wherein the S domain comprises one or more than one substitution mutation or modification at a position selected from amino acids in sequence alignment, or corresponding, with amino acid 39, 53 and 80 of norovirus VP1 protein GII4/2012 (SEQ ID NO:1); the P domain comprising one or more than one modification at a position selected from amino acids in sequence alignment, or corresponding, with amino acids 333 and 368 of norovirus VP1 protein G11.4/2015 (SEQ ID NO:3, or GII.4/2012, SEQ ID NO:1), or a combination thereof. Alternatively, the nucleic acid sequence may encode a modified GII.4/Sydney/2015 VP1 protein comprising I119V, M144I, I145V and S174P, with one or more than one substitution, mutation, or modification at positions 39, 53, 80, 333 and 368, or a combination thereof.
(112) Plant expressing nucleic acid sequences encoding the modified norovirus G11.4 VP1 protein and comprising one or more than one substitution, mutation, or modification at a position selected from a group consisting of amino acids in sequence alignment, or corresponding, with amino acids 39, 53, 80, 333 and 368 of norovirus VP1 protein GII.4 exhibit improved VP1 characteristics as compared to the wild type GII.4 VP1 that does not comprise the one or more than one substitution, mutation, or modification for example wild type GII.4/Sydney/2015 (SEQ ID NO:3).
(113) Examples of improved characteristics of the modified GII.4 VP1 include, increased modified GII.4 VP1 protein yield (determined for example using Coomassie stained SDS-PAGE and Western analysis) when expressed in plant cells as compared to the wild type VP1 that does not comprise the one or more than one substitution, mutation or modification. For example, increased yields of modified GII.4 VP1 protein may range from 1.5 to 20 fold, or any amount there between, over that of the corresponding wild type VP1 yield; increased density of VLPs comprising the modified GII.4 VP1 proteins, for example as determined using iodixanol density gradient separation of protein extracts as compared to density gradient separation of the wild type GII.4 VP1 that does not comprise the one or more than one substitution, mutation or modification. For example, VLPs comprising modified GII.4 VP1 protein may be observed in the same or more dense fractions following density gradient centrifugation; improved integrity of VLPs that are comprised of the modified GII.4 VP1 proteins compared to the wild type GII.4 VP1 that does not comprise the one or more than one substitution, mutation or modification. For example, the number of disrupted, or partially assembled, VLPs may be determined using TEM; increased VLP yield when expressed in plant cells as compared to the wild type level of VLP production of the same genotype that does not comprise the substitution(s), mutation(s) or modification(s). VLP yield may be determined in washed samples obtained from VLP containing fractions following density gradient centrifugation using TEM. For example, increased yields of VLPs comprising modified GII.4 VP1 protein may range from 1.5 to 20 fold, or any amount there between, over that of the corresponding yield of VLPs comprising wild type VP1 protein; a greater proportion of VLPs that assemble into 38 nm VLPs as opposed to 23 nm VLPs, compared to VLPs comprising the wild type GII.4 VP1 that does not comprise the one or more than one substitution, mutation or modification (determined using TEM); and a combination of these improved characteristics.
(114) Without wishing to be bound by theory, VLPs that are observed in higher density fractions following density gradient centrifugation, as compared to wild type norovirus VLPs, indicates that the assembly of the VLPs comprising native GII.4 VP1 may be less stable when expressed in, and extracted from, plants, than VLPs comprising the modified VP1 protein. The native VLP may therefore be more susceptible to malformed capsid particles and the generation of fragmentation products. As a result, the VLPs comprising modified GII.4 VP1 protein that are characterized as having increased density may also exhibit greater structural integrity than VLPs produced using the corresponding wild type VP1.
(115) The nucleic acid sequences encoding the modified GII.4 VP1 proteins as described herein may exhibit from about 80% to about 99% sequence similarity (or identity) with a nucleic acid sequences encoding GII.4 VP1, for example, nucleic acid sequences described herein may exhibit from about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or any amount therebetween, sequence identity with a nucleic acid sequence encoding a norovirus GII.4 VP1, for example: GII.4/Sydney/2012/K4LM89 (GII.4/2012; SEQ ID NO:1;
(116) Similarly, the present invention includes amino acid sequences that exhibit from about 30% to about 99% or any amount therebetween, sequence similarity with any GII.4 VP1 sequence for example, GII.4/Sydney/2012/K4LM89 (GII.4/2012; SEQ ID NO:1;
(117) By “VP1 mutant protein”, “mutant VP1 protein”, “modified VP1 protein”, “modified norovirus VP1 protein” and the like, it is meant, a norovirus VP1 protein comprising one or more than one substitution, mutation, or modification, within the amino acid sequence. For example, a GII.4 VP1 modified or mutant protein may comprise one or more substitutions at positions in alignment with amino acids 39, 53, 80, 333 and 368 of norovirus VP1 protein GII.4/2015 (SEQ ID NO:1). The modified VP1 protein may further include a norovirus VP1 fusion protein, comprising an S domain derived from a first norovirus genotype variant fused to a P domain, or a portion of the P domain, derived from a second norovirus genotype variant. The S domain derived from the first norovirus genotype variant may be substituted, mutated or modified at any one or more amino acids in sequence alignment, or corresponding, with positions 39, 53 and 80 of norovirus VP1 protein GII.4/2012 (SEQ ID NO:1; see
(118) As described herein, modified VP1 proteins comprising one or more than one substitutions of amino acids at positions 39, 53, 80, 333 and 368 in GII.4 strains, resulted in an improved characteristic of the modified VP1 protein, or VLP produced using the modified VP1 protein. It is to be understood that the improved characteristic is not limited to substituting the specific amino acid at the specified sites, since as noted above, one of skill in the art would understand that amino acids with similar properties may be substituted for the amino acids at the identified positions. For example, the modification P80S, comprises substituting proline at position 80 with serine, an amino acid characterized as having a polar neutral side chain. The proline at this position may also be substituted with an alternate amino acid characterized as having a polar neutral side chain, for example either asparagine, cysteine, or threonine, i.e. P80X, where X=S, N, C or T.
