TARGET NUCLEIC ACID DETECTION METHOD BASED ON PROXIMITY PROTEOLYSIS REACTION

Abstract

A method for detecting a target nucleic acid includes: (a) a step of mixing a sample containing the target nucleic acid with a nucleic acid detection solution containing i) ssDNA-protease conjugate, ii) ssDNA-zymogen conjugate, and iii) a substrate specific for the zymogen; and (b) a step of detecting a signal generated by a proximity proteolysis reaction between the ssDNA-zymogen conjugate and the ssDNA-protease conjugate which are hybridized to the target nucleic acid.

Claims

1. A method for detecting a target nucleic acid, the method comprising: (a) mixing a sample containing the target nucleic acid with a nucleic acid detection solution containing: i) a ssDNA-protease conjugate in which ssDNA having a sequence complementary to the target nucleic acid is bound to a protease; ii) a ssDNA-zymogen conjugate in which ssDNA having a sequence complementary to the target nucleic acid is bound to a zymogen; and iii) a substrate specific for the zymogen; and (b) detecting a signal generated by a proximity proteolysis reaction between the ssDNA-zymogen conjugate and the ssDNA-protease conjugate which are hybridized to the target nucleic acid.

2. The method according to claim 1, wherein the zymogen comprises an enzyme and an activity inhibitor protein of the enzyme bound through a peptide linker that can be cleaved by a protease.

3. The method according to claim 1, wherein the proximity proteolysis reaction in step (b) comprises: cleaving the zymogen into the enzyme and the activity inhibitor protein of the enzyme by cleaving the peptide linker by the protease, when the ssDNA-protease conjugate and the ssDNA-zymogen conjugate are hybridized to the target nucleic acid, to activate the enzyme; and hydrolyzing the substrate by the activated enzyme to generate a signal.

4. The method according to claim 1, wherein the protease is a tobacco etch virus (TEV) protease, a hepatitis C virus (HCV) protease, a tobacco vein mottling virus (TVMV) protease or a human rhinovirus (HRV) 3c protease.

5. The method according to claim 1, wherein the zymogen is β-lactamase zymogen or pro-caspase-3.

6. The method according to claim 1, wherein the substrate is a colorimetric or fluorescent substrate.

7. The method according to claim 6, wherein when the zymogen is β-lactamase zymogen and the colorimetric substrate is CENTA, a change in absorbance at 405 nm, in case where the ssDNA-protease conjugate and the ssDNA-zymogen conjugate are hybridized to the target nucleic acid, is increased compared to a change in absorbance at 405 nm, in case where the conjugates are not hybridized thereto.

8. The method according to claim 6, wherein, when the zymogen is β-lactamase zymogen and the colorimetric substrate is nitrocefin, in case where the ssDNA-protease conjugate and the ssDNA-zymogen conjugate are not hybridized to the target nucleic acid, a yellow signal is shown, and in case where the conjugates are hybridized to the target nucleic acid, a red signal is shown.

9. The method according to claim 6, wherein, when the zymogen is β-lactamase zymogen and the fluorescent substrate is CCF2-AM, upon emission of light having a wavelength of 408 nm thereto, in case where the ssDNA-protease conjugate and ssDNA-zymogen conjugate are not hybridized to the target nucleic acid, light having a wavelength of 530 nm is emitted, and in case where the conjugates are hybridized to the target nucleic acid, light having a wavelength of 460 nm is emitted.

10. The method according to claim 6, wherein when the zymogen is β-lactamase zymogen and the fluorescent substrate is CCF4-AM, upon emission of light having a wavelength of 409 nm thereto, in case where the ssDNA-protease conjugate and ssDNA-zymogen conjugate are not hybridized to the target nucleic acid, light having a wavelength of 520 nm is emitted, and in case where the conjugates are hybridized to the target nucleic acid, light having a wavelength of 447 nm is emitted.

11. The method according to claim 1, wherein the nucleic acid detection solution in step (a) further comprises MgCl.sub.2.

12. The method according to claim 1, wherein the proximity proteolysis reaction is performed at a temperature of 20 to 40° C.

13. The method according to claim 1, wherein step (a) further comprises amplifying the target nucleic acid.

14. The method according to claim 11, wherein a concentration of MgCl.sub.2 is 10 mM to 90 mM.

15. A nucleic acid detection solution comprising: i) a ssDNA-protease conjugate, in which ssDNA having a sequence complementary to a target nucleic acid is bound to a protease; ii) a ssDNA-zymogen conjugate in which ssDNA having a sequence complementary to the target nucleic acid is bound to a zymogen; and iii) a substrate specific for the zymogen.

16. The nucleic acid detection solution according to claim 15, wherein the protease is a tobacco etch virus (TEV) protease, a hepatitis C virus (HCV) protease, a tobacco vein mottling virus (TVMV) protease or a human rhinovirus (HRV) 3c protease.

