Inhibitors of RNA guided nucleases and uses thereof
11787795 · 2023-10-17
Assignee
- President And Fellows Of Harvard College (Cambridge, MA)
- The Brigham And Women's Hospital, Inc. (Boston, MA)
- The Regents Of The University Of California (Oakland, CA)
Inventors
- Amit Choudhary (Cambridge, MA, US)
- Peng Wu (Boston, MA, US)
- Basudeb Maji (Boston, MA, US)
- Elisa Franco (Oakland, CA, US)
- Hari K. K. Subramanian (Oakland, CA, US)
Cpc classification
C07C291/00
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C07C291/00
CHEMISTRY; METALLURGY
International classification
C07C291/00
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
Abstract
Compositions and methods are provided for the inhibition of the function of RNA guided endonucleases, including the identification and use of such inhibitors.
Claims
1. A method of inhibiting the activity of an RNA guided endonuclease-guide RNA complex, the method comprising contacting the RNA guided endonuclease-guide RNA complex with a small molecule; wherein the small molecule is a compound having the formula of Formula I: ##STR00050## wherein R.sup.1 is independently selected at each occurrence from hydrogen, —X, —R, -L.sub.1-X, or -L.sub.1-R; and R.sub.2-R.sub.4 are independently selected from hydrogen, —X, —R, -L.sub.1-X, or -L.sub.1-R; where X is independently selected at each occurrence from CN, OH, CF.sub.3, COOH, OR, NR.sub.2, or halogen; L.sub.1 is selected from —(CH.sub.2).sub.n—, —(CH.sub.2).sub.n—C(O)O—, —(CH.sub.2).sub.n—C(O)—NH—, —C(O)—NH—(CH.sub.2).sub.n—, —(CH.sub.2).sub.n—NH—C(O)—, —(CH.sub.2).sub.n—NH—SO.sub.2—, —NH—SO.sub.2—(CH.sub.2).sub.n—, —(CH.sub.2).sub.n—SO.sub.2—NH—, —(CH.sub.2).sub.n—SO.sub.2—, —(CH.sub.2).sub.n—SO.sub.2—NH—C(O)—, —(CH.sub.2).sub.n—R.sup.L—, —R.sup.L—C(O)—O—, —R.sup.L—NH—C(O)—(CH.sub.2).sub.n—, —R.sup.L—NH—S(O).sub.2—(CH.sub.2).sub.n—, —S—, —S(O)—, —S(O).sub.2—; wherein n is independently at each occurrence 0, 1, 2, 3, 4, 5, or 6; R.sup.L is independently selected at each occurrence from C.sub.1-C.sub.12 linear and/or branched and/or cyclic and/or aromatic bivalent radicals; optionally substituted with one or more groups X and/or with 1-6 heteroatoms selected from O, S, N, P, F, Cl, Br, I; and R is independently selected at each occurrence from C.sub.1-12 hydrocarbons, optionally substituted with one or more groups selected from CN, OH, CF, COOH, and NH.sub.2, and/or with 1-10 heteroatoms selected from O, S, N, P, F, Cl, Br, I, and combinations thereof.
2. A method of inhibiting the activity of an RNA guided endonuclease-guide RNA complex, the method comprising contacting the RNA guided endonuclease-guide RNA complex with a small molecule, wherein the small molecule is a compound of Formula IA, IB, IC, or ID: ##STR00051## wherein R.sup.1 is independently selected at each occurrence from hydrogen, —X, —R, or -L.sub.1-R; and R.sup.2-R.sup.4 are independently selected from hydrogen, —X, —R, or -L.sub.1-R; where X is independently selected at each occurrence from CN, OH, CF.sub.3, COOH, OR, NR.sub.2, or halogen; L.sub.1 is selected from —(CH.sub.2).sub.n—, —(CH.sub.2).sub.n—C(O)O—, —(CH.sub.2).sub.n—C(O)—NH—, —(CH.sub.2).sub.n—NH—C(O)—, —(CH.sub.2).sub.n—NH—SO.sub.2—, —(CH.sub.2).sub.n—SO.sub.2—NH—, —(CH.sub.2).sub.n—SO.sub.2—, —(CH.sub.2).sub.n—SO.sub.2—NH—C(O)—, —(CH.sub.2).sub.n—R.sup.L—, —R.sup.L—C(O)—O—, —R.sup.L—NH—C(O)—(CH.sub.2).sub.n—, —R.sup.L—NH—S(O).sub.2—(CH.sub.2).sub.n—, —S—, —S(O)—, —S(O).sub.2—; wherein n is independently at each occurrence 0, 1, 2, 3, 4, 5, or 6; R.sup.L is independently selected at each occurrence from C.sub.1-C.sub.12 linear and/or branched and/or cyclic and/or aromatic bivalent radicals; optionally substituted with one or more groups X and/or with 1-6 heteroatoms selected from O, S, N, P, F, Cl, Br, I; and R is independently selected at each occurrence from C.sub.1-12 hydrocarbons, optionally substituted with one or more groups selected from CN, OH, CF.sub.3, COOH, and NH.sub.2 and/or with 1-10 heteroatoms selected from O, S, N, P, F, Cl, Br, I, and combinations thereof.
3. The method of claim 2, wherein the small molecule is selected from a compound having the structure ##STR00052## ##STR00053##
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
DETAILED DESCRIPTION OF THE INVENTION
(57) The invention provides compositions and methods for inhibiting the activity of RNA guided endonucleases (e.g., Cas9, Cpf1), and methods of use therefore, as well as to inhibit or prevent Cas9 genome editing. The invention is based, at least in part, on the discovery of small molecule inhibitors of RNA guided endonucleases. As described herein, high-throughput biochemical and cellular assays, and workflows comprising combinations of such assays, were developed for screening and identifying small molecules with the ability to inhibit one or more activities of RNA guided endonucleases. Methods involving small molecule inhibitors of RNA guided endonucleases are useful for the modulation of RNA guided endonuclease activity, including rapid, reversible, dosage, and/or temporal control of RNA guided endonuclease technologies.
(58) CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat)-Cas System
(59) The CRISPR (clustered regularly interspaced short palindromic repeat)-Cas system is an adaptive immune system used by bacteria and archaea to defend against invading phages or mobile genetic elements. Three types of CRISPR-Cas system occur naturally and the type II system was first to be employed for genome editing in mammalian cells. This system employs an RNA-guided endonuclease Cas9, which cleaves double stranded DNA using RuvC and HNH nuclease domains. Cas9 identifies the target sequence by two recognition mechanisms: (i) Watson-Crick base-pairing between the target sequence and gRNA, and (ii) Protospacer Adjacent Motif (PAM) sequence on the target sequence.
(60) Upon target recognition, Cas9 induces double strand breaks in the target gene, which when repaired by non-homologous end joining (NHEJ) can result in frameshift mutations and gene knockdown. Alternatively, homology-directed repair (HDR) at the double-strand break site can allow insertion of the desired sequence.
(61) Cas9 is a spectacular molecular machine with several fascinating attributes. First, the Cas9 employs molecular interactions and recognition between all the three elements of the central dogma—DNA, RNA, and protein. Second, Cas9 unwinds target DNA and facilitates strand invasion without utilizing ATP. Third, Cas9 efficiently induces DNA strand breaks in both prokaryotic and eukaryotic genome despite enormous differences in their genome size, structure, and organization. Finally, unlike transcription factors that often employ 1D diffusion and hopping for target search, Cas9:gRNA complex accomplishes target search by 3D diffusion only.
(62) While Cas9 is a highly efficient molecular machine, its specificity is poor at best. Using genomewide, unbiased identification of double strand breaks enabled by sequencing (GUIDE-seq), Joung and co-workers showed that Cas9's off-targets were present on nearly every chromosome for the on-target gene EMX1. In another specificity study, Zhang and co-workers systematically studied the effect of single-base mismatch between gRNA and target sequence on Cas9 cleavage efficiency for the EMX1 gene. They found that Cas9 tolerated mismatches at PAM-distal sites on gRNA for multiple locations on EMX1 gene. Similar trends in mismatch tolerance were also reported by Doudna and Joung laboratories. Finally, Alt and co-workers have shown that in addition to off-target editing, Cas9 induces chromosomal translocations leading to dicentric chromosomes, which will generate genomic instability. They and others also demonstrated the inverse correlation between Cas9 activity and specificity.
(63) Compounds
(64) The compounds of the invention can be prepared from commercially available starting materials, compounds known in the literature, or readily prepared intermediates, by employing standard synthetic methods and procedures known to those skilled in the art. Standard synthetic methods and procedures for the preparation of organic molecules and functional group transformations and manipulations can be readily obtained from the relevant scientific literature or from standard textbooks in the field. It will be appreciated that where typical or preferred process conditions (i.e., reaction temperatures, times, mole ratios of reactants, solvents, pressures, etc.) are given, other process conditions can also be used unless otherwise stated. Optimum reaction conditions may vary with the particular reactants or solvent used, but such conditions can be determined by one skilled in the art by routine optimization procedures. Those skilled in the art of organic synthesis will recognize that the nature and order of the synthetic steps presented may be varied for the purpose of optimizing the formation of the compounds described herein.
(65) Synthetic chemistry transformations (including protecting group methodologies) useful in synthesizing the compounds described herein are known in the art and include, for example, those such as described in R. C. Larock, Comprehensive Organic Transformations, 2d.ed., Wiley-VCH Publishers (1999); P. G. M. Wuts and T. W. Greene, Protective Groups in Organic Synthesis, 4th Ed., John Wiley and Sons (2007); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), and subsequent editions thereof.
(66) The processes described herein can be monitored according to any suitable method known in the art. For example, product formation can be monitored by spectroscopic means, such as nuclear magnetic resonance spectroscopy (e.g., .sup.1H or .sup.13C), infrared spectroscopy (FTIR), spectrophotometry (e.g., UV-visible), or mass spectrometry (MS), or by chromatography such as high performance liquid chromatography (HPLC) or thin layer chromatography (TLC).
(67) Preparation of compounds can involve the protection and deprotection of various chemical groups. The need for protection and deprotection, and the selection of appropriate protecting groups can be readily determined by one skilled in the art. The chemistry of protecting groups can be found, for example, in Greene, et al., Protective Groups in Organic Synthesis, 2d. Ed., Wiley & Sons, 1991, which is incorporated herein by reference in its entirety.