(119) The modification A39V that comprises substituting an alanine with valine (an amino acid characterized as having a hydrophobic side chain) at position 39, in addition to valine, alanine may also be substituted with amino acid characterized as having a hydrophobic side chain, for example, isoleucine, leucine, or methionine i.e. A39X, where X=V, I, L or M.
(120) The modification R53I that comprises substituting an arginine with isoleucine (an amino acid characterized as having a hydrophobic side chain) at position 53, in addition to isoleucine, arginine may also be substituted with an amino acid characterized as having a hydrophobic side chain, for example, leucine, valine, alanine or methionine i.e. R53X, where X=I, L, V, A or M.
(121) The modification M333V that comprises substituting a methionine with a valine (an amino acid characterized as having a hydrophobic side chain) at position 333, in addition to valine, methionine may also be substituted with an amino acid characterized as having a hydrophobic side chain, for example, isoleucine or leucine i.e. M333V, where X=V, I or L.
(122) The modification Q368E that comprises substituting a glutamine at position 368 with glutamic acid (an amino acid characterized as having a polar side chain), in addition to glutamic acid, glutamine may also be substituted with an amino acid characterizes as having a polar side chain, for example asparagine or aspartate i.e. Q368X, where X=E, N or D.
(123) Examples of VP1 modified or mutant proteins (modified VP1 proteins) include, but are not limited to, the following.
(124) GII.4_P80S VP1 (GII.4_P80X, where X=S, N, C or T, VP1): wherein the proline corresponding to amino acid 80 of norovirus VP1 protein GII.4/2012 (SEQ ID NO:1, or GII.4/2015, SEQ ID NO:3) has been substituted, mutated, or modified for example, to serine (GII.4_P80S; SEQ ID NO:11,
VLP Yield
(125) An example of an improved characteristic of VP1 may be observed comparing the yields of VLPs comprising modified VP1 proteins is shown with reference to
(126) Additionally, VLPs comprising modified VP1 protein with one or more than one substitution of an amino acid at position 39, 53, 80, 333 and 368 (or corresponding to, or in alignment with, position 39, 53, 80, 333 and 368 of GII.4 VP1) exhibited an increase in VLP yield when compared to the yield of VLPs comprising the corresponding wild type, or native, VP1 protein, for all modified VP1 proteins that were examined.
(127) Increased VP1 protein yield (see
Size, Density, Stability and Quality of VLPs
(128) As shown in
(129) Induction of Immunity Against Norovirus Infection
(130) An “immune response” generally refers to a response of the adaptive immune system of a subject. The adaptive immune system generally comprises a humoral response, and a cell-mediated response. The humoral response is the aspect of immunity that is mediated by secreted antibodies, produced in the cells of the B lymphocyte lineage (B cell). Secreted antibodies bind to antigens on the surfaces of invading microbes (such as viruses or bacteria), which flags them for destruction. Humoral immunity is used generally to refer to antibody production and the processes that accompany it, as well as the effector functions of antibodies, including Th2 cell activation and cytokine production, memory cell generation, opsonin promotion of phagocytosis, pathogen elimination and the like. The terms “modulate” or “modulation” or the like refer to an increase or decrease in a particular response or parameter, as determined by any of several assays generally known or used, some of which are exemplified herein.
(131) A cell-mediated response is an immune response that does not involve antibodies but rather involves the activation of macrophages, natural killer cells (NK), antigen-specific cytotoxic T-lymphocytes, and the release of various cytokines in response to an antigen. Cell-mediated immunity is used generally to refer to some Th cell activation, Tc cell activation and T-cell mediated responses. Cell mediated immunity may be of particular importance in responding to viral infections.
(132) For example, the induction of antigen specific CD8 positive T lymphocytes may be measured using an ELISPOT assay; stimulation of CD4 positive T-lymphocytes may be measured using a proliferation assay. Anti-norovirus antibody titres may be quantified using an ELISA assay; isotypes of antigen-specific or cross reactive antibodies may also be measured using anti-isotype antibodies (e.g. anti-IgG, IgA, IgE or IgM). Methods and techniques for performing such assays are well-known in the art.
(133) Cytokine presence or levels may also be quantified. For example a T-helper cell response (Th1/Th2) will be characterized by the measurement of IFN-γ and IL-4 secreting cells using by ELISA (e.g. BD Biosciences OptEIA kits). Peripheral blood mononuclear cells (PBMC) or splenocytes obtained from a subject may be cultured, and the supernatant analyzed. T lymphocytes may also be quantified by fluorescence-activated cell sorting (FACS), using marker specific fluorescent labels and methods as are known in the art.
(134) A microneutralization assay may also be conducted to characterize an immune response in a subject, see for example the methods of Rowe et al., 1973. Virus neutralization titers may be quantified in a number of ways, including: enumeration of lysis plaques (plaque assay) following crystal violent fixation/coloration of cells; microscopic observation of cell lysis in in vitro culture; and
(135) 2) ELISA and spectrophotometric detection of norovirus.
