METHODS AND COMPOSITIONS
20220010296 · 2022-01-13
Inventors
- Jason Chin (Cambridgeshire, GB)
- Nicolas HUGUENIN-DEZOT (Basel, CH)
- Mohan MAHESH (Cambridgeshire, GB)
- Shan TANG (Cambridgeshire, GB)
- Duy P. NGUYEN (Cambridgeshire, GB)
Cpc classification
C12Y304/22069
CHEMISTRY; METALLURGY
C07D317/62
CHEMISTRY; METALLURGY
C07K2319/60
CHEMISTRY; METALLURGY
C07K11/02
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12P21/02
CHEMISTRY; METALLURGY
International classification
C12N9/00
CHEMISTRY; METALLURGY
C07D317/62
CHEMISTRY; METALLURGY
Abstract
The invention relates to genetic incorporation of 2,3-diamino propionic acid (DAP) into polypeptides, to unnatural amino acids comprising DAP, to a tRNA synthetase for charging tRNA with unnatural amino acids comprising DAP, and to methods of using the resulting polypeptides, for example in capturing substrates and/or intermediates in enzymatic reactions. The invention also relates to compounds of formula (I) or (II): or salts, solvates, tautomers, isomers or mixtures thereof.
##STR00001##
Claims
1. An unnatural amino acid of formula (I) or (H1): ##STR00068## or salts, solvates, tautomers, isomers or mixtures thereof: wherein: R.sub.1 is H, an amino acid residue or a peptide; R.sub.2 is H, C.sub.1-6 alkyl, C.sub.1-6 haloalkyl or C.sub.5-20 aryl. q is 1, 2 or 3; each R.sub.3 or R.sub.4 is independently selected from H, halo, C.sub.1-6 alkyl, C.sub.1-6 haloalkyl, C.sub.5-20, aryl, C.sub.3-20 heteroaryl, OC.sub.1-6 alkyl, SC.sub.1-6 alkyl, NH(C.sub.1-6 alkyl) and N(C.sub.1-6 alkyl).sub.2; X is X.sub.1—Y, S—S—R.sub.5, Se—Se—R.sub.5, O—NH—R.sub.5, S—NH—R.sub.5, Se—NH—R.sub.5, X.sub.2—Y.sub.1, X.sub.3—Y.sub.2, N.sub.3 or NH—S(O).sub.2—Y.sub.3; X.sub.1 is S, Se, O, NH or N(C.sub.1-6 alkyl); X.sub.2 is S, Se or O; X.sub.3 is NH—C(O)—O; X.sub.4 is N H—C(O)—O, O, S or NH; R.sub.5 is selected from H, halo, C.sub.1-6 alkyl, C.sub.1-6 haloalkyl, C.sub.5-20 aryl, C.sub.3-20 heteroaryl, OC.sub.1-6 alkyl, NH(C.sub.1-6 alkyl), N(C.sub.1-6 alkyl).sub.2, peptides, sugars, C.sub.3-20 heterocyclyl and nucleic acids; Y is a protecting group selected from: ##STR00069## R.sub.6 is selected from H, C.sub.1-6 alkyl, C.sub.1-6 haloalkyl, CO.sub.2H, CO.sub.2R′, SO.sub.2H, SO.sub.2R′, C.sub.5-20 aryl, C.sub.3-20 heteroaryl, NHC(O)R′ and NHR′; R.sub.7 and R.sub.8 are independently selected from H, OH, O(C.sub.1-6 alkyl), O(C.sub.5-20 aryl) and O(C.sub.3-20 heteroaryl); or R.sub.7 and R.sub.8 are linked together to form an O—CH.sub.2—O group; each R′ is independently selected from C.sub.1-6 alkyl, C.sub.1-6 haloalkyl and C.sub.5-20 aryl; R.sub.9 is selected from H, C.sub.1-6 alkyl, C.sub.1-6 haloalkyl, CO.sub.2H, CO.sub.2R′, SO.sub.2H, SO.sub.2R′ and C.sub.5-20 aryl; R.sub.10 is selected from H, C.sub.1-6 alkyl and C.sub.1-6 haloalkyl; R.sub.11 is selected from H, C.sub.1-6 alkyl and C.sub.1-6 haloalkyl; X.sub.5 is S, O, NH, N—C(O)—O—R′, N—S(O).sub.2H, N—S(O).sub.2R′ or NR′; Y.sub.1 is a protecting group selected from ##STR00070## Y.sub.2 is a protecting group selected from ##STR00071## t-Bu and CH.sub.2Ph; M.sup.+ is Li.sup.+, Na.sup.+, K.sup.+ or N(R.sub.13).sub.4.sup.+; Z is Si or Ge; R.sub.12 is C.sub.1-6 alkyl or C(O)—(C.sub.5-20 aryl) R.sub.13 is H, C.sub.1-6 alkyl, allyl or C.sub.5-20 aryl; and Y.sub.3 is a protecting group ##STR00072##
2. An unnatural amino acid of formula (I) or (II) according to claim 1, wherein the unnatural amino acid has the following formula: ##STR00073## or salts, solvates, tautomers, isomers or mixtures thereof.
3. An unnatural amino acid of formula (I) according to claim 1, wherein the unnatural amino acid has the following formula: ##STR00074## or salts, solvates, tautomers, isomers or mixtures thereof.
4. An unnatural amino acid of formula (I) or salts, solvates, tautomers, isomers or mixtures thereof according to claim 1, wherein the unnatural amino acid comprises a group Y that is: ##STR00075##
5. An unnatural amino acid of formula (I) according to claim 1, wherein the unnatural amino acid has the following formula: ##STR00076## or salts, solvates, tautomers, isomers or mixtures thereof.
6. An unnatural amino acid of formula (I) or salts, solvates, tautomers, isomers or mixtures thereof according to claim 1, wherein the unnatural amino acid comprises a group Y that is: ##STR00077##
7. An unnatural amino acid of formula (I) or salts, solvates, tautomers, isomers or mixtures thereof according to claim 1, wherein R.sub.6 is selected from H, CH.sub.3, CH.sub.2CH.sub.3, CF.sub.3, CO.sub.2H, CO.sub.2CH.sub.3, CO.sub.2CH.sub.2CH.sub.3 and Ph.
8. An unnatural amino acid of formula (I) or salts, solvates, tautomers, isomers or mixtures thereof according to claim 1, wherein R.sub.6 is CH.sub.3.
9. An unnatural amino acid of formula (I) or salts, solvates, tautomers, isomers or mixtures thereof according to claim 1, wherein Y is: ##STR00078##
10. An unnatural amino acid of formula (I) according to claim 1, wherein the unnatural amino acid has the following formula: ##STR00079## or salts, solvates, tautomers, isomers or mixtures thereof.
11. A polypeptide comprising an unnatural amino acid according to claim 1 wherein said unnatural amino acid is attached to said polypeptide via a peptide bond.
12. A method of preparing a polypeptide comprising DAP, the method comprising deprotecting a polypeptide according to claim 11.
13. A method according to claim 12 wherein said deprotecting comprises illumination at 365 nm, 35 mWcm.sup.−2, for 1 minute.
14. A PylRS tRNA synthetase comprising the mutations Y271C, N311Q, Y349F and V366C.
15. A PylRS tRNA synthetase according to claim 14 which is a Methanosarcina barkerii PylRS (MbPylRS) tRNA synthetase comprising said mutations.
16. A method of producing a polypeptide comprising 2,3-diamino propionic acid (DAP), said method comprising genetically incorporating an unnatural amino acid according to claim 1 into a polypeptide, and optionally deprotecting said unnatural amino acid to 2,3-diamino propionic acid (DAP).
17. The method of claim 16 comprising (i) providing a nucleic acid encoding the polypeptide which nucleic acid comprises an orthogonal codon encoding the unnatural amino acid; (ii) translating said nucleic acid in the presence of an orthogonal tRNA synthetase/tRNA pair capable of recognising said orthogonal codon and incorporating said unnatural amino acid into the polypeptide chain.
18. A method according to claim 17 wherein said orthogonal codon comprises an amber codon (AG), said tRNA comprises MbtRNA.sub.CUA, and said tRNA synthetase comprises a MbPylRS synthetase having the mutations Y271C, N311Q, Y349F and V366C.
19. A method according to claim 16 wherein said unnatural amino acid comprises ##STR00080##
20. A method according to claim 16, wherein said method is carried out inside a live cell.
21. A method according to claim 20, wherein said live cell comprises an E. coli cell such as a BL21 DE3 E. coli cell,
22. A method according to claim 20, wherein said live cell comprises a mammalian cell such as a HEK293T cell.
23. A polypeptide according to claim 11, wherein said polypeptide is an enzyme, and wherein said unnatural amino acid is incorporated at a position corresponding to an amino acid residue within the active site of said enzyme.
24. A polypeptide according to claim 23 wherein said enzyme is an EC 3.4 peptidase, an EC 3.4.22.44 peptidase, or an EC 2.3.2.23 E2 ubiquitin-conjugating enzyme, according to the International Nomenclature and Classification of Enzymes.
25. A polypeptide according to claim 11 which comprises one to twenty 2,3-diamino propionic acid (DAP) groups.
26. A polypeptide according to claim 25 which comprises a single 2,3-diamino propionic acid (DAP) group.
27. A polypeptide according to claim 11, wherein said unnatural amino acid is incorporated at a position corresponding to a cysteine, serine or threonine residue in the wild type polypeptide, optionally at a position corresponding to a cysteine or serine residue in the wild type polypeptide.
28. Use of an unnatural amino acid according to claim 1 in the production of a polypeptide comprising 2,3-diamino propionic acid (DAP).
29. Use of an unnatural amino acid according to claim 1 in the production of a polypeptide comprising 2,3-diamino propionic acid (DAP), wherein production of the polypeptide comprises deprotecting a polypeptide comprising said unnatural amino acid attached via a peptide bond.
30. A method of capturing a substrate for an enzyme, the method comprising a) providing an enzyme comprising at least one 2,3-diamino propionic acid (DAP) group in its active site, b) contacting said enzyme with candidate substrate(s) for said enzyme, and c) incubating to allow reaction of said DAP group with said candidate substrate(s).
31. A method according to claim 30 wherein said substrate is a metabolite.
32. A method according to claim 30 wherein said enzyme is a peptidase or a ubiquitin-conjugating enzyme or a hydrolase or an enzyme forming carbon-sulphur bonds.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0357] Embodiments of the present invention will now be described further, with reference to the accompanying drawings, in which:
[0358]
[0359]
[0360]
[0361]
[0362]
[0363] Extracted ion chromatograms (EICs) from HR-LC-ESI-MS of reactions of tetradepsipeptidyl-SNAC 7 (1.7 mM) and Vlm TE (6.5 μM). a, TE.sub.wt produces valinomycin as its major product. The presence of octadepsipeptidyl-SNAC 11, dodecadepsipeptidyl-SNAC 15 and 16-mer depsipeptidyl-SNAC 19 confirm the oligomerization scenario in Supplementary
[0364]
[0365] a, Representative electron density for TE.sub.wt (2mFo-DFc map contoured at 1.0 σ). b, The structure of TE.sub.wt. The lid (grey) is nearly completely ordered but has higher B factors than the core of the protein. Deconvoluted mass spectra of c, TE.sub.DAP. d, TE.sub.DAP incubated with deoxy-tetradepsipeptidyl-SNAC 8. e, TE.sub.DAP incubated with valinomycin. f and g, Unbiased mFo-DFc electron density map (green mesh, 2.5 σ) for depsipeptide residues of tetradepsipeptidyl-TE.sub.DAP (f) and dodecadepsipeptidyl-TE.sub.DAP (g). An amide bond links diaminopropionic acid (DAP, brown sticks) and depsipeptide residues (cyan sticks). h and i, The active site of tetradepsipeptidyl-TE.sub.DAP (h) and dodecadepsipeptidyl-TE.sub.DAP (i) complexes. The carbonyl oxygen of the amide formed by DAP and val4 (h) or val12 (i) is positioned close to the oxyanion hole formed by the main chain amine of A2399 and L2464. The catalytic triad residues H2625 and D2490 are shown in sticks. j, The lid of tetradepsipeptidyl-TE.sub.DAP is in a similar position to that seen in TE.sub.q, while k, all crystallographically independent molecules of the dodecadepsipeptidyl-TE.sub.DAP (from P1 and H3 space group structures) are in a set of similar conformations, distinct from that seen in TE.sub.wt. l, An illustration of the substantial conformational change in lid helixes Lα1-Lα4 between structures of tetradepsipeptidyl-TE.sub.DAP and dodecadepsipeptidyl-TE.sub.DAP. The mobile helices are shown in colours of progressively higher wavelengths for clarity.
[0366]
[0367] a, Superimposition of dodecadepsipeptidyl-TE.sub.DAP with the structure of EntF PCP-TE didomain.sup.46 shows the path of the PPE moiety to the active site. b, The lid sterically prevents the dodecadepsipeptide from extending out in a linear fashion, and favours curling back through this steric block and largely hydrophobic, non-specific interactions between lid and dodecadepsipeptide. c, Hypothetical pathway for oligomerization and cyclization, starting from octadepsipeptidyl-TE. i, The position of Lai in observed apo/tetradepsipeptide conformation promotes an extended peptide conformation. ii, The tetradepsipeptidyl-PCP accepts the octadepsipeptide onto its terminal hydroxyl, perhaps using a dodecadepsipeptide-like lid conformation which could accommodate the ˜30 Å tetradepsipeptidyl-PPE bound to the PCP domain and guide it towards the active site. iii, The PCP domain presents the thioester for transfer back to the Ser2463. iv, Finally, the lid conformation observed in the dodecadepsipeptide-TE.sub.DAP structures could help curl the dodecadepsipeptide back towards Ser2463 for cyclization.
[0368]
[0369]
[0370]
[0371]
[0372]
[0373]
[0374]
[0375]
[0376]
[0377]
[0378]
[0379]
[0380]
[0381]
[0382]
[0383]
[0384]
[0385]
EXAMPLES: GENETICALLY ENCODING DAP DERIVATIVES IN RECOMBINANT PROTEINS
Example 1
[0386] The inventors reasoned that the structural similarity of DAP to cysteine and serine, which are constitutively present in the cell, suggests that it may be challenging to discover an aminoacyl-tRNA synthetase that selectively incorporates DAP. We therefore designed and synthesized (
[0387] Compounds 3 and 4 contain a conservative SH to NH.sub.2 substitution relative to photocaged cysteine derivatives that we have previously incorporated into proteins using the PCC1RS/tRNA.sub.CUA and PCC2RS/tRNA.sub.CUA pairs, respectively.sup.32. (These pairs were derived from the pyrrolysyl-tRNA synthetase/tRNA.sub.CUA pair). This similarity suggested that these pairs might direct the incorporation of 3 or 4 in response to the amber codon. However, we found that these pairs did not function to supress amber codons in reporter genes when cells were provided with 3 or 4 and the relevant pair.
[0388] In an effort to discover orthogonal aminoacyl-tRNA synthetases that incorporate amino acids 2-5, we interrogated five variant libraries (Susani, Susan2.sup.32, Susan4, PylS fwd.sup.33 and D3 (Supplementary Table 1)) of the MbPylRS/tRNA.sub.CUA pair. These libraries randomize residues in the active site of the synthetase, and were previously generated to enable ncAA incorporation. The Susan2 library has previously been used to discover synthetases for photocaged derivatives of cysteine.sup.32. We subjected each library to two rounds of serial positive selections in the presence of each ncAA and one round of negative selections in the absence of ncAA.sup.34-36. However, we did not discover a synthetase/tRNA pair for compounds 2-5 from these selections.
[0389] Examination of the predicted log P values for compounds 2-5 revealed that they are quite hydrophilic; prompting us to examine whether they enter cells. Using an LC-MS based amino acid uptake assay.sup.37 we did not detect substantial quantities of amino acids 2-5 in cells, and our data suggest that the intracellular concentrations of compounds 2-5 are substantially below 10 μM (
Example 2: Preferred Unnatural Amino Acid Comprising DAP
[0390] To address the challenge of encoding a protected version of DAP, the inventors designed and synthesized amino acid 6 (Supplementary
Example 3: Creation of DAP tRNA Synthetase (‘DAPRS’)
[0391] In light of the failure of numerous earlier approaches, the inventors devised and created a completely new library, DAPRSlib, in which positions to be randomised were carefully chosen based on a model of 6 in the active site of PylRS (Supplementary
[0392] As a result of this intellectual exercise, decisions were made that five positions (Y271; N311; Y349; V366; W382) were randomised to all twenty canonical amino acids, leading to a theoretical library diversity of 3.4×10.sup.7 different sequences. We subjected DAPRSlib to three rounds of serial positive and negative selection.sup.34 in the presence and absence of 6. Following this selection, we screened 96 clones in cells containing a cat(112TAG) reporter.
[0393] We obtained a single clone that conferred high levels of chloramphenicol resistance in the presence of 6 and minimal chloramphenicol resistance in the absence of 6 (
[0394] The selected synthetase contains four active-site mutations (Y271C, N311Q, Y349F and V366C) with respect to MbPylRS.
[0395] (It may be noted that the library contained randomised 5 positions but only 4 mutations are present in DAPRS—the 5th position is wild-type (i.e. W382) in DAPRS.)
Example 4: Incorporation of Unnatural Amino Acid Comprising DAP into a Polypeptide
[0396] To further characterize the genetically directed, site-specific incorporation of 6 into a protein, superfolder green fluorescent protein (sfGFP) containing an amber stop codon (TAG) at position 150 (sfGFP(150TAG)His6) was expressed in the presence of DAPRS/tRNA.sup.Pyl.sub.CUA and 1 mM 6, and purified by Ni-NTA affinity chromatography (
[0397] The yield of GFP incorporating 6 (GFP(6)), was comparable to that for BocK incorporation, demonstrating the efficiency of the DAPRS/tRNA.sup.pyl.sub.CUA pair. Electrospray ionization mass spectrometry (ESI-MS) confirms that the DAPRS/tRNA.sup.Pyl.sub.CUA pair directs the incorporation of 6 into proteins in response to the amber codon (
Example 5: Deprotection of Amino Acid Comprising DAP
[0398] Here we demonstrate deprotection of the amino acid comprising DAP, leaving the DAP group in the polypeptide backbone, thereby resulting in a polypeptide comprising DAP.