(68) The reactions of the processes described herein can be carried out in suitable solvents which can be readily selected by one of skill in the art of organic synthesis. Suitable solvents can be substantially nonreactive with the starting materials (reactants), the intermediates, or products at the temperatures at which the reactions are carried out, i.e., temperatures which can range from the solvent's freezing temperature to the solvent's boiling temperature. A given reaction can be carried out in one solvent or a mixture of more than one solvent. Depending on the particular reaction step, suitable solvents for a particular reaction step can be selected.
(69) Resolution of racemic mixtures of compounds can be carried out by any of numerous methods known in the art. An example method includes preparation of the Mosher's ester or amide derivative of the corresponding alcohol or amine, respectively. The absolute configuration of the ester or amide is then determined by proton and/or .sup.19F NMR spectroscopy. An example method includes fractional recrystallization using a “chiral resolving acid” which is an optically active, salt-forming organic acid. Suitable resolving agents for fractional recrystallization methods are, for example, optically active acids, such as the D and L forms of tartaric acid, diacetyltartaric acid, dibenzoyltartaric acid, mandelic acid, malic acid, lactic acid or the various optically active camphorsulfonic acids. Resolution of racemic mixtures can also be carried out by elution on a column packed with an optically active resolving agent (e.g., dinitrobenzoylphenylglycine). Suitable elution solvent compositions can be determined by one skilled in the art.
(70) Disclosed herein are inhibitors of Cas9, an RNA-guided DNA endonuclease that naturally occurs in S. pyogenes (SpCas9) and S. aureus (SaCas9), respectively. Cas9 recognizes foreign DNA using Protospacer Adjacent Motif (PAM) sequence and the base-pairing of the target DNA by the guide RNA (gRNA). The relative ease of inducing targeted strand breaks at any genomic loci by Cas9 has enabled efficient genome editing in multiple cell types and organisms. Cas9 derivatives can also be used as transcriptional activators/repressors.
(71) A challenge posed by Cas9 is that its cleavage selectivity is low. Off-target editing activity can result in undesired undesirable chromosomal translocation. This activity limits the use of Cas9 in a therapeutic setting due to unreliable gene manipulation and lack of ability to control the action of Cas9. The Cas9 inhibitors disclosed herein provide rapid, dosable, and/or temporal control of Cas9 that increases Cas9 specificity and enables external control and manipulation of gene targeting.
(72) Provided herein are compounds having Formula I, II, III, IV, or V which may be used as Cas9 inhibitors in any embodiment of the invention described. Although each of the disclosed inventive compounds having formulas I-V may be disclosed with wedged bonds to indicate the specific stereochemistries, each stereocenter may independently have the R or S configuration, unless reference is given to specific compounds. For any compound having the structure of Formula I-V described herein, R.sup.1-R.sup.4 may be defined as R.sup.1 is selected from Hydrogen, aryl, heteroaryl, —C.sub.1-6alkyl, —C.sub.2-6alkenyl, —C.sub.2-6alkynyl, —(CH.sub.2).sub.nCOOH, —(CH.sub.2).sub.nCOOC.sub.1-6lakyl, —(CH.sub.2).sub.nCOC.sub.1-6alkyl, —(CH.sub.2).sub.nOH, —(CH.sub.2).sub.nCONHR, —(CH.sub.2).sub.nNHCOR, —(CH.sub.2).sub.nNHCOC.sub.1-6alkyl, —(CH.sub.2).sub.nNHSO.sub.2R, —(CH.sub.2)SO.sub.2NHR, —(CH.sub.2)SO.sub.2R, —(CH.sub.2)SO.sub.2NHCOR, —(CH.sub.2)SO.sub.2NHCOOR, —(CH.sub.2).sub.nSO.sub.2NHCONRR, —(CH.sub.2)CONHSO.sub.2R, —(CH.sub.2).sub.nNHCONRR, —(CH.sub.2)C.sub.3-10cycloalkyl-COOR, —SC.sub.1-6alkyl, SOC.sub.2-6alkyl, SO.sub.2C.sub.1-6alkyl, —C.sub.3-10cycloheteroalkenyl, —C.sub.3-10cycloheteroalkyl, substituted or unsubstituted phenyl, —(CH.sub.2).sub.n-phenyl, —(CH.sub.2).sub.n-aryl and —(CH.sub.2)-heteroaryl, —(CH.sub.2).sub.nC.sub.3-10cycloalkyl, —(CH.sub.2).sub.nC.sub.3-10cycloalkyl-aryl, —(CH.sub.2).sub.nC.sub.3-10cycloalkyl-heteroaryl, —(CH.sub.2).sub.nC.sub.4-10cycloalkenyl, —(CH.sub.2).sub.nC.sub.4-10cycloalkenyl-aryl, —(CH.sub.2)C.sub.4-10cycloalkenyl-heteroaryl, —(CH.sub.2)C.sub.2-10cycloheteroalkyl, —(CH.sub.2).sub.nC.sub.2-10 cycloheteroalkenyl, —C.sub.2-6alkenyl-alykl, —C.sub.2-6alkenyl-aryl, —C.sub.2-6alkenyl-heteroaryl, —C.sub.2-6alkenyl-C.sub.3-7cycloalkyl, —C.sub.2-6alkenyl-C.sub.3-7cycloalkenyl, —C.sub.2-6alkenyl-C.sub.2-7cycloheteroalkyl, —C.sub.2-6alkynyl-(CH.sub.2).sub.n—O-aryl, —C.sub.2-6alkynyl-alkyl, —C.sub.2-6alkynyl-aryl, —C.sub.2-6alkynyl-heteroaryl, —C.sub.2-6alkynyl-C.sub.3-7cycloalkyl, —C.sub.2-6alkynyl-C.sub.3-7cycloalkenyl, —C.sub.2-6alkynyl-C.sub.3-7 cycloheteroalkyl, —C.sub.2-6alkynyl-C.sub.3-7 cycloheteroalkenyl, —CONH—(CH.sub.2).sub.nphenyl, wherein n equals to 0 to 6 (i.e., 0, 1, 2, 3, 4, 5, or 6), and each CH.sub.2 is unsubstituted or substituted with one or two substituents selected from C.sub.1-C.sub.6alkyl, —OH, —CN, —CF.sub.3, halogen, COOH, COC.sub.1-C.sub.6alkyl, COOC.sub.1-C.sub.6alkyl, and —NH.sub.2, wherein each NH is unsubstituted or substituted with C.sub.1-C.sub.6alkyl, —OH, halogen, COOH, COC.sub.1-C.sub.6alkyl, COOC.sub.1-C.sub.6alkyl.
(73) In some embodiments, the Cas9 inhibitors are compounds having the structure of Formula (I):
(74) ##STR00023##
wherein each wavy bond indicates the presence of a stereocenter, and each stereocenter may be independently at each occurrence in the R or S configuration. In some embodiments, both stereocenters of the five membered fused ring are in the same configuration (i.e., both (R) or both (S)). The groups R.sup.1-R.sup.4 may be defined as shown below. In some embodiments, the Cas9 inhibiting compounds may have the structure of Formula IA, IB, IC, or ID:
(75) ##STR00024## wherein R.sub.1 is independently selected at each occurrence from hydrogen, —X, —R, -L.sub.1-X, or -L.sub.1-R; and R.sub.2-R.sub.4 are independently selected from hydrogen, —X, —R, -L.sub.1-X, or -L.sub.1-R; where X is independently selected at each occurrence from CN, OH, CF.sub.3, COOH, OR, OR, NR.sub.2, or halogen (e.g., —Cl, —F, —Br, etc.); L.sub.1 is selected from —(CH.sub.2).sub.n—, —(CH.sub.2).sub.n—C(O)O—, —(CH.sub.2).sub.n—C(O)—NH—, —(CH.sub.2).sub.n—NH—C(O)—, —(CH.sub.2).sub.n—NH—SO.sub.2—, —(CH.sub.2).sub.n—SO.sub.2—NH—, —(CH.sub.2).sub.n—SO.sub.2—, —(CH.sub.2).sub.n—SO.sub.2—NH—C(O)—, —(CH.sub.2).sub.n—R.sup.L—, —R.sup.L—C(O)—O—, —R.sup.L—NH—C(O)—(CH.sub.2).sub.n—, —R.sup.L—NH—S(O).sub.2—(CH.sub.2).sub.n—, —S—, —S(O)—, —S(O).sub.2—; wherein n is independently 0, 1, 2, 3, 4, 5, or 6; R.sup.L is independently selected at each occurrence from C.sub.1-C.sub.12 linear and/or branched and/or cyclic and/or aromatic bivalent radicals (e.g., alkyl, alkenyl, alkynyl, aryl, alkyl-aryl, arayl-alkyl, and combinations thereof); optionally substituted with one or more (e.g., 1-5) groups X and/or with 1-6 heteroatoms selected from O, S, N, P, F, Cl, Br, I; and R is selected from C.sub.1-12 hydrocarbons (e.g., alkyl, alkenyl, alkynyl, aryl, alkyl-aryl, arayl-alkyl, and combinations thereof), optionally substituted with one or more (e.g., 1-5) groups X and/or with 1-10 heteroatoms selected from O, S, N, P, F, Cl, Br, I, and combinations thereof.