(136) The term “epitope” or “epitopes”, as used herein, refers to a structural part of an antigen to which an antibody specifically binds.
(137) It is also provided herein a method of producing an antibody or antibody fragment comprising, administering a modified norovirus VP1 protein, or a norovirus VLP comprising one or more than one modified VP1 protein to a subject, or a host animal, thereby producing the antibody or the antibody fragment. The modified norovirus VP1 protein comprising one or more than one substitution, mutation or modification at a position selected from amino acids in sequence alignment, or corresponding, with amino acids 39, 53, 80, 333 and 368 of norovirus VP1 genotype GII.4 (SEQ ID NO:1). The VLP may further comprise a norovirus VP2 protein.
(138) There is also provided a composition for inducing an immune response comprising, an effective dose of the VLP comprising the modified norovirus VP1 protein, and a pharmaceutically acceptable carrier, adjuvant, vehicle or excipient.
(139) Plant Expression
(140) The constructs of the present invention can be introduced into plant cells using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, micro-injection, electroporation, etc. For reviews of such techniques see for example Weissbach and Weissbach, Methods for Plant Molecular Biology, Academy Press, New York VIII, pp. 421-463 (1988); Geierson and Corey, Plant Molecular Biology, 2d Ed. (1988); and Miki and Iyer, Fundamentals of Gene Transfer in Plants. In Plant Metabolism, 2d Ed. D T. Dennis, D H Turpin, D D Lefebvre, D B Layzell (eds), Addison Wesly, Langmans Ltd. London, pp. 561-579 (1997). Other methods include direct DNA uptake, the use of liposomes, electroporation, for example using protoplasts, micro-injection, microprojectiles or whiskers, and vacuum infiltration. See, for example, Bilang, et al. (1991, Gene 100: 247-250), Scheid et al. (1991, Mol. Gen. Genet. 228: 104-112), Guerche et al. (1987, Plant Science 52: 111-116), Neuhause et al. (1987, Theor. Appl Genet. 75: 30-36), Klein et al. (2987, Nature 327: 70-73); Freeman et al. (1984, Plant Cell Physiol. 29: 1353), Howell et al. (1980, Science 208: 1265), Horsch et al. (1985, Science 227: 1229-1231), DeBlock et al. (1989, Plant Physiology 91: 694-701), Methods for Plant Molecular Biology (Weissbach and Weissbach, eds., Academic Press Inc., 1988), Methods in Plant Molecular Biology (Schuler and Zielinski, eds., Academic Press Inc., 1989), WO 92/09696, WO 94/00583, EP 331083, EP 175966, Liu and Lomonossoff (2002, J Virol Meth, 105:343-348), EP 290395; WO 8706614; U.S. Pat. Nos. 4,945,050; 5,036,006; and 5,100,792, U.S. patent application Ser. No. 08/438,666, filed May 10, 1995, and Ser. No. 07/951,715, filed Sep. 25, 1992, (all of which are hereby incorporated by reference).
(141) Transient expression methods may be used to express the constructs of the present invention (see D'Aoust et al., 2009, Methods in molecular biology, Vol 483, pages 41-50; Liu and Lomonossoff, 2002, Journal of Virological Methods, 105:343-348; which is incorporated herein by reference). Alternatively, a vacuum-based transient expression method, as described by Kapila et al. (1997, Plant Sci. 122, 101-108; which is incorporated herein by reference), or WO 00/063400, WO 00/037663 (which are incorporated herein by reference) may be used. These methods may include, for example, but are not limited to, a method of Agro-inoculation or Agro-infiltration, syringe infiltration, however, other transient methods may also be used as noted above. With Agro-inoculation, Agro-infiltration, or syringe infiltration, a mixture of Agrobacteria comprising the desired nucleic acid enter the intercellular spaces of a tissue, for example the leaves, aerial portion of the plant (including stem, leaves and flower), other portion of the plant (stem, root, flower), or the whole plant. After crossing the epidermis the Agrobacteria infect and transfer t-DNA copies into the cells. The t-DNA is episomally transcribed and the mRNA translated, leading to the production of the protein of interest in infected cells, however, the passage of t-DNA inside the nucleus is transient.
(142) Also considered part of this invention are transgenic plants, plant cells or seeds containing the gene construct of the present invention that may be used as a platform plant suitable for transient protein expression described herein. Methods of regenerating whole plants from plant cells are also known in the art (for example see Guerineau and Mullineaux (1993, Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Croy R R D ed) Oxford, BIOS Scientific Publishers, pp 121-148). In general, transformed plant cells are cultured in an appropriate medium, which may contain selective agents such as antibiotics, where selectable markers are used to facilitate identification of transformed plant cells. Once callus forms, shoot formation can be encouraged by employing the appropriate plant hormones in accordance with known methods and the shoots transferred to rooting medium for regeneration of plants. The plants may then be used to establish repetitive generations, either from seeds or using vegetative propagation techniques. Transgenic plants can also be generated without using tissue culture. Methods for stable transformation, and regeneration of these organisms are established in the art and known to one of skill in the art. Available techniques are reviewed in Vasil et al. (Cell Culture and Somatic Cell Genetics of Plants, VoI I, II and III, Laboratory Procedures and Their Applications, Academic Press, 1984), and Weissbach and Weissbach (Methods for Plant Molecular Biology, Academic Press, 1989). The method of obtaining transformed and regenerated plants is not critical to the present invention.