[0399] We anticipated that illumination of proteins incorporating amino acid 6 with 365 nm light would reveal a sulfhydryl group containing intermediate, that may undergo further reactions that lead to DAP (either through 5 exo-trig cyclization of the sulfhydryl group onto the carbonyl of the carbamate and collapse of the resulting tetrahedral intermediate to release the amino group, or through formation of the episulfide and carbon dioxide to release the amino group). Indeed, illumination of GFP(6) (365 nm, 35 mWcm.sup.−2, 1 min) led to complete deprotection of 6 to the expected sulfhydryl (
Example 6: Stably Trapping a Cysteine Protease Acyl-Enzyme Intermediate
[0400] Cysteine proteases like the tobacco etch virus (TEV) protease commonly contain a Cys-His-Asp catalytic triad and generate a thioester intermediate upon treatment with their cognate substrates.sup.5, 39. We thus aimed to replace the active site cysteine of the TEV protease with DAP and trap the acyl-enzyme intermediate. E. coli provided with 0.1 mM 6 and expressing His6-Lipoyl-TEV(151TAG)-Strep, and the DAPRS/tRNA.sup.Pyl.sub.CUA pair were used to produce TEV.sub.Cys1516 protease, in which 6 replaces the catalytic cysteine in the active site. The protein was purified by tandem affinity chromatography with a yield of ˜0.1 mg per litre of culture, and ESI-MS confirmed the incorporation of 6 at the genetically encoded site. Photodeprotection quantitatively converted encoded 6 to the sulfhydryl intermediate, and approximately 70% of the protein was subsequently completely deprotected to reveal amino acid 1 at position 151 of TEV (TEV.sub.DAP), as judged by ESI-MS (Supplementary
[0401] To demonstrate that replacing the catalytic cysteine with DAP enables the capture of a covalent protease-substrate intermediate, we incubated TEV.sub.DAP with a model substrate, Ub-tev-His6 (in which the TEV cleavage site (tev) is flanked by ubiquitin and the hexahistidine tag) and resolved the protein species by SDS-PAGE. We observed the formation of a new band that migrated more slowly than TEV.sub.DAP, and did not observe free ubiquitin, which would have been generated by cleavage of the tev site (
Example 7: Activity and Synthetic Pathway of Vlm TE
[0402] To gain insight into TE domain function and to prepare it for use with the DAP incorporation system, we cloned and expressed Vlm TE, and purified the resulting Vlm TE (TE.sub.wt, wild type) protein for biochemical and structural studies. The native substrate of TE domains is the peptide intermediate linked by thioester to the phosphopantetheine-PCP (peptidyl-PCP). In NRPS TE domains, including those from gramicidin S, surfactin and fengycin synthetasesis.sup.18, 27,28, the PCP-linked substrates can be mimicked by a small molecule in which the peptide intermediate is linked by a thioester to N-acetylcysteine (peptidyl-SNAC). We synthesized the SNAC derivative of the native peptide, D-hiv-D-val-L-lac-L-val-SNAC (tetradepsipeptidyl-SNAC 7, Supplementary
[0403] The synthetic intermediates detected in valinomycin synthesis reveal the oligomerization pathway catalyzed by Vlm TE.sub.wt, differentiating between two possible pathways (Supplementary
Example 8: Visualizing Key Intermediates in TE Domain-Mediated Valinomycin Synthesis
[0404] We next obtained and optimized crystallization conditions for robust and repeatable growth of TE.sub.wt, and determined its structure (
[0405] Incubation of Vlm TE with depsipeptidyl-SNAC molecules did not yield stable conjugates (Supplementary
[0406] To enable the visualization of acyl-enzyme complexes of Vlm TE, we produced Vlm TE in which the active site serine 2463 was replaced by DAP (TE.sub.DAP). Expression of Vlm2TE(2463TAG) in E. coli containing a DAPRS/tRNA.sub.CUA pair and supplemented with 0.1 mM 6 enabled the purification of Vlm TE in which serine 2463 is replaced by 6, with a yield of ˜0.1-0.5 mg per litre of culture. Deprotection of 6 led to quantitative production of TE.sub.DAP (
[0407] To provide insight into the first acyl-TE intermediate in the catalytic cycle of Vlm TE, we captured a tetradepsipeptidyl-N-TE.sub.DAP conjugate. Incubation of TE.sub.DAP with tetradepsipeptidyl-SNAC 7 led to production of a stable depsipeptidyl-TE.sub.DAP intermediate at >60% yield (Supplementary
[0408] We hypothesized that TE.sub.DAP-catalyzed attack of the hydroxyl group of the tetradepsipeptidyl-SNAC 7 on the tetradepsipeptidyl-N-TE.sub.DAP conjugate might contribute to the observed non-quantitative yield of the conjugate. Therefore, we optimized conditions for conjugating deoxy-tetradepsipeptidyl-SNAC 8 with TE.sub.DAP, which produced (˜70%) the deoxy-depsipeptidyl-TE.sub.DAP conjugate (
[0409] To determine the structure of the deoxy-tetradepsipeptidyl-N-TE.sub.DAP conjugate, we incubated pre-formed TE.sub.DAP crystals with the deoxy-tetradepsipeptidyl-SNAC 8 substrate analogue. The resulting electron density shows somewhat weak, but unambiguous density for an amide bond between residue DAP2463 and L-val4 of the deoxy-tetradepsipeptide (
[0410] Next, we focused on gaining insight into the last acyl-TE intermediate in the catalytic cycle of Vlm TE by capturing a dodecadepsipeptidyl-N-TE.sub.DAP conjugate. We reasoned that incubation of valinomycin and TE.sub.DAP might lead to dodecadepsipeptidyl-N-TE.sub.DAP through a reaction analogous to the reverse of cyclisation, and that this conjugate would be thermodynamically favoured by virtue of the amide bond. Indeed, under optimized conditions we observed dodecadepsipeptidyl-N-TE.sub.DAP conjugate formation in ˜65-100% yield (
[0411] All eight crystallographically independent molecules of dodecadepsipeptidyl-TE.sub.DAP showed some density for the dodecadepsipeptide. Molecules P1_A-F and H3_A-B show strong density for 4, 3, 2, 2, 2, 2, 3 and 1 dodecadepsipeptide residues respectively (Supplementary
[0412] Comparing the position of the Vlm TE lid in the apo/tetradepsipeptide-bound structures with the position of the lid in the dodecadepsipeptide-bound structures demonstrates and emphasizes its extreme mobility. To transition from one lid conformation to the other, helices Lα5-6 maintain their position, Lα3-4 rotate ˜45° and translocate ˜13 Å, Lα2 translocates ˜25 Å, and Lα1 shortens, translocates ˜13 Å, and rotates >90° in the opposite direction to Lα3-4 (
[0413] The distinct lid conformations directly influence the possible location of the depsipeptide. In the apo/tetradepsipeptide-bound conformation of the lid, the C-terminus of helix Lα1 comes within 10 Å of Ser/DAP2463, leading the tetradepsipeptide to extend towards the TE core helix αE. In the dodecadepsipeptide-bound conformations of the lid, the loop adjacent to Lai blocks the location occupied by the tetradepsipeptide in the tetradepsipeptide-bound structure. Moreover, in the dodecadepsipeptide-bound structure the N-terminus of Lai forms part of the semi-sphere-like pocket, which likely helps curl the dodecadepsipeptide back towards Ser/DAP2463 during the cyclization step.
[0414] The models and structure factors for the crystal structures are deposited in at the Protein Data Bank with accession numbers 6ECB, 6ECC, 6ECD, 6ECE and 6ECF.
[0415] Methods
[0416] General Synthetic Procedures.
[0417] All reagents were purchased from Sigma-Aldrich with the following exceptions: L-lactic acid was purchased from Fisher Scientific, EDC was purchased from Oakwood Chemicals (Estill, S.C.) at the highest available purity and used without further purification. Valinomycin was purchased from Sigma-Aldrich and BioShop Canada. All solvents were purchased from Fisher Scientific. All reactions were conducted using dry solvents under an argon atmosphere unless otherwise noted. NMR spectroscopy was performed with a Bruker AVANCE II, operating at 400 MHz for .sup.1H spectra, and 100 MHz for .sup.13C spectra and a Bruker AVANCE 300, operating at 300 MHz for .sup.1H spectra, and 75 MHz for .sup.13C spectra. High-resolution mass spectroscopy (HRMS) was conducted on a Micromass Q-TOF I for ESI measurements (John L. Holmes Mass Spectroscopy Facility).
[0418] Abbreviations: M=Molarity; conc.=concentrated; mol=moles; mmol=millimoles; 20° C.=degree Celcius; eq.=equivalents; h=hour; min=minutes; r.t.=room temperature; cat.=catalytic, aq.=aqueous; Su=succinimidyl; DIPEA=diisopropylethylamine; atm=atmosphere, Boc=tert-butoxycarbonyl; .sup.tBu=tert-butyl; Et=ethyl; Ph=phenyl; TFA=trifluoroacetic acid; THF=tetrahydrofuran; LC-MS=liquid chromatography-mass spectrometry; ELS=evaporative light scattering.
[0419] Synthesis of Amino Acids
[0420] The general synthetic scheme for preparation of amino acids is shown below, the reagents and conditions used are as follows:
##STR00034## ##STR00035##
(S)-3-{[(Allyloxy)carbonyl]amino}-2-aminopropanoic acid (2)
[0421] ##STR00036##
[0422] Boc-Dap(Alloc)-OH 2a (4.325 g, 15.0 mmol, 1.0 eq., procured from Bachem Ltd.) was loaded onto a dry 250 mL single-necked round-bottomed flask and dissolved in HCl (4M in 1,4-dioxane, 60.0 mL, 240.0 mmol, 16.0 eq.). Dry Et.sub.3SiH (10.0 mL, 62.6075 mmol, 4.174 eq.) was added to the solution at r.t. and a faint white precipitate appeared immediately, which intensified with time upon stirring at r.t. under a nitrogen atmosphere. After 24 h, an intense white precipitate was observed and the reaction was judged to be complete by LC-MS analysis (C18 reverse phase column, H.sub.2O—CH.sub.3CN as mobile phase, gradient). The mixture was then evaporated under reduced pressure and the product was dissolved in dry CH.sub.3OH (100 mL) followed by evaporation to dryness under reduced pressure. This was repeated thrice to remove bulk of 1,4-dioxane by azeotropic evaporation. The residue was re-dissolved in dry CH.sub.3OH (10 mL) and triturated with dry Et.sub.2O (500 mL) to precipitate the product. This was filtered and washed with further Et.sub.2O (2×125 mL) and dried in high vacuum (<0.1 mbar) overnight to obtain (S)-3-{[(allyloxy)carbonyl]amino}-2-aminopropanoic acid HCl salt 2 as a bright white powder (3.03 g, 90%); .sup.1H NMR (400.13 MHz, DMSO-d.sub.6) δ3.42-3.56 (m, 2H), 4.48 (d, J=5.3 Hz, 2H), 5.15-5.36 (m, 2H), 5.80-5.98 (m, 1H), 7.44-7.60 (m, 1H), 8.24-8.70 (broad s, 3H); .sup.13C NMR (100.61 MHz, DMSO-d.sub.6) δ40.4 (CH.sub.2), 52.4 (CH), 64.7 (CH.sub.2), 117.2 (CH.sub.2), 133.4 (CH), 156.2 (C), 169.1 (C); MS (ESI+) m/z (rel intensity) 189 [(M+H).sup.+, 100], 134 (4), 81 (9); HRMS (ESI+) m/z calc'd for C.sub.7H.sub.13O.sub.4N.sub.2 [M+H].sup.+: 189.0870, found 189.0866 (Δ=−2.19 ppm).
tert-Butyl (S)-2-[(tert-butoxycarbonyl)amino]-3-[(2-nitrobenzyl)amino]propanoate (3a)
[0423] ##STR00037##
[0424] Boc-L-Dap-O.sup.tBu-HCl 1b (5.0 g, 19.206 mmol, 1.0 eq.) was loaded into a dry 500 mL 2-neck round-bottomed flask and dry THF (75 mL) was added to it, followed by dry DIPEA (6.69 mL, 38.412 mmol, 2.0 eq.). The contents were left stirring under an argon atmosphere at 0° C. 2-nitrobenzyl bromide (4.979 g, 23.048 mmol, 1.2 eq.) was loaded on to a separate 250 mL dry single-neck round bottomed flask, dissolved in dry THF (125 mL), and the resulting solution then transferred to the main flask containing Boc-L-Dap-O.sup.tBu by cannula under a positive pressure of argon over 5 min at 0° C. The mixture was then warmed to r.t. and left stirring at r.t. for 10 h. The reaction mixture was then concentrated under reduced pressure and the crude mixture extracted with EtOAc (200 mL) and washed with brine solution (3×250 mL). The organic layer was separated, dried over anhydrous Na.sub.2SO.sub.4, filtered and evaporated to dryness to obtain a brown viscous oil. Product was purified by flash chromatography on SiO.sub.2 (gradient; eluent: EtOAc/n-hexane=1:9.fwdarw.1:4) to obtain the desired product, tert-butyl (S)-2-[(tert-butoxycarbonyl)amino]-3-[(2-nitrobenzyl)amino]propanoate 3a as a faint yellow viscous oil (5.05 g, 67%): R.sub.f=0.27 (SiO.sub.2 plate, EtOAc/n-hexane=1:4); .sup.1H NMR (400.13 MHz, CDCl.sub.3 with TMS as internal standard) δ 1.44 (s, 9H), 1.46 (s, 9H), 2.85-3.40 (m, 2H), 4.02 (d, J=14.5 Hz, 1H), 4.07 (d, J=14.5 Hz, 1H), 4.22-4.35 (m, 1H), 5.20-5.55 (m, 1H), 7.41 (ddd, J=8.4, 8.4, 2.0 Hz, 1H), 7.50-7.67 (m, 2H), 7.94 (d, J=8.0 Hz, 1H); .sup.13C NMR (100.61 MHz, CDCl.sub.3 with TMS as internal standard) δ28.1 (CH.sub.3), 28.5 (CH.sub.3), 50.7 (CH.sub.2), 50.9 (CH.sub.2), 54.4 (CH), 79.9 (C), 82.3 (C), 124.9 (CH), 128.2 (CH), 131.3 (CH), 133.3 (CH), 135.5 (C), 149.2 (C), 155.7 (C), 170.9 (C).
(S)-2-Amino-3-[(2-nitrobenzyl)amino]propanoic acid 3
[0425] ##STR00038##
[0426] A 100 mL dry single necked round-bottomed flask was charged with tert-butyl (S)-2-[(tert-butoxycarbonyl)amino]-3-[(2-nitrobenzyl)amino]propanoate 3a (4.59 g, 11.607 mmol, 1.0 eq.). HCl (25 mL, 4 M in 1,4-dioxane, 100.0 mmol, 8.615 eq.) was added, followed by dry Et.sub.3SiH (5.0 mL, 31.304 mmol, 2.697 eq.). The contents were stirred in the dark under an argon atmosphere. The progress of the reaction was periodically monitored by TLC analysis (SiO.sub.2 plate, EtOAc/n-hexane=3:7). After 48 h, an intense white precipitate was formed and the reaction was judged to be complete by TLC and LC-MS analysis (C18 reverse phase column, H.sub.2O—CH.sub.3CN as mobile phase, gradient). The contents were evaporated to dryness under reduced pressure. Remaining 1,4-dioxane was removed by azeotropic evaporation 3× dry CH.sub.3OH (25 mL). The contents were then re-dissolved in dry CH.sub.3OH (25 mL), cooled to 0° C., triturated with dry Et.sub.2O (400 mL) and vigorously stirred in the dark at room temperature to obtain an intense precipitate. The precipitate was filtered, washed with further dry Et.sub.2O (150 mL), followed by dry n-hexane (50 mL), and then evaporated to dryness under high vacuum (<0.1 mbar) for 14 h in dark to obtain the desired product, (S)-2-amino-3-[(2-nitrobenzyl)amino]propanoic acid HCl salt 3, as an off-white powder (3.575 g, 99%): .sup.1H NMR (400.13 MHz, CD.sub.3OD) δ3.68 (dd, J=13.2, 5.6 Hz, 1H), 3.81 (dd, J=13.2, 7.7 Hz, 1H); 4.48 (dd, J=7.7, 5.6 Hz, 1H), 4.65 (d, J=13.2 Hz, 1H), 4.69 (d, J=13.2 Hz, 1H), 7.74-7.82 (m, 1H), 7.84-7.95 (m, 2H), 8.30 (app. d, J=8.1 Hz, 1H); .sup.13C NMR (100.61 MHz, CD.sub.3OD) δ47.8 (CH.sub.2), 50.2 (CH), 50.7 (CH.sub.2), 127.1 (CH), 127.3 (C), 132.8 (CH), 135.3 (CH), 136.0 (CH), 150.3 (C), 169.0 (C); MS (ESI+, LC-MS) m/z (rel intensity) 240 [(M+H).sup.+, 100%].
4′,5′-Methylenedioxy-2′-nitroacetophenone (4b)
[0427] ##STR00039##
[0428] Following a slightly modified procedure described by McGall et al..sup.50, a solution of 3′,4′-(methylenedioxy)acetophenone 4a (16.416 g, 0.1 mol) in glacial CH.sub.3COOH (64 mL) was added drop-wise to a 2 litre three-necked round-bottomed flask containing conc. HNO.sub.3 (136 mL, 70% strength) at 0° C. over 1 h. The reaction mixture was maintained at 0° C. during addition and for a further 1 h with stirring under an argon atmosphere. The mixture was then warmed to 40° C. and stirred for additional 2.5 h. Finally, the mixture was cooled to r.t. and poured slowly into crushed ice (1 litre) in a beaker. A yellow precipitate appeared which was stirred for 15 min and then filtered. The yellow solid was washed with water (3×200 mL) and dried in vacuum. The crude yellow solid was then purified by recrystallization (THF/n-hexane) and then by flash chromatography on SiO.sub.2 [eluent: CH.sub.2Cl.sub.2/n-hexane (1:1) to 100% CH.sub.2Cl.sub.2] to obtain 4′,5′-methylenedioxy-2′-nitroacetophenone.sup.32,50,51 4b as yellow crystals (12.141 g, 58%): R.sub.f=0.52 (CH.sub.2Cl.sub.2); m.p. 122.8-124.0° C. (.sup.51 m.p. 112° C.); .sup.1H NMR (400.13 MHz, CDCl.sub.3) δ2.45 (s, 3H), 6.16 (s, 2H), 6.71 (s, 1H), 7.48 (s, 1H); .sup.13C NMR (100.61 MHz, CDCl.sub.3) δ30.2 (CH.sub.3), 103.8 (CH.sub.2), 104.8 (CH), 106.2 (CH), 135.1 (C), 140.1 (C), 148.9 (C), 152.8 (C), 199.3 (C); IR (CH.sub.2Cl.sub.2) v.sub.max 2980, 1708, 1525, 1506, 1484, 1424, 1362, 1338, 1271, 1152, 1038, 932, 875, 819 cm.sup.−1; MS (ESI+) m/z (rel intensity) 232 [(M+Na).sup.+, 10%], 210 (2), 209 (7), 194 (100), 171 (45), 130 (32), 111 (9).
(R,S)-1-[4′,5′-(Methylenedioxy)-2′-nitrophenyl]ethanol (4c)
[0429] ##STR00040##
[0430] 4′,5′-Methylenedioxy-2′-nitroacetophenone 4b (43.714 g, 0.209 mol, 1.0 eq.) was suspended in CH.sub.2Cl.sub.2 (400 mL), CH.sub.3OH (650 mL) and absolute CH.sub.3CH.sub.2OH (425 mL) in a 2 litre, single-necked, round-bottomed flask. The mixture was sonicated for 10 min at r.t. to dissolve the majority of the yellow solid. NaBH.sub.4 granules (7.116 g, 0.188 mol, 0.9 eq.) were added in 8 portions (each 0.890 g) to the yellow suspension every 15 min (total time=2 h addition) at 15° C., NOTE: effervescence appeared as NaBH.sub.4 dissolved and the reaction mixture became a homogeneous yellow solution. After the addition was complete, the reaction mixture was stirred at r.t. for a further 4 h. After this time the reaction was judged complete by TLC analysis (SiO.sub.2, TLC eluent: 100% CH.sub.2Cl.sub.2), and the reaction quenched by addition of dry acetone (100 mL) stirring at r.t. for a further 2 h. The mixture was then evaporated to dryness under reduced pressure to obtain a yellow solid. The solid was subsequently re-dissolved in CH.sub.2Cl.sub.2 (800 mL) and washed sequentially with saturated aq. NH.sub.4Cl solution (3×500 mL) and finally with saturated aq. NaCl solution (6×800 mL) The organic layer was separated, dried over anhydrous Na.sub.2SO.sub.4, filtered, and evaporated to dryness in high vacuum to obtain (R,S)-1-[4′,5′-(methylenedioxy)-2′-nitrophenyl]ethanol.sup.32,50 4c as a yellow solid (43.563 g, 99%): R.sub.f=0.19 (CH.sub.2Cl.sub.2); m.p. 76.5-77.5° C.; .sup.1H NMR (400.13 MHz, CDCl.sub.3) δ 1.50 (d, J=6.3 Hz, 3H), 2.54 (d, J=3.0 Hz, 1H), 5.42 (qd, J=6.3, 3.0 Hz, 2H), 6.096 (app. d, .sup.2J.sub.HH=3.5 Hz, 1H, diastereotopic OCH.sub.2O), 6.104 (app. d, .sup.2J.sub.HH=3.5 Hz, 1H, diastereotopic OCH.sub.2O), 7.24 (s, 1H), 7.42 (s, 1H); .sup.13C NMR (100.61 MHz, CDCl.sub.3) δ24.3 (CH.sub.3), 65.8 (CH), 103.1 (CH.sub.2), 105.2 (CH), 106.4 (CH), 139.2 (C), 141.5 (C), 147.0 (C), 152.5 (C); IR (CH.sub.2Cl.sub.2) v.sub.max 3649, 2980, 2889, 2360, 2343, 1521, 1506, 1482, 1393, 1340, 1253, 1135, 1090, 1038, 934, 819 cm.sup.−1; MS (ESI+) m/z (rel intensity) 234 [(M+Na).sup.+, 1%], 194 [(M-OH).sup.+, 100], 130 (20); HRMS (ESI+) m/z calc'd for C.sub.9H9NO.sub.5 [M+Na].sup.+: 234.0373, found 234.0364 (Δ=−3.95 ppm).