(76) In some embodiments, R.sup.2 is a group —CH.sub.2—R. In some embodiments, R.sup.1-R.sup.4 are independently selected at each occurrence from hydrogen, —R, or -L.sub.1-R, -L.sub.1-X where L.sub.1 independently selected at each occurrence from —(CH.sub.2).sub.1-6— or —C≡C—. In some embodiments, R is a five or six membered optionally aromatic and optionally substituted ring. In some embodiments, R is selected from phenyl, benzyl, or pyridinyl. In some embodiments, —X is selected from —F, —Cl, —OH, or —OR. In some embodiments, L.sub.1 is selected from —(CH.sub.2).sub.1-6— or —C≡C—. In some embodiments, R is a C.sub.3-6 optionally aromatic cyclic hydrocarbon optionally substituted with one or more (e.g., two, three, etc.) functional groups selected from —F, —Cl, —OR* (e.g., —OCH.sub.3), or —NH—C(O)O—C(CH.sub.3).sub.3 (i.e. NHBoc). In some embodiments, R is methyl, ethyl, propyl, butyl, ethenyl (i.e., —CH═CH.sub.2), or ethynyl (e.g., —C≡CH). In some embodiments, R.sup.2 is -L.sub.1-X, or -L.sub.1-R, where L.sub.1 is —R.sup.L—NH—C(O)—(CH.sub.2).sub.n—, —R.sup.L—NH—S(O).sub.2—(CH.sub.2).sub.n—, or —C(O)—(CH.sub.2).sub.n—. In some embodiments, R.sup.L has the structure:
(77) ##STR00025##
In some embodiments, R.sup.L has the structure:
(78) ##STR00026##
In some embodiments, each R.sup.1 is hydrogen. In some embodiments, one of R.sup.1 is a group —R, or —R.sup.L—R and each other R.sup.1 is hydrogen. The Cas9 inhibiting compounds may have the structure:
(79) ##STR00027## ##STR00028##
(80) In some embodiments, the Cas9 inhibiting compounds may have the structure of Formula (II):
(81) ##STR00029## wherein “y” is independently selected at each occurrence from 0 or 1, and the wavy bond indicates the presence of a stereocenter which may be in the (R) or (S) configuration. In some embodiments, “y” is selected from 0 or 1. In some embodiments, the Cas9 inhibiting compounds have the structure of Formula IIA or IIB:
(82) ##STR00030## wherein R.sub.4 is independently selected at each occurrence from hydrogen, —X, —R, -L.sub.1-X, or -L.sub.1-R; and R.sup.1-R.sup.3 are independently selected from hydrogen, —X, —R, -L.sub.1-X, or -L.sub.1-R; where X is independently selected at each occurrence from CN, OH, CF.sub.3, COOH, OR, OR, NR.sub.2, or halogen (e.g., —Cl, —F, —Br, etc.); L.sub.1 is selected from —(CH.sub.2).sub.n—, —(CH.sub.2).sub.n—C(O)O—, —(CH.sub.2).sub.n—C(O)—NH—, —(CH.sub.2).sub.n—NH—C(O)—, —(CH.sub.2).sub.n—NH—SO.sub.2—, —(CH.sub.2).sub.n—SO.sub.2—NH—, —(CH.sub.2).sub.n—SO.sub.2—, —(CH.sub.2).sub.n—SO.sub.2—NH—C(O)—, —(CH.sub.2).sub.n—R.sup.L—, —R.sup.L—NH—C(O)—(CH.sub.2).sub.n—, —R.sup.L—NH—S(O).sub.2—(CH.sub.2).sub.n—, —R.sup.L—C(O)—O—, —S—, —S(O)—, —S(O).sub.2—; wherein n is independently at each occurrence 0, 1, 2, 3, 4, 5, or 6; R.sup.L is independently selected at each occurrence from C.sub.1-C.sub.12 linear and/or branched and/or cyclic and/or aromatic bivalent radicals (e.g., alkyl, alkenyl, alkynyl, aryl, alkyl-aryl, arayl-alkyl, and combinations thereof); optionally substituted with one or more (e.g., 1-5) groups X and/or with 1-6 heteroatoms selected from O, S, N, P, F, Cl, Br, I; and R is selected from C.sub.1-12 hydrocarbons (e.g., alkyl, alkenyl, alkynyl, aryl, alkyl-aryl, arayl-alkyl, and combinations thereof), optionally substituted with one or more (e.g., 1-5) groups X and/or with 1-10 heteroatoms selected from O, S, N, P, F, Cl, Br, I, and combinations thereof.
(83) In some embodiments, R.sup.4 is selected at each occurrence from hydrogen or —OR. In some embodiments, one of R.sup.4 is —OR and each other of R.sup.4 is hydrogen. In some embodiments, R.sup.2 is a group -L.sub.1-R, -L.sub.1-X, where L.sub.1 is selected from —C(O), —(CH.sub.2).sub.n—, —C(O)—(CH.sub.2).sub.n—, —CH.sub.2).sub.n—C(O)—. In some embodiments, R is a C.sub.3-6 optionally aromatic cyclic hydrocarbon optionally substituted with one or more (e.g., two, three, etc.) functional groups selected from —F, —Cl, —OR* (e.g., —OCH.sub.3), or —NH—C(O)O—C(CH.sub.3).sub.3 (i.e. NHBoc). In some embodiments, R is methyl, ethyl, propyl, butyl, ethenyl (i.e., —CH═CH.sub.2), or ethynyl (e.g., —C≡CH). In some embodiments, R.sup.2 is -L.sub.1-X, or -L.sub.1-R, where L.sub.1 is —R.sup.L—NH—C(O)—(CH.sub.2).sub.n—, —R.sup.L—NH—S(O).sub.2—(CH.sub.2).sub.n—, or —C(O)—(CH.sub.2).sub.n—. In some embodiments, R.sup.L has the structure:
(84) ##STR00031##
In some embodiments, R.sup.L has the structure:
(85) ##STR00032##
In some embodiments, the Cas9 inhibiting compounds have the structure:
(86) ##STR00033##
(87) In some embodiments, the Cas9 inhibiting compounds have the structure of Formula (III):
(88) ##STR00034## wherein R.sup.1-R.sup.2 are independently selected from hydrogen, —X, —R, -L.sub.1-X, or -L.sub.1-R; where X is independently selected at each occurrence from CN, OH, CF.sub.3, COOH, OR, OR, NR.sub.2, or halogen (e.g., —Cl, —F, —Br, etc.); L.sub.1 is selected from —(CH.sub.2).sub.n—, —(CH.sub.2).sub.n—C(O)O—, —(CH.sub.2).sub.n—C(O)—NH—, —(CH.sub.2).sub.n—NH—C(O)—, —(CH.sub.2).sub.n—NH—SO.sub.2—, —(CH.sub.2).sub.n—SO.sub.2—NH—, —(CH.sub.2).sub.n—SO.sub.2—, —(CH.sub.2).sub.n—SO.sub.2—NH—C(O)—, —(CH.sub.2).sub.n—R.sup.L—, —R.sup.L—C(O)—O—, —S—, —S(O)—, —S(O).sub.2—; wherein n is independently 0, 1, 2, 3, 4, 5, or 6; R.sup.L is independently selected at each occurrence from C.sub.1-C.sub.12 linear and/or branched and/or cyclic and/or aromatic bivalent radicals (e.g., alkyl, alkenyl, alkynyl, aryl, alkyl-aryl, arayl-alkyl, and combinations thereof); optionally substituted with one or more (e.g., 1-5) groups X and/or with 1-6 heteroatoms selected from O, S, N, P, F, Cl, Br, I; and R is selected from C.sub.1-12 hydrocarbons (e.g., alkyl, alkenyl, alkynyl, aryl, alkyl-aryl, arayl-alkyl, and combinations thereof), optionally substituted with one or more (e.g., 1-5) groups X and/or with 1-10 heteroatoms selected from O, S, N, P, F, Cl, Br, I, and combinations thereof.
(89) In some embodiments, the Cas9 inhibiting compounds have the structure of Formula (IV):
(90) ##STR00035## wherein each wavy bond may be in the R or the S configuration, R.sup.1-R.sup.2 are independently selected from hydrogen, —X, —R, -L.sub.1-X, or -L.sub.1-R; where X is independently selected at each occurrence from CN, OH, CF.sub.3, COOH, OR, OR, NR.sub.2, or halogen (e.g., —Cl, —F, —Br, etc.); L.sub.1 is selected from —(CH.sub.2).sub.n—, —(CH.sub.2).sub.n—C(O)O—, —(CH.sub.2).sub.n—C(O)—NH—, —(CH.sub.2).sub.n—NH—C(O)—, —(CH.sub.2).sub.n—NH—SO.sub.2—, —(CH.sub.2).sub.n—SO.sub.2—NH—, —(CH.sub.2).sub.n—SO.sub.2—, —(CH.sub.2).sub.n—SO.sub.2—NH—C(O)—, —(CH.sub.2).sub.n—R.sup.L—, —R.sup.L—C(O)—O—, —S—, —S(O)—, —S(O).sub.2—; wherein n is independently 0, 1, 2, 3, 4, 5, or 6; R.sup.L is independently selected at each occurrence from C.sub.1-C.sub.12 linear and/or branched and/or cyclic and/or aromatic bivalent radicals (e.g., alkyl, alkenyl, alkynyl, aryl, alkyl-aryl, arayl-alkyl, and combinations thereof); optionally substituted with one or more (e.g., 1-5) groups X and/or with 1-6 heteroatoms selected from O, S, N, P, F, Cl, Br, I; and R is selected from C.sub.1-12 hydrocarbons (e.g., alkyl, alkenyl, alkynyl, aryl, alkyl-aryl, arayl-alkyl, and combinations thereof), optionally substituted with one or more (e.g., 1-5) groups X and/or with 1-10 heteroatoms selected from O, S, N, P, F, Cl, Br, I, and combinations thereof. In some embodiments, the Cas9 inhibiting compounds have the structure:
(91) ##STR00036##
(92) In some embodiments, the Cas9 inhibiting compounds have the structure of Formula V:
(93) ##STR00037## wherein R.sup.1 is independently selected at each occurrence from hydrogen, —X, —R, -L.sub.1-X, or -L.sub.1-R; and R.sup.2-R.sup.3 are independently selected from hydrogen, —X, —R, -L.sub.1-X, or -L.sub.1-R; where X is independently selected at each occurrence from CN, OH, CF.sub.3, COOH, OR, OR, NR.sub.2, or halogen (e.g., —Cl, —F, —Br, etc.); L.sub.1 is selected from —(CH.sub.2).sub.n—, —(CH.sub.2).sub.n—C(O)O—, —(CH.sub.2).sub.n—C(O)—NH—, —(CH.sub.2).sub.n—NH—C(O)—, —(CH.sub.2).sub.n—NH—SO.sub.2—, —(CH.sub.2).sub.n—SO.sub.2—NH—, —(CH.sub.2).sub.n—SO.sub.2—, —(CH.sub.2).sub.n—SO.sub.2—NH—C(O)—, —(CH.sub.2).sub.n—R.sup.L—, —R.sup.L—C(O)—O—, —S—, —S(O)—, —S(O).sub.2—; wherein n is independently 0, 1, 2, 3, 4, 5, or 6; R.sup.L is independently selected at each occurrence from C.sub.1-C.sub.12 linear and/or branched and/or cyclic and/or aromatic bivalent radicals (e.g., alkyl, alkenyl, alkynyl, aryl, alkyl-aryl, arayl-alkyl, and combinations thereof); optionally substituted with one or more (e.g., 1-5) groups X and/or with 1-6 heteroatoms selected from O, S, N, P, F, Cl, Br, I; and R is selected from C.sub.1-12 hydrocarbons (e.g., alkyl, alkenyl, alkynyl, aryl, alkyl-aryl, arayl-alkyl, and combinations thereof), optionally substituted with one or more (e.g., 1-5) groups X and/or with 1-10 heteroatoms selected from O, S, N, P, F, Cl, Br, I, and combinations thereof. In some embodiments, each of R.sup.1 is hydrogen. In some embodiments, R.sup.2 or R.sup.3 is independently -L.sub.1-R, where L.sub.1 is selected from —C(O)—, or —C(O)—(CH.sub.2).sub.n—. In some embodiments R is a six membered aromatic ring optionally substituted with N. In some embodiments, the Cas9 inhibitors have the structure:
(94) ##STR00038##
(95) The disclosed compounds can be in free base form unassociated with other ions or molecules, or they can be a pharmaceutically acceptable salt, solvate, or prodrug thereof. One aspect provides a disclosed compound or a pharmaceutically acceptable salt. One aspect provides a disclosed compound or a pharmaceutically acceptable salt or solvate thereof. One aspect provides a pharmaceutically acceptable salt of a disclosed compound. One aspect provides a solvate of a disclosed compound. One aspect provides a hydrate of a disclosed compound. One aspect provides a prodrug of a disclosed compound.