17. The nucleic acid detection solution according to claim 15, wherein the zymogen comprises an enzyme and an activity inhibitor protein of the enzyme bound through a peptide linker that can be cleaved by a protease.

18. The nucleic acid detection solution according to claim 15, wherein the zymogen is β-lactamase zymogen or pro-caspase-3.

19. The nucleic acid detection solution according to claim 15, wherein the substrate is a colorimetric or fluorescent substrate.

20. The nucleic acid detection solution according to claim 15, wherein the nucleic acid detection solution further comprises MgCl.sub.2.

21. The nucleic acid detection solution according to claim 20, wherein a concentration of MgCl.sub.2 is 10 mM to 90 mM.

Description

DESCRIPTION OF DRAWINGS

[0013] FIG. 1 is a schematic diagram showing a method of detecting a target nucleic acid using a proximity proteolysis reaction according to the present invention.

[0014] FIG. 2a is a schematic diagram showing a process of producing a ssDNA-zymogen conjugate, and FIG. 2b is a schematic diagram showing the process of producing a ssDNA-protease conjugate.

[0015] FIG. 3a shows a one-step method and analysis results for DNA detection according to the present invention, FIG. 3b shows the optimum conditions of the proximity proteolysis reaction according to the present invention with respect to temperature and MgCl.sub.2 concentration, FIG. 3c shows the optimal conditions of the nucleotide spacer between the target nucleic-acid binding sites of the ssDNA-protease conjugate and the ssDNA-zymogen conjugate according to the present invention, FIG. 3d shows the absorbance at 405 nm of various concentrations (0-40 nM) of target DNA-3, FIG. 3e shows the absorbance at 405 nm of various concentrations (0-40 nM) of target RNA, FIG. 3f shows effects of mouse serum (red) and HEK 293F lysate (yellow), as biological substrates, on proximal proteolysis reaction to detect RNA, and FIG. 3g shows effects of mouse serum (red) and HEK 293F lysate (yellow), as biological substrates, on proximal proteolysis reaction to detect RNA.

[0016] FIG. 4a a d FIG. 4b shows a proximity proteolysis reaction according to the present invention further including nucleic acid sequence-based amplification (NASBA), wherein FIG. 4a shows the use of NASBA to amplify a RNA transcript and to convert RNA through the proximity proteolysis reaction, and FIG. 4b shows the absorbance at 405 nm of various concentrations (0.01 pM to 10 pM) of the RNA transcript.

DETAILED DESCRIPTION AND PREFERRED EMBODIMENTS OF THE INVENTION

[0017] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as appreciated by those skilled in the field to which the present invention pertains. In general, the nomenclature used herein is well-known in the art and is ordinarily used.

[0018] In the present invention, in an attempt to develop a method for detecting target nucleic acids that is fast, simple, and enables easy detection even at a small nucleic acid concentration, a proximity proteolysis reaction between a ssDNA-protease conjugate, in which ssDNA having a sequence complementary to the target nucleic acid is bound to a protease, and a ssDNA-zymogen conjugate, in which ssDNA having a sequence complementary to the target nucleic acid is bound to a zymogen, was used. As a result, it was found that nucleic acid detection is possible even at a concentration of about 100 pM, is realized through a one-step method of adding two DNA-protein conjugates and a colorimetric substrate to a sample, and is completed within 1 hour to detect the target nucleic acid.

[0019] Therefore, in one aspect, the present invention is directed to a method for detecting a target nucleic acid, the method including: (a) mixing a sample containing the target nucleic acid with a nucleic acid detection solution containing: i) a ssDNA-protease conjugate in which ssDNA having a sequence complementary to the target nucleic acid is bound to a protease; ii) a ssDNA-zymogen conjugate in which ssDNA having a sequence complementary to the target nucleic acid is bound to a zymogen; and iii) a substrate specific for the zymogen; and (b) detecting a signal generated by a proximity proteolysis reaction between the ssDNA-zymogen conjugate and the ssDNA-protease conjugate which are hybridized to the target nucleic acid.

[0020] As used herein, the term “protease” refers to an enzyme that hydrolyzes protein and peptide bonds.

[0021] As used herein, the term “zymogen”, which is interchangeable with “proenzyme”, refers to an inactive enzyme precursor, and is composed of an enzyme and an activity inhibitor protein of the enzyme bound through a peptide linker that can be cleaved by a protease. The zymogen is activated, when biochemical changes, such as revealing the active site of the enzyme, occur, by being cleaved into the enzyme and the activity inhibitor protein of the enzyme through hydrolysis or a change in configuration of the peptide linker through the protease.