(R,S)-1-Bromo-1-[4′,5′-(methylenedioxy)-2′-nitrophenyl]ethane (4d)
[0431] ##STR00041##
[0432] A 1 litre, 3-necked round-bottomed flask was dried in vacuo for 15 min at >100° C. using a heat gun and purged with dry argon gas and allowed to cool to room temperature. To this was added (R,S)-1-[4′,5′-(methylenedioxy)-2′-nitrophenyl]ethanol, 4c (15.838 g, 75.0 mmol, 1.0 eq.). 4c was dissolved in dry CH.sub.2Cl.sub.2 (375 mL, sonication required for complete solubility), cooled to 0° C. under an argon atmosphere, and the round-bottomed flask was wrapped with aluminium foil to shield it from light. After 20 min, PBr.sub.3 (2.82 mL, 30.0 mmol, 0.4 eq.) was added dropwise for 10 min using a syringe pump at 0° C., followed by addition of dry pyridine (0.5 mL). The yellow reaction mixture was stirred at 0° C. for 15 min, then brought to r.t. and stirred continuously for 1.5 h. The reaction was judged to be complete by TLC analysis (SiO.sub.2, TLC eluent: 100% CH.sub.2Cl.sub.2), cooled to 0° C., quenched by the addition of dry CH.sub.3OH (15 mL), warmed to r.t. and stirred for 30 min under an argon atmosphere. After the quenching was complete, the reaction mixture was evaporated to dryness under reduced pressure using a rotary evaporator. The resulting yellow gum was dissolved in CH.sub.2Cl.sub.2 (300 mL) and saturated aq. NaHCO.sub.3 solution (300 mL). The contents were loaded into a separating funnel, the aqueous phase was discarded and the organic phase was washed sequentially with further saturated aq. NaHCO.sub.3 solution (1×300 mL) and saturated aq. NaCl solution (3 30×300 mL). The organic layer was separated, dried over anhydrous Na.sub.2SO.sub.4, filtered and evaporated to dryness to obtain a yellow solid. The crude product was purified by flash chromatography on SiO.sub.2 [eluent: CH.sub.2Cl.sub.2/n-hexane (1:1), then 100% CH.sub.2Cl.sub.2] to obtain a pure sample of (R,S)-1-bromo-1-[4′,5′-(methylenedioxy)-2′-nitrophenyl]ethane.sup.32 4d (18.330 g, 89%) as shining yellow crystals. The sample was stored in a freezer at −20° C. in a dry atmosphere and in the dark for several months without any significant decomposition: R.sub.f=0.17 (CH.sub.2Cl.sub.2/n-hexane, 1:4); m.p. 76.1-77.8° C.; .sup.1H NMR (400.13 MHz, CDCl.sub.3) δ 2.04 (d, J=6.8 Hz, 3H), 5.89 (q, J=6.8 Hz, 1H), 6.13 (s, 2H), 7.27 (s, 1H), 7.35 (s, 1H); .sup.13C NMR (100.61 MHz, CDCl.sub.3) δ27.6 (CH.sub.3), 42.9 (CH), 103.3 (CH.sub.2), 105.1 (CH), 108.8 (CH), 134.8 (C), 141.6 (C), 147.7 (C), 152.1 (C); IR (CH.sub.2Cl.sub.2) v.sub.max 2981, 2970, 2930, 1615, 1504, 1481, 1420, 1395, 1385, 1328, 1305, 1257, 1156, 1141, 1057, 1028, 1014, 957, 925, 872, 815, 752, 730, 719, 698 cm.sup.−1; HRMS (ESI+) m/z calc'd for C.sub.9H.sub.8.sup.79BrNO.sub.4 [M+Na].sup.+: 295.9529, found 295.9519 (Δ=−3.45 ppm).
tert-Butyl (2S)-2-[(tert-butoxycarbonyl)amino]-3-{[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethyl] amino}propanoate (4e)
[0433] ##STR00042##
[0434] Boc-L-Dap-O.sup.tBu-HCl 1b (6.233 g, 21.0 mmol, 1.1 eq.) was suspended in dry THF (275 mL) in a dry 1 litre 3-neck round-bottomed flask and dry DIPEA (9.98 mL, 57.273 mmol, 3.0 eq.) was added. The contents were stirred for 10 min at r.t. under a nitrogen atmosphere. The flask was wrapped with aluminium foil and the contents were kept in the dark. (R,S)-1-bromo-1-[4′,5′-(methylenedioxy)-2′-nitrophenyl]ethane 4d (5.232 g, 19.091 mmol, 1.0 eq.) was then added to the reaction mixture. The homogeneous yellow solution and was left stirring in the dark at r.t. under a nitrogen atmosphere for a period of 68 h. The reaction was judged to be complete by TLC analysis (SiO.sub.2 plate; CH.sub.2Cl.sub.2/n-hexane=3:7) and evaporated to dryness under reduced pressure to obtain a dark brown oil. The crude reaction oil was dissolved in CH.sub.2Cl.sub.2 (250 mL) and washed with saturated brine solution (3×500 mL). The organic layer was separated, dried over anhydrous Na.sub.2SO.sub.4, filtered and evaporated to dryness to obtain a dark brown viscous oil. This was then purified by flash chromatography on SiO.sub.2 (gradient; eluent: 100% CH.sub.2Cl.sub.2, then CH.sub.2Cl.sub.2/CH.sub.3OH/NEt.sub.3=94:5:1) to afford the desired product, tert-butyl (2S)-2-[(tert-butoxycarbonyl)amino]-3-{[1-(6-nitrobenzo[d][1,3]dioxol-5-yl) ethyl]amino}propanoate 4e, as a yellow-brown sticky gum (7.49 g, 87%): R.sub.f=0.13 (SiO.sub.2 plate, CH.sub.2Cl.sub.2); .sup.1H NMR (400.13 MHz, CDCl.sub.3 with TMS as internal standard) S 1.34 and 1.36 (2×d, J=3.6 and 3.6 Hz, 3H), 1.42 and 1.450 (2×s, 9H), 1.454 and 1.47 (2×s, 9H), 2.54-2.74 (m, 1H), 2.75-2.89 (m, 1H), 4.03-4.27 (m, 1H), 4.28-4.53 (m, 1H), 5.15-5.43 (m, 1H), 6.05-6.10 (m, 2H), 7.21 (app. broad s, 1H), 7.345 and 7.352 (2×s, 1H); .sup.13C NMR (100.61 MHz, CDCl.sub.3 with TMS as internal standard) δ (mixture of diastereoisomers) 23.9 (CH.sub.3), 24.0 (CH.sub.3), 28.12 (CH.sub.3), 28.15 (CH.sub.3), 28.41 (CH.sub.3), 28.46 (CH.sub.3), 49.3 (CH.sub.2), 49.4 (CH.sub.2), 53.1 (CH), 53.2 (CH), 54.3 (CH), 54.5 (CH), 79.9 (C), 80.1 (C), 82.3 (C), 82.4 (C), 102.8 (2×CH.sub.2), 105.2 (2×CH), 106.77 (CH), 106.83 (CH), 138.1 (C), 143.30 (C), 143.37 (C), 146.7 (C), 152.1 (C), 152.2 (C), 155.5 (C), 155.6 (C), 170.7 (C), 170.8 (C); MS (ESI+) m/z (rel intensity) 454 [(M+H).sup.+, 86%], 301 (70), 261 (100), 205 (7), 203 (10), 186 (7), 147 (10); HRMS (ESI+) m/z calc'd for C.sub.21H.sub.32O.sub.8N.sub.3 [M+H].sup.+: 454.2184, found 454.2201 (Δ=3.65 ppm).
(2S)-2-Amino-3-{[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethyl]amino}propanoic acid (4)
[0435] ##STR00043##
[0436] tert-Butyl (2S)-2-[(tert-butoxycarbonyl)amino]-3-{[1-(6-nitrobenzo[d][1,3]dioxol-5-yl) ethyl]amino} propanoate 4e (4.303 g, 9.489 mmol, 1.0 eq.) was dissolved in dry CH.sub.2Cl.sub.2 (30 mL) in a dry 250 mL round-bottomed flask wrapped with aluminium foil to exclude light. Freshly distilled CF.sub.3COOH (15 mL, 195.887 mmol, 20.644 eq.) was added and the yellow solution turned brown. Dry Et.sub.3SiH (10.0 mL, 62.608 mmol, 6.598 eq.) was added and the reaction mixture stirred at r.t. in the dark. The reaction was periodically monitored by LC-MS analysis. After 48 h, the reaction was judged to be complete by LC-MS analysis (C18 reverse phase column, H.sub.2O—CH.sub.3CN as mobile phase, gradient), and the mixture then evaporated to dryness to obtain a dark brown gum. The gum was dissolved in anhydrous CH.sub.3OH (10 mL) and cooled to 0° C. under an argon atmosphere in a dry 2 L round-bottomed flask. This was triturated by addition of dry Et.sub.2O (900 mL) at 0° C. and then stirred vigorously at r.t. for 1 h to obtain a pale-yellow precipitate. The precipitate was filtered, washed with additional dry Et.sub.2O (2×200 mL), followed by n-hexane (150 mL). The pale yellow powder was transferred to a 100 mL round-bottomed flask and dried in high vacuum (<0.1 mbar) for 40 h in the dark. (2S)-2-Amino-3-{[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethyl]amino} propanoic acid 4 was obtained as a free-flowing pale yellow powder (3.646 g, 73%). The product is a salt of CF.sub.3COOH and a ˜1:1 mixture of epimers. The product was stored under argon in the dark at −20° C.: .sup.1H NMR (400.13 MHz, DMSO-d.sub.6 with TMS as internal standard) δ1.36 and 1.38 (2×d, J=3.8 and 3.8 Hz, 3H), 2.65-2.95 and 2.96-3.20 (2×m, 1H), 3.07-3.25 (m, 1H), 3.60-3.70 (m, 1H), 3.71-3.85 and 4.18-4.44 (2×m, 1H), 6.21 and 6.23 (2×d, J=3.5 and 2.9 Hz, 2H), 7.41 and 7.42 (2×s, 1H), 7.52 and 7.53 (2×s, 1H); .sup.13C NMR (100.61 MHz, DMSO-d.sub.6 with TMS as internal standard) δ (mixture of diastereoisomers) 22.6 (CH.sub.3), 22.7 (CH.sub.3), 38.5 (CH.sub.2), 45.8 (CH.sub.2), 51.6 (CH), 51.8 (CH), 52.3 (CH), 52.6 (CH), 103.2 (CH.sub.2), 103.3 (CH.sub.2), 104.5 (CH), 104.6 (CH), 106.4 (CH), 106.6 (CH), 117.1 (C, q, .sup.1J.sub.C-F=299.0 Hz), 135.4 (C), 135.6 (C), 142.96 (C), 143.01 (C), 146.61 (C), 146.66 (C), 151.93 (C), 151.96 (C), 158.56 (C, q, .sup.2J.sub.C-F=31.5 Hz), 168.7 (2×C), 169.6 (2×C); MS (ESI+) m/z (rel intensity) 298 [(M+H).sup.+, 100%], 261 (10), 225 (10), 211 (4), 147 (12), 144 (9), 134 (6), 105 (9), 82 (31); HRMS (ESI+) m/z calc'd for C.sub.12H.sub.16O.sub.6N.sub.3 [M+H].sup.+: 298.1034, found 298.1039 (Δ=1.74 ppm).
2,5-Dioxopyrrolidin-1-yl (i-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethyl) carbonate (5a)
[0437] ##STR00044##
[0438] (R,S)-1-[4′,5′-(Methylenedioxy)-2′-nitrophenyl]ethanol 4c (42.234 g, 200.0 mmol, 1.0 eq.) was charged onto a dry 2 litre 3-neck round-bottomed flask and dissolved in dry CH.sub.3CN (1 L). Dry DIPEA (104.5 mL, 600.0 mmol, 3.0 eq.) was added to the solution, followed by N,N-disuccinimidyl carbonate (80.896 g of ≥95% purity, 300 mmol, 1.5 eq.). The flask was wrapped with aluminium foil to keep the contents in the dark. The yellow heterogeneous reaction mixture was stirred at r.t. under an argon atmosphere in the dark. After 16 h, the reaction mixture was homogeneous and reaction was judged to be complete by TLC analysis (SiO.sub.2 plate, CH.sub.3CN/CH.sub.2Cl.sub.2=1:19). The yellow reaction mixture was then adsorbed on to Biotage® Isolute HM-N sorbent and dried under reduced pressure. This was then quickly subjected to flash chromatography on SiO.sub.2 [eluent: CH.sub.2Cl.sub.2, then CH.sub.3CN/CH.sub.2Cl.sub.2=1:19] in the dark to obtain the desired product, 2,5-dioxopyrrolidin-1-yl-(1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethyl) carbonate 5a as yellow crystalline needles (65-051 g, 92%) [NOTE: The flash column must be performed quickly to avoid decomposition of the product on prolonged exposure to SiO.sub.2]. The product 5a was used for the subsequent step immediately. It can be stored in the dark at −20° C. in a freezer: R.sub.f=0.6 (SiO.sub.2 plate, CH.sub.3CN/CH.sub.2Cl.sub.2=1:19); .sup.1H NMR (400.13 MHz, CDCl.sub.3 with TMS as internal standard) δ1.75 (d, J=6.4 Hz, 3H), 2.81 (s, 4H), 6.15 (d, J=3.0 Hz, 2H), 6.42 (q, J=6.4 Hz, 1H), 7.11 (s, 1H), 7.51 (s, 1H); .sup.13C NMR (100.61 MHz, CDCl.sub.3 with TMS as internal standard) 522.2 (CH.sub.3), 25.6 (CH.sub.2), 76.4 (CH), 103.5 (CH.sub.2), 105.5 (CH), 105.8 (CH), 133.1 (C), 141.6 (C), 148.0 (C), 150.7 (C), 153.0 (C), 168.6 (C).
(2S)-2-[(tert-Butoxycarbonyl)amino]-3-({[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethoxy]carbonyl}-amino)propanoic acid (5b)
[0439] ##STR00045##
[0440] Boc-L-Dap-OH 1a (2.553 g, 12.5 mmol, 1.25 eq.) was suspended in dry THF (180 mL) and dry CH.sub.3CN (20 mL) in a dry 1 litre single-necked round-bottomed flask wrapped with aluminium foil to exclude light. Dry DIPEA (5.23 mL, 30.0 mmol, 3.0 eq.) was added to the mixture and the contents were stirred for 20 min at r.t. under an argon atmosphere, after which 2,5-dioxopyrrolidin-1-yl-(1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethyl) carbonate 5a (3.523 g, 10.0 mmol, 1.0 eq.) was added. The heterogeneous mixture was stirred at r.t. under an argon atmosphere in the dark and the progress of the reaction was periodically monitored by LC-MS analysis. After a few hours the heterogeneous mixture started to be a homogeneous yellow solution. After 24 h, the reaction was judged to be complete and the contents were adsorbed onto Biotage® Isolute HM-N sorbent and dried under reduced pressure. This was then quickly subjected to flash chromatography on SiO.sub.2 [eluent: CH.sub.2Cl.sub.2, then CH.sub.2Cl.sub.2/CH.sub.3OH/CH.sub.3COOH=94:5:1] in the dark to obtain the desired product, (2S)-2-[(tert-butoxy-carbonyl)amino]-3-({[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethoxy]carbonyl}amino) propanoic acid 5b as a brown-yellow gum. This was subjected to azeotropic evaporation using CH.sub.2Cl.sub.2/cyclohexane (1:1) under reduced pressure to remove residual CH.sub.3COOH from the product 5b. The product was dried in high vacuum to obtain a pure sample of 5b as a yellow solid (4.360 g, 99%) and a ˜1:1 mixture of epimers; R.sub.f=0.41 (SiO.sub.2 plate, CH.sub.2Cl.sub.2/CH.sub.3OH/CH.sub.3COOH=94:5:1); MS (ESI−, LC-MS) m/z (rel intensity) 440 [(M−H).sup.−, 100%].
(2S)-2-Amino-3-({[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethoxy]carbonyl}-amino)propanoic acid (5)
[0441] ##STR00046##
[0442] Freshly distilled CF.sub.3COOH (15 mL, 195.894 mmol, 21.293 eq.) was added to a solution of (2S)-2-[(tert-butoxycarbonyl)amino]-3-({[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)-ethoxy] carbonyl}amino)propanoic acid 5b (4.061 g, 9.2 mmol, 1.0 eq.) in dry CH.sub.2Cl.sub.2 (50 mL) in a dry 1 L single-necked round-bottomed flask wrapped with aluminium foil. Upon addition of CF.sub.3COOH the yellow solution turned to dark brown, the reaction was stirred at r.t. in the dark and monitored by TLC analysis. After 2 h, the reaction was judged to be complete by both TLC (SiO.sub.2 plate; CH.sub.2Cl.sub.2/CH.sub.3OH/CH.sub.3COOH=94:5:1) and LC-MS analysis (C18 reverse phase column, H.sub.2O—CH.sub.3CN as mobile phase, gradient). The reaction mixture was evaporated to dryness under reduced pressure to obtain a dark brown gum. The gum was dissolved in dry CH.sub.3OH (5 mL), cooled to 0° C. and triturated with dry Et.sub.2O (0.9 L) to obtain a pale yellow precipitate. The mixture was left stirring vigorously in the dark under an atmosphere of argon at r.t. The pale yellow precipitate was then filtered and washed with Et.sub.2O (2×100 mL) and dry hexane (50 mL). This was dried in vacuo (<0.1 mbar) for 2 days in the dark to obtain the desired (2S)-2-amino-3-({[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethoxy]carbonyl}-amino)propanoic acid TFA salt 5 as a fine, pale yellow powder (4.132 g, 99%) and a ˜1:1 mixture of epimers as observed by .sup.1H and .sup.13C NMR spectroscopic analysis: .sup.1H NMR (400.13 MHz, CD.sub.3OD) δ1.57 (d, J=6.2 Hz, 3H), 2.68 (s, 2H), 3.41-3.58 (m, 1H), 3.59-3.74 (m, 1H), 3.78-4.15 (m, 1H), 6.14 (s, 2H), 6.22 (q, J=6.2 Hz, 1H), 7.12 (app. d, J=5.2 Hz, 1H), 7.47 (s, 1H); .sup.13C NMR (100.61 MHz, CD.sub.3OD) δ22.4 (CH.sub.3), 22.5 (CH.sub.3), 42.1 (CH.sub.2), 42.3 (CH.sub.2), 55.6 (CH), 55.9 (CH), 70.4 (2×CH), 104.8 (2×CH.sub.2), 105.7 (2×CH), 106.7 (CH), 106.9 (CH), 118.2 (C, q, .sup.1J.sub.C-F=292.6 Hz), 136.8 (C), 137.1 (C), 142.8 (C), 142.9 (C), 148.8 (C), 154.0 (C), 158.5 (C), 158.6 (C), 163.1 (C, q, .sup.2J.sub.C-F=34.4 Hz), 170.9 (2×C), 174.9 (2×C); MS (ESI+) m/z (rel intensity) 342 [(M+H).sup.+, 100%], 311 (10), 233 (5), 189 (9), 130 (19); HRMS (ESI+) m/z calc'd for C.sub.13H.sub.16O.sub.8N.sub.3 [M+H].sup.+: 342.0932, found 342.0923 (Δ=−2.63 ppm).