(96) The disclosed compounds can be in free base form unassociated with other ions or molecules, or they can be a pharmaceutically acceptable salt, solvate, or prodrug thereof. One aspect provides a disclosed compound or a pharmaceutically acceptable salt. One aspect provides a disclosed compound or a pharmaceutically acceptable salt or solvate thereof. One aspect provides a pharmaceutically acceptable salt of a disclosed compound. One aspect provides a solvate of a disclosed compound. One aspect provides a hydrate of a disclosed compound. One aspect provides a prodrug of a disclosed compound.
(97) Methods of Use
(98) Small molecule inhibitors of RNA guided endonucleases (e.g., Cas9) were developed that have the potential to allow rapid, dosable, and/or temporal control of Cas9 activities. Reports of small-molecule controlled Cas9 activity are present in literature (Senis et al., Biotechnol J 2014, 9, 1402-12; Wright et al., Proc Natl Acad Sci USA. 2015 March 10; 112(10):2984-9; Gonzalez et al., Cell Stem Cell 2014, 15, 215-26; Davis et al., Nat Chem Biol 2015, 11, 316-8). However, none of them ensure dosability—the small molecules act merely as inducers of Cas9 activity. Further, most of these small molecule systems are not reversible upon removal of the small molecule (Zetsche et al., Nat Biotech 2015, 33, 139-142; Davis et al., Nat Chem Biol 2015, 11, 316-8), and therefore, do not allow precise temporal control in transcriptional regulatory technologies.
(99) Small molecule inhibitors of RNA guided endonucleases (e.g., Cas9) have potential therapeutic uses for regulating genome editing technologies involving RNA guided endonucleases. Dosable control of the therapeutic activity of RNA guided endonucleases introduced into a subject or cell of a subject is important for effective genome editing therapeutic strategies. Small molecule inhibitors of RNA guided endonucleases can be administered to a subject undergoing RNA guided endonuclease based gene therapy or any other RNA guided endonuclease based therapy. In certain embodiments, the subject is a human or mammal. Small molecule inhibitors of RNA guided endonucleases eliminate or reduce undesirable off-target editing and chromosomal translocations when present at high concentrations Furthermore, small molecule inhibitors of RNA guided endonucleases can be used to rapidly terminate constitutively active Cas9, following on-target gene-editing.
(100) Small molecule inhibitors of RNA guided endonucleases can also be used to regulate genome editing technologies in other organisms, including invertebrates, plants, and unicellular organisms (e.g., bacteria). Potential uses include regulating gene drives for entomological and agricultural uses. In addition, it is anticipated that Cas9 inhibitors will be valuable probes to understand the role of Cas9 in CRISPR-mediated bacterial immunity (e.g., spacer acquisition) (Nunez et al., Nature. 2015 Mar. 12; 519(7542):193-8; Heler et al., Nature 2015, 519, 199-202). Along similar lines, Cas9 inhibitors can be deployed for directed evolution of Cas9. It is hypothesized that Cas9 inhibitors will disrupt bacterial immunity against bacteriophages (or toxic DNA) by interfering with the CRISPR-Cas9-based immune surveillance system in bacteria. Akin to the development of antibiotic resistance, bacteria will be forced to evolve Cas9 protein. Accordingly, the inhibitors may also be used as an anti-infective agent.
(101) Formulations
(102) Agents described herein, including analogs thereof, and/or agents discovered to have medicinal value using the methods described herein are useful as a drug for inhibiting RNA guided nucleases (e.g., Cas9, Cpf1). For therapeutic uses, the compositions or agents identified using the methods disclosed herein may be administered systemically, for example, formulated in a pharmaceutically-acceptable buffer such as physiological saline. Preferable routes of administration include, for example, subcutaneous, intravenous, interperitoneally, intramuscular, or intradermal injections that provide continuous, sustained levels of the drug in the patient. Treatment of human patients or other animals will be carried out using a therapeutically effective amount of a therapeutic identified herein in a physiologically-acceptable carrier. Suitable carriers and their formulation are described, for example, in Remington's Pharmaceutical Sciences by E. W. Martin. The amount of the therapeutic agent to be administered varies depending upon the manner of administration, the age and body weight of the patient, and with the clinical symptoms. Generally, amounts will be in the range of those used for other agents used in the treatment of disease.
(103) The disclosed compounds may be administered alone (e.g., in saline or buffer) or using any delivery vehicles known in the art. For instance the following delivery vehicles have been described: Cochleates; Emulsomes, ISCOMs; Liposomes; Live bacterial vectors (e.g., Salmonella, Escherichia coli, Bacillus calmatte-guerin, Shigella, Lactobacillus); Live viral vectors (e.g., Vaccinia, adenovirus, Herpes Simplex); Microspheres; Nucleic acid vaccines; Polymers; Polymer rings; Proteosomes; Sodium Fluoride; Transgenic plants; Virosomes; Virus-like particles. Other delivery vehicles are known in the art and some additional examples are provided below.
(104) The disclosed compounds may be administered by any route known, such as, for example, orally, transdermally, intravenously, cutaneously, subcutaneously, nasally, intramuscularly, intraperitoneally, intracranially, and intracerebroventricularly.
(105) In certain embodiments, disclosed compounds are administered at dosage levels greater than about 0.001 mg/kg, such as greater than about 0.01 mg/kg or greater than about 0.1 mg/kg. For example, the dosage level may be from about 0.001 mg/kg to about 50 mg/kg such as from about 0.01 mg/kg to about 25 mg/kg, from about 0.1 mg/kg to about 10 mg/kg, or from about 1 mg/kg to about 5 mg/kg of subject body weight per day, one or more times a day, to obtain the desired therapeutic effect. It will also be appreciated that dosages smaller than about 0.001 mg/kg or greater than about 50 mg/kg (for example about 50-100 mg/kg) can also be administered to a subject.
(106) In one embodiment, the compound is administered once-daily, twice-daily, or three-times daily. In one embodiment, the compound is administered continuously (i.e., every day) or intermittently (e.g., 3-5 days a week). In another embodiment, administration could be on an intermittent schedule.
(107) Further, administration less frequently than daily, such as, for example, every other day may be chosen. In additional embodiments, administration with at least 2 days between doses may be chosen. By way of example only, dosing may be every third day, bi-weekly or weekly. As another example, a single, acute dose may be administered. Alternatively, compounds can be administered on a non-regular basis e.g., whenever symptoms begin. For any compound described herein the effective amount can be initially determined from animal models.
(108) Toxicity and efficacy of the compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD.sub.50 (the dose lethal to 50% of the population) and the ED.sub.50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD.sub.50/ED.sub.50. Compounds that exhibit large therapeutic indices may have a greater effect when practicing the methods as disclosed herein. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
(109) Data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage of the compounds disclosed herein for use in humans. The dosage of such agents lies within a range of circulating concentrations that include the ED.sub.50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the disclosed methods, the effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC.sub.50 (i.e., the concentration of the test compound that achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography. In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.1% of an active compound. In other embodiments, the active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein. Multiple doses of the compounds are also contemplated.
(110) The formulations disclosed herein are administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, and optionally other therapeutic ingredients.
(111) For use in therapy, an effective amount of one or more disclosed compounds can be administered to a subject by any mode that delivers the compound(s) to the desired surface, e.g., mucosal, systemic. Administering the pharmaceutical composition of the present disclosure may be accomplished by any means known to the skilled artisan. Disclosed compounds may be administered orally, transdermally, intravenously, cutaneously, subcutaneously, nasally, intramuscularly, intraperitoneally, intracranially, or intracerebroventricularly.
(112) For oral administration, one or more compounds can be formulated readily by combining the active compound(s) with pharmaceutically acceptable carriers well known in the art. Such carriers enable the compounds to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated.
(113) Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. Optionally the oral formulations may also be formulated in saline or buffers, i.e. EDTA for neutralizing internal acid conditions or may be administered without any carriers.