[0022] As used herein, the term “target nucleic acid” refers to a nucleic-acid molecule to be detected by the method according to the present invention. The type of nucleic acid may be deoxyribonucleotide (DNA), ribonucleotide (RNA), and a mixture or combination thereof. The bases (nucleobases) constituting the same are nucleotides that are present in nature, such as guanine (G), adenine (A), thymine (T), cytosine (C), and uracil (U), but may include other natural and artificial modified bases. The term “modified base” refers to a base in which five nucleotides, namely guanine, adenine, thymine, cytosine and uracil, are chemically modified. In the present invention, the target nucleic acid needs to be a single strand when detected, but even a nucleic acid having a double strand or a higher-order structure may be used after conversion into a single strand by heat denaturation, alkali denaturation treatment or the like. The target nucleic acid of the present invention also includes aspects to which such denaturation treatment was added. In addition, the target nucleic acid of the present invention also includes cDNA produced through a reverse transcription reaction using RNA as a template.

[0023] As used herein, the term “sample” refers to a mixture predicted to contain a target nucleic acid to be detected. The sample is derived from living organisms including humans (e.g. blood, saliva, body fluids, body tissues, etc.), the environment [e.g., soil, sea water, environmental water (hot spring water, bathtub water, cooling tower water, etc.)], or artificial or natural materials (e.g. processed foods such as bread, fermented foods such as yogurt, cultivated plants such as rice or wheat, microorganisms, or viruses) and is usually subjected to a nucleic acid extraction operation. If necessary, the sample may be further subjected to nucleic acid purification.

[0024] As used herein, the term “oligonucleotide” refers to a linear oligomer formed by linking nucleotides including nucleotides such as adenosine, thymidine, cytidine, guanosine, and uridine, or modified nucleotides, through a phosphodiester bond, and represents DNA, RNA, and conjugates thereof. In some cases, the oligonucleotide may be a peptide nucleic acid (PNA).

[0025] As used herein, the term “complementary” refers to the state in which a polynucleotide or oligonucleotide strand is annealed with another strand to form a double-stranded structure and the nucleotide of each strand forms Watson-Click base pairing. Complementary nucleotides are generally A and T (or A and U), or C and G. The term “complementary” is also meant to include formation of non-Watson-click base pairing, such as pairing of modified nucleotides having deoxyinosine (dI) and 2-amino purine bases.

[0026] As used herein, the term “hybridization” generally refers to a reaction in which a single-stranded nucleic acid is bound to a complementary strand to form a double-stranded structure. DNA is usually a double strand, and when DNA is heated to a high temperature in a solution, the complementary hydrogen bond between the bases that form the double-strand is broken and DNA is cleaved into two single strands, which is called “denaturation”. The denatured single-stranded DNA is bound to a complementary base sequence again under appropriate conditions to form a double-strand, which is called “renaturation”. Hybrids may be formed between DNA-DNA, DNA-RNA or RNA-RNA. They may be formed between short strands and long strands that include regions complementary to the short strands. Incomplete hybrids may be formed, but as the incompleteness of hybrids increases, the possibility of formation of thereof decreases.

[0027] As used herein, the term “proximity proteolysis reaction” means that the distance between a protease and a peptide bond is close to one to five nucleotide spacers, so that the rate of proteolysis, in which the peptide bond of the protein is cleaved by hydrolysis to form an amino acid or a peptide, increases. The present inventors previously reported a β-lactamase zymogen, constructed by linking a permutate β-lactamase enzyme and a β-lactamase inhibitory protein (BLIP), which is an inhibitor protein thereof, through a linker that can be cleaved by a protease (H. Kim, et al., Chemical Communications 2014, 50, 10155-10157). In the present invention, a peptide linker including a TEV protease cleavage site was inserted between β-lactamase and BLIP. The TEV protease cleavage site is the cleavage site 1 of SEQ ID NO: 14 or the cleavage site 2 of SEQ ID NO: 15 (R. B. Kapust, et al., Protein Engineering vol. 14 no. 12, 993-1000, 2001). When the ssDNA-protease conjugate and the ssDNA-zymogen conjugate were hybridized to the target nucleic acid, β-lactamase could be activated by separating β-lactamase from BLIP through cleavage (degradation) of the peptide linker by the TEV protease. The activated β-lactamase hydrolyzes a substrate specific for β-lactamase to generate a signal.

[0028] TEV cleavage site 1: SEQ ID NO: 14: ENLYFQ/G

[0029] TEV cleavage site 2: SEQ ID NO: 15: ENLYFQ/S

[0030] (/: peptide bond cleaved by TEV protease)

[0031] When β-lactamase-specific substrate is CENTA (CENIA™ β-lactamase substrate), the change in absorbance at 405 nm, in the case where the ssDNA-protease conjugate and the ssDNA-zymogen conjugate are hybridized to the target nucleic acid, is increased compared to the change in absorbance at 405 nm, in the case where the conjugates are not hybridized thereto (Example 4).

[0032] When the β-lactamase-specific substrate is nitrocefin, in the case where the ssDNA-protease conjugate and the ssDNA-zymogen conjugate are not hybridized to the target nucleic acid, a yellow signal is shown, and in the case where the conjugates are hybridized to the target nucleic acid, a red signal is shown.