2-{[1-(6-Nitrobenzo[d][1,3]dioxol-5-yl)ethyl]thio}ethan-1-ol (6a)
[0443] ##STR00047##
[0444] A freshly prepared solution of NaOH (0.5 M, 8 g in 40 mL of deionized H.sub.2O, 20.0 mmol, 1 eq.) was loaded onto a 500 mL round 3-necked round-bottomed flask and the solution was degassed by bubbling through a stream of argon gas at r.t. After 30 min, mercaptoethanol (1.47 mL, 21.0 mmol, 1.05 eq.) was added to the flask and degassing was continued for a further 15 min. Separately, freshly (R,S)-1-bromo-1-[4′,5′-(methylenedioxy)-2′-nitrophenyl]ethane 13 (5.481 g, 20.0 mmol, 1.0 eq) was dissolved in 1,4-dioxane (20 mL) in a 100 mL round-bottomed flask wrapped with aluminium foil and degassed by bubbling a stream of argon gas for 15 min in the dark. The degassed solution of 13 in 1,4-dioxane was transferred onto the flask containing aq. NaOH and mercaptoethanol solution, dropwise, for a period of 90 min at r.t. using a cannula under a positive pressure of argon gas. A yellow precipitate formed, which was then dissolved by addition of degassed 1,4-dioxane (60 mL), followed by sonication for 30 min until a homogenous clear yellow solution was obtained. The contents were then left stirring for 12 h at r.t. in the dark under an argon atmosphere, after which time the reaction was judged to be complete by TLC and LC-MS analysis (C18 reverse phase column, H.sub.2O—CH.sub.3CN as mobile phase, gradient). The mixture was then evaporated under reduced pressure to remove the volatile organic components. The yellow aqueous content was then extracted with EtOAc (2×175 mL) and the combined organic phase was washed with saturated NH.sub.4Cl solution (1×500 mL), followed by brine solution (3×500 mL). The organic layer was then separated, dried over anhydrous Na.sub.2SO.sub.4, filtered and evaporated to dryness to obtain a yellow oil. The product was purified by flash chromatography on SiO.sub.2 (eluent: EtOAc/n-hexane=3:7) in the dark to obtain 2-{[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethyl]thio}ethan-1-ol 6a as a sticky yellow oil (5.179 g, 95%): R.sub.f=0.33 (SiO.sub.2 plate, EtOAc/n-hexane=3:7); .sup.1H NMR (400.13 MHz, CDCl.sub.3) δ1.55 (d, J=7.0 Hz, 3H), 1.96 (t, J=5.9 Hz, 1H), 2.44-2.65 (m, 2H), 3.52-3.74 (m, 2H), 4.78 (q, J=7.0 Hz, 1H), 6.10 (dd, J=3.8, 1.0 Hz, 2H), 7.27 (s, 1H), 7.28 (s, 1H); .sup.13C NMR (100.61 MHz, CDCl.sub.3) δ23.2 (CH.sub.3), 34.9 (CH.sub.2), 38.4 (CH), 60.9 (CH.sub.2), 103.1 (CH.sub.2), 104.8 (CH), 108.0 (CH), 136.1 (C), 143.3 (C), 146.9 (C), 152.0 (C); IR (neat) v.sub.max 3393, 2980, 1617, 1518, 1503, 1480, 1418, 1375, 1332, 1252, 1156, 1031, 928, 872, 817, 759; m/z (ESI−, LC-MS) 270.1 [(M−H).sup.−, 100%].
2,5-Dioxopyrrolidin-1-yl-(2-{[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethyl]thio}ethyl) carbonate (6b)
[0445] ##STR00048##
[0446] Intermediate 6b used for the subsequent reaction for the synthesis of DAP derivatives 6c and 6d was synthesised in situ starting from the alcohol 6a. A 3-necked 500 mL round-bottomed flask was dried in vacuo using a heat gun and purged with argon gas; this procedure was repeated three times prior to use. The dry flask was charged with 2-{[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethyl]thio}ethan-1-ol 6a (4.883 g, 18.0 mmol, 1.0 eq.) dissolved in dry CH.sub.3CN (90 mL). Dry DIPEA (9.41 mL, 54.0 mmol, 3.0 eq.), followed by N,N′-disuccinimidyl carbonate (6.796 g of 95% purity, 25.2 mmol, 1.4 eq.), was added to the reaction mixture at r.t. in the dark under an argon atmosphere. The reaction mixture turned to turbid yellow and a white precipitate began to form, and after 1 h, the reaction mixture became a homogeneous yellow-brown solution. The reaction was left stirring at r.t. for 12 h and was judged to be complete by TLC analysis (SiO.sub.2 plate, EtOAc/n-hexane=3:7) after this time. The 2,5-dioxopyrrolidin-1-yl-(2-{[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethyl]thio}ethyl) carbonate 6b was immediately carried to the next step without further purification: R.sub.f=0.12 (SiO.sub.2 plate, EtOAc/n-hexane=3:7).
tert-Butyl (2S)-2-[(tert-Butoxycarbonyl)amino]-3-{[(2-{[1-(6-nitrobenzo-[d][1,3]dioxol-5-yl)ethyl]thio}ethoxy)carbonyl]amino}propanoate (6c)
[0447] ##STR00049##
[0448] Boc-L-Dap-O.sup.tBu-HCl (8.548 g, 28.8 mmol, 1.6 eq.) was added in one portion to a solution of 6b, prepared as described above. The yellow reaction mixture turned homogeneous in few minutes and the contents were stirred in dark under an argon atmosphere at After 10 h the reaction was judged to be complete by both TLC (SiO.sub.2 plate, R.sub.f=0.39, EtOAc/n-hexane=3:7) and LC-MS analysis (C18 reverse phase column, H.sub.2O—CH.sub.3CN as mobile phase), confirming consumption of 6b. The reaction mixture was then adsorbed onto Biotage® Isolute HM-N sorbent and dried under reduced pressure. This was then subjected to flash chromatography on SiO.sub.2 [eluent: EtOAc/n-hexane=3:7] in the dark to obtain the desired tert-butyl (2S)-2-[(tert-butoxycarbonyl)amino]-3-{[(2-{[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethyl]thio}-ethoxy)carbonyl] amino}propanoate 6c as a thick yellow gum (9.405 g, 94%) and a mixture of ˜1:1 epimers: R.sub.f=0.39 (EtOAc/n-hexane=3:7); .sup.1H NMR (400.13 MHz, CDCl.sub.3) δ (Mixture of epimers) 1.44 (s, 9H), 1.46 (s, 9H), 1.54 (d, J=6.8 Hz, 3H), 2.36-2.61 (m, 2H), 3.41-3.68 (m, 2H), 4.00-4.18 (m, 2H), 4.24 (broad s, 1H), 4.85 (q, J=6.8 Hz, 1H), 5.15 (broad s, 1H), 5.41 (broad s, 1H), 6.10 (d, J=6.8, 2H), 7.27 (s, 1H), 7.29 (s, 1H); .sup.13C NMR (100.61 MHz, CDCl.sub.3) δ23.1 (CH.sub.3), 28.1 (CH.sub.3), 28.4 (CH.sub.3), 30.5 (CH.sub.2), 39.0 (CH), 43.2 (CH.sub.2), 54.6 (CH), 65.2 (CH.sub.2), 80.1 (C), 82.9 (C), 103.0 (CH.sub.2), 104.7 (CH), 108.2 (CH), 136.3 (C), 143.5 (C), 146.9 (C), 152.1 (C), 155.6 (C), 156.4 (C), 169.7 (C); m/z (ESI+, LC-MS) 558.2 [(M+H).sup.+, 100%]
(2S)-2-[(tert-Butoxycarbonyl)amino]-3-{[(2-{[1-(6-nitrobenzo[d][1,3]-dioxol-5-yl)ethyl] thio}ethoxy)carbonyl]amino}propanoic acid (6d)
[0449] ##STR00050##
[0450] Boc-L-Dap-OH (13.479 g, 66.0 mmol, 1.082 eq.) was added in one portion to a solution of 6b (26.70 g, prepared as described above) in dry CH.sub.3CN (305 mL) under argon and stirred for 12 h at r.t. After this time the reaction was judged to be complete by LC-MS (C18 reverse phase column, H.sub.2O—CH.sub.3CN as mobile phase) and the contents were adsorbed on to Biotage® Isolute HM-N sorbent and dried under reduced pressure. This was then subjected to flash chromatography on spherical SiO.sub.2 [Supelco®, procured from Sigma Aldrich Ltd., 40-75 μm particle size; gradient; eluent: EtOAc/n-hexane=1:1.fwdarw.7:3.fwdarw.1:0] in the dark to obtain the desired (2S)-2-[(tert-butoxycarbonyl)amino]-3-{[(2-{[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethyl]thio}-ethoxy)-carbonyl]amino}propanoic acid 6d as a thick yellow gum (28.995 g, 95%) and a mixture of ˜1:1 epimers: .sup.1H NMR [400.13 MHz, CDCl.sub.3 with 0.1% v/v TMS as internal standard] δ (Mixture of epimers) 1.43 (s, 9H), 1.52 (d, J=6.8 Hz, 3H), 2.30-2.95 (m, 2H), 3.33-3.82 (broad m, 2H), 3.86-4.18 (m, 2H), 4.20-4.48 (m, 1H), 4.64-4.97 (m, 1H), 5.34-5.58 (broad s, 1H), 5.60-5.84 (broad s, 1H), 6.20 (d, J=8.3 Hz, 2H), 7.10-7.39 (m, 2H), 8.47 (broad s, 1H); .sup.13C NMR [100.61 MHz, CDCl.sub.3 with 0.1% v/v TMS as internal standard] δ 23.1 (CH.sub.3), 28.4 (3×CH.sub.3), 30.5 (CH.sub.2), 39.0 (CH), 42.7 (CH.sub.2), 54.4 (CH), 65.3 (CH.sub.2), 80.8 (C), 103.1 (CH.sub.2), 104.7 (CH), 108.1 (CH), 136.2 (C), 143.4 (C), 146.9 (C), 152.1 (C), 156.3 (C), 157.2 (C), 173.5 (C); m/z (ESI−, LC-MS) 500.1 [(M−H).sup.−, 100%]
(2S)-2-Amino-3-{[(2-{[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethyl]thio}ethoxy)carbonyl] amino}propanoic acid (6)
[0451] ##STR00051##
Method I (Prepared from 6c)
[0452] A dry sample of (2S)-2-[(tert-butoxycarbonyl)amino]-3-{[(2-{[1-(6-nitrobenzo[d][1,3]-dioxol-5-yl)ethyl]thio}-ethoxy)carbonyl]amino}propanoate 6c (6.728 g, 12.066 mmol, 1.0 eq.) was loaded to a dry 250 mL single-necked round-bottomed flask and dissolved in dry CH.sub.2Cl.sub.2 (50 mL), the flask was wrapped in foil to exclude light. Dry Et.sub.3SiH (20 mL, 125.215 mmol, 10.378 eq.) was added to the solution followed by the drop-wise addition of freshly distilled CF.sub.3COOH (20 mL, 261.182 mmol, 21.647 eq.) using a syringe over 15 min at r.t. The reaction mixture turned from yellow to a brown-green colour and was left stirring at r.t. in the dark. After 24 h, the reaction was judged to be complete by TLC (SiO.sub.2 plate, EtOAc/n-hexane=3:7) and LC-MS analysis (C18 reverse phase column, H.sub.2O—CH.sub.3CN as mobile phase). The reaction mixture was concentrated under reduced pressure in the dark to obtain a yellow-brown gum. This was dissolved in anhydrous CH.sub.3OH (20 mL) and evaporated to dryness under reduced pressure; this was repeated three times and dried in high vacuum (<0.1 mbar) to remove any residual CF.sub.3COOH, Et.sub.3SiH and H.sub.2O. The yellow-brown gum was then dissolved in dry CH.sub.3OH (40 mL) and transferred to a dry 2 L round-bottomed flask under an argon atmosphere and cooled to 0° C. Dry Et.sub.2O (2 L) was added to the solution via cannula under a positive pressure of argon gas in the dark and the contents were vigorously stirred. A yellow precipitate formed and the contents stirred vigorously at 0° C. for 15 min, then at r.t. for a further 2 h. The pale yellow precipitate was filtered and washed with dry Et.sub.2O (3×250 mL) and finally with dry n-hexane (50 mL). The product was dried in vacuum (<0.1 mbar) overnight for 14 h in the dark to obtain (2S)-2-amino-3-{[(2-{[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethyl]thio}ethoxy)carbonyl]amino}-propanoic acid TFA salt 6 as a pale yellow powder (3.940 g, 63%) and a 1:1 mixture of epimers: .sup.1H NMR [400.13 MHz, CD.sub.3OD/CF.sub.3COOD (5:1) with 1% v/v TMS as internal standard] δ (Mixture of epimers) 1.55 (d, J=7.0 Hz, 3H), 2.49-2.73 (m, 2H), 3.63 (dd, J=15.0, 6.4 Hz, 1H), 3.78 (ddd, J=15.0, 3.6, 2.3 Hz, 1H), 4.0-4.24 (m, 3H), 4.81 (q, J=7.0 Hz, 1H), 6.11 and 6.13 (2×s, 1H), 6.40 (s, 1H), 7.29 and 7.33 (2×s, 1H); .sup.13C NMR [100.61 MHz, CD.sub.3OD/CF.sub.3COOD (5:1) with 1% v/v TMS as internal standard] δ23.2 (CH.sub.3), 31.4 (CH.sub.2), 40.0 (CH), 42.1 (CH.sub.2), 55.1 (CH), 65.8 (CH.sub.2), 104.8 (CH.sub.2), 105.6 (CH), 109.0 (CH), 117.0 (C, .sup.1J.sub.C-F=286.5 Hz), 137.1 (C), 144.9 (C), 148.7 (C), 153.7 (C), 160.7 (C), 160.8 (C, .sup.1J.sub.C-F=38.1 Hz), 170.2 (C); MS (ESI+) m/z (rel intensity) 402 [(M+H).sup.+, 100%], 386 (20), 224 (9), 208 (11), 151 (11); HRMS (ESI+) m/z calc'd for C.sub.15H.sub.20N.sub.3O.sub.8S [M+H].sup.+: 402.0971, found 402.0974 (Δ=0.7 ppm).
[0453] Storage: The dry sample of DAP amino acid 6-TFA was stored in air-tight dark glass vials in a cold, dry and dark environment and was stable for over 3 years without decomposition.
[0454] Handling: DAP amino acid 6-TFA is light sensitive and slightly hygroscopic upon exposure to moist air, hence the sample of it in a vial was always handled in a dark and dry atmosphere. It is noteworthy that the vial containing 6-TFA taken out from the fridge or freezer was always allowed to warm to r.t. prior to opening and handling.
Method II (Prepared from 6d)
[0455] A dry sample of (2S)-2-[(tert-butoxycarbonyl)amino]-3-{[(2-{[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethyl]thio}ethoxy)carbonyl]amino}propanoic acid 6d (26.70 g, 53.2395 mmol, 1.0 eq.) was loaded on to a dry 1 litre single-necked round-bottomed flask and dissolved in dry CH.sub.2Cl.sub.2 (300 mL). The flask was wrapped with aluminium foil to exclude light, and dry Et.sub.3SiH (84.69 mL, 530.24 mmol, 10.0 eq.) was added to the solution. After 5 min, freshly distilled CF.sub.3COOH (81.54 mL, 1.0648 mol, 20.0 eq.) was added to the solution drop-wise for 15 min. The solution turned yellow-brown and was left stirring at r.t. in the dark. After 5 h, the reaction was judged to be complete by TLC (SiO2 plate, EtOAc/CH.sub.3COOH=98:2) and LC-MS analysis (C18 reverse phase column, H.sub.2O—CH.sub.3CN as mobile phase) and the solution was concentrated to dryness under reduced pressure to obtain a yellow-brown gum. This was dissolved in dry CH.sub.3OH (40 mL) and evaporated to dryness under reduced pressure; this was repeated three times and product dried in high vacuum (<0.1 mbar) to remove any residual CF.sub.3COOH, Et.sub.3SiH and H.sub.2O. The yellow-brown gum was dissolved in dry CH.sub.3OH (40 mL), transferred to a dry 3 L round-bottomed flask under an argon atmosphere and cooled to 0° C. Dry Et.sub.2O (2.5 L) was added to the flask via cannula under a positive pressure of argon gas while the contents were vigorously stirred. A pale yellow precipitate was formed and the contents stirred vigorously at 0° C. for 15 min and then at r.t. for 2 h. The precipitate was then filtered and washed with dry Et.sub.2O (3×500 mL), followed by dry n-hexane (150 mL). The product was dried in high vacuum (<0.1 mbar) overnight for 14 h in the dark to obtain (2S)-2-amino-3-{[(2-{[1-(6-nitrobenzo[d][1,3]dioxol-5-yl)ethyl]thio}ethoxy)carbonyl]amino}propanoic acid TFA salt 6 as a pale-yellow powder (20.465 g, 75%) and a mixture of ˜1:1 epimers.
VlmTE Substrate Syntheses
[0456] ##STR00052## ##STR00053## ##STR00054##
Synthesis Scheme for Depsipeptidyl-SNAC Compounds 7 and 8
[0457] a, Synthesis of deoxytetradepsipeptidyl-SNAC 8. a) 8c, EDC, DMAP, 72%; b) TFA, DCM, 99%; c) TBSCl, Imid., DCM; d) LiOH, THF, 78%, 2 steps; e) (COCl).sub.2, DMF, DCM; f) TEA, DCM, 53%; g) HF, Pyr., MeCN, 84%; h) EDC, DMAP, TEA, DCM, 60%; i) LiOH, MeOH, THF, 60%; j) EDC, DMAP, DMF, 5:4 dr, 92%
[0458] b, Synthesis of tetradepsipeptidyl-SNAC 7. a) AllylBr, Cs.sub.2CO.sub.3, DMF, 95%; b) Boc-d-Val, EDC, DMAP, DCM, 84%; c) Pd(PPh.sub.3).sub.4, Morpholine, DCM; d) EDC, HOBt, DIPEA, DCM, 94%; e) HCl, Dioxane; f) d-HIV, EDC, HOBt, DIPEA, DCM, 95%.
[0459] c Structure for deoxytetradepsipeptidyl-SNAC 8 and
[0460] d Structure for tetradepsipeptidyl-SNAC 7.