(114) Also specifically contemplated are oral dosage forms of one or more disclosed compounds. The compound(s) may be chemically modified so that oral delivery of the derivative is efficacious. Generally, the chemical modification contemplated is the attachment of at least one moiety to the compound itself, where said moiety permits (a) inhibition of proteolysis; and (b) uptake into the blood stream from the stomach or intestine. Also desired is the increase in overall stability of the compound(s) and increase in circulation time in the body. Examples of such moieties include: polyethylene glycol, copolymers of ethylene glycol and propylene glycol, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone and polyproline. Other polymers that could be used are poly-1,3-dioxolane and poly-1,3,6-tioxocane. In some aspects for pharmaceutical usage, as indicated above, are polyethylene glycol moieties.
(115) The location of release may be the stomach, the small intestine (the duodenum, the jejunum, or the ileum), or the large intestine. One skilled in the art has available formulations which will not dissolve in the stomach, yet will release the material in the duodenum or elsewhere in the intestine. In some aspects, the release will avoid the deleterious effects of the stomach environment, either by protection of the compound or by release of the biologically active material beyond the stomach environment, such as in the intestine.
(116) To ensure full gastric resistance a coating impermeable to at least pH 5.0 is important. Examples of the more common inert ingredients that are used as enteric coatings are cellulose acetate trimellitate (CAT), hydroxypropylmethylcellulose phthalate (HPMCP), HPMCP 50, HPMCP 55, polyvinyl acetate phthalate (PVAP), Eudragit L30D, Aquateric, cellulose acetate phthalate (CAP), Eudragit L, Eudragit S, and Shellac. These coatings may be used as mixed films.
(117) A coating or mixture of coatings can also be used on tablets, which are not intended for protection against the stomach. This can include sugar coatings, or coatings which make the tablet easier to swallow. Capsules may consist of a hard shell (such as gelatin) for delivery of dry therapeutic i.e. powder; for liquid forms, a soft gelatin shell may be used. The shell material of cachets could be thick starch or other edible paper. For pills, lozenges, molded tablets or tablet triturates, moist massing techniques can be used.
(118) The disclosed compounds can be included in the formulation as fine multiparticulates in the form of granules or pellets of particle size about 1 mm. The formulation of the material for capsule administration could also be as a powder, lightly compressed plugs or even as tablets. The compound could be prepared by compression.
(119) Colorants and flavoring agents may all be included. For example, the compound may be formulated (such as by liposome or microsphere encapsulation) and then further contained within an edible product, such as a refrigerated beverage containing colorants and flavoring agents.
(120) One may dilute or increase the volume of compound delivered with an inert material. These diluents could include carbohydrates, especially mannitol, α-lactose, anhydrous lactose, cellulose, sucrose, modified dextrans and starch. Certain inorganic salts may be also be used as fillers including calcium triphosphate, magnesium carbonate and sodium chloride. Some commercially available diluents are Fast-Flo, Emdex, STA-Rx 1500, Emcompress and Avicell. Disintegrants may be included in the formulation of the therapeutic into a solid dosage form. Materials used as disintegrates include but are not limited to starch, including the commercial disintegrant based on starch, Explotab. Sodium starch glycolate, Amberlite, sodium carboxymethylcellulose, ultramylopectin, sodium alginate, gelatin, orange peel, acid carboxymethyl cellulose, natural sponge and bentonite may all be used. Another form of the disintegrants is the insoluble cationic exchange resins. Powdered gums may be used as disintegrants and as binders and these can include powdered gums such as agar, Karaya or tragacanth. Alginic acid and its sodium salt are also useful as disintegrants.
(121) Binders may be used to hold the therapeutic together to form a hard tablet and include materials from natural products such as acacia, tragacanth, starch and gelatin. Others include methyl cellulose (MC), ethyl cellulose (EC) and carboxymethyl cellulose (CMC). Polyvinyl pyrrolidone (PVP) and hydroxypropylmethyl cellulose (HPMC) could both be used in alcoholic solutions to granulate the therapeutic.
(122) An anti-frictional agent may be included in the formulation of the compound to prevent sticking during the formulation process. Lubricants may be used as a layer between the compound and the die wall, and these can include but are not limited to; stearic acid including its magnesium and calcium salts, polytetrafluoroethylene (PTFE), liquid paraffin, vegetable oils and waxes. Soluble lubricants may also be used such as sodium lauryl sulfate, magnesium lauryl sulfate, polyethylene glycol of various molecular weights, Carbowax 4000 and 6000. Glidants that might improve the flow properties of the drug during formulation and to aid rearrangement during compression might be added. The glidants may include starch, talc, pyrogenic silica and hydrated silicoaluminate.
(123) To aid dissolution of the compound into the aqueous environment a surfactant might be added as a wetting agent. Surfactants may include anionic detergents such as sodium lauryl sulfate, dioctyl sodium sulfosuccinate and dioctyl sodium sulfonate. Cationic detergents might be used and could include benzalkonium chloride or benzethomium chloride. The list of potential non-ionic detergents that could be included in the formulation as surfactants are lauromacrogol 400, polyoxyl 40 stearate, polyoxyethylene hydrogenated castor oil 10, 50 and 60, glycerol monostearate, polysorbate 40, 60, 65 and 80, sucrose fatty acid ester, methyl cellulose and carboxymethyl cellulose. These surfactants could be present in the formulation of the compound either alone or as a mixture in different ratios.
(124) Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. Microspheres formulated for oral administration may also be used. Such microspheres have been well defined in the art. All formulations for oral administration should be in dosages suitable for such administration.
(125) For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.
(126) For administration by inhalation, the compounds for use according to the present disclosure may be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
(127) Also contemplated herein is pulmonary delivery of the compounds of the disclosure. The compound is delivered to the lungs of a mammal while inhaling and traverses across the lung epithelial lining to the blood stream using methods well known in the art.
(128) Contemplated for use in the practice of methods disclosed herein are a wide range of mechanical devices designed for pulmonary delivery of therapeutic products, including but not limited to nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those skilled in the art. Some specific examples of commercially available devices suitable for the practice of these methods are the Ultravent nebulizer, manufactured by Mallinckrodt, Inc., St. Louis, Missouri; the Acorn II nebulizer, manufactured by Marquest Medical Products, Englewood, Colorado; the Ventolin metered dose inhaler, manufactured by Glaxo Inc., Research Triangle Park, North Carolina; and the Spinhaler powder inhaler, manufactured by Fisons Corp., Bedford, Massachusetts
(129) All such devices require the use of formulations suitable for the dispensing of compound. Typically, each formulation is specific to the type of device employed and may involve the use of an appropriate propellant material, in addition to the usual diluents, and/or carriers useful in therapy. Also, the use of liposomes, microcapsules or microspheres, inclusion complexes, or other types of carriers is contemplated. Chemically modified compound may also be prepared in different formulations depending on the type of chemical modification or the type of device employed. Formulations suitable for use with a nebulizer, either jet or ultrasonic, will typically comprise compound dissolved in water at a concentration of about 0.1 to about 25 mg of biologically active compound per mL of solution. The formulation may also include a buffer and a simple sugar (e.g., for stabilization and regulation of osmotic pressure). The nebulizer formulation may also contain a surfactant, to reduce or prevent surface induced aggregation of the compound caused by atomization of the solution in forming the aerosol.
(130) Formulations for use with a metered-dose inhaler device will generally comprise a finely divided powder containing the compound suspended in a propellant with the aid of a surfactant. The propellant may be any conventional material employed for this purpose, such as a chlorofluorocarbon, a hydrochlorofluorocarbon, a hydrofluorocarbon, or a hydrocarbon, including trichlorofluoromethane, dichlorodifiuoromethane, dichlorotetrafluoroethanol, and 1,1,1,2-tetrafluoroethane, or combinations thereof. Suitable surfactants include sorbitan trioleate and soya lecithin. Oleic acid may also be useful as a surfactant.
(131) Formulations for dispensing from a powder inhaler device will comprise a finely divided dry powder containing compound and may also include a bulking agent, such as lactose, sorbitol, sucrose, or mannitol in amounts which facilitate dispersal of the powder from the device, e.g., about 50 to about 90% by weight of the formulation. The compound should most advantageously be prepared in particulate form with an average particle size of less than 10 mm (or microns), such as about 0.5 to about 5 mm, for an effective delivery to the distal lung.
(132) Nasal delivery of a disclosed compound is also contemplated. Nasal delivery allows the passage of a compound to the blood stream directly after administering the therapeutic product to the nose, without the necessity for deposition of the product in the lung. Formulations for nasal delivery include those with dextran or cyclodextran.
(133) For nasal administration, a useful device is a small, hard bottle to which a metered dose sprayer is attached. In one embodiment, the metered dose is delivered by drawing the pharmaceutical composition solution into a chamber of defined volume, which chamber has an aperture dimensioned to aerosolize and aerosol formulation by forming a spray when a liquid in the chamber is compressed. The chamber is compressed to administer the pharmaceutical composition. In a specific embodiment, the chamber is a piston arrangement. Such devices are commercially available.
(134) Alternatively, a plastic squeeze bottle with an aperture or opening dimensioned to aerosolize an aerosol formulation by forming a spray when squeezed is used. The opening is usually found in the top of the bottle, and the top is generally tapered to partially fit in the nasal passages for efficient administration of the aerosol formulation. In some aspects, the nasal inhaler will provide a metered amount of the aerosol formulation, for administration of a measured dose of the drug.
(135) The compound, when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
(136) Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions.
(137) Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
(138) Alternatively, the active compounds may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
(139) The compounds may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
(140) In addition to the formulations described previously, the compounds may also be formulated as a depot preparation. Such long acting formulations may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
(141) The pharmaceutical compositions also may comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
(142) Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin. The pharmaceutical compositions also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above. The pharmaceutical compositions are suitable for use in a variety of drug delivery systems.
(143) The compounds may be administered per se (neat) or in the form of a pharmaceutically acceptable salt. When used in medicine the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof. Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group.
(144) Suitable buffering agents include: acetic acid and a salt (about 1-2% w/v); citric acid and a salt (about 1-3% w/v); boric acid and a salt (about 0.5-2.5% w/v); and phosphoric acid and a salt (about 0.8-2% w/v). Suitable preservatives include benzalkonium chloride (about 0.003-0.03% w/v); chlorobutanol (about 0.3-0.9% w/v); parabens (about 0.01-0.25% w/v) and thimerosal (about 0.004-0.02% w/v).