[0033] When the β-lactamase-specific substrate is CCF2-AM, upon emission of light having a wavelength of 408 nm thereto, in the case where the ssDNA-protease conjugate and ssDNA-zymogen conjugate are not hybridized to the target nucleic acid, light having a wavelength of 530 nm is emitted, and in the case where the conjugates are hybridized to the target nucleic acid, light having a wavelength of 460 nm is emitted.

[0034] When the β-lactamase-specific substrate is CCF4-AM, upon emission of light having a wavelength of 409 nm is emitted thereto, in the case where the ssDNA-protease conjugate and ssDNA-zymogen conjugate are not hybridized to the target nucleic acid, light having a wavelength of 520 nm is emitted, and in the case where the conjugates are hybridized to the target nucleic acid, light having a wavelength of 447 nm is emitted.

[0035] The present inventors have previously reported an engineered procaspase-3 that is activated by forming a dimer through proteolysis using a protease (D. K. Yang, et al., Anal. Methods, 2016, 8, 6270-6276). The enzyme activated by the protease hydrolyzed a substrate specific for caspase-3 to generate a signal.

[0036] In the present invention, the ssDNA (single-stranded DNA) is DNA having a single strand, and has a linear structure or a hairpin structure, but is not limited thereto. Linear ssDNA generated a signal more quickly than hairpin ssDNA in the detection of a target nucleic acid, and the reason for this is expected to be that linear ssDNA easily binds to the target nucleic acid.

[0037] In a specific embodiment of the present invention, the sequence of the ssDNA was selected from dual molecular beacons designed to target KRAS transcripts (P. J. Santangelo, et al., Nucleic Acid Research 2004, 32, e57).

[0038] In the present invention, site-specific conjugation between β-lactamase zymogen and ssDNA was achieved through an accelerated click reaction between azide and cyclooctyne (in FIG. 2a)).

[0039] In the present invention, the TEV-ssDNA conjugate produced using a method similar to that used for β-lactamase zymogen exhibited remarkably lower activity compared to an unconjugated TEV protease. The loss of activity was expected to be caused by the purification procedure or covalent binding of ssDNA, and another strategy for binding TEV protease to ssDNA was used (FIG. 2b)). The SpyTag/Catcher system, which was first reported by Howarth et al., is based on an efficient isopeptide bond formation reaction between two proteins, SpyTag and SpyCatcher (M. Howarth, et al., Proceedings of the National Academy of Sciences of the United States of America 2012, 109, 690-697).

[0040] In the present invention, the proximity proteolysis reaction includes: (a) mixing a sample containing the target nucleic acid with a nucleic acid detection solution containing: i) a ssDNA-protease conjugate, in which ssDNA having a sequence complementary to the target nucleic acid is bound to a protease; ii) a ssDNA-zymogen conjugate, in which ssDNA having a sequence complementary to the target nucleic acid is bound to a zymogen; and iii) a substrate specific for the zymogen; (b) hybridizing the ssDNA-protease conjugate and the ssDNA-zymogen conjugate to the target nucleic acid; (c) hydrolyzing the zymogen using the protease; and (d) binding the enzyme activated by hydrolysis to a colorimetric substrate to generate a signal (FIG. 1), but is not limited thereto.

[0041] In the present invention, the proximity proteolysis reaction may be performed at a temperature of 20 to 40° C., preferably 25 to 35° C., and more preferably 37° C.

[0042] In a specific example of the present invention, the proximity proteolysis reaction was found to be the most optimal when the nucleic acid detection solution further contains 40 mM MgCl.sub.2 and the proximity proteolysis reaction is performed at a temperature of 37° C. (FIG. 2b).

[0043] Although the method for detecting a target nucleic acid according to the present invention exhibits high sensitivity, some target nucleotides are present at a much lower concentration in a biological fluid. For example, viral RNA is present at a femtomolar concentration in the serum of a patient. In a specific embodiment of the present invention, in order to further improve the detection limit, isothermal RNA amplification and nucleic-acid-sequence-based amplification (NASBA) are applied to KRAS mRNA prepared by in-vitro transcription, but the invention is not limited thereto.

[0044] Therefore, in the present invention, step (a) may further include amplifying the target nucleic acid.

[0045] In another aspect, the present invention is directed to a nucleic acid detection solution containing: i) a ssDNA-protease conjugate, in which ssDNA having a sequence complementary to a target nucleic acid is bound to a protease; ii) a ssDNA-zymogen conjugate in which ssDNA having a sequence complementary to the target nucleic acid is bound to a zymogen; and iii) a colorimetric substrate specific for the zymogen.

[0046] In the present invention, the protease may be a tobacco etch virus (TEV) protease, a hepatitis C virus (HCV) protease, a tobacco vein mottling virus (TVMV) protease or a human rhinovirus (HRV) 3c protease, but is not limited thereto.