(S)—S-(2-acetamidoethyl) 2-((tert-butoxycarbonyl)amino)-3-methylbutanethioate (7a)
[0461] ##STR00055##
[0462] Boc-L-Valine (7.29 g, 33-56 mmol, 1.0 equiv.) was dissolved in CH.sub.2Cl.sub.2. N-Acetyl-cysteamine (4.00 g, 33-56 mmol, 1.0 equiv.). N-(3-dimethylaminopropyl)-N′-ethyl-carbodiimide hydrochloride (EDC, 7.72 g, 40.27 mmol, 1.2 equiv.) and 4-(dimethyl-amino)pyridine (DMAP, 410 mg, 3.36 mmol, 0.1 equiv.) were added to the mixture. The reaction was stirred for 16 h at ambient temperature. The reaction was quenched with NH.sub.4Cl(aq) and extracted 3× with EtOAc. The organic fractions were combined, washed with brine, dried over Na.sub.2SO.sub.4 and concentrated. The desired product (7.69 g, 24.16 mmol, 72% yield) was purified with silica column chromatography (5% MeOH in CH.sub.2Cl.sub.2). R.sub.f=0.37 (2:3 acetone:hexanes). .sup.1H NMR (400 MHz, CDCl.sub.3) δ 5.95 (s, 1H), 4.97 (d, J=8.8 Hz, 1H), 4.21 (dd, J=8.9, 4.8 Hz, 1H), 3.48-3.30 (m, 2H), 3.08-2.94 (m, 2H), 2.22 (td, J=13.4, 6.7 Hz, 1H), 1.43 (s, 9H), 0.96 (d, J=6.9 Hz, 3H), 0.85 (d, J=6.9 Hz, 3H). .sup.13C NMR (100 MHz, CDCl.sub.3) δ 201.74, 170-35, 155.66, 80.42, 65.68, 39-38, 30-77, 28-38, 28.33, 23.16, 19.40, 17.01. HRMS (ESI+) Calculated Mass (C.sub.14H.sub.26N.sub.2O.sub.4SNa) 341.1511, found 341.1512.
(S)—S-(2-acetamidoethyl) 2-amino-3-methylbutanethioate (7b)
[0463] ##STR00056##
[0464] In a round-bottom flask, 7a (0.5 g, 1.57 mmol, 1.0 equiv.) was dissolved in CH.sub.2Cl.sub.2 (3 mL). The solution was cooled to 0° C. using an ice bath and trifluoroacetic acid (3 mL) was added. The reaction was allowed to proceed at ambient temperature for 45 min. The reaction mixture was concentrated and the desired product (341 mg, 1.56 mmol, >99% yield) was purified by silica column chromatography (5% to 10% MeOH in CH.sub.2Cl.sub.2). .sup.1H NMR (300 MHz, DMSO) δ 8.45 (s, 157 2H), 8.10 (t, J=5.5 Hz, 1H), 4.15 (d, J=4.8 Hz, 1H), 3.27-3.17 (m, 2H), 3.13-2.98 (m, 2H), 2.28-2.09 (m, 1H), 0.99 (d, J=6.9 Hz, 3H), 0.95 (d, J=7.0 Hz, 3H). .sup.13C NMR (75 MHz, DMSO) δ 196.18, 169-35, 63.48, 37.78, 30.10, 28.40, 22.50, 18.03, 17.26.
(S)-2-((tert-butyldimethylsilyl)oxy)propanoic acid (7c)
[0465] ##STR00057##
[0466] In a round-bottom flask, ethyl L-lactate (5.08 g, 43.0 mmol, 1.0 equiv.) was dissolved in CH.sub.2Cl.sub.2 (55 mL) and the solution was cooled to 0° C. using an ice bath. tert-Butyldimethylsilyl chloride (6.48 g, 45-15 mmol, 1.05 equiv.) and imidazole (3.51 g, 51.6 mmol, 1.2 equiv.) was added to this mixture, after which the reaction was allowed to proceed at ambient temperature for 2 h. The reaction mixture was then diluted with H.sub.2O and extracted 3× with CH.sub.2Cl.sub.2. The organic fractions were combined, washed with ice cold 5% HCl(aq), washed with brine, dried over Na.sub.2SO.sub.4 and concentrated. The crude intermediate (S)-ethyl 2-(tert-butyldimethylsilyloxy)propanoate was dissolved in THF (215 mL). The mixture was cooled to 0° C. using an ice bath, and a cooled solution of LiOH (0.4 M, 215 mL) was added dropwise over 20 min. The reaction mixture was stirred for 4 h at ambient temperature. The resulting reaction mixture was concentrated to half its original volume, and the resulting aqueous solution was extracted 3× with Et.sub.2O. The organic fractions were combined and extracted 3× with a saturated solution of NaHCO.sub.3(aq). The aqueous fractions were combined, acidified to pH 4 with 1 M KHSO.sub.4(aq) and extracted 3× with Et.sub.2O. The organic fractions were combined, dried over Na.sub.2SO.sub.4 and concentrated. The desired product (6.88 g, 33.7 mmol, 78% yield over two steps) was obtained and used without further purification. The NMR data were consistent with literature values.sup.45. 1H NMR (300 MHz, CDCl.sub.3) δ 4.36 (q, J=6.8 Hz, 1H), 1.45 (d, J=6.8 Hz, 3H), 0.92 (s, 9H), 0.13 (s, 6H).
(S)-2-((tert-butyldimethylsilyl)oxy)propanoyl chloride (7d)
[0467] ##STR00058##
[0468] In a round-bottom flask, 7c (3.7 g, 18 mmol, 1.0 equiv.) was dissolved in DMF (45 mL) and the solution was cooled to 0° C. using an ice bath. Oxalyl chloride (13.6 mL of a 2.0 M solution in DCM, 10.0 equiv.) and a catalytic amount of DMF were added. The reaction proceeded for 2 h from 0° C. to ambient temperature. The reaction mixture was concentrated and the crude oil was used in subsequent reactions without purification.
TBSO-L-Lac-L-Val-SNAC (7e)
[0469] ##STR00059##
[0470] In a round-bottom flask, 7b (1.95 g, 9 mmol, 1.0 equiv.) was dissolved in CH.sub.2Cl.sub.2 (40 mL). The crude oil 7d (18 mmol, 2.0 equiv.) was dissolved in CH.sub.2Cl.sub.2 (5 mL) and added to the mixture. Et.sub.3N (2.5 mL, 18 mmol, 2.0 equiv.) was added and the reaction was allowed to proceed for 4 h. The reaction mixture was quenched with NH.sub.4Cl(aq), extracted 3× with EtOAc, washed with brine and concentrated. The desired product (1.93 g, 4.77 mmol, 53% yield) was purified from the crude mixture by silica column chromatography (50% to 90% EtOAc in hexanes). .sup.1H NMR (300 MHz, CDCl.sub.3) δ 7.22 (d, J=9.3 Hz, 1H), 6.03 (s, 1H), 4.53 (dd, J=9.3, 4.5 Hz, 1H), 4.25 (q, J=6.7 Hz, 1H), 3.38 (q, J=6.2 Hz, 2H), 3.07-2.98 (m, 2H), 2.40-2.21 (m, 1H), 1.93 (s, 3H), 1.38 (d, J=159 6.7 Hz, 3H), 1.01-0.82 (m, 15H), 0.13 (s, 3H), 0.12 (s, 3H). .sup.13C NMR (75 MHz, CDCl.sub.3) δ 200-34, 174-90, 170-47, 70.03, 63.48, 39.47, 31.04, 28.51, 25.82, 23.23, 22.04, 19.47, 18.00, 16.83, −4.54, −5.03.
HO-L-Lac-L-Val-SNAC (7f)
[0471] ##STR00060##
[0472] Compound 7e (250 mg, 0.617 mmol, 1.0 equiv.) was dissolved in acetonitrile (20 mL) in a 50 mL polypropylene Falcon tube. Pyridine (249 μL, 3.09 mmol, 5 equiv.) and HF (48 wt. % aq. 533 μL, 30.9 mmol, 50 equiv.) were added. The reaction was stirred at ambient temperature for 16 h. The reaction mixture was quenched with NH.sub.4Cl(aq), extracted 3× with EtOAc, washed with brine, dried over Na.sub.2SO.sub.4 and concentrated. The desired product (150.1 mg, 0.517 mmol, 84% yield) was purified with silica column chromatography (2% to 8% MeOH in CH.sub.2Cl.sub.2). .sup.1H NMR (400 MHz, CDCl.sub.3) δ 7.21 (d, J=9.2 Hz, 1H), 6.20 (s, 1H), 4.54 (dd, J=9.2, 5.4 Hz, 1H), 4.30 (q, J=6.8 Hz, 1H), 4.15 (s, 1H), 3.52-3.32 (m, 2H), 3.12-2.94 (m, 2H), 2.36-2.21 (m, 1H), 1.95 (s, 3H), 1.44 (t, J=6.3 Hz, 3H), 0.97 (d, J=6.8 Hz, 3H), 0.91 (d, J=6.8 Hz, 3H). .sup.13C NMR (100 MHz, CDCl.sub.3) δ 200.20, 175-47, 170-94, 68.66, 63-77, 39.24, 30-90, 28.71, 23.25, 21.28, 19.45, 17.27.
(S)-allyl 2-hydroxypropanoate (7 g)
[0473] ##STR00061##
[0474] In a round bottom flask, 1 g L-lactic acid (11.11 mmol, 1 equiv.), and 3.8 g caesium carbonate (11.67 mmol, 1.05 equiv.) were dissolved in 13 mL DMF. Allyl bromide (3.75 mL, 5.37 g, 44.44 mmol, 4 equiv.) was added dropwise at ambient temperature. Upon complete addition the reaction was stirred at ambient temperature for 48 h. At completion the excess allyl bromide was removed by rotary evaporation and the remaining solution diluted with water then extracted 3× with Et.sub.2O. The combined organic fractions were washed twice with water, once with brine, dried over Na.sub.2SO.sub.4 and concentrated to the title compound (1.47 g, 95%) as a pale yellow oil. Characterization data is consistent with reported values.sup.46. 1H NMR (400 MHz, CDCl.sub.3) δ 5.99-5.82 (m, 1H), 5.40-5.18 (m, 2H), 4.71-4.59 (m, 2H), 4.29 (q, J=6.9 Hz, 1H), 2.75 (s, 1H), 1.42 (d, J=6.9 Hz, 3H).
(R)—(S)-1-(allyloxy)-1-oxopropan-2-yl 2-((tert-butoxycarbonyl)amino)-3-methyl-butanoate (7 h)
[0475] ##STR00062##
[0476] In a round bottom flask, 1 g of 7 g (7.69 mmol, 1 equiv.) and 1.67 g of Boc-D-Val (8.46 mmol, 1.1 equiv.) were dissolved in 39 mL of CH.sub.2Cl.sub.2. To this solution 2.21 g EDC (11.54 mmol, 1.5 equiv.) and 1.03 g DMAP (8.46 mmol, 1 equiv.) were added at ambient temperature. The resulting solution was stirred for 20 h at ambient temperature. The reaction was quenched with NH.sub.4Cl(aq), extracted 3× with CH.sub.2Cl.sub.2, washed with NaHCO.sub.3(aq), washed with brine, dried over Na.sub.2SO.sub.4, and concentrated. The title compound (2.12 g, 84%) was purified by silica column chromatography (20% EtOAc in hexanes). R.sub.f=0.41 (1:3 EtOAc:Hexanes).sup.1H NMR (400 MHz, CDCl.sub.3) δ 5.95-5.81 (m, 1H), 5.29 (dddd, J=21.3, 11.7, 6.6, 1.3 Hz, 2H), 5.13 (q, J=7.0 Hz, 1H), 4.97 (d, J=8.9 Hz, 1H), 4.67-4.59 (m, 2H), 4.28 (dd, J=8.9, 4.8 Hz, 1H), 2.25-2.11 (m, 1H), 1.50 (d, J=7.1 Hz, 3H), 1.43 (s, 9H), 0.97 (d, J=6.9 Hz, 3H), 0.91 (d, J=6.9 Hz, 3H). .sup.13C NMR (100 MHz, CDCl.sub.3) δ 171-50, 169-95, 155-56, 131-43, 118.83, 79.77, 69.17, 65.93, 58.60, 31.28, 28.32, 18.99, 17.49, 17.00. HRMS (ESI+): Exact mass calculated for C.sub.16H.sub.27NNaO.sub.6: 352.1736. Found: 352.1721.
Boc-D-Val-L-Lac-L-Val-SNAC (7i)
[0477] ##STR00063##
[0478] In a round bottom flask, 250 mg of 7 h (0.76 mmol, 1 equiv.) was dissolved in 4 mL of CH.sub.2Cl.sub.2 under a nitrogen atmosphere. To this solution 86 μL of morpholine (87 mg, 0.99 mmol, 1.3 equiv.) and 62 mg of Pd(PPh.sub.3).sub.4 was added in a single portion. The reaction was stirred at ambient temperature and monitored by TLC. At completion the reaction was quenched by the addition of 10% aq. HCl, the organic layer was removed and the remaining aqueous fraction was extracted 3× with CH.sub.2Cl.sub.2. The combined organic fractions were washed with brine, dried over Na.sub.2SO.sub.4 and concentrated, this intermediate, 7j, was used immediately in the subsequent reaction. To a flame dried round bottom flask was added 194 mg of 7b (as HCl salt, 0.76 mmol, 1 equiv.) and the crude 7j (0.76 mmol, 1 equiv.) in 4 mL of CH.sub.2Cl.sub.2. To the resulting solution was added 400 μL of Hünig's base (295 mg, 2.28 mmol, 3 equiv.), 154 mg HOBt (1.14 mmol, 1.5 equiv.) and 220 mg EDC (1.14 mmol, 1.5 equiv.). The reaction was stirred under argon at ambient temperature for 20 h. The reaction was quenched with NH.sub.4Cl(aq), extracted 3× with CH.sub.2Cl.sub.2, washed with NaHCO.sub.3(aq), then with brine, dried over Na.sub.2SO.sub.4, and concentrated. The title compound (350 mg, 94% over 2 steps) was purified by silica column chromatography (40% acetone in hexanes). R.sub.f=0.35 (2:3 acetone:hexanes).sup.1H NMR (400 MHz, CDCl.sub.3) δ 7.08 (d, J=8.2 Hz, 1H), 6.07 (s, 1H), 5.38 (q, J=6.8 Hz, 1H), 5.02 (d, J=7.0 Hz, 1H), 4.46-4.39 (m, 1H), 3.99 (t, J=6.9 Hz, 1H), 3.45-3.30 (m, 2H), 3.11-2.89 (m, 2H), 2.30 (dq, J=13.4, 6.7 Hz, 1H), 2.11-2.01 (m, 1H), 1.92 (s, 3H), 1.49 (d, J=6.9 Hz, 3H), 1.39 (s, 9H), 1.01-0.91 (m, 12H). .sup.13C NMR (100 MHz, CDCl.sub.3) δ 200.14, 171.72, 170.89, 170.48, 155.92, 80.45, 70.58, 64.74, 59-74, 39-30, 30-47, 30.27, 28.46, 28.26, 23-10, 19-33, 18.90, 18.49, 17.85, 17.53. HRMS (ESI+): Exact mass calculated for C.sub.22H.sub.39N.sub.3NaO.sub.7S: 512.2406. Found: 512.2391.
HO-D-Hiv-D-Val-L-Lac-L-Val-SNAC (7)
[0479] ##STR00064##
[0480] To a round bottom flask was added 118 mg 7i (0.24 mmol, 1 equiv.) in a minimal amount of THF and this was cooled to 0° C. To this was added 1 mL of 4M HCl in dioxane (Sigma), and the reaction allowed to warm to ambient temperature. The reaction was monitored by TLC and at completion all solvent was removed by rotary evaporation. The unpurified intermediate 7k was used immediately in the subsequent reaction. Intermediate 7k was dissolved in 2 mL of CH.sub.2Cl.sub.2 and to this was added sequentially 125 μL of Hünig's base (93 mg, 0.72 mmol, 3 equiv.), 32 mg of D-α-hydroxyisovaleric acid (0.27 mmol, 1.1 equiv.), 49 mg HOBt (0.36 mmol, 1.5 equiv.), and 70 mg EDC (0.36 mmol, 1.5 equiv.). The reaction was stirred at ambient temperature for 24 h and at completion was quenched with NH.sub.4Cl(aq), extracted 5× with CH.sub.2Cl.sub.2, washed with NaHCO.sub.3(aq), then with brine, dried over Na.sub.2SO.sub.4, and concentrated. The title compound (111 mg, 95%) was purified by silica column chromatography (50% Acetone in hexanes). .sup.1H NMR (300 MHz, CDCl.sub.3) δ 7.29 (s, 1H), 6.20 (t, J=5.7 Hz, 1H), 5.26 (q, J=7.0 Hz, 1H), 4.55 (br, 1H), 4.47 (dd, J=9.0, 6.5 Hz, 1H), 4.26 (t, J=7.7 Hz, 1H), 3.99 (d, J=2.9 Hz, 1H), 3.52-3.25 (m, 2H), 2.99 (ddt, J=20.4, 13.3, 6.5 Hz, 2H), 2.39-2.25 (m, 1H), 2.20-2.06 (m, 2H), 1.97 (s, 3H), 1.54 (d, J=7.0 Hz, 3H), 1.06-0.93 (m, 15H), 0.88 (d, J=6.9 Hz, 3H). .sup.13C NMR (75 MHz, CDCl.sub.3) δ 200.05, 175.25, 171.69, 171.43 (2C), 76.33, 71.14, 64.55, 58.39, 38.95, 31.95, 30.25, 30.12, 28.64, 23.22, 19.49, 19.17, 19.13, 18.83, 18.18, 18.04, 16.15. HRMS (ESI+): Exact mass calculated for C.sub.22H.sub.39N.sub.3NaO.sub.7S: 512.2401. Found: 512.2406.
(R)-methyl 3-methyl-2-(3-methylbutanamido)butanoate (8a)
[0481] ##STR00065##
[0482] In a round-bottom flask, D-valine methyl ester hydrochloride (250 mg, 1.5 mmol, 1.0 equiv.) was dissolved in CH.sub.2Cl.sub.2 (15 mL). Isovaleric acid (230 mg, 2.25 mmol, 1.5 equiv.), EDC (430 mg, 2.25 mmol, 1.5 equiv.), DMAP (276 mg, 2.25 mmol, 1.5 equiv.), and Et.sub.3N (420 μL, 3.00 mmol, 2.0 equiv.) were added and the reaction was allowed to mix at ambient temperature for 16 h. The reaction was quenched with NH.sub.4Cl(aq), extracted 3× with CH.sub.2Cl.sub.2, washed with NaHCO.sub.3(aq), washed with brine, dried over Na.sub.2SO.sub.4, and concentrated. The desired compound (193.7 mg, 0.90 mmol, 60% yield) was purified by silica column chromatography (20 to 50% EtOAc in hexanes). .sup.1H NMR (400 MHz, CDCl.sub.3) δ 5.96 (d, J=8.0 Hz, 1H), 4.57 (dd, J=8.8, 4.9 Hz, 1H), 3.71 (s, 3H), 2.19-2.04 (m, 4H), 0.97-0.86 (m, 12H). .sup.13C NMR (100 MHz, CDCl.sub.3) δ 172.85, 172.49, 56.91, 52.19, 46.14, 31.35, 26.29, 22.56, 22.53, 19.07, 17.93
(R)-3-methyl-2-(3-methylbutanamido)butanoic acid (8b)
[0483] ##STR00066##
[0484] In a round-bottom flask, 8a (180 mg, 1.2 mmol, 1.0 equiv.) was dissolved in MeOH (24 mL) and THF (24 mL) and the solution was cooled to 0° C. using an ice bath. LiOH (1 M, 24 mL) was added dropwise and the solution was allowed to proceed from 0° C. to ambient temperature over 4 h. The solution was concentrated to one-third volume and the resulting aqueous solution was acidified to pH 3 with 10% HCl. The solution was extracted 3× with CH.sub.2Cl.sub.2, dried over Na.sub.2SO.sub.4 and concentrated. The desired product (145 mg, 0.72 mmol, 60% yield) was purified by silica column chromatography (5% MeOH in CH.sub.2Cl.sub.2+0.5% acetic acid). .sup.1H NMR (300 MHz, MeOD) δ 4.32 (d, J=5.8 Hz, 1H), 2.23-2.01 (m, 4H), 1.01-0.92 (m, 12H). .sup.13C NMR (75 MHz, MeOD) δ 175.84, 174.93, 59.00, 45.90, 31.53, 27.50, 22.76, 22.72, 19.65, 18.41.