(145) The pharmaceutical compositions contain an effective amount of a disclosed compound optionally included in a pharmaceutically acceptable carrier. The term pharmaceutically acceptable carrier means one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration to a human or other vertebrate animal. The term carrier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being commingled with the compounds, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficiency.
(146) Provided herein are methods of synthesizing disclosed compounds. A compound provided herein can be synthesized using a variety of methods known in the art. The schemes and description below depict general routes for the preparation of disclosed compounds.
(147) Fluorescence Polarization-Based Assays
(148) In one aspect, the invention provides an assay that monitors the change in the fluorescence polarization of the fluorophore-labelled PAM-rich target DNA (henceforth called 12PAM-DNA) upon binding to [Cas9:guideRNA] complex. In this assay, the complexation of [Cas9:guideRNA] to 12PAM-DNA shows a dose-dependent increase in fluorophore polarization.
(149) Fluorescence polarization is a useful technique to monitor the interaction between two molecules, including for example, Cas9-gRNA (ribonucleoprotein) complex and target DNA (12PAM). Exemplary fluorophore-labelled PAM-rich target DNA is shown below:
(150) TABLE-US-00011 (SEQ ID NO: 1) 5′-GGCTGGACCACGCGGGAAAATCCACCTAGGTGGTTCCTCTTCGG ATGTTCCATCCTTT/36-FAM-3′ (SEQ ID NO: 2) 3′-CCGACCTGGTGCGCCCTTTTAGGTGGATCCACCAAGGAGAAGCC TACAAGGTAGGAAA-5′
The technique is based on the change in the tumbling rate or mass after complexation. Following the FP principle, smaller fragment was fluorescently labelled and polarizations were compared before and after complexation in the presence and absence of compounds. While complexation of Cas9:gRNA-DNA showed an enhancement in the FP value, the inhibitors should revert back the enhanced signal intensity. To verify this assumption, Cas9:gRNA-DNA complexation was formed in the presence of excess unlabeled DNA template (with no fluorophore tagging) and measured the FP value. As expected, a sharp decrease in the FP value was observed. Without being bound to theory, this was due at least in part to the displacement of the fluorophore labeled DNA by the cold one. Furthermore, it was investigate whether the displacement by the cold DNA was random or specific. To address this, a competition assay was performed where Cas9-gRNA was incubated with 12PAM DNA template either in the absence or presence of unlabeled DNA with increasing number of PAM density. Interestingly, zero (0) PAM DNA template did not show any considerable inhibition of fluorophore labeled 12PAM binding. In contrast, both 4PAM and 12PAM showed efficient inhibition though the extent was considerably more for 12PAM than the 4PAM DNA. These findings confirmed that the interaction between Cas9:gRNA and DNA template was specific and can be precisely monitored by reading out the FP value. In conclusion, the FP based assay can be used for the Cas9 inhibitor screening assay.
(151) At an initial stage, FP-based screening of 10,000 compounds was performed consisting of structurally diverse scaffolds with vast functional variability. DMSO was used as a negative control while 12PAM cold DNA was used as the competitive positive control. Upon transformation of the large set of data into scatter plot, nearly 0.5% (>3 standard deviation) of the compounds were identified as the potential hits. Interestingly, a large portion of the hit compounds found to have similarity in their molecular scaffold with variation in the stereochemistry and functionality. Numerous structural and functional diversities in the compound library offered a wide scope of medicinal chemistry. Some of the hit compounds like spirocyclic library showed exciting stereo-centric dependence of the compound on their activity. To further understand the nature of these hit compounds, their dose dependence on activity was examined. The potential hit compounds showed excellent dose dependent Cas9 inhibition activity with an IC.sub.50 value as low as 0.6 μM. These finding further re-confirms the validation of the primary assay.
(152) Spinach Transcription Assay
(153) In one aspect, the invention provides a transcription assay to detect the activity of an RNA guided endonuclease. In one embodiment, the level of transcription is suppressed by Cas9 nuclease activity in an in vitro assay. In various embodiments, the transcription assay involves expression of a nucleic acid aptamer that binds a molecular fluorophore to generate a fluorescent signal. Such aptamer-fluorophore combinations are known in the art, including for example, the Spinach aptamer having the sequence
(154) TABLE-US-00012 (SEQ ID NO: 20) 5′-GGGAGACGCAACUGAAUGAAAUGGUGAAGGACGGGUCCAGGUGU GGCUGCUUCGGCAGUGCAGCUUGUUGAGUAGAGUGUGAGCUCCGCGU AACUAGUCGCGUCAC-3′
and the fluorophore 4-(3,5-difluoro-4-hydroxybenzylidene)-1,2-dimethyl-1H-imidazol-5-one (DFHBI) (see, e.g., US20120252699 and US20140220560, each of which is incorporated herein in their entirety). In the Spinach assay, Cas9 can cleave the DNA template and thus inhibit in vitro transcription of the nucleic acid aptamer. In certain embodiments, the guide RNA targeting the Spinach aptamer has the sequence
(155) TABLE-US-00013 (SEQ ID NO: 11) 5′-GCUAUAGGACGCGACCGAAAGUUUUAGAGCUAGAAAUAGCAAGU UAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUC GGUGCUUUU-3′
In the presence of fluorophore, suppression in transcription results in the reduction of RNA aptamer-fluorophore concentration and hence in the fluorescence signal. In vitro transcription reactions may comprise a purified linear DNA template containing a promoter operatively linked to a nucleic acid sequence encoding an RNA aptamer, ribonucleotide triphosphates, a buffer system (e.g., including DTT and magnesium ions, and an appropriate phage RNA polymerase (e.g., T7 polymerase).
EGFP Disruption Assay
(156) In some embodiments, a quantitative human cell-based reporter assay that enables rapid quantitation of targeted nuclease activities is used to characterize off-target cleavage of Cas9-based RNA guided endonucleases. In this assay, the activities of nucleases targeted to a single integrated EGFP reporter gene can be quantified by assessing loss of fluorescence signal in human U2OS.EGFP cells caused by inactivating frameshift insertion/deletion (indel) mutations introduced by error prone non-homologous end-joining (NHEJ) repair of nuclease-induced double-stranded breaks (DSBs).
(157) In one protocol, U2OS.EGFP cells harboring a single integrated copy of an EGFP-PEST fusion gene are cultured (see e.g., Reyon et al., Nat Biotech 30, 460-465 (2012), which is herein incorporated by reference in its entirety). For transfections, 200,000 cells are Nucleofected with gRNA expression plasmid and pJDS246 together with 30 ng of a Td-tomato-encoding plasmid using the SE Cell Line 4D-Nucleofector™ X Kit (Lonza) according to the manufacturer's protocol. Cells are analyzed 2 days post-transfection using a BD LSRII flow cytometer. Transfections for optimizing gRNA/Cas9 plasmid concentration are performed in triplicate and all other transfections are performed in duplicate.
(158) PCR amplification is used for sequence verification of endogenous human genomic sites. PCR reactions are performed using Phusion Hot Start II high-fidelity DNA polymerase (NEB). Loci are amplified using touchdown PCR (98° C., 10 s; 72-62° C., −1° C./cycle, 15 s; 72° C., 30 s] 10 cycles, [98° C., 10 s; 62° C., 15 s; 72° C., 30 s] 25 cycles). Alternatively, PCR for other targets are performed with 35 cycles at a constant annealing temperature of 68° C. or 72° C. and 3% DMSO or 1M betaine, if necessary. PCR products are analyzed on a QIAXCEL capillary electrophoresis system to verify both size and purity. Validated products are treated with ExoSap-IT (Affymetrix) and sequenced by the Sanger method (MGH DNA Sequencing Core) to verify each target site.
(159) SURVEYOR Nuclease Assay
(160) In various embodiments, SURVEYOR nuclease assay is used to assess genome modification (see e.g., US20150356239, which is herein incorporated by reference in its entirety. In one protocol, 293FT cells are transfected with plasmid DNA. Cells were incubated at 37° C. for 72 hours post-transfection prior to genomic DNA extraction. Genomic DNA is extracted using the QuickExtract DNA Extraction Solution (Epicentre) following the manufacturer's protocol. Briefly, pelleted cells are resuspended in QuickExtract solution and incubated at 65° C. for 15 minutes and 98° C. for 10 minutes.
(161) The genomic region flanking the CR1SPR target site for each gene is PCR amplified, and products are purified using QiaQuick Spin Column (Qiagen) following the manufacturer's protocol. 400 ng total of the purified PCR products are mixed with 2 μl 10× Taq DNA Polymerase PCR buffer (Enzytrsaties) and ultrapure water to a final volume of 20 μl, and subjected to a re-annealing process to enable heteroduplex formation: 95° C. for 10 min, 95° C. to 85° C. ramping at −2° C./s, 85° C. to 25° C. at −0.25° C./s, and 25° C. hold for 1 minute. After re-annealing, products are treated with SURVEYOR nuclease and SURVEYOR enhancer S (Transgenomics) following the manufacturer's recommended protocol, and analyzed on 4-20% Novex TBE poly-acrylamide gels (Life Technologies). Gels re stained with SYBR Gold DNA stain (Life Technologies) for 30 minutes and imaged with a Gel Doe gel imaging system (Bio-rad). Quantification is based on relative band intensities.
(162) Test Compounds and Extracts
(163) In general, small molecule compounds are known in the art or are identified from large libraries of both natural product or synthetic (or semi-synthetic) extracts or chemical libraries or from polypeptide or nucleic acid libraries, according to methods known in the art. Those skilled in the field of drug discovery and development will understand that the precise source of test extracts or compounds is not critical to the screening procedure(s) of the invention. Compounds used in screens may include known compounds (for example, known therapeutics used for other diseases or disorders). Alternatively, virtually any number of unknown chemical extracts or compounds can be screened using the methods described herein. Examples of such extracts or compounds include, but are not limited to, plant-, fungal-, prokaryotic- or animal-based extracts, fermentation broths, and synthetic compounds, as well as modification of existing compounds.