(143) If plants, plant portions or plant cells are to be transformed or co-transformed by two or more nucleic acid constructs, the nucleic acid construct may be introduced into the Agrobacterium in a single transfection event so that the nucleic acids are pooled, and the bacterial cells transfected. Alternatively, the constructs may be introduced serially. In this case, a first construct is introduced into the Agrobacterium as described, the cells are grown under selective conditions (e.g. in the presence of an antibiotic) where only the singly transformed bacteria can grow. Following this first selection step, a second nucleic acid construct is introduced into the Agrobacterium as described, and the cells are grown under doubly-selective conditions, where only the doubly-transformed bacteria can grow. The doubly-transformed bacteria may then be used to transform a plant, plant portion or plant cell as described herein, or may be subjected to a further transformation step to accommodate a third nucleic acid construct.
(144) Alternatively, if plants, plant portions, or plant cells are to be transformed or co-transformed by two or more nucleic acid constructs, the nucleic acid construct may be introduced into the plant by co-infiltrating a mixture of Agrobacterium cells with the plant, plant portion, or plant cell, each Agrobacterium cell may comprise one or more constructs to be introduced within the plant. In order to vary the relative expression levels within the plant, plant portion or plant cell, of a nucleotide sequence of interest within a construct, during the step of infiltration, the concentration of the various Agrobacteria populations comprising the desired constructs may be varied.
(145) Therefore, there is provided herein, a plant, a portion of a plant, a plant cell, or a plant extract, comprising, one or more than one modified norovirus VP1 protein, or a norovirus VLP comprising one or more than one modified VP1 protein. The one or more than one modified norovirus VP1 protein comprising one or more than one substitution, mutation or modification at a position selected from amino acids in sequence alignment, or corresponding, with amino acids 39, 53, 80, 333 and 368 of norovirus VP1 protein GII.4/2015 (SEQ ID NO:3). The VLP may further comprise a norovirus VP2 protein.
(146) Also provided herein is a plant, portion of a plant, a plant cell, or a plant extract comprising, a nucleic acid or polynucleotide sequence encoding one or more than one modified norovirus VP1 protein. The one or more than one modified norovirus VP1 protein comprising one or more than one substitution, mutation or modification at a position selected from amino acids in sequence alignment, or corresponding, with amino acids 39, 53, 80, 333 and 368 of norovirus VP1 protein GII.4/2015 (SEQ ID NO:3, or GII4/2012, SEQ ID NO:1).
(147) TABLE-US-00003 TABLE 3 Norovirus strains and constructs. Norovirus VP1 SEQ ID NO: FIG. # Const # FIG. # Wt GII.4 Syd12 (“GII.4/2012”) (aa) 1 5A — — Wt GII.4 Syd12 (“GII.4/2012”) hCod (nt) 2 5B 3760 20A Wt GII.4 Syd15 (“GII.4/2015”) (aa) 3 5C — — Wt GII.4 Syd15 (“GII.4/2015”) hCod (nt) 4 5D 4153 5E Wt GII.4 US96/GII.4/Dresden174/1997/DE_AY741811 (aa) 5 6A — — Wt GII.4 FH02/GII.4/FarmingtonHills/2002/US_AY502023 (aa) 6 6B — — Wt GII.4 Hnt04:GII.4/Hunter-NSW504D/2004/AU_DQ078814 (aa) 7 6C — — Wt GII.4 2006b: GII.4/Shellharbour-NSW696T/2006/AU_EF684915 (aa) 8 6D — — Wt GII.4 N009/GII.4/Orange-NSW001P/2008/AU_GQ845367 (aa) 9 6E — — Mut GII.4/2012 (P80S) hCod (nt) 10 7A 4152 7C Mut GII.4/2012 (P80S) (aa) 11 7B — — Mut GII.4/2015 (P80S) hCod (nt) 12 7D 4154 7F Mut GII.4/2015 (P80S) (aa) 13 7E — — Mut S(GII.4/2012_P80S) + P(GII.4/2015) hCod (nt) 14 7G 4171 7I Mut S(GII.4/2012_P80S) + P(GII.4/2015) aa 15 7H — — Mut S(GII.4/2012_P80S) + P(GII.4/2015_M333V) hCod (nt) 16 8A 4174 8C Mut S(GII.4/2012_P80S) + P(GII.4/2015_M333V) (aa) 17 8B — — Mut S(GII.4/2012_P80S) + P(GII.4/2015_Q368E) hCod (nt) 18 8D 4176 8F Mut