8(A) and 8c (B)
(R)—(S)-1-(((S)-1-((2-acetamidoethyl)thio)-3-methyl-1-oxobutan-2-yl)amino)-1-oxopropan-2-yl 3-methyl-2-(3-methylbutanamido)butanoate (8)
[0485] ##STR00067##
[0486] In a round bottom flask, the alcohol 7f (25.2 mg, 0.087 mmol, 1.0 equiv.) and carboxylic acid 8b (35 mg, 0.174 mmol, 2.0 equiv.) were dissolved in DMF (1 mL). The solution was cooled to −20° C. using a dry ice/acetone bath and EDC (67 mg, 0.35 mmol, 4.0 equiv.) and DMAP (21 mg, 0.174 mmol, 2.0 equiv.) were added. The mixture was allowed to warm to ambient temperature and the reaction proceeded for 16 h. The reaction was quenched with NH.sub.4Cl(aq) and extracted 3× with EtOAc. The organic fractions were combined, washed with brine, dried over Na.sub.2SO.sub.4 and concentrated. A mixture of C-2.2 diastereomers (37.9 mg, 0.08 mmol, 92% yield) in a 5:4 ratio (A:B) was purified from the crude residue by silica column chromatography (1% to 5% MeOH in CH2Cl2). The diastereomers were separated with preparatory-TLC. 8 (A).sup.1H NMR (400 MHz, CDCl.sub.3) δ 7.21 (d, J=8.2 Hz, 1H), 6.15 (s, 1H), 5.93 (d, J=6.8 Hz, 1H), 5.35 (q, J=7.0 Hz, 1H), 4.44 167 (dd, J=8.3, 6.4 Hz, 1H), 4.29 (t, J=7.0 Hz, 1H), 3.50-3.32 (m, 2H), 3.08-2.95 (m, 2H), 2.41-2.29 (m, 1H), 2.19-2.00 (m, 4H), 1.96 (s, 3H), 1.53 (d, J=6.9 Hz, 3H), 1.05-0.92 (m, 18H). .sup.13C NMR (100 MHz, CDCl.sub.3) δ 200.14, 173-48, 171.62, 171.04, 170.65, 71.03, 64-93, 58.71, 45.66, 39-33, 30-37, 30-35, 28.75, 26.31, 23.27, 22.63, 22.57, 19.48, 19.07, 18.79, 18.11, 17.91. 8c (B).sup.1H NMR (400 MHz, CDCl.sub.3) δ 6.95 (d, J=8.7 Hz, 1H), 6.04 (s, 1H), 5.81 (d, J=7.2 Hz, 1H), 5.25 (q, J=6.8 Hz, 1H), 4.54 (dd, J=8.8, 5.9 Hz, 1H), 4.49 (dd, J=7.3, 4.7 Hz, 1H), 3.47-3.36 (m, 2H), 3.11-2.98 (m, 2H), 2.38-2.26 (m, 2H), 2.20-2.09 (m, 3H), 1.95 (s, 3H), 1.51 (d, J=6.9 Hz, 3H), 1.04 (d, J=6.9 Hz, 3H), 0.99 (dd, J=6.7, 2.5 Hz, 12H), 0.94 (d, J=6.8 Hz, 3H). .sup.13C NMR (100 MHz, CDCl.sub.3) δ 199-74, 173.66, 170.84, 170.68, 170.49, 71.63, 64.29, 57.90, 46.06, 39.32, 30.72, 30.55, 28.91, 26.35, 23.30, 22.64, 22.57, 19.42 (2C), 18.16, 17.94, 17.70. HRMS (ESI+): Exact mass calculated for C.sub.22H.sub.39N.sub.3NaO.sub.6S: 496.2452. Found: 496.2457.
Summary of Examples 1-8
[0487] We describe a strategy for genetically encoding DAP in recombinant proteins. We show that genetically encoding DAP in place of catalytic cysteines or serines enables the capture of unstable thioester or ester intermediates as their stable amide analogues. We have exemplified the utility of this approach for a cysteine protease and a thioesterase, and provided unique insight into intermediates in the synthesis of valinomycin by Vlm TE. Our results reveal the massive lid rearrangement associated with the dodecapeptidyl-bound Vlm TE. Importantly, the DAP system allows use of both widely-used, reaction competent, substrates (e.g. native proteins containing protease sites), substrate analogues (in this case SNACs), and commercially available natural products (here valinomycin, and likely other cyclic products.sup.28) to form near-native acyl-enzyme complexes.
[0488] The PCP domain, a key player in the TE domain catalytic cycle, is absent from these structures, but its binding site can be inferred from the informative dead-end inhibitor trapped PCP-TE structure of EntF.sup.46 (
[0489] One can thus assemble the known structures into a hypothetical pathway for oligomerization and cyclization (
[0490] The lid conformation and the semi-sphere-like pocket seen in the structures of dodecadepsipeptide-TE.sub.DAP are likely to be very important during the cyclization step in the thioesterase cycle. This pocket is mainly made up of hydrophobic residues, and it provides a steric barrier that prevents a dodecadepsipeptide attached to Ser/DAP2463 from extending out in a linear fashion (
[0491] The mobility of the lid seen in other studies and seen dramatically here, even when the TE domain is covalently bound with bona fide substrates, and the paucity of specific interactions between the lid and the rest of the TE domain make it unlikely that there is a single, fully defined conformation at any of these steps of the synthetic cycle. Formation of a pre-defined/templated conformation of the cyclization substrate has been proposed to facilitate cyclization in tyrocidine synthetase.sup.40, 47, while specific interaction between the lid and the polyketide substrate was proposed to do this in pikromycin synthase, but there is no evidence for these mechanisms in Vlm TE. Indeed, specific and strong binding interactions could slow the synthetic cycle, as the tetradepsipeptide must transition back and forth between being ligated to the PCP domain and to the TE domain, and the same tetradepsipeptide must assume multiple different positions in the course of a cycle. Rather, the lid conformation likely fluctuates rapidly through the cycle, “breathing” and transiently visiting reaction-competent conformations. Interestingly, a novel inhibitor to a Mycobacterium tuberculosis polyketide synthase TE domain binds between the cluster of lid helices.sup.48. It is proposed to compete with substrate binding, but such an inhibitor could also act by preventing structural rearrangements in the lid similar to those we observe here.
[0492] While we have focused on utilizing encoded DAP to provide insight into the thioesterase acyl-enzyme intermediates in the synthesis of valinomycin, the DAP system holds great promise for the study of the large variety of enzymes that feature cysteine- or serine-bound acyl-enzyme intermediates.sup.1, including natural product megaenzyme domains like other cyclizing TE domains, transglutaminase homologue condensation domains and PKS ketosynthase domains. Extensions of the approaches reported herein will facilitate the structural and biochemical characterization of diverse acyl-enzyme intermediates. In addition, by genetically encoding DAP in enzymes that proceed through acyl-enzyme intermediates.sup.49 but have unknown substrate specificity, it may be possible to covalently capture and identify native substrates.
Example 9—Expression, Purification and Activity Tests of UBE2L3-DAP
[0493] Purification of UBE2L3(C86DAP5) by GST-tag affinity purification, followed by GST-tag cleavage by TEV protease and Strep-tag affinity purification was also tested. This strategy led to a clean product.
[0494] The mass of purified UBE2L3(C86DAP5)-Strep was determined by LC-ESI-MS: LC-ESI-MS of UBE2L3(C86DAP5)-Strep before UV light irradiation: UBE2L3(C86DAP5)-Strep [1]: Expected: 19050.57 Da, Observed: 19048.79 Da; UBE2L3(C86INT); Strep [2]: Expected: 18857.53 Da, Observed: 18853.15 Da.
[0495] The deprotection of DAP5 occurs in two distinct steps. First, the photocaging group is removed under the action of UV-light, leading to a semi-deprotected intermediate. A second intramolecular reaction finally results in the completely deprotected DAP. After the purification of UBE2L3(C86DAP5), it was found that most of the protein contained the semi-deprotected intermediate (UBE2L3[C86INT]), although some of it was present in the complete photocaged form. After UV light irradiation, the protein mass was assessed again by LC-ESI-MS:
[0496] LC-ESI-MS of UBE2L3(C86DAP5)-Strep after UV light irradiation: UBE2L3(C86INT)-Strep [2]: Expected: 18857.53 Da, Observed: 18853.15 Da.
[0497] As expected UBE2L3(C86DAP5)-Strep could not be detected anymore after UV light irradiation. Indeed, only UBE2L3(C86INT)-Strep could be detected. The protein was subsequently incubated at 37° C. for 3 h and its mass assessed by LC-ESI-MS. As expected, UBE2L3(C86DAP)-Strep was detected together with UBE2L3(C86INT)-Strep.
[0498] LC-ESI-MS of UBE2L3(C86DAP5)-Strep after UV light irradiation and 3 h incubation at 37° C.: UBE2L3(C86INT)-Strep [2]: Expected: 18857.53 Da, Observed: 18853.15 Da; UBE2L3(C86DAP)-Strep [3]: Expected: 18753.59 Da, Observed: 18753.13 Da.
[0499] Unfortunately, longer incubation times at 37° C. (6 h and 16 h) did not lead to an improvement in the deprotection of UBE2L3(C86INT)-Strep. Indeed, the fraction of protein containing DAP did not appear to vary, representing about 30% of the total protein LC-ESI-MS of UBE2L3(C86DAP5)-Strep after UV light irradiation and longer incubation times. UBE2L3(C86INT)-Strep was incubated for 6 h or 16 h at 37° C. No improvement in deprotection was noticed, the fraction of protein containing DAP (approximately 30%) remained largely unchanged.
[0500] In order to test whether UBE2L3(C86DAP5), which had been irradiated with UV light and incubated overnight at 37° C., could be charged with Ub, a reaction containing 0.2 μM E1 and HA-tagged Ub in E2 loading buffer was set up. Each reaction (positive control [wt], negative control [C86A] and [C86DAP]) was performed with and without Ub (see
[0501] As expected, a higher molecular weight band could be observed for UBE2L3(wt), corresponding to the thioester-linked E2-Ub complex. In addition, a higher molecular weight band could also be detected for UBE2L3[C86DAP], corresponding to the isopeptide-linked E2-Ub complex. The incomplete conversion of UBE2L3 into a complex with Ub (
[0502] The newly formed isopeptide bond between UBE2L3(C86DAP) and Ub is redox insensitive and cannot be reduced in the presence of ß-mercaptoethanol. This is in contrast with the complex formed of UBE2L3(wt) and Ub which is redox sensitive (
[0503] To further characterise the identity of the different bands, both an anti-HA and anti-UBE2L3 blot were performed (
[0504] Finally, to characterise the chemical nature of the newly formed bond, the band corresponding to the UBE2L3(C86DAP)-Ub complex was excised and analysed by tandem mass spectrometry after tryptic digestion (performed by the Proteomics Facility, University of Bristol) Tandem mass spectrometry of isopeptide-linked UBE2L3(C86DAP)-Ub complex.
[0505] Tandem mass spectrometry unambiguously identifies the DAP modification at the desired site and the expected Gly-Gly modification on the residue which is consistent with Ub loading on DAP.
[0506] The analysis unambiguously confirmed the formation of a stable amide bond between UBE2L3(C86DAP) and Ub.
Example 10—Application In Live Cells
[0507] In this example, we demonstrate the technique in live cells.
[0508] In this example we show the invention in E. coli cells (BL21) and in mammalian cells (HEK293T).
[0509] We refer to TEV-GFP WB data provided in
[0510] In particular we refer to
[0511] Moreover we refer to
Additional Methods for Example 10
[0512] TEV(Dap)-GFP.sub.sub Trapping in E. coli
[0513] BL21 (DE3) cells co-transformed with GFPs containing plasmid and TEV containing plasmid were induced to express proteins at 20° C. 0.1 mM Dappc (DAP5) was added to media to incorporated Dappc (DAP5). After 20 h, cells were transferred to a falcon 50 mL conical centrifuge tube and irradiated by UV light (365 nm, 35 mW/cm.sup.2) for 2 min with gentle stirring. Then cells were centrifuged at 5,000 g for 5 min. The supernatant was discarded and the pellet was resuspended in fresh media containing freshly added antibiotics. Cell culture was shaken at 37° C. At each indicated time point, 5 mL of cell culture was collected and lysed in BugBuster (Merck). The total lysate was analyzed by WB (anti-Strep (ab76949, abcam) and anti-GFP (ab13970, abcam)).
[0514] TEV-GFP.sub.sub Trapping in HEK29 T Cells
[0515] HEK293T Cells were co-transfected with GFPs containing plasmid, TEV containing plasmid. 1 mM Dappc (DAP5) was added 30 min after transfection for amber suppression. 48 h after transfection, cells in 6-well plate were irradiated by UV light (365 nm, 10 mW/cm.sup.2) for 2 min. Then, the media was replaced with fresh media and incubated at 37° C. At each indicated time point, cells were collected and lysed in NP lysis buffer (Cat. No. 87787, Thermo). The total lysate was used for StrepTactinXT pulldown. Elutes from beads were analyzed by WB (anti-Strep (ab76949, abcam) and anti-GFP (ab13970, abcam)).
[0516] Supplementary Methods
[0517] List of primers used in this study. Mutated residues are depicted in uppercase.
TABLE-US-00008 Primer name Primer sequence MbY271f ggaaaggtctcgaccctgNNKaactatctgc gtaaactggatcgtattc MbY271r ggaaaggtctcagggtcggggccagcatcgg acgcag MbN311f ggaaaggtctccatggIINNKttttgccaaat gggcagcggctgcacc MbN311r ggaaaggtctcaccatggtgaattcttcca ggtgttcMgc MbY349f ggaaaggtctccatggtgNNKggcgatacc ctggatattatgcatgg MbY349r ggaaaggtctcaccatgcagctatcgccca caatttcgaagtc MbV366f ggaaaggtctccagcgcgNNKgtgggtccg gttagcctggatcgtg MbV366r ggaaaggtctcgcgctgctcagttccagat cgccatgc MbW382f ggaaaggtctctaaaccgNNKattggcgcg ggttttggcctggaacg MbW382r ggaaaggtctcggtttatcaatgccccatt cacgatcc TEV_Amb_ ggaaaggtctcgTAGggcagtccattagta fw tcaactagagatgg TEV_Amb_ ggaaaggtctcccCTActgcccatccttgg rev tttgaatccaatgc TEV_Ala_ ggaaaggtctcgGCTggcagtccattagta fw tcaactagagatgg TEV_Ala_ ggaaaggtctcccAGCctgcccatccttgg rev tttgaatccaatgc TE_for_ ttattacatatgcatcatcatcaccacca pNHD_fw tc TE_for_ ataataactcgagttagccacgcg pNHD_rev Vlm2_TE_ gtgtatatcggtggtcacTAGctgggtggc Amb_Fw catat Vlm2_TE_ atatggccacccagCTAgtgaccaccgata Amb_Rev tacac
[0518] Creation of DAPRSlib Library by Inverse PCR
[0519] Using the plasmid pBK-pylS as a template.sup.39, the library (DAPRSlib) for amino acid 6 was generated by five consecutive rounds of inverse PCR reactions using the PrimeSTAR HS DNA Polymerase (Takara Bio) following manufacturer's guidelines. Primers randomised the codons for positions Y271, N311, Y349, V366 and W382 of the pylS gene to the codons for all 20 natural amino acids (All primer are listed in Supplementary Table 1). The resulting PCR products were digested with BsaI-HF and DpnI, and circularised with T4 DNA ligase. DNA was transformed into Eletrocompetent MegaX DH10B™ TiR Electrocomp™ E. coli cells (Invitrogen) following the manufacturer's instructions and inoculated into overnight culture with appropriate antibiotic to prepare plasmid DNA. Diversity was estimated by plating serial dilutions of the transformation rescue culture on LB-agar plates with appropriate antibiotic. A library of 108 transformants that was isolated covered the theoretical diversity of the library with 97% confidence.
[0520] Selections of Active aaRS with DAP Derivatives
[0521] Selections of synthetase mutants specific for amino acids 2-6 were carried out as previously reported.sup.39 using the following libraries: DAPRSlib (Y271, N311, Y349, V366, W382), D3 (L270, Y271, L274, N311, C313), PylS fwd (A267, Y271, L274, C313, M315), Susan 1(A267, Y271, Y349, V366, W382), Susan 2 (N311, C313, V366, W382, G386), Susan 4 (A267, Y349, S364, V366, G386). Briefly, MbPylRS libraries in pBK vectors were subjected to five rounds of alternating positive and negative selection. The positive selections were performed in the presence of the desired ncAA (1 mM) using a chloramphenicol acetyl transferase reporter with an amber codon at a permissive position (codon 112) and expressing the cognate tRNA. Cells that survived the positive selection on chloramphenicol (typically 50 μg/mL) LB agar are predicted to use either a natural amino acid that is constitutively present in the cell or the ncAA added to the cell. The negative selection used a barnase reporter containing amber codons and providing the cognate tRNA, in the absence of ncAA, to remove synthetase variants that use natural amino acids.
[0522] GFP(150TAG)His6 Expression and Purification
[0523] Superfolder green fluorescent protein (sfGFP) with 6 incorporated at position 150 was expressed from pSF-sfGFP150TAG in MegaX DH10B TiR cells containing pBK_DAPRS or pBK_PylRS vector. LB broth supplemented with 12.5 μg/mL tetracycline, 25 μg/mL kanamycin and 1 mM of 6 or N.sup.ε-tert-butyloxycarbonyl-lysine (BocK) was inoculated with the transformed cells. Expression was induced with 0.2% (w/v) L-(+)-arabinose (Sigma) for 16 h at 37° C. whilst shaking at 220 rpm. Bacteria were then harvested and the protein purified by polyhistidine affinity chromatography.
[0524] His6-Lipoyl-TEV-Strep Expression and Purification
[0525] BL21 (DE3) cells were transformed with pNHD-His6-lipoyl-TEV.sub.wt-Strep, pNHD-His6-lipoyl-TEV.sub.Ala-Strep (gene is a gift from Mark Allen) 40 or co-transformed with pSF-DAPRS-PylT.sup.41 pNHD-His6-lipoyl-TEV.sub.Amber-Strep and grown on TB-agar plates containing 25 μg/mL tetracycline and (and 50 μg/mL kanamycin for co-transformed cells) overnight at 37° C. (TB media containing 25 μg/mL tetracycline (and 50 μg/mL kanamycin for co-transformed cells) was inoculated with some transformed colonies. The cultures were diluted 1:100 into TB media containing 12.5 μg/mL tetracycline (and 25 μg/mL kanamycin and 100 μM of 6 for co-transformed cells) and incubated at 37° C.; once the OD.sub.600 reached 0.5-0.7, the cultures were moved to 20° C. After 30 min of further incubation, the cultures were induced using 250 μM isopropyl β-D-1-thiogalactopyranoside (IPTG) and protein expression was carried out at 20° C. for 16 h. Cells were harvested by centrifugation and resuspended in 50 mM tris-HCl pH 7.5, 150 mM NaCl, 2 mM β-Mercaptoethanol, 1 Roche Inhibitor Cocktail tablet/50 mL, 0.5 mg/mL lysozyme (Sigma), 50 μg/mL DNase (Sigma) and lysed by sonication. The lysate was clarified by centrifugation at 39′000× g for 30 min and filtered through a 0.4 μm polyethersulfone (PES) membrane. His6-lipoyl-TEV-Strep was purified using nickel affinity chromatography (HisTrap HP column, GE Healthcare) with a linear gradient of imidazole (o mM to 500 mM). Fractions containing the protein were further purified by Strep-tag affinity purification using a 5 mL StrepTrap HP column (GE Healthcare). After sample loading, the column was washed with strep binding buffer (50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid [HEPES] pH 8.0, 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid [EDTA], 5 mM dithiothreitol [DTT]). The protein was eluted using a linear gradient of desthiobiotin (o mM to 1.25 mM). For His6-lipoyl-TEV.sub.Amber-Strep, the protein was irradiated with UV light (365 nm, 35 mWcm.sup.2, 1 min) at the end of the purification.