[0047] In the present invention, the zymogen may be β-lactamase zymogen or pro-caspase-3, but is not limited thereto.

[0048] In the present invention, the substrate may be a colorimetric or fluorescent substrate, but is not limited thereto.

[0049] In the present invention, the colorimetric substrate may be CENTA (CENTA™ β-lactamase substrate) or nitrocefin, which is a substrate specific for β-lactamase, but is not limited thereto.

[0050] In the present invention, the colorimetric substrate may be Ac-DEVD-pNA, Ac-DMQD-pNA, or Z-DEVD-pNA, which is a substrate specific for caspase-3, but is not limited thereto.

[0051] In the present invention, the fluorescent substrate may be CCF2-AM or CCF4-AM, which is a substrate specific for β-lactamase, but is not limited thereto.

[0052] In the present invention, the fluorescent substrate may be Ac-DEVD-AFC, Ac-DMQD-AMC or Z-DEVD-AFC, which is a substrate specific for caspase-3, but is not limited thereto.

[0053] In the present invention, the nucleic acid detection solution may further contain MgCl.sub.2.

[0054] In the present invention, the concentration of MgCl.sub.2 may be 10 mM to 90 mM, preferably 30 mM to 50 mM, and more preferably 40 mM.

[0055] Hereinafter, the present invention will be described in more detail with reference to examples. However, it will be obvious to those skilled in the art that these examples are provided only for illustration of the present invention and should not be construed as limiting the scope of the present invention.

Example 1

Plasmid Construction for Protein Expression

[0056] Tobacco etch virus (TEV) protease variants (L56V, S135G), which have been reported to exhibit improved solubility and stability compared to wild-type enzymes (LD Cabrita, et al., Protein science: a publication of the Protein Society 2007, 16, 2360-2367), were used. The synthetic gene of the TEV protease variants was cloned into pET-21a using EcoRI and XhoI, and then the double-stranded oligonucleotides of Strep-Tag and SpyTag were cloned into a plasmid containing the TEV protease gene using NdeI and EcoRI, and the cloned plasmid was called “pSPEL515”. The gene encoding the TEV protease variant is represented by SEQ ID NO: 1. A synthetic gene of SpyCatcher containing one TAG codon at the N-terminus of pSPEL515 was cloned into pET-21a using NdeI and XhoI to obtain pSPEL517. The gene encoding SpyCatcher is represented by SEQ ID NO: 2.

[0057] To construct a plasmid for expressing β-lactamase zymogen, pSPEL166, previously reported by the present inventors (H. Kim, et al., Chemical Communications 2014, 50, 10155-10157), was modified. The TAG codon was introduced by amplifying the β-lactamase zymogen gene using primer 1 of SEQ ID NO: 5 and primer 2 of SEQ ID NO: 6, and the PCR product was cloned into the same plasmid using NcoI and XhoI. The gene encoding β-lactamase zymogen is represented by SEQ ID NO: 3. Then, the cleavage site of the TEV protease was replaced with the original cleavage site of the MMP-2 protease using a double-stranded oligonucleotide regarding GGGSGGGSENLYFQ/GGGGSGGGS (/: peptide bond cleaved by TEV protease) through BamHI and HindIII.

TABLE-US-00001 Primer 1: SEQ ID NO: 5: AACCTTCCATGGGCTAGGGCGGCAGCGGTGGTAGCGCGGGGGTGATGACC GGGGCG Primer 2: SEQ ID NO: 6: AACCTTCTCGAGTGCCTGACTCCCCGTCGTGTAGATAACTACGATACG

Example 2

[0058] Protein Expression and Purification

[0059] 1. SpyTag-TEV Protease

[0060] E. coli BL21 (DE3) cells transformed with pSPEL515 were used for SpyTag-TEV protease expression. Recombinant E. coli strains were cultured at 2×YT at 37° C. until an optical density, that is, an OD.sub.600, reached 0.5. Protein expression was induced with 0.4 mM β-D-1-thiogalactopyranoside (IPTG) at 25° C. for 8 hours. Cell pellets were obtained by centrifugation and then stored at −20° C. until purification. SpyTag-TEV protease having a His6-tag at the N-terminus thereof was purified using a Ni-NTA resin (Clontech, USA) according to the manufacturer's instructions. Purified SpyTag-TEV protease was stored in a TEV protease storage buffer (50 mM Tris, 10 mM NaCl, 0.5 mM EDTA, 40% (v/v) glycerol, pH 8.0) at −20° C.