S(GII.4/2012_P80S) + P(GII.4/2015_Q368E) (aa) 19 8E — — Mut S(GII.4/2012_P80S) + P(GII.4/2015_ M333V + Q368E) hCod (nt) 20 8G 4187 8I Mut S(GII.4/2012_P80S) + P(GII.4/2015_ M333V + Q368E) (aa) 21 8H — — Mut S(GII.4/2012_A39V + P80S) + P(GII.4/2015_M333V) hCod (nt) 22 9A 4188 9C Mut S(GII.4/2012_A39V + P80S) + P(GII.4/2015_M333V) (aa) 23 9B — — Mut VP1 S(GII.4/2012_A39V + P80S) + P(GII.4/2015_Q368E) hCod (nt) 24 9D 4194 9F Mut VP1 S(GII.4/2012_A39V + P80S) + P(GII.4/2015_Q368E) (aa) 25 9E — — Mut VP1 S(GII.4/2012_A39V + P80S) + P(GII.4/2015_M333V + Q368E hCod (nt) 26 9G 4191 9I Mut VP1 S(GII.4/2012_A39V + P80S) + P(GII.4/2015_M333V + Q368E (aa) 27 9H — — Mut VP1 S(GII.4/2012_R53I + P80S) + P(GII.4/2015_M333V) hCod (nt) 28 10A 4189 10C Mut VP1 S(GII.4/2012_R53I + P80S) + P(GII.4/2015_M333V) (aa) 29 10B — — Mut VP1 S(GII.4/2012_R53I + P80S) + P(GII.4/2015_Q368E) hCod (nt) 30 10D 4195 10F Mut VP1 S(GII.4/2012_R53I + P80S) + P(GII.4/2015_Q368E) (aa) 31 10E — — Mut VP1 S(GII.4/2012_R53I + P80S) + P(GII.4/2015_M333V + Q368E) hCod (nt) 32 10G 4192 10I Mut VP1 S(GII.4/2012_R53I + P80S) + P(GII.4/2015_M333V + Q368E) (aa) 33 10H — — Mut VP1 S(GII.4/2012_A39V + R53I + P80S) + P(GII.4/2015_M333V) hCod (nt) 34 11A 4190 11C Mut VP1 S(GII.4/2012_A39V + R53I + P80S) + P(GII.4/2015_M333V) (aa) 35 11B — — Mut (P1 S(GII.4/2012_A39V + R53I + P80S) + P(GII.4/2015_Q368E) hCod (nt) 36 11D 4196 11F Mut VP1 S(GII.4/2012_A39V + R53I + P80S) + P(GII.4/2015_Q368E) (aa) 37 11E — — Mut VP1 S(GII.4/2012_A39V + R53I + P80S) + P(GII.4/2015_M333V + Q368E) hCod (nt) 38 11G 4193 11I Mut VP1 S(GII.4/2012_A39V + R53I + P80S) + P(GII.4/2015_M333V + Q368E) (aa) 39 11H — — Mut VP1 GII.4/2015_P80S + M333V hCod (nt) 40 12A 4241 12C Mut VP1 GII.4/2015_P80S + M333V (aa) 41 12B — — Mut VP1 GII.4/2015_P80S + Q368E hCod (nt) 42 12D 4242 12F Mut VP1 GII.4/2015_P80S + Q368E (aa) 43 12E — — Mut VP1 GII.4/2015_P80S + M333V + Q368E (hCod (nt) 44 12G 4243 12I Mut VP1 GII.4/2015_P80S + M333V + Q368E (aa) 45 12H — — Mut VP1 GII.4/2015_A39V + P80S hCod (nt) 46 13A 4244 13C Mut VP1 GII.4/2015_A39V + P80S m(aa) 47 13B — — Mut VP1 GII.4/2015_A39V + P80S + M333V hCod (nt) 48 13D 4245 13F Mut VP1 GII.4/2015_A39V + P80S + M333V (aa) 49 13E — — Mut VP1 GII.4/2015_A39V + P80S + Q386E hCod (nt) 50 13G 4246 13I Mut VP1 GII.4/2015_A39V + P80S + Q386E (aa) 51 13H — — Mut VP1 GII.4/2015_A39V + P80S + M333V + Q386E hCod (nt) 52 13J 4247 13L Mut VP1 GII.4/2015_A39V + P80S + M333V + Q386E (aa) 53 13K — — Mut VP1 GII.4/2015_R53I + P80S hCod (nt) 54 14A 4248 14C Mut VP1 GII.4/2015_R53I + P80S (aa) 55 14B Mut VP1 GII.4/2015_R53I + P80S + M333V hCod (nt) 56 14D 4249 14F Mut VP1 GII.4/2015_R53I + P80S + M333V (aa) 57 14E — — Mut VP1 GII.4/2015_R53I + P80S + Q386E hCod (nt) 58 14G 4250 14I Mut VP1 GII.4/2015_R53I + P80S + Q386E (aa) 59 14H — — Mut VP1 GII.4/2015_R53I + P80S + M333V + Q386E hCod (nt) 60 14J 4251 14L Mut VP1 GII.4/2015_R53I + P80S + M333V + Q386E (aa) 61 14K — — Mut VP1 GII.4/2015_A39V + R53I + P80S hCod (nt) 62 15A 4252 15C Mut VP1 GII.4/2015_A39V + R53I + P80S (aa) 63 15B — — Mut of VP1 GII.4/2015_A39V + R53I + P80S + M333V hCod (nt) 64 15D 4253 15F Mut of VP1 GII.4/2015_A39V + R53I + P80S + M333V (aa) 65 15E — — Mut VP1 GII.4/2015_A39V + R53I + P80S + Q386E hCod (nt) 66 15G 4254 15I Mut VP1 GII.4/2015_A39V + R53I + P80S + Q386E (aa) 67 15H — — Mut VP1 GII.4/2015_A39V + R53I + P80S + M333V + Q386E hCod (nt) 68 15J 4255 15L Mut VP1 GII.4/2015_A39V + R53I + P80S + M333V + Q386E (aa) 69 15K — — Cloning vector 3674 from left to right T-DNA (nt) 70 16A 3674 16B Construct 4153 from 2X35S promoter to NOS terminator (nt) 71 16C — — Construct 4154 from 2X35S promoter to NOS terminator (nt) 72 16D — — ‘aa’ refers to amino acid sequence; ‘nt’ refers to nucleotide sequence Amino acids substitutions in the VP1 are indicated by wild type amino acid residue followed by the residue number and the substituted amino acid residue.
(148) The present invention will be further illustrated in the following examples.