[0526] Ub.sub.tev Expression and Purification
[0527] BL21 (DE3) cells were transformed with pNHD-Ub-tev-His6 and grown on LB-agar plates containing 25 μg/mL tetracycline overnight at 37° C. LB media containing 25 μg/mL tetracycline was inoculated with the some colonies resulting from the transformation. The culture was diluted 1:100 into fresh LB media containing 12.5 μg/mL tetracycline; once the OD.sub.600 reached 0.5, the cultures were induced using 1 mM IPTG and protein expression was carried out at 37° C. for 6 h. Cells were harvested by centrifugation and resuspended 50 mM tris-HCl pH 7.5, 150 mM NaCl, 2 mM β-Mercaptoethanol, 1 Roche Inhibitor Cocktail tablet/50 mL, 0.5 mg/mL lysozyme (Sigma), 50 μg/mL DNase (Sigma) and lysed by sonication. The lysate was clarified by centrifugation at 39′000×g for 30 min and filtration through a 0.4 μm PES membrane. Ub was purified using nickel affinity chromatography (HisTrap HP column, GE Healthcare) with a linear gradient of imidazole (30 mM to 500 mM). The protein was dialysed overnight against 10 mM tris-HCl at 4° C. and Ub was further purified by ion exchange chromatography (HiTrapS 5 mL column, GE Healthcare) using a NaCl gradient (0-1 M mM) in 50 mM ammonium acetate, pH 4.5. Pure fractions were pooled before overnight dialysis against 20 mM tris-HCl pH 7.4. The sample was then concentrated to ˜15 mg/mL using an Amicon Ultra-15 (3 kDa MWCO) centrifugal filter device (Millipore).
[0528] Reactions of TEV with Ub.sub.tev
[0529] 15 μg of His6-lipoyl-TEV-Strep were incubated at 30° C. with 60 μg of Ub.sub.tev and allowed to react overnight in 150 μL of 50 mM HEPES pH 8.0, 150 mM NaCl, 1 mM EDTA, 5 mM DTT. 20 μL of the reaction were loaded on a 4-12% NuPAGE Bis-Tris gel (Invitrogen) and allowed to run for 45 min in 2-(n-morpholino)-ethanesulfonic acid (MES) buffer. Protein was transferred on a polyvinylidene fluoride (PVSF) membrane (Roche) using 25 mM Tris pH 8.2, 192 mM glycine, 10% (v/v) methanol. Membranes were subsequently blocked for 1 h in TBST buffer (25 mM Tris pH pH 7.4, 150 mM NaCl, 0.05% [v/v] Tween 20) containing 5% (w/v) milk powder at room temperature. Antibodies (Strep-Tactin-HRP conjugate (α Strep) [IBA Lifesciences] or P4D1 antibody (α Ub) [Enzo Life Sciences]) were added in 5% TBST-Milk and incubated at 4° C. overnight. Secondary antibody (for a Ub antibody) was added in 5% TBST-Milk and incubated at room temperature for 1 h. Blots were developed using Amersham enhanced chemiluminescence (ECL) (GE Healthcare) and a ChemiDoc XRS+ gel imaging system (Bio-Rad).
[0530] Analysis of Intracellular Concentration of DAP Derivatives
[0531] The analysis of intracellular concentration of DAP derivatives was performed as previously described.sup.41. In short, DAP derivatives were added to a 5 mL solution of LB media to a final concentration of 1 mM. A control sample was also prepared with 5 mL of unsupplemented LB media. Each solution was inoculated with DH10B cells. The cultures were agitated at 220 rpm in the dark at 37° C. for 12 h. The OD.sub.600 of each sample was determined, and the cells from each culture were harvested. The cell pellets were washed three times with 1 mL of fresh ice-cold LB media by cycles of resuspension and centrifugation. The washed cell pellets were resuspended in a methanol:water solution (60:40). Zirconium beads (0.1 mm) were added to each suspension. The suspensions were vortexed for 12 min to lyse the cells. The lysate was centrifuged at 21000×g for 30 min at 4° C. The supernatant was carefully removed, and placed into a fresh 1.5 mL Eppendorf tube. The solutions were centrifuged again at 21000×g for 2 h at 4° C. A 100 μl aliquot of the supernatant from the resulting sample was analyzed by LC-ESI-MS. A gradient of 0.5% to 95% acetonitrile in water was applied to elute the clarified lysates from a Zorbax C18 (4.6×150 mm) column. The concentrations were estimated using an estimate of 8×10.sup.8 cells per 1 OD.sub.600 unit and a cell volume of 0.6×10.sup.−15 L.
[0532] Cloning, Expression and Purification of Vlm TE Constructs
[0533] A codon-optimized construct containing vlm2.sub.PCP.sub.
[0534] TE domains were heterologously expressed in E. coli BL21(DE3) cells transformed with pJExpress411-vlm2-TE.sub.wt (TE.sub.wt) or co-transformed with pNHD-Vlm2-TE.sub.amber2463 and pSF-DAPRS-PylT (TE.sub.DAP). Cultures expressing TE.sub.wt were grown in LB media supplemented with 17 mg L.sup.−1 of kanamycin. Those expressing TE.sub.DAP were grown in TB media supplemented with 25 mg L.sup.−1 of kanamycin, 12.5 mg L.sup.−1 of tetracycline, 0.1 mM of 6 (a 100 mM stock solution of 6 was prepared in 0.4 M NaOH, added to the culture and neutralised using 5 M HCl). Cultures were incubated at 37° C., with agitation at 220 r.p.m, until they reached an OD.sub.600 nm=0.6, after which they were incubated at 16° C. for 30 min, and then expression was induced with 100 μM IPTG. Cultures were incubated for an additional 16 hours at 16° C. before harvesting by centrifugation at 5000 g for 20 min. Cell pellets were stored at −80° C.
[0535] For protein purification, cell pellets of TE.sub.wt were resuspended in 5 mL of buffer wt-A (50 mM TRIS pH 7.4, 150 mM NaCl, 50 mM imidazole, 2 mM β-mercaptoethanol [βME]) plus DNAseI (Bioshop) per g of wet cells, and lysed by sonication. Lysate was clarified by centrifugation at 40 000 g for 20 min. Clarified lysate was applied to two 5 mL HiTrap IMAC FF (GE Healthcare Life Sciences) columns connected in series on an AKTA Prime system (GE Healthcare Life Sciences). Bound protein was eluted with buffer wt-B (buffer wt-A plus 150 mM imidazole). Fractions containing TE.sub.wt (as determined by SDS-PAGE analysis) were pooled and incubated with TEV protease in a 1:100 (Te:TEV) mass/mass ratio and dialyzed against buffer wt-C(50 mM TRIS pH 7.4, 10 mM NaCl, 2 mM βME) for 16 hours at 4° C. The dialyzed sample was applied to two 5 mL HiTrap IMAC FF columns connected in series, pre-equilibrated in buffer wt-A. Cleaved protein was recovered from the flow through and applied to two 5 mL HiTrap Q HP columns connected in series, pre-equilibrated in buffer Q-A (50 mM TRIS pH 7.4, 10 mM NaCl, 2 mM βME). Protein was eluted by a gradient of 0 to 100% buffer Q-B (50 mM TRIS pH 7.4, 500 mM NaCl, 2 mM βME) over 240 mL. TE.sub.wt-containing fractions were concentrated in a 10 kDa molecular weight cut off Amicon® Ultra centrifugal filter (Millipore) and injected onto a Superdex S-200 16/60 PG column (GE-Healthcare) pre-equilibrated in SEC buffer (25 mM HEPES pH 7.4 or pH 8.0, 100 mM NaCl, 0.2 mM tris(2-carboxyethyl)phosphine [TCEP]). Fractions containing purified TE.sub.wt were pooled, concentrated and flash frozen.
[0536] Cell resuspension, lysis, clarification and Ni-IMAC purification for TE.sub.DAP were performed as described for Te.sub.wt, except that prolonged exposure to light was avoided. After elution from the Ni-IMAC column, the sample was irradiated with UV light (365 nm, 35 mWcm.sup.−2, 1 min). TEV cleavage and the subsequent IMAC column were performed as described for TE.sub.wt, except that a 1:1 TE:TEV ratio was used. Anion exchange was performed as described for Te.sub.wt, except that 25 mM HEPES replaced TRIS as the buffer and 0.2 mM TCEP replaced βME as the reducing agent in the mobile phases. Relevant fractions were concentrated and injected onto a Superdex S-75 10/300 column pre-equilibrated in buffer T (25 mM HEPES pH 8.0, 100 mM NaCl, 0.2 mM TCEP). Fractions containing purified TE.sub.DAP were pooled, concentrated, and immediately used for further experiments. The yield of purified TE.sub.wt was 30-60 mg per L, the yield of purified TE.sub.DAP was 0.1-0.5 mg per L.
[0537] Crystallography
[0538] Crystallization conditions for TE.sub.wt structure 1 were found in vapour diffusion crystallization trials using commercially available screens (Qiagen) and a protein concentration of 10 mg mL.sup.−1. Optimization of an initial crystallization hit in 24-well plates led to a final crystallization condition where 3.2 μL of 10 mg mL.sup.−1 TE.sub.wt, 4.0 μL 1.65 M DL-malic acid pH 9.5, and 0.8 μL of 17% m/v IPTG were incubated against a reservoir solution of 500 μL of 1.65 M DL-malic acid pH 9.5. TE.sub.wt structure 2 crystals were grown in similar conditions, where 0.5 μL of purified TE.sub.wt 50 at 22.4 mg mL.sup.−1 and 0.5 μL of 1.65 M DL-malic acid pH 8.1 were incubated against a reservoir solution of 500 μL of DL-malic acid pH 8.1. Crystals appeared between 24 and 48 hours and reached their maximum size in approximately one week.
[0539] Crystals of unliganded TE.sub.DAP were grown in similar conditions to TE.sub.wt, with a reservoir solution of 1.65 M DL-malic acid pH 8.0. In order to obtain the tetradepsipeptidyl-TE.sub.DAP complex structure, TE.sub.DAP crystals were incubated with deoxytetradepsipeptidyl-SNAC 8 once they achieved their maximum size. The reservoir solution was exchanged to 2.66 M DL-malic acid, pH 9.5, and 32 μL of a solution of 1 mM deoxytetradepsipeptidyl-SNAC, 2.66 M DL-malic acid pH 9.5, 100 mM NaCl, 25 mM HEPES pH 9.2, 10% DMSO was added to the drop. Crystals were incubated in this condition for 9 days at room temperature.
[0540] For dodecadepsipeptidyl-TE.sub.DAP complex crystals, TE.sub.DAP (0.1 mg mL.sup.−1) was incubated in a 1.1 mg mL.sup.−1 suspension of valinomycin in buffer T for 16 hours at room temperature. The sample was centrifuged at 20 000 g and applied to a Superdex S-75 10/300 column preequilibrated in buffer T to remove excess valinomycin. Relevant fractions were pooled and complex formation was evaluated by LC-ESI-MS (see below). The sample was concentrated to 13.4 mg mL.sup.−1 and diffraction-quality crystals, with a different morphology from the TE.sub.wt crystals, were obtained in sitting drops consisting of 1 μL of dodecadepsipeptidyl-TE.sub.DAP complex plus 1 μL reservoir solution (1.30 to 1.45 M DL-malic acid pH 8.1) equilibrated against 500 μL reservoir solution. In an attempt to improve the occupancy of the ligand, a subset of these crystals were further incubated with valinomycin, by addition of 20 μL of a solution containing 555 μM valinomycin, 2 M DL-malic acid pH 8.1, 11 mM HEPES pH 8.0, 44 mM NaCl, 0.088 mM TCEP for 24 hours.
[0541] TE.sub.wt and dodecadepsipeptidyl-TE.sub.DAP crystals were cryo-protected by addition of 10 μL (TE.sub.wt structure 1 and dodecadepsipeptidyl-TE.sub.DAP) or 20 μL (TE.sub.wt structure 2) 3.6 M DL-malic acid pH 8.1 to the crystallization drop. For dodecadepsipeptidyl-TeDAP crystals that had been incubated with valinomycin, the drop solution was removed and replaced by 10 μL of 3.6 M DL-malic acid. Crystals were equilibrated for at least two minutes and then flash cooled in liquid nitrogen. Tetradepsipeptidyl-TE.sub.DAP complex crystals were looped and flash cooled directly from the incubating solution. TE.sub.wt data were first collected at the Centre for Structural Biology at McGill University, Montreal, Canada, on a Rigaku RUH3R generator and a R-AXIS IV++ detector. Higher resolution data for TE.sub.wt and depsipeptidyl-TE.sub.DAP complexes were collected at the Canadian Light Source (CLS) 08ID-1 beamline or at the Advanced Photon Source (APS) NE-CAT 24-ID-C beamline using a Pilatus detector (Extended Data Table 1).
[0542] TE.sub.wt Structure Determination
[0543] Diffraction data from TE.sub.wt structure 1 crystals were indexed and integrated in the space group P432 using iMosfim.sup.47 or DIALS.sup.48. Further space group determination and scaling were performed using the programs POINTLESS and SCALA.sup.49. The structure was solved by molecular replacement using PHASER.sup.50, with a SCULPTOR.sup.51 modified version of the TE domain of srfA-C (PDB ID 2VSQ).sup.52 as a search model. The structure was iteratively refined and built with the programs Phenix.sup.53 and AUTOBUILD.sup.54. Coot.sup.55 was used for iterative model building. Topology diagrams were generated using TopDraw.sup.56 based on results from PDBsum generate (http://www.ebi.ac.uk/thornton-srv/databases/pdbsum/Generate.html) using the TE-.sub.wt structure as input.
[0544] Diffraction data sets collected from dodecadepsipeptidyl-TE.sub.DAP complex crystals were indexed into either P1 or H3 space groups using iMosfim.sup.47 or DIALS.sup.48. Most crystals belonging to the H3 group showed evidence of twinning, and only non-twinned diffraction data were used for structure determination. Structures in both the P1 and H3 space groups were solved by molecular replacement using PHASER.sup.50, with the TE.sub.wt structure lacking residues 2500-2647 used as a search model. The P1 structure had six molecules in the asymmetric unit whereas the H3 structure contained 2 molecules in the asymmetric unit. All depsipeptidyl-TE.sub.DAP models were refined, and mF.sub.o-F.sub.c maps were generated before depsipeptide residues were built in the model (
[0545] Depsipeptidyl-TE Complex Formation
[0546] TE.sub.DAP or TE.sub.wt at a final concentration of 0.2 mg mL.sup.−1 was incubated with tetradepsipeptidyl-SNAC 7 (1.7 mM), or valinomycin (50 μM) in buffer T containing 1.7% or 1% v/v DMSO for 16 hours. Reactions were concentrated in a 10 kDa molecular weight cut off Amicon® Ultra centrifugal filter (Millipore), clarified by centrifugation at 20 000 g and applied to a Superdex S-75 10/300 column pre-equilibrated in buffer T to remove excess depsipeptidyl-SNACs or valinomycin before final LC-ESI-MS analysis. To form the deoxytetradepsipeptidyl-TE.sub.DAP complex, TE.sub.DAP at a final concentration of 8.7 mg mL.sup.−1 was incubated with deoxytetradepsipeptidyl-SNAC 8 (2.6 mM) in 25 mM HEPES pH 8.6, 100 mM NaCl, 3.8% v/v DMSO for 40 hours. The sample was diluted in 100 mM ammonium bicarbonate pH 8.0 before final LC-ESI-MS analysis. All incubations were performed at room temperature.
[0547] LC-ESI-MS Analysis of Intact Proteins
[0548] For experiments shown in
[0549] For experiments shown in
[0550] Tandem MS/MS Analysis
[0551] Proteins were run on 4-12% NuPAGE Bis-Tris gel (Invitrogen) with MES buffer and briefly stained using InstantBlue (Expedeon). The bands were excised and stored in 20 mM Tris pH 7.4. Tryptic digestion and tandem MS/MS analyses were performed by Kate Heesom (Proteomics Facility, University of Bristol).
[0552] LC-ESI-MS Analysis of Vlm TE Reaction Products
[0553] Purified TE.sub.wt or TE.sub.DAP at 0.2 mg mL.sup.−1 (6.5 μM) was incubated with tetradepsipeptidyl-SNAC 7 (1.7 mM), or a mix of tetradepsipeptidyl-SNAC 7 and deoxytetradepsipeptidyl-SNAC 8 (1.7 mM each) in buffer T. Samples were incubated at room temperature for 24 hours, and then quenched with one volume of 0.1% formic acid in acetonitrile. Next, samples were centrifuged at 20,000 g, flash frozen in liquid nitrogen and stored at −80° C. before HPLC analysis. For HPLC-MS analysis, frozen samples were thawed at room temperature, vortexed and clarified by centrifugation at 20,000 g before injection. HR-LC-ESI-MS was performed at the Mass Spectroscopy Facility (Department of Chemistry, McGill University) with an Agilent XDB-C8 (5 μm, 4.6×150 mm) column in a Dionex Ultimate 3000 UHPLC system coupled to a Bruker maXis impact QTOF mass spectrometer in positive ESI mode. Ion-trap LC-ESI-MS analysis was performed in an Agilent Technologies 1260 Infinity HPLC system coupled to a Bruker Amazon Speed ETD ion trap mass spectrometer in positive ESI mode. The column compartment was set up at 40° C. throughout the runs. Starting HPLC conditions were 50% mobile phase A (0.1% formic acid in H.sub.2O), 50% mobile phase B (0.1% formic acid in acetonitrile). After injection (1 μL for HR-LC-ESI-MS and 5 μL for ion-trap LC-ESI-MS), a gradient from 50% to 98% mobile phase B in 5 minutes was performed, followed by an isocratic step of 98% mobile phase B, run for 20 minutes. For HR-LC-ESI-MS, internal calibration was performed with an intra-run infusion at the beginning of the first analysis using Na.sup.+ formate, and the resulting calibration was used as an external calibration for subsequent analysis. Ion trap external calibration was performed using the Agilent ESI tune mix. Data was analyzed using the Bruker DataAnalysis software and the SmartFormula tool (Bruker).