[0061] 2. SpyCatcher

[0062] In order to introduce 4-azido-L-phenylalanine (AzF) at the amber codon position of the SpyCatcher protein, pSEPL517 was transformed into E. coli BL21 (DE3) cells having two different plasmids: pSPEL150 expressing an orthogonal pair of tRNA and aminoacyl-tRNA synthetase of Methanococcus jannaschii to introduce AzF in response to a TAG codon (AzF-RS/tRNACUA), and pSPEL168 overexpressing E. coli prolyl-tRNA synthetase (ProRS) to prevent AzF from being mistaken for the Pro position of the protein. The cells were cultured in 2×YT at 37° C. until OD.sub.600 reached 0.5, and then 0.2% L-arabinose and 50 nM anhydrous tetracycline (aTc) were each added to induce the expression of orthogonal aminoacyl-tRNA synthetase and ProRS. When the OD.sub.600 reached 1.0, 0.4 mM IPTG was added in the presence of 1 mM AzF to induce the expression of SpyCatcher at 30° C. for 8 hours. The SpyCatcher purification process is the same as the SpyTag-TEV purification process. The purified protein was stored in a storage buffer (70 mM NaCl, 1.5 mM KCl, 5 mM Na.sub.2HPO.sub.4, 1 mM KH.sub.2PO.sub.4, 20% (V/V) glycerol, pH 7.4) at −20° C.

[0063] 3. β-lactamase Zymogen

[0064] E. coli BL21 (DE3) transformed with three plasmids (pSPEL427, pSEPL150 and pSPEL168) was used to express β-lactamase zymogen having AzF. The expression of AzF-RS and ProRS was induced at an OD.sub.600 of 0.5 using 0.26% L-arabinose and 50 nM aTc, respectively, and then expression of β-lactamase zymogen was induced using 0.4 mM IPTG in the presence of 1 mM AzF at 25° C. for 16 hours. The protein was purified from the periplasmic fraction according to the method described above. The purified β-lactamase zymogen was stored in a storage buffer at −20° C.

[0065] 4. Determination of Purified Protein Concentration

[0066] The purified protein concentration was determined by measuring the absorbance at 280 nm using the extinction coefficient calculated at the ProtParam site (http://web.expasy.org/protparam/).

Example 3

[0067] Conjugation of Single-Stranded DNA (ssDNA) and Protein

[0068] 1. Derivatization of ssDNA by N-hydroxysuccinimide ester-(polyethyleneglycol)4-dibenzylcyclooctyne (NHS-PEG4-DECO)

[0069] ssDNA functionalized with a 5′-amine group (ssDNA-1 or ssDNA-2) or a 3′-amine group (ssDNA-3) was purchased from Bioneer Co. (Korea). ssDNA was mixed with a 20-fold molar excess of NHS-PEG4-DECO linker, and the reaction was conducted at 25° C. in a phosphate-buffered saline solution (PBS; 137 mM NaCl, 2.7 mM KCl, 10 mM Na.sub.2HPO.sub.4, 2 mM KH.sub.2PO.sub.4, pH 7.4) in the dark for 2 hours. The modified ssDNA was precipitated with ethanol to remove an excess linker, and the pellet was resuspended in PBS for storage at −20° C.

TABLE-US-00002 ssDNA-1: SEQ ID NO: 11: [Amine]CCTACGCCACCAGCTCCGTAGG ssDNA-2: SEQ ID NO: 12: [Amine]CCTACGCCACCAGC ssDNA-3: SEQ ID NO: 13: AGTGCGCTGTATCGTCAAGGCACT[Amine]

[0070] 2. ssDNA-β-lactamase Zymogen Conjugate

[0071] The ssDNA (ssDNA-1 or ssDNA-2) having a modified 5′-end was mixed with a β-lactamase zymogen protein containing AzF at a molar ratio of 5:1 in PBS, and the mixture was incubated at 4° C. for 16 minutes. First, the unconjugated protein was removed through anion-exchange chromatography using a HiTrap Q column (GE Healthcare Life Sciences, USA). A mixture of ssDNA-conjugate and ssDNA was eluted with a 0.2-1M NaCl gradient. The eluted fraction was further purified by gel filtration chromatography using a Superdex-column (GE Healthcare Life Sciences, USA) to remove ssDNA. The purified ssDNA-β-lactamase zymogen conjugate was stored in a storage buffer at −20° C.

[0072] 3. ssDNA-TEV Protease Conjugate

[0073] First, the SpyCatcher protein containing AzF was conjugated to ssDNA (ssDNA-3) having a modified 3′ end using an NHS-PEG4-DBCO linker. The protein was mixed with a 5-fold molar excess of modified ssDNA in PBS, and the mixture was incubated at 25° C. for 4 hours. Unconjugated SpyCatcher was removed through anion-exchange chromatography using a HiTrap Q column. The partially purified ssDNA-SpyCatcher conjugate containing unreacted ssDNA was reacted with a SpyTag-TEV protease in PBS at 4° C. for 2 hours. Because the modified ssDNA was not expected to interfere with the reaction between SpyTag and SpyCatcher, the conjugation reaction was performed in the presence of unreacted ssDNA. The ssDNA-TEV protease conjugate was purified using Strep-Tactin resin (IBA Lifesciences, Germany) according to the manufacturer's instructions. Purified ssDNA-TEV protease in a TEV protease storage buffer was stored at −20° C.