(164) Numerous methods are also available for generating random or directed synthesis (e.g., semi-synthesis or total synthesis) of any number of chemical compounds, including, but not limited to, saccharide-, lipid-, peptide-, and nucleic acid-based compounds. Synthetic compound libraries are commercially available from Brandon Associates (Merrimack, N.H.) and Aldrich Chemical (Milwaukee, Wis.). Alternatively, chemical compounds to be used as candidate compounds can be synthesized from readily available starting materials using standard synthetic techniques and methodologies known to those of ordinary skill in the art. For example, a library of 8,000 novel small molecules is available, which was created using combinatorial methods of Diversity-Oriented Synthesis (DOS) (Comer et al, Proc Natl Acad Sci USA 108, 6751 (Apr. 26, 2011; Lowe et al, J Org Chem 77, 7187 (Sep. 7, 2012); Marcaurelle et al, J Am Chem Soc 132, 16962 (Dec. 1, 2010))—to investigate chemical compounds not represented in traditional pharmaceutical libraries (Schreiber, S. L. (2000). Science 287, 1964-1969; Schreiber et al, Nat Biotechnol 28, 904 (September, 2010), each of which is herein incorporated by reference in their entirety). Synthetic chemistry transformations and protecting group methodologies (protection and deprotection) useful in synthesizing the compounds identified by the methods described herein are known in the art and include, for example, those such as described in R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); T. W. Greene and P. G. M. Wuts, Protective Groups in Organic Synthesis, 2nd ed., John Wiley and Sons (1991); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), and subsequent editions thereof.
(165) Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are commercially available from a number of sources, including Biotics (Sussex, UK), Xenova (Slough, UK), Harbor Branch Oceangraphics Institute (Ft. Pierce, Fla.), and PharmaMar, U.S.A. (Cambridge, Mass.). In addition, natural and synthetically produced libraries are produced, if desired, according to methods known in the art, e.g., by standard extraction and fractionation methods. Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90:6909, 1993; Erb et al., Proc. Natl. Acad. Sci. USA 91:11422, 1994; Zuckermann et al., J. Med. Chem. 37:2678, 1994; Cho et al., Science 261:1303, 1993; Carrell et al., Angew. Chem. Int. Ed. Engl. 33:2059, 1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33:2061, 1994; and Gallop et al., J Med. Chem. 37:1233, 1994. Furthermore, if desired, any library or compound is readily modified using standard chemical, physical, or biochemical methods.
(166) Libraries of compounds may be presented in solution (e.g., Houghten, Biotechniques 13:412-421, 1992), or on beads (Lam, Nature 354:82-84, 1991), chips (Fodor, Nature 364:555-556, 1993), bacteria (Ladner, U.S. Pat. No. 5,223,409), spores (Ladner U.S. Pat. No. 5,223,409), plasmids (Cull et al., Proc Natl Acad Sci USA 89:1865-1869, 1992) or on phage (Scott and Smith, Science 249:386-390, 1990; Devlin, Science 249:404-406, 1990; Cwirla et al. Proc. Natl. Acad. Sci. 87:63786382, 1990; Felici, J. Mol. Biol. 222:301-310, 1991; Ladner supra.).
(167) In addition, those skilled in the art of drug discovery and development readily understand that methods for dereplication (e.g., taxonomic dereplication, biological dereplication, and chemical dereplication, or any combination thereof) or the elimination of replicates or repeats of materials already known for their activity should be employed whenever possible.
(168) When a crude extract is identified as containing a compound of interest, further fractionation of the positive lead extract is necessary to isolate chemical constituents responsible for the observed effect. Thus, the goal of the extraction, fractionation, and purification process is the careful characterization and identification of a chemical entity within the crude extract that achieves a desired biological effect. Methods of fractionation and purification of such heterogenous extracts are known in the art.
(169) Small molecules of the invention preferably have a molecular weight below 2,000 daltons, more preferably between 300 and 1,000 daltons, and most preferably between 400 and 700 daltons. It is preferred that these small molecules are organic molecules.
(170) Kits
(171) The present compositions may be assembled into kits or pharmaceutical systems. The kits can include instructions for the treatment regime, reagents, equipment (test tubes, reaction vessels, needles, syringes, etc.) and standards for calibrating or conducting the treatment. The instructions provided in a kit according to the invention may be directed to suitable operational parameters in the form of a label or a separate insert. Optionally, the kit may further comprise a standard or control information so that the test sample can be compared with the control information standard to determine if whether a consistent result is achieved.
(172) The container means of the kits will generally include at least one vial, test tube, flask, bottle, or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit, the kit also will generally contain additional containers into which the additional components may be separately placed. However, various combinations of components may be comprised in a container. The kits of the present invention also will typically include a means for packaging the component containers in close confinement for commercial sale. Such packaging may include injection or blow-molded plastic containers into which the desired component containers are retained.
(173) The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, “Molecular Cloning: A Laboratory Manual”, second edition (Sambrook, 1989); “Oligonucleotide Synthesis” (Gait, 1984); “Animal Cell Culture” (Freshney, 1987); “Methods in Enzymology” “Handbook of Experimental Immunology” (Weir, 1996); “Gene Transfer Vectors for Mammalian Cells” (Miller and Calos, 1987); “Current Protocols in Molecular Biology” (Ausubel, 1987); “PCR: The Polymerase Chain Reaction”, (Mullis, 1994); “Current Protocols in Immunology” (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.
(174) The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the assay, screening, and therapeutic methods of the invention, and are not intended to limit the scope of what the inventors regard as their invention.
EXAMPLES
Example 1. Synthesis and Characterization of Compounds
(175) The following Examples illustrate the synthesis of a representative number of compounds and the use of these compounds in the treatment of malaria. Accordingly, the Examples are intended to illustrate but not to limit the disclosure. Additional compounds not specifically exemplified may be synthesized using conventional methods in combination with the methods described herein.
(176) Unless otherwise noted, reactions were performed under an argon atmosphere using freshly dried HPLC grade solvents in flame-dried glassware. All reagents were purchased and used as received from commercial sources or synthesized based on cited procedures. XPhos-Pd-G3, 4-pyridinecarboxaldehyde, palladium on carbon, and sodium triacetoxyborohydride were purchased from Sigma Aldrich; 3-fluorophenylboronic acid was purchased from Oakwood Chemical, and 4-methoxyphenylboronic acid was purchased from Combi-Blocks. All reactions were monitored by thin-layer chromatography (TLC) using Merck Silica gel 60 F254 pre-coated plates (0.25 mm) visualized by UV light at 254 nm. Yields refer to pure compounds after purification by flash column chromatography, unless otherwise noted. Flash column chromatography was performed using silica gel (60 Å mesh, 20-40 μm) on a Teledyne Isco CombiFlash Rf system.
(177) Nuclear magnetic resonance (NMR) spectra were recorded on a Bruker 400 Spectrometer (.sup.1H NMR, 400 MHz; .sup.13C, 100 MHz; Dept-135 Carbon, 100 MHz; .sup.19F NMR, 376 MHz). Chemical shifts are reported in parts per million (ppm) relative to the solvent used. NMR solvents were purchased from Cambridge Isotope Laboratories, Inc. NMR data were obtained in CDCl.sub.3 or DMSO-d.sub.6. Data for .sup.1H NMR are reported as follows: chemical shift value in ppm, multiplicity (s=singlet, d=doublet, t=triplet, dd=double doublet, and m=multiplet), integration value, and coupling constant value in Hz. Optical rotations were recorded on an Autopol IV automatic Rudolph Research Analytical polarimeter. For each test, 4 mg of the appropriate compound was dissolved in 1 mL chloroform. The reported optical rotations values are averages of five independent measurements at 22° C. (set temperature at 20° C.). Enantiopurity of compounds was determined by analytic supercritical fluid chromatography (SFC) on a Waters UPC2 convergence chromatography system connected to a QDa single quadrupole mass spectrometer with Chiralcel AD-H, AS-H, IC, and OD-H columns using chiral stationary phase with mobile phase A consisting of supercritical carbon dioxide and mobile phase B consisting of isopropanol (IPA) at 45° C. Infrared spectra were recorded on a Nicolet IR 100 FTIR from Thermo Scientific and are reported in frequency of absorption (cm.sup.−1). Tandem liquid chromatography mass spectrometry (LCMS) was performed on a Waters 2795 separations module with a 3100 mass detector. High-resolution mass-spectra (HRMS) were acquired on an Agilent 1290 Infinity separations module coupled to a 6230 time-of-flight (TOF) mass detector operating in ESI.sup.+ or ESI mode. “Find-by-Formula” feature in the MassHunter Qualitative Analysis Vb.06.00 was used to confirm mass values, which are averages of three independent measurements.
(178) Compounds may be synthesized using the Synthetic Schemes S1 and S2. References to a substrate number include all compound permutations of that substrate number with alphabetic demarcations. For example, Substrate 12 includes compounds 12a, 12b, 12c, and 12d and Substrate 13 includes compounds 13a-h.
(179) ##STR00039##
(180) ##STR00040##
General Procedure A: Microwave-Assisted Suzuki Coupling to Give Hexahydropyrroloquinoline Substrates 13a-h
(181) The four isomers of benzyl 8-bromo-4-(hydroxymethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 12a-d were synthesized as described by Jacobsen et al. and Marcaurelle et al. using the chiral urea catalyst 9a or 9b (H. Xu, H. Zhang, E. N. Jacobsen, Nat. Protoc. 2014, 9, 1860-1866; B. Gerald, M. W. O'Shea, E. Donckele, S. Kesavan, L. B. Akella, H. Xu, E. N. Jacobsen, L. S. Marcaurelle, ACS Comb. Sci. 2012, 14, 621-630). Urea catalysts 9a and 9b were synthesized as described by Jacobsen et al. The obtained NMR spectral data were consistent with those reported in the literature (K. L. Tan, E. N. Jacobsen, Angew. Chem. Int. Ed. 2007, 46, 1315-1317.).