Example 1: Norovirus VP1 Constructs
(149) Examples of candidate native sequences for GII.4 VP1 are publicly available, for example in Genbank. It is to be understood that the examples provided below are to be considered non-limiting, since norovirus strains are known to mutate and evolve on a regular basis over time, and the intra-genotypic variability of GII.4 is well known (see for example Parra G. I. et. al., 2017 PLOS Pathogens 13(1):e1006136, doi:10.371/joumal.ppat.1006136; which is incorporated herein by reference). Non-limiting examples of native GII.4 VP1 sequences include:
(150) Hu/GII.4/Sydney/NSW0514/2012/AU (also referred to as GII.4_Sydney_2012_K4LM89; GII.4/2012; SEQ ID NO's:1 and 2;
(151) Hu/GII.4/Sydney2015 (GII.4/2015; SEQ ID NO's:3 and 4;
(152) US96/GII.4/Dresden174/1997/DE_AY741811 (GII.4; SEQ ID NO:5;
(153) FH02/GII.4/FarmingtonHills/2002/US_AY502023 (GII.4; SEQ ID NO:6;
(154) Hnt04:GII.4/Hunter-NSW504D/2004/AU_DQ078814 (GII.4; SEQ ID NO:7;
(155) 2006b: GII.4/Shellharbour-NSW696T/2006/AU_EF684915 (GII.4; SEQ ID NO:8;
(156) NO09: GII.4/Orange-NSW001P/2008/AU_GQ845367 (GII.4; SEQ ID NO:9;
(157) The primers listed in Table 2 were used to prepare the constructs described below.
(158) TABLE-US-00004 TABLE 4 primers used to prepare constructs defined herein. SEQ ID Primer Sequence NO IF(nbPK74)GII.4Syd15(opt1).c TCTTTGAAATTTCTGCAACAATGAAGATGGCT 74 AGCTCAGACGCCAATCCAAGCG IF-(Syd15)GII4(opt1).r ACTAAAGAAAATAGGCCTCTACACGGCTCTCC 74 TGCGGCCTGTACCGTTG IF(nbPK74)GII.4Syd12.c TCTTTGAAATTTCTGCAACAATGAAAATGGCC 75 TCGAGTGACGCTAACCCTA GII.4(P80S).r GATCGGGTCCCAAGCTGGCCGACCACAGGATT 76 TCTCCTGGCGCATTTCTC GII.4(P80S).c AATCCTGTGGTCGGCCAGCTTGGGACCCGATC 77 TGAACCCCTATTTGTCAC IF-GII4Syd12VP1.r ACTAAAGAAAATAGGCCTTCAGACAGCCCTGC 78 GTCTGCCAGTCCCATT G11.4Syd15(opt1)(P80S).r GTCGGGGCCGAGGGAGGCGCTCCACAGTATCT 79 CTCCAGGAGCGTTTCT G11.4Syd15(opt1)(P80S).c GATACTGTGGAGCGCCTCCCTCGGCCCCGACC 80 TCAACCCCTATCTGT GII.4Syd15(opt1) + GII.4Syd121 GGCTTAGTTCTGCTCTCAACAGTGGGGGGCAC 81 TAAGAAGATAAAGTCAA GII.4Syd12 + GII.4Syd15(opt1).c TGCCCCCCACTGTTGAGAGCAGAACTAAGCCC 82 TTTTCTGTTCCCGTGCT GII.4Syd15(opt1)(M333V).r CGTCTGTGTCAGCACGCCCTGGATCTTTCCAA 83 CAAAGTCGGGTGTCCC GII.4Syd15(opt1)(M333V).c TGGAAAGATCCAGGGCGTGCTGACACAGACGA 84 CAAAGACAGATGGTTCA GII.4Syd15(opt1)(Q368E).r ATCTGTATCTGTCTCAAACTGCACTCTACCGA 85 GTTTTGGTGCGAAATCG GII.4Syd15(opt1)(Q368E).c CGGTAGAGTGCAGTTTGAGACAGATACAGATC 86 ACGACTTTGAAGCCAAC VP1_GII.4Syd12(A39V).r GACCGGCCACGGGGACTGCTATGGCTGCGCCC 87 ACCACAGGCTCCAGGGCCATCA VP1_GII.4Syd12(A39V).c GGGCGCAGCCATAGCAGTCCCCGTGGCCGGTC 88 AGCAGAATGTGATTGACCCGTG VP1_GII.4Syd12(R53I).r TGGACAAAATTGTTGATTATCCACGGGTCAAT 89 CACATTCTGCTGACCG VP1_GII.4Syd12(R53I).c GATTGACCCGTGGATAATCAACAATTTTGTCC 90 AAGCCCCTGGTGGGGAGT VP1(Syd15)GII4(opt1)(A39V).r TGCCCAGCAACAGGCACAGCTATAGCAGCTCC 91 AACCACGGGCTCAAGG VP1(Syd15)GII4(opt1)(A39V).c TGGAGCTGCTATAGCTGTGCCTGTTGCTGGGC 92 AGCAGAACGTGATAGA VP1(Syd15)GII4(opt1)(R53I).r CAAAGTTGTTGATTATCCATGGGTCTATCACG 93 TTCTGCTGCCCAGCAACAG VP1(Syd15)GII4(opt1)(R53I).c TGATAGACCCATGGATAATCAACAACTTTGTT 94 CAGGCCCCCGGTGGAG
2×35S/atPK74/VP1 GII.4-Sydney 2015 (hCod)/NOS+MAR (Construct number 4153)
(159) A human codon-optimized sequence encoding VP1 from Norovirus strain GII.4/Sydney/2015 was cloned into 2×35S/nbPK74/CPMV 3′UTR/NOS expression system using the following PCR-based method. A fragment containing the GII.4 VP1 coding sequence was amplified using primers IF(nbPK74)GII.4Syd15(opt1).c (SEQ ID NO: 73) and IF-(Syd15)GII4(opt1).r (SEQ ID NO: 74), using human codon-optimized GII.4/Sydney 2015 VP1 gene sequence (SEQ ID NO: 4) as template. For sequence optimization, a GII.4/Sydney 2015 strain protein sequence (SEQ ID NO: 3) was backtranslated and optimized for human codon usage, GC content and mRNA structure. The PCR product was cloned in 2×35S/nbPK74/CPMV 3′UTR/NOS expression system using In-Fusion cloning system (Clontech, Mountain View, CA). Construct number 3674 (SEQ ID NO:70,
(160) 2×35S/nbPK74/GII.4-Sydney 2015_P80S (hCod)/CPMV 3′UTR/NOS+MAR (Construct Number 4154)