[0074] 4. Determination of Protein and DNA Concentration in ssDNA-Protein Conjugate

[0075] The concentration of the conjugate was calculated by measuring the absorbance at 260 and 280 nm using the following equation. The DNA extinction coefficient (ε.sub.260,DNA) at 260 nm was calculated using molbiotools (http://www.molbiotools.com/dnacalculator.html), and the extinction coefficient at 280 nm (ε.sub.280,DNA) was determined by measuring the absorbance of a sample having a known concentration. The protein extinction coefficient ε.sub.280,protein) at 280 nm was calculated at the ProtParam site, and the protein extinction coefficient (ε.sub.260,protein) at 260 nm was determined by measuring the absorbance of a sample having a known concentration.

A.sub.260=A.sub.260,DNA++A.sub.260,protein=ε.sub.260 DNA×b×C.sub.DNA+ε.sub.260, protein×b×C.sub.protein

A.sub.260=A.sub.260,DNA++A.sub.280,protein=ε.sub.280 DNA×b×C.sub.DNA+ε.sub.280,protein×b×C.sub.protein

[0076] ε: Extinction coefficient (M.sup.−1cm.sup.−1)

[0077] b: Path leng (cm)

[0078] C: Concentration (M)

Example 4

[0079] Detection of Nucleic Acid by Proximity Proteolysis Reaction

[0080] 1. Experimental Method

[0081] A proximity proteolysis reaction was initiated by adding 40 nM ssDNA-TEV protease, 20 nM ssDNA-β-lactamase zymogen and 200 μM CENTA (CENTA™ β-lactamase substrate, EMD Millipore, Billerica, Mass., USA) to a sample solution containing the target nucleotide molecule in the presence of a reaction buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na.sub.2HPO.sub.4, 2 mM KH.sub.2PO.sub.4, 40 mM MgCl.sub.2, 10 mM DTT, 0.5% (w/v) BSA, pH 7.4). The target nucleotide was established using a 46-nt DNA oligonucleotide (target DNA-4) sequence corresponding to a portion of the KRAS transcript. The reaction was performed at 37° C., and the incubation time was 45 minutes for ssDNA detection and 60 minutes for RNA detection. For RNA samples, a 10 U/l mL RNase inhibitor (Roche, Switzerland) was added. Hydrolysis of CENTA by β-lactamase was observed through absorbance at 405 nm, measured using a plate reader (Synergy HT Multi-Detection Reader; BioTek Instruments, USA). The limit of detection (LOD) was calculated using a standard curve as the target concentration of the absorbance, corresponding to the sum of the target mean absorbance and three times the standard deviation. The interference of biological substrates in proximity proteolysis assay was tested using two biological fluids: HEK 293F cell lysate and mouse serum (Sigma, USA). A HEK 293F cell lysate was prepared through ultrasonication using a 130-watt ultrasonic disperser (Sonics & Materials, Inc., USA), and a 200 μL analytic sample was prepared using 1×10.sup.6 of the cell lysate. Mouse serum was added to the sample at a concentration of 5% (v/v).

[0082] 2. Analysis of Optimal Conditions for Proximity Proteolysis Reaction

[0083] In order to establish optimal conditions for the proximity proteolysis reaction, the signal difference depending on the concentration of MgCl.sub.2 and temperature conditions was analyzed. Initially, a relatively small signal difference was observed depending on the presence of the target nucleotide (20 mM MgCl.sub.2 at 25° C.). Two factors of the MgCl.sub.2 concentration and temperature were further optimized, and the conditions of 40 mM MgCl.sub.2 and 37° C. showed the highest signal difference (FIG. 3b).

[0084] Differences in proteolytic reactions depending on the spatial arrangement of target nucleic-acid binding sites of TEV protease and β-lactamase zymogen were analyzed. A proximity proteolysis reaction was performed with 1 to 5 nucleotide spacers (target DNA 1 to 5) as the distance between the binding sites of the template DNA regarding two ssDNAs. As a result, the three-nucleotide spacer showed a higher signal difference than other cases (FIG. 3c).

TABLE-US-00003 Target DNA-1: TACGGAGCTGGTGGCGTAGGtAGTGCCTTGACGATACAGCGCA Target DNA-2: TAGGGAGCTGGTGGCGTAGGtaAGTGCCTTGACGATACAGCGCA Target DNA-3: TACGGAGCTGGTGGCGTAGGtagAGTGCCTTGACGATACAGCGCA Target DNA-4: TACGGAGCTGGTGGCGTAGGtagaAGTGCCTTGACGATACAGCGCA Target DNA-5: TACGGAGCTGGTGGCGTAGGtagatAGTGCCTTGACGATACAGCGCA Target RNA: LACGGAGCUGGUGGCGUAGGuagAGUGCCUUGACGAUAEAGCGCA

[0085] (The underlined sequence represents the nucleotide spacer between the two binding sites of β-lactamase zymogen-ssDNA and TEV-ssDNA.)