REFERENCES TO EXAMPLES 1-9
[0554] 1. Holliday, G. L., Mitchell, J. B. O. & Thornton, J. M. Understanding the Functional Roles of Amino Acid Residues in Enzyme Catalysis. Journal of molecular biology 390, 560-577 (2009). [0555] 2. Di Cera, E. Serine proteases. IUBMB Life 61, 510-515 (2009). [0556] 3. Hedstrom, L. Serine protease mechanism and specificity. Chem Rev 102, 4501-4523 (2002). [0557] 4. Long, J. Z. & Cravatt, B. F. The Metabolic Serine Hydrolases and Their Functions in Mammalian Physiology and Disease. Chem Rev 111, 6022-6063 (2011). [0558] 5. Verma, S., Dixit, R. & Pandey, K. C. Cysteine Proteases: Modes of Activation and Future Prospects as Pharmacological Targets. Front Pharmacol 7 (2016). [0559] 6. Otto, H. H. & Schirmeister, T. Cysteine proteases and their inhibitors. Chem Rev 97, 133-171 (1997). [0560] 7. Swatek, K. N. & Komander, D. Ubiquitin modifications. Cell Res 26, 399-422 (2016). [0561] 8. Yang, W. & Drueckhammer, D. G. Understanding the relative acyl-transfer reactivity of oxoesters and thioesters: computational analysis of transition state delocalization effects. Journal of the American Chemical Society 123, 11004-11009 (2001). [0562] 9. Liu, B., Schofield, C. J. & Wilmouth, R. C. Structural analyses on intermediates in serine protease catalysis. Journal of Biological Chemistry 281, 24024-24035 (2006). [0563] 10. Ngo, P. D., Mansoorabadi, S. O. & Frey, P. A. Serine Protease Catalysis: A Computational Study of Tetrahedral Intermediates and Inhibitory Adducts. J Phys Chem B 120, 7353-7359 (2016). [0564] 11. Cleary, J. A., Doherty, W., Evans, P. & Malthouse, J. P. G. Quantifying tetrahedral adduct formation and stabilization in the cysteine and the serine proteases. Bba-Proteins Proteom 1854, 1382-1391 (2015). [0565] 12. Scaglione, J. B. et al. Biochemical and structural characterization of the tautomycetin thioesterase: analysis of a stereoselective polyketide hydrolase. Angew Chem Int Ed Engl 49, 5726-5730 (2010). [0566] 13. Cappadocia, L. & Lima, C. D. Ubiquitin-like Protein Conjugation: Structures, Chemistry, and Mechanism. Chem Rev 118, 889-918 (2018). [0567] 14. Plechanovova, A., Jaffray, E. G., Tatham, M. H., Naismith, J. H. & Hay, R. T. Structure of a RING E3 ligase and ubiquitin-loaded E2 primed for catalysis. Nature 489, 115-U135 (2012). [0568] 15. Hay, R. W. & Morris, P. J. Interaction of Dl-2,3-Diaminopropionic Acid and Its Methyl Ester with Metal Ions 0.1. Formation Constants. J Chem Soc A, 3562-& (1971). [0569] 16. Lan, Y. et al. Incorporation of 2,3-Diaminopropionic Acid into Linear Cationic Amphipathic Peptides Produces pH-Sensitive Vectors. Chembiochem 11, 1266-1272 (2010). [0570] 17. Radzicka, A. & Wolfenden, R. Rates of uncatalyzed peptide bond hydrolysis in neutral solution and the transition state affinities of proteases. Journal of the American Chemical Society 118, 6105-6109 (1996). [0571] 18. Hoyer, K. M., Mahlert, C. & Marahiel, M. A. The iterative gramicidin s thioesterase catalyzes peptide ligation and cyclization. Chemistry & biology 14, 13-22 (2007). [0572] 19. Alonzo, D. A., Magarvey, N. A. & Schmeing, T. M. Characterization of cereulide synthetase, a toxin-producing macromolecular machine. PloS one 10, e0128569 (2015). [0573] 20. Magarvey, N. A., Ehling-Schulz, M. & Walsh, C. T. Characterization of the cereulide NRPS alpha-hydroxy acid specifying modules: activation of alpha-keto acids and chiral reduction on the assembly line. Journal of the American Chemical Society 128, 10698-10699 (2006). [0574] 21. Shaw-Reid, C. A. et al. Assembly line enzymology by multimodular nonribosomal peptide synthetases: the thioesterase domain of E. coli EntF catalyzes both elongation and cyclolactonization. Chemistry & biology 6, 385-400 (1999). [0575] 22. May, J. J., Wendrich, T. M. & Marahiel, M. A. The dhb operon of Bacillus subtilis encodes the biosynthetic template for the catecholic siderophore 2,3-dihydroxybenzoate-glycine-threonine trimeric ester bacillibactin. J Biol Chem 276, 7209-7217 (2001). [0576] 23. Zhou, Y. et al. Iterative Mechanism of Macrodiolide Formation in the Anticancer Compound Conglobatin. Chemistry & biology 22, 745-754 (2015). [0577] 24. Robbel, L., Hoyer, K. M. & Marahiel, M. A. TioS T-TE—a prototypical thioesterase responsible for cyclodimerization of the quinoline- and quinoxaline-type class of chromodepsipeptides. FEBS J276, 1641-1653 (2009). [0578] 25. Jaitzig, J., Li, J., Sussmuth, R. D. & Neubauer, P. Reconstituted biosynthesis of the nonribosomal macrolactone antibiotic valinomycin in Escherichia coli. ACS Synth Biol 3, 432-438 (2014). [0579] 26. Akey, D. L. et al. Structural basis for macrolactonization by the pikromycin thioesterase. Nat Chem Biol 2, 537-542 (2006). [0580] 27. Samel, S. A., Wagner, B., Marahiel, M. A. & Essen, L. O. The thioesterase domain of the fengycin biosynthesis cluster: a structural base for the macrocyclization of a non-ribosomal lipopeptide. Journal of molecular biology 359, 876-889 (2006). [0581] 28. Tseng, C. C. et al. Characterization of the surfactin synthetase C-terminal thioesterase domain as a cyclic depsipeptide synthase. Biochemistry 41, 13350-13359 (2002). [0582] 29. Bruner, S. D. et al. Structural basis for the cyclization of the lipopeptide antibiotic surfactin by the thioesterase domain SrfTE. Structure 10, 301-310 (2002). [0583] 30. Li, J. et al. Palladium-triggered deprotection chemistry for protein activation in living cells. Nat Chem 6, 352-361 (2014). [0584] 31. Baker, A. S. & Deiters, A. Optical Control of Protein Function through Unnatural Amino Acid Mutagenesis and Other Optogenetic Approaches. Acs Chemical Biology 9, 1398-1407 (2014). [0585] 32. Nguyen, D. P. et al. Genetic Encoding of Photocaged Cysteine Allows Photoactivation of TEV Protease in Live Mammalian Cells. Journal of the American Chemical Society 136, 2240-2243 (2014). [0586] 33. Nguyen, D. P., Elliott, T., Holt, M., Muir, T. W. & Chin, J. W. Genetically Encoded 1,2-Aminothiols Facilitate Rapid and Site-Specific Protein Labeling via a Bio-orthogonal Cyanobenzothiazole Condensation. Journal of the American Chemical Society 133, 11418-11421 (2011). [0587] 34. Neumann, H., Peak-Chew, S. Y. & Chin, J. W. Genetically encoding N-epsilon-acetyllysine in recombinant proteins. Nature Chemical Biology 4, 232-234 (2008). [0588] 35. Chin, J. W. Expanding and Reprogramming the Genetic Code of Cells and Animals. Annu Rev Biochem 83, 379-408 (2014). [0589] 36. Liu, C. C. & Schultz, P. G. Adding New Chemistries to the Genetic Code. Annual Review of Biochemistry, Vol 79 79, 413-444 (2010). [0590] 37. Zhang, M. S. et al. Biosynthesis and genetic encoding of phosphothreonine through parallel selection and deep sequencing. Nat Methods 14, 729-736 (2017). [0591] 38. Virdee, S., Ye, Y., Nguyen, D. P., Komander, D. & Chin, J. W. Engineered diubiquitin synthesis reveals Lys29-isopeptide specificity of an OTU deubiquitinase. Nature Chemical Biology 6, 750-757 (2010). [0592] 39. Phan, J. et al. Structural basis for the substrate specificity of tobacco etch virus protease. Journal of Biological Chemistry 277, 50564-50572 (2002). [0593] 40. Trauger, J. W., Kohli, R. M., Mootz, H. D., Marahiel, M. A. & Walsh, C. T. Peptide cyclization catalysed by the thioesterase domain of tyrocidine synthetase. Nature 407, 215-218 (2000). [0594] 41. Zhou, Y., Prediger, P., Dias, L. C., Murphy, A. C. & Leadlay, P. F. Macrodiolide formation by the thioesterase of a modular polyketide synthase. Angew Chem Int Ed Engl 54, 5232-5235 (2015). [0595] 42. Horsman, M. E., Hari, T. P. A. & Boddy, C. N. Polyketide synthase and non-ribosomal peptide synthetase thioesterase selectivity: Logic gate or a victim of fate? Natrual Products Reports (2015). [0596] 43. Frueh, D. P. et al. Dynamic thiolation-thioesterase structure of a non-ribosomal peptide synthetase. Nature 454, 903-906 (2008). [0597] 44. Whicher, J. R. et al. Structure and function of the RedJ protein, a thioesterase from the prodiginine biosynthetic pathway in Streptomyces coelicolor. J Biol Chem 286, 22558-22569 (2011). [0598] 45. Ekici, O.D., Paetzel, M. & Dalbey, R. E. Unconventional serine proteases: variations on the catalytic Ser/His/Asp triad configuration. Protein Sci 17, 2023-2037 (2008). [0599] 46. Liu, Y., Zheng, T. & Bruner, S. D. Structural basis for phosphopantetheinyl carrier domain interactions in the terminal module of nonribosomal peptide synthetases. Chemistry & biology 18, 1482-1488 (2011). [0600] 47. Trauger, J. W., Kohli, R. M. & Walsh, C. T. Cyclization of backbone-substituted peptides catalyzed by the thioesterase domain from the tyrocidine nonribosomal peptide synthetase. Biochemistry 40, 7092-7098 (2001). [0601] 48. Aggarwal, A. et al. Development of a Novel Lead that Targets M. tuberculosis Polyketide Synthase 13. Cell 170, 249-259 e225 (2017). [0602] 49. Cravatt, B. F., Wright, A. T. & Kozarich, J. W. Activity-based protein profiling: from enzyme chemistry to proteomic chemistry. Annu Rev Biochem 77, 383-414 (2008). [0603] 50. McGall, G. H. et al. The efficiency of light-directed synthesis of DNA arrays on glass substrates. Journal of the American Chemical Society 119, 5081-5090, doi:DOI 10.1021/ja964427a (1997). [0604] 51. Pendrak, I., Wittrock, R. & Kingsbury, W. D. Synthesis and Anti-Hsv Activity of Methylenedioxy Mappicine Ketone Analogs. J Org Chem 60, 2912-2915, doi:DOI 10.1021/jo00114a050 (1995).
REFERENCES TO SUPPLEMENTARY METHODS
[0605] 31 Alonzo, D. A., Magarvey, N. A. & Schmeing, T. M. Characterization of cereulide synthetase, a toxin-producing macromolecular machine. PloS one 10, e0128569, doi:10.1371/journal.pone.0128569 (2015). [0606] 32 Shaw-Reid, C. A. et al. Assembly line enzymology by multimodular nonribosomal peptide synthetases: the thioesterase domain of E. coli EntF catalyzes both elongation and cyclolactonization. Chemistry & biology 6, 385-400, doi:10.1016/S1074-5521(99) 80050-7 (1999). [0607] 33 May, J. J., Wendrich, T. M. & Marahiel, M. A. The dhb operon of Bacillus subtilis encodes the biosynthetic template for the catecholic siderophore 2,3-dihydroxybenzoate-glycine-threonine trimeric ester bacillibactin. J Biol Chem 276, 7209-7217, doi:10.1074/jbc. M009140200 (2001). [0608] 34 Zhou, Y. et al. Iterative Mechanism of Macrodiolide Formation in the Anticancer Compound Conglobatin. Chemistry & biology 22, 745-754, doi:10.1016/j.chembiol.2015.05.010 (2015). [0609] 35 Robbel, L., Hoyer, K. M. & Marahiel, M. A. TioS T-TE—a prototypical thioesterase responsible for cyclodimerization of the quinoline- and quinoxaline-type class of chromodepsipeptides. FEBS J 276, 1641-1653, doi:10.1111/j.1742-4658.2009.06897.x (2009). [0610] 36 Liu, Y., Zheng, T. & Bruner, S. D. Structural basis for phosphopantetheinyl carrier domain interactions in the terminal module of nonribosomal peptide synthetases. Chemistry & biology 18, 1482-1488, doi:10.1016/j.chembiol.2011.09.018 (2011). [0611] 37 Trauger, J. W., Kohli, R. M. & Walsh, C. T. Cyclization of backbone-substituted peptides catalyzed by the thioesterase domain from the tyrocidine nonribosomal peptide synthetase. Biochemistry 40, 7092-7098 (2001). [0612] 38 Aggarwal, A. et al. Development of a Novel Lead that Targets M. tuberculosis Polyketide Synthase 13. Cell 170, 249-259 e225, doi:10.1016/j.cell.2017.06.025 (2017). [0613] 39 Neumann, H., Peak-Chew, S. Y. & Chin, J. W. Genetically encoding N(epsilon)-acetyllysine in recombinant proteins. Nat Chem Biol 4, 232-234, doi:10.1038/nchembi0.73 (2008). [0614] 40 Rogerson, D. T. et al. Efficient genetic encoding of phosphoserine and its nonhydrolyzable analog. Nat Chem Biol 11, 496-503, doi:10.1038/nchembi0.1823 (2015). [0615] 41 Zhang, M. S. et al. Biosynthesis and genetic encoding of phosphothreonine through parallel selection and deep sequencing. Nat Methods 14, 729-736, doi:10.1038/nmeth.4302 (2017). [0616] 42 McGall, G. H. et al. The efficiency of light-directed synthesis of DNA arrays on glass substrates. Journal of the American Chemical Society 119, 5081-5090, doi:DOI 10.1021/ja964427a (1997). [0617] 43 Nguyen, D. P. et al. Genetic encoding of photocaged cysteine allows photoactivation of TEV protease in live mammalian cells. Journal of the American Chemical Society 136, 2240-2243, doi:10.1021/ja412191m (2014). [0618] 44 Pendrak, I., Wittrock, R. & Kingsbury, W. D. Synthesis and Anti-Hsv Activity of Methylenedioxy Mappicine Ketone Analogs. J Org Chem 60, 2912-2915, doi:DOI 10.1021/jo00114a050 (1995). [0619] 45 Mayer, S. C., Ramanjulu, J., Vera, M. D., Pfizenmayer, A. J. & Joullie, M. M. Synthesis of New Didemnin B Analogs for Investigations of Structure/Biological Activity Relationships. J Org Chem 59, 5192-5205, doi:10.1021/jo00097a022 (1994). [0620] 46 Faure, S. et al. Asymmetric intramolecular [2+2] photocycloadditions: alpha- and beta-hydroxy acids as chiral tether groups. J Org Chem 67, 1061-1070, doi:10.1021/jo001631e (2002). [0621] 47 Battye, T. G., Kontogiannis, L., Johnson, O., Powell, H. R. & Leslie, A. G. iMOSFLM: a new graphical interface for diffraction-image processing with MOSFLM. Acta crystallographica. Section D, Biological crystallography 67, 271-281, doi:10.1107/S0907444910048675 (2011). [0622] 48 Winter, G. et al. DIALS: implementation and evaluation of a new integration package. Acta crystallographica. Section D, Structural biology 74, 85-97, doi:10.1107/S2059798317017235 (2018). [0623] 49 Evans, P. Scaling and assessment of data quality. Acta crystallographica. Section D, Biological crystallography 62, 72-82, doi:10.1107/S0907444905036693 (2006). [0624] 50 McCoy, A. J. et al. Phaser crystallographic software. Journal of applied crystallography 40, 658-674, doi:10.1107/S0021889807021206 (2007). [0625] 51 Bunkoczi, G. & Read, R. J. Improvement of molecular-replacement models with Sculptor. Acta crystallographica. Section D, Biological crystallography 67, 303-312, doi:10.1107/S0907444910051218 (2011). [0626] 52 Tanovic, A., Samel, S. A., Essen, L. O. & Marahiel, M. A. Crystal structure of the termination module of a nonribosomal peptide synthetase. Science 321, 659-663, doi:10.1126/science.1159850 (2008). [0627] 53 Adams, P. D. et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta crystallographica. Section D, Biological crystallography 66, 213-221, doi:10.1107/S0907444909052925 (2010). [0628] 54 Terwilliger, T. C. et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta crystallographica. Section D, Biological crystallography 64, 61-69, doi:10.1107/S090744490705024X (2008). [0629] 55 Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. Features and development of Coot. Acta crystallographica. Section D, Biological crystallography 66, 486-501, doi:10.1107/S0907444910007493 (2010). [0630] 56 Bond, C. S. TopDraw: a sketchpad for protein structure topology cartoons. Bioinformatics 19, 311-312 (2003). [0631] 57 Long, F. et al. AceDRG: a stereochemical description generator for ligands. Acta crystallographica. Section D, Structural biology 73, 112-122, doi:10.1107/S2059798317000067 (2017). [0632] 58 Vagin, A. A. et al. REFMAC5 dictionary: organization of prior chemical knowledge and guidelines for its use. Acta crystallographica. Section D, Biological crystallography 60, 2184-2195, doi:10.1107/S0907444904023510 (2004). [0633] 59 Murshudov, G. N. et al. REFMAC5 for the refinement of macromolecular crystal structures. Acta crystallographica. Section D, Biological crystallography 67, 355-367, doi:10.1107/S0907444911001314 (2011). [0634] 60 Korman, T. P. et al. Structure and function of an iterative polyketide synthase thioesterase domain catalyzing Claisen cyclization in aflatoxin biosynthesis. Proceedings of the National Academy of Sciences of the United States of America 107, 6246-6251, doi:10.1073/pnas.0913531107 (2010). [0635] 61 Gehret, J. J. et al. Terminal alkene formation by the thioesterase of curacin A biosynthesis: structure of a decarboxylating thioesterase. J Biol Chem 286, 14445-14454, doi:10.1074/jbc. M110.214635 (2011). [0636] 62 Tsai, S. C. et al. Crystal structure of the macrocycle-forming thioesterase domain of the erythromycin polyketide synthase: versatility from a unique substrate channel. Proceedings of the National Academy of Sciences of the United States of America 98, 14808-14813, doi:10.1073/pnas.011399198 (2001). [0637] 63 Tsai, S. C., Lu, H., Cane, D. E., Khosla, C. & Stroud, R. M. Insights into channel architecture and substrate specificity from crystal structures of two macrocycle-forming thioesterases of modular polyketide synthases. Biochemistry 41, 12598-12606 (2002). [0638] 64 Argyropoulos, P. et al. Towards a characterization of the structural determinants of specificity in the macrocyclizing thioesterase for deoxyerythronolide B biosynthesis. Biochim Biophys Acta 1860, 486-497, doi:10.1016/j.bbagen.2015.11.007 (2016). [0639] 65 Giraldes, J. W. et al. Structural and mechanistic insights into polyketide macrolactonization from polyketide-based affinity labels. Nat Chem Biol 2, 531-536, doi:10.1038/nchembio822 (2006). [0640] 66 Koglin, A. et al. Structural basis for the selectivity of the external thioesterase of the surfactin synthetase. Nature 454, 907-911, doi:10.1038/nature07161 (2008). [0641] 67 Drake, E. J. et al. Structures of two distinct conformations of holo-non-ribosomal peptide synthetases. Nature 529, 235-238, doi:10.1038/nature16163 (2016). [0642] 68 Gavalda, S. et al. The polyketide synthase Pksl3 catalyzes a novel mechanism of lipid transfer in mycobacteria. Chemistry & biology 21, 1660-1669, doi:10.1016/j.chembiol.2014.10.011 (2014). [0643] 69 Guntaka, N. S., Healy, A. R., Crawford, J. M., Herzon, S. B. & Bruner, S. D. Structure and Functional Analysis of ClbQ, an Unusual Intermediate-Releasing Thioesterase from the Colibactin Biosynthetic Pathway. ACS Chem Biol 12, 2598-2608, doi:10.1021/acschembi0.7b00479 (2017).
[0644] Although illustrative embodiments of the invention have been disclosed in detail herein, with reference to the accompanying drawings, the reader should note that the invention is not limited to those precise embodiments and that various changes and modifications can be effected therein by one skilled in the art without departing from the scope of the invention as defined by the appended claims and their equivalents.