(161) A human codon-optimized sequence encoding VP1 from strain GII.4/Sydney/2015 strain comprising a P80S substitution in the S domain was cloned into 2×35S/nbPK74/CPMV3′UTR/NOS+MAR expression system using the following PCR-based method. In a first round of PCR, a fragment containing the S domain with the modified P80S amino acid was amplified using primers IF(nbPK74)GII.4Syd15(opt1).c (SEQ ID NO:73) and GII.4Syd15(opt1)(P80S).r (SEQ ID NO:79), using human codon-optimized GII.4/Sydney 2015 VP1 gene sequence (SEQ ID NO:4) as template. A second fragment containing the P80S substitution with the remaining of the S and P domain was amplified using GII.4Syd15(opt1)(P80S).c (SEQ ID NO:80) and IF-(Syd15)GII4(opt1).r (SEQ ID NO:74), using human codon-optimized GII.4/Sydney 2015 VP1 gene sequence (SEQ ID NO:4) as template. For sequence optimization, a GII.4/Sydney 2015 strain protein sequence (SEQ ID NO:3) was backtranslated and optimized for human codon usage, GC content and mRNA structure. The PCR product was cloned in 2×35S/nbPK74/CPMV 3′UTR/NOS expression system using In-Fusion cloning system (Clontech, Mountain View, CA). Construct number 3674 (
(162) A summary of the wildtype and modified VP1 proteins, primers, templates and products is provided in Tables 3 and 4. The modified VP1 proteins were assembled using the same methods as described above.
Example 2: Methods
(163) Agrobacterium tumefaciens Transfection
(164) Agrobacterium tumefaciens strain AGL1 was transfected by electroporation with the native norovirus VP1, native norovirus VP2, or norovirus VP1 modified protein expression vectors using the methods described by D'Aoust et al., 2008 (Plant Biotech. J. 6:930-40). Transfected Agrobacterium were grown in YEB medium supplemented with 10 mM 2-(N-morpholino)ethanesulfonic acid (MES), 20 μM acetosyringone, 50 μg/ml kanamycin and 25 μg/ml of carbenicillin pH5.6 to an OD.sub.600 between 0.6 and 1.6. Agrobacterium suspensions were centrifuged before use and resuspended in infiltration medium (10 mM MgCl.sub.2 and 10 mM MES pH 5.6).
(165) Preparation of Plant Biomass, Inoculum and Agroinfiltration
(166) N. benthamiana plants were grown from seeds in flats filled with a commercial peat moss substrate. The plants were allowed to grow in the greenhouse under a 16/8 photoperiod and a temperature regime of 25° C. day/20° C. night. Three weeks after seeding, individual plantlets were picked out, transplanted in pots and left to grow in the greenhouse for three additional weeks under the same environmental conditions
(167) Agrobacteria transfected with each native norovirus VP1, native norovirus VP2, or norovirus VP1 modified expression vector were grown in a YEB medium supplemented with 10 mM 2-(N-morpholino)ethanesulfonic acid (MES), 20 μM acetosyringone, 50 μg/ml kanamycin and 25 μg/ml of carbenicillin pH5.6 until they reached an OD.sub.600 between 0.6 and 1.6. Agrobacterium suspensions were centrifuged before use and resuspended in infiltration medium (10 mM MgCl.sub.2 and 10 mM MES pH 5.6) and stored overnight at 4° C. On the day of infiltration, culture batches were diluted in 2.5 culture volumes and allowed to warm before use. Whole plants of N. benthamiana were placed upside down in the bacterial suspension in an air-tight stainless steel tank under a vacuum of 20-40 Torr for 2-min. Plants were returned to the greenhouse for a 6 or 9 day incubation period until harvest.
(168) Leaf Harvest and Total Protein Extraction
(169) Following incubation, the aerial part of plants was harvested, frozen at −80° C. and crushed into pieces. Total soluble proteins were extracted by homogenizing (Polytron) each sample of frozen-crushed plant material in 2 volumes of cold 100 mM phosphate buffer pH 7.2+150 mM NaCl, 0.4 μg/ml Metabisulfite and 1 mM phenylmethanesulfonyl fluoride. After homogenization, the slurries were centrifuged at 10,000 g for 10 min at 4° C. and these clarified crude extracts (supernatant) kept for analyses.