[0086] 3. Experiment Result

[0087] Proximal proteolysis reactions were conducted at various concentrations of target DNA oligonucleotides under optimized conditions. As shown in FIG. 3d), a difference in the amount of color development to yellow due to a change in absorbance at 405 nm was observed depending on the DNA concentration immediately after the protein-ssDNA conjugate and CENTA were added. The change in absorbance at 405 nm was 0.166 in the absence of the target nucleic acid, and the change in absorbance at 405 nm was 1.019 in the presence of the target nucleic acid. The highest signal difference was observed at 45 minutes. In this case, absorbance at 405 nm was shown compared to the target concentration. A hyperbolic curve appeared at all concentrations in the experimental range, and a linear relationship was observed from 94 pM as the limit of detection (LOD) to 5 nM (FIG. 3d).

TABLE-US-00004 Target (nM) 40 20 10 5 2.5 1.25 0.625 0.313 0.156 0 Absorbance 1.341 1.282 1.115 0.894 0.705 0.583 0.515 0.477 0.455 0.440 at 405 nm

[0088] Since ssDNA bound to TEV protease and β-lactamase zymogen was originally produced to detect KRAS mRNA, proximity proteolysis analysis was applied to the synthesized RNA nucleotides corresponding to the DNA targets used above. Because the interaction between DNA and RNA is weak, it took to develop color of ssDNA longer than the DNA target (45 minutes). A hyperbolic curve was observed over the entire range of target concentration, and a linear relationship was observed from 93 pM as a limit of detection to 5 nM (FIG. 3e).

[0089] The interference of biological substrates in proximity proteolysis was evaluated using HEK293F cell lysate and mouse serum, and the results showed that the proximity proteolysis can be used to detect nucleotides of DNA and RNA present in the biological sample, as shown in FIGS. 3f and 3g.

[0090] In particular, it was found that the proximity protein hydrolysis method was not only simple to use, but also took less than 1 hour to detect the target nucleotide at concentrations smaller than a nanomolar concentration.

Example 5

[0091] Nucleic-Acid-Sequence-Based Amplification (NASBA)

[0092] The synthetic gene of KRAS was cloned into pET-21a (IDT, USA) using NdeI and XhoI (pSPEL570), and a PCR fragment for transcription was prepared using primer 3 of SEQ ID NO: 7 and primer 4 of SEQ ID NO: 8. The gene encoding KRAS is represented by SEQ ID NO: 4. The KRAS transcript was produced by in-vitro transcription using the EZ High-Yield In-Vitro Transcription Kit (Enzynomics, Korea) according to the manufacturer's instructions. RNA was purified using a MEGAclear Kit (Ambion, USA) and stored at −20° C. KRAS mRNA was amplified through NASBA reaction using primer 5 of SEQ ID NO: 9 and primer 6 of SEQ ID NO: 10, and a NASBA Liquid Kit Complete (Life Sciences Advanced Technologies, USA) according to the manufacturer's instructions, and RNA fragments were used for proximity proteolysis reaction.

[0093] A completely different signal from the baseline was observed in the sample containing the KRAS transcript concentration as low as 10 fM, and was found to be 10,000 times lower than the detection limit without amplification (FIG. 4b).

TABLE-US-00005 Primer 3: SEQ ID NO: 7: TCGATCCCGCGAAATTAATACGACTCACTATAGG Primer 4: SEQ ID NO: 8: CAAAAAACCCCTCAAGACCCGTTTA Primer 5: SEQ ID NO: 9: AATTCTAATACGACTCACTATAGGGAGAAGGCTCGCTTGCGCGAATACGG AGCTGGTGGCG Primer 6: SEQ ID NO: 10: GTCGTATCCAGTGCGTCATCTTTCGAGGTGACTTGCACTGGATACGACTG CGCT

INDUSTRIAL APPLICABILITY

[0094] The method for detecting a target nucleic acid according to the present invention is carried out through a one-step process of adding two DNA-protein conjugates and a colorimetric substrate to a sample using a proximity proteolysis reaction, and takes less than an hour to detect a target nucleic acid, and thus is quick, simple and highly sensitive. Thus, the method will be useful in disease diagnosis, testing of genetically modified organisms (GMOs), and forensic medicine investigations that require detection of target nucleic acids.

[0095] Although specific configurations of the present invention have been described in detail, those skilled in the art will appreciate that this description is provided to set forth preferred embodiments for illustrative purposes and should not be construed as limiting the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the accompanying claims and equivalents thereto.

[0096] [Sequence Listing Free Text]

[0097] An electronic file is attached.