(170) The total protein content of clarified crude extracts was determined by the Bradford assay (Bio-Rad, Hercules, California) using bovine serum albumin as the reference standard. Proteins were separated by SDS-PAGE under reducing conditions using Criterion™ TGX Stain-Free™ precast gels (Bio-Rad Laboratories, Hercules, CA). Proteins were visualized by staining the gels with Coomassie Brilliant Blue. Alternatively, proteins were visualized with Gel Doc™ EZ imaging system (Bio-Rad Laboratories, Hercules, CA) and electrotransferred onto polyvinylene difluoride (PVDF) membranes (Roche Diagnostics Corporation, Indianapolis, Indiana) for immunodetection. Prior to immunoblotting, the membranes were blocked with 5% skim milk and 0.1% Tween-20 in Tris-buffered saline (TBS-T) for 16-18 h at 4° C.
(171) Protein Analysis and Immunoblotting
(172) Immunoblotting was performed with a first incubation with a primary mAb 242P antibody specific to VP1 from GI and GII genotypes, diluted 1/500 in 2% skim milk in TBS-Tween 20 0.1%. Peroxydase-conjugated goat anti-mouse (Jackson Immunoresearch, cat #115-035-146) diluted 1/10000 was used as secondary antibody for chemiluminescence detection, diluted in 2% skim milk in TBS-Tween 20 0.1% Immunoreactive complexes were detected by chemiluminescence using luminol as the substrate (Roche Diagnostics Corporation). Horseradish peroxidase-enzyme conjugation of human IgG antibody was carried out by using the EZ-Link Plus® Activated Peroxidase conjugation kit (Pierce, Rockford, Ill.).
(173) Analysis of VLP Formation/Iodixanol Gradients
(174) Proteins were extracted from frozen biomass by mechanical extraction in a blender with 2 volumes of extraction buffer (100 mM phosphate buffer pH 7.2+150 mM NaCl). The slurry was filtered through a large pore nylon filter to remove large debris and centrifuged 5000 g for 5 min at 4° C. The supernatant was collected and centrifuged again at 5000 g for 30 min (4° C.) to remove additional debris. The supernatant is then loaded on a discontinuous iodixanol density gradient. Analytical density gradient centrifugation was performed as follows: 38 ml tubes containing discontinuous iodixanol density gradient in acetate buffer (1 ml at 45%, 2 ml at 35%, 2 ml at 33%, 2 ml at 31%, 2 ml at 29% and 5 ml at 25% of iodixanol) were prepared and overlaid with 25 ml of the extracts containing the virus-like particles. The gradients were centrifuged at 175,000 g for 4 hours (4° C.). After centrifugation, 1 ml fractions were collected from the bottom to the top and fractions were analyzed by SDS-PAGE combined with protein staining or Western blot.
(175) Electron Microscopy
(176) Following centrifugation of partially clarified plant extracts on discontinuous iodixanol density gradients, as described above, fractions (1 ml/fraction) containing the samples are pooled, mixed with 100 mM PBS pH 7.2+150 mM NaCl buffer to completely fill the tube and centrifuged 120 minutes at 100000 g. The pellets were re-suspended in 300-1000 μl of buffer depending of the VP1 quantity. Protein content was analyzed by BCA.
(177) Carbon-coated copper grids with a 200 nm mesh size. Pooled elution are made hydrophilic by placing the carbon side face up on a Whatman paper in a petri dish and incubated overnight at 4° C. 20 μl of pooled fractions from density gradient centrifugation to be observed by transmission electron microscopy (TEM) are deposited on a Parafilm and grids were floated with the carbon side facing down and incubated at room temperature for 5 minutes. Grids are then washed 4 times on 20 μl water droplet and the excess water from the last wash is drained by touching a Whatman paper with the side of the grid. Grids are then incubated 1 minute on a 20 μl droplet of 2% uranyl acetate in water. Grids are allowed to dry 5 minutes on a Whatman paper. Observation was performed under transmission electron microscopy at magnifications ranging from 10,000× to 150,000×.
Example 3: VP1 Protein and VLP Production in Plants
(178) N. benthamiana leaves were, vacuum infiltrated, as described in Example 2, with Agrobacterium tumefaciens comprising expression vectors encoding wild type norovirus VP1s or modified norovirus VP1 constructs to permit expression of the VP1 sequences, and the leaves examined for VP1 protein and/or VLP production. After 9 days post infiltration (DPI), total crude protein extracts were prepared from leaf homogenates were separated by SDS-PAGE, and stained with Coomassie (VP1 production), or separated using discontinuous iodixanol density gradients as described in Example 2, above (VLP production). Fractions from the density gradients were examined using Coomassie-stained SDS-PAGE. Norovirus VP1 proteins appear at an approximate 55-60 kDa band. The occurrence of the VP1 protein within a fraction of the density gradients is indicative of the fraction(s) to which the VLPs equilibrate during density gradient centrifugation. The yield of VLPs obtained from peak fractions after density gradient centrifugation was also determined.
(179) Wild type GII.4/2015 genotype variant Hu/GII.4_Sydney/2015 VP1 was poorly expressed in plants (
(180) In contrast, modified norovirus VP1 proteins, wherein the GII.4 VP1 protein is substituted, mutated, or modified at any one or more amino acids in sequence alignment, or corresponding, with positions 39, 53, 80, 333 and 368 of norovirus VP1 protein GII.4 (SEQ ID NO:1), resulted in higher yield (
(181) All citations are hereby incorporated by reference.
(182) The present invention has been described with regard to one or more embodiments. However, it will be apparent to persons skilled in the art that a number of variations and modifications can be made to the described subject matter. The scope of the claims should not be limited by the preferred embodiments set forth in the examples but should be given the broadest interpretation consistent with the description as a whole.