(182) The microwave reactions were performed in a Biotage single-mode microwave reactor with a power of 0 to 400 W. A 10-20 mL Biotage microwave reaction vial was charged with the hexahydropyrroloquinoline substrate 12 (1.0 equiv., >90% ee), 3-fluorophenylboronic acid or 4-methoxyphenylboronic acid (1.2 equiv.), potassium carbonate (2.0 equiv.), XPhos Palladium third generation catalyst (5% mol), and a mixture solvent of THF-H.sub.2O (v/v, 2/1). The vial was sealed with a septum cap, degassed under high vacuum, and backfilled with an argon atmosphere. The degassing step was repeated three times, and the resulting reaction mixture was microwave irradiated for 45 min at 100° C. The reaction mixture was then cooled to room temperature and filtered through a short pad of Celite. The filtrate was evaporated under vacuum to give crude substrate, usually as off-yellow oily substance, which was purified by flash column chromatography on silica gel eluting with hexane and ethyl acetate (or dichloromethane and methanol).
(183) General Procedure B: Reductive Amination to Give Pyridinylmethylhexahydropyrroloquinoline Compounds 1 to 8
(184) A round-bottom flash was charged with hexahydropyrroloquinoline substrate 13 (1.0 equiv.), palladium on carbon (10% weight), and methanol (0.05 M). The flask was sealed with a rubber septum, degassed under high vacuum, and backfilled with a hydrogen atmosphere. The degassing and hydrogen refilling step was repeated three times, and the resulting reaction mixture was stirred at room temperature for one hour or until the full conversion of the starting material monitored by TLC (methanol in CH.sub.2Cl.sub.2). The reaction mixture was filtered through a Celite pad and the filtrate was evaporated under vacuum to give the corresponding Cbz-deprotected hexahydropyrroloquinoline substrate.
(185) A flame-dried round-bottom flash was charged with the Cbz-deprotected hexahydropyrroloquinoline substrate (1.0 equiv.) dissolved in dry CH.sub.2Cl.sub.2 (0.05 M), 4-pyridinecarboxyaldehyde (1.5 equiv.), and acetic acid (2.0 equiv.). The reaction mixture was stirred at room temperature for one hour before the adding of NaBH(OAc).sub.3 (3.0 equiv.). The reaction mixture was stirred at room temperature for another three hours or until the full conversion of the starting material monitored by TLC (methanol in CH.sub.2Cl.sub.2). The reaction mixture was then diluted with CH.sub.2Cl.sub.2, quenched with a saturated NaHCO.sub.3 aqueous solution, and extracted with CH.sub.2CL.sub.2 (three times). Organic layers were combined, washed with brine, dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentrated in vacuo to give a crude residue, usually as off-white or light yellow oily substance, which was purified by flash column chromatography on silica gel eluting with hexane and ethyl acetate (or dichloromethane and methanol).
((3aR,4S,9bR)-8-(3-Fluorophenyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-4-yl)methanol (1/BRD7087)
(186) ##STR00041##
(187) Prepared from benzyl (3aR,4S,9bR)-8-(3-fluorophenyl)-4-(hydroxymethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13a (667 mg, 1.54 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 5% methanol in dichloromethane gave the desired product 3 as a white solid (348 mg, yield 58%).
(188) R.sub.f=0.38 (silica gel, 10% methanol in dichloromethane, UV).
(189) .sup.1H NMR (400 MHz, CDCl.sub.3): δ 8.45 (d, 2H, J=4.8 Hz, aromatic H), 7.35 (d, 2H, J=8.2 Hz, aromatic H), 7.28-7.25 (m, 4H, aromatic H), 7.21 (d, 1H, J=10.5 Hz, aromatic H), 6.97 (t, 1H, J=8.6 Hz, aromatic H), 6.73 (d, 1H, J=8.4 Hz, aromatic H), 4.38 (d, 1H, J=13.8 Hz, CH.sub.2OH), 4.01 (d, 1H, J=8.6 Hz, CH.sub.2NCH), 3.56-3.53 (m, 2H, NHCHCH and CH.sub.2NCH), 3.33 (s, 1H, CH.sub.2NCH), 3.27 (d, 1H, J=13.8 Hz, CH.sub.2OH), 2.97-2.93 (m, 1H, NCH.sub.2CH.sub.2), 2.21-2.19 (m, 1H, NCH.sub.2CH.sub.2), 2.10-2.03 (m, 2H, NCH.sub.2CH.sub.2 and NHCHCH), 1.65-1.62 (m, 1H, NCH.sub.2CH.sub.2).
(190) .sup.13C NMR (100 MHz, CDCl.sub.3): δ 164.5 and 162.1 (d, .sup.1J.sub.C,F=243.4 Hz, aromatic C), 150.0 (aromatic C), 149.1 (2) (pyridinyl C), 144.7 (pyridinyl C), 143.6 and 143.5 (d, .sup.3J.sub.C,F=7.8 Hz, aromatic C), 130.3 (aromatic C), 130.1 and 130.0 (d, .sup.3J.sub.C,F=8.8 Hz, aromatic C), 127.8 (aromatic C), 127.6 (aromatic C), 123.6 (2) (pyridinyl C), 121.7 and 121.7 (d, .sup.4J.sub.C,F=2.8 Hz, aromatic C), 118.3 (aromatic C), 114.6 (aromatic C), 113.0 and 112.8 (d, .sup.2J.sub.C,F=21.8 Hz, aromatic C), 112.8 and 112.6 (d, .sup.2J.sub.C,F=21.0 Hz, aromatic C), 64.7 (CH.sub.2NCH), 64.1 (CH.sub.2NCH), 56.0 (CH.sub.2OH), 54.5 (NHCHCH), 51.4 (NCH.sub.2CH.sub.2), 35.8 (NHCHCH), 25.7 (NCH.sub.2CH.sub.2).
(191) .sup.19F NMR (376 MHz, CDCl.sub.3): δ −113.5.
(192) [α].sub.D.sup.22=+34.40 (c=0.4, CHCl.sub.3).
(193) Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et.sub.3N in CO.sub.2, λ=210 nm): t.sub.R(minor)=6.4 min, t.sub.R(major)=7.0 min.
(194) IR (thin film, cm.sup.−1): ν.sub.max 3413, 2925, 1608, 1522, 1484, 1325, 1261, 1198, 1159, 1077, 869, 819, 782, 752, 693.
(195) LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >95% by UV, rt=0.92 min, m/z 390.1 (M+H).sup.+, m/z 434.5 (M+FA-H).sup.−.
(196) HRMS (ESI, m/z): calcd for C.sub.24H.sub.24FN.sub.3O (M+H).sup.+: 390.1982, found: 390.1976.
((3aR,4S,9bR)-8-(4-Methoxyphenyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-4-yl)methanol (2/BRD5779)
(197) ##STR00042##
(198) Prepared from benzyl (3aR,4S,9bR)-4-(hydroxymethyl)-8-(4-methoxyphenyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13b (186 mg, 0.42 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 70% ethyl acetate in hexane gave the desired product 2 as an off-white solid (72 mg, yield 43%).
(199) R.sub.f=0.69 (silica gel, 10% methanol in dichloromethane, UV).
(200) .sup.1H NMR (400 MHz, CDCl.sub.3): δ 8.46 (d, 2H, J=4.9 Hz, aromatic H), 7.44 (d, 2H, J=8.2 Hz, aromatic H), 7.33 (d, 1H, J=8.2 Hz, aromatic H), 7.25-7.24 (m, 3H, aromatic H), 6.97 (d, 2H, J=8.2 Hz, aromatic H), 6.74 (d, 1H, J=8.2 Hz, aromatic H), 4.41 (d, 1H, J=13.8 Hz, CH.sub.2OH), 3.99 (d, 1H, J=9.6 Hz, CH.sub.2NCH), 3.85 (s, 3H, OCH.sub.3), 3.59 (d, 1H, J=9.6 Hz, CH.sub.2NCH), 3.53-3.51 (m, 1H, NHCHCH), 3.32 (s, 1H, CH.sub.2NCH), 3.25 (d, 1H, J=13.8 Hz, CH.sub.2OH), 2.97 (t, 1H, J=9.2 Hz, NCH.sub.2CH.sub.2), 2.20-2.18 (m, 1H, NCH.sub.2CH.sub.2), 2.10-2.05 (m, 2H, NCH.sub.2CH.sub.2 and NHCHCH), 1.66-1.62 (m, 1H, NCH.sub.2CH.sub.2).
(201) .sup.13C NMR (100 MHz, CDCl.sub.3): δ 158.3 (aromatic C), 149.9 (aromatic C), 149.2 (2) (aromatic C), 143.7 (aromatic C), 134.0 (aromatic C), 130.0 (aromatic C), 129.3 (aromatic C), 127.3 (3) (aromatic C), 123.6 (2) (aromatic C), 118.5 (aromatic C), 114.8 (aromatic C), 114.2 (2) (aromatic C), 64.7 (CH.sub.2NCH), 64.1 (CH.sub.2NCH), 56.1 (CH.sub.2OH), 55.4 (OCH.sub.3), 54.5 (NHCHCH), 51.4 (NCH.sub.2CH.sub.2), 35.9 (NHCHCH), 25.7 (NCH.sub.2CH.sub.2).
(202) [α].sub.D.sup.22=+33.1° (c=0.4, CHCl.sub.3).
(203) Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et.sub.3N in CO.sub.2, λ=210 nm): t.sub.R(minor)=6.1 min, t.sub.R(major)=7.3 min.
(204) IR (thin film, cm.sup.1): ν.sub.max 3402, 2929, 1614, 1499, 1480, 1246, 1180, 1028, 817, 753.
(205) LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >95% by UV, rt=0.84 min, m/z 402.2 (M+H).sup.+, m/z 446.5 (M+FA-H).sup.−.
(206) HRMS (ESI, m/z): calcd for C.sub.25H.sub.27N.sub.3O.sub.2 (M+H).sup.+: 402.2182, found: 402.2172.
((3aR,4R,9bR)-8-(3-Fluorophenyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-4-yl)methanol (3/BRD2161)
(207) ##STR00043##
(208) Prepared from benzyl (3aS,4S,9bS)-8-(3-fluorophenyl)-4-(hydroxymethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13c (276 mg, 0.64 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 5% methanol in dichloromethane gave the desired product 3 as a white solid (66 mg, yield 27%).
(209) R.sub.f=0.23 (silica gel, 5% methanol in dichloromethane, UV).
(210) .sup.1H NMR (400 MHz, CDCl.sub.3): δ 8.55-8.53 (m, 2H, aromatic H), 7.33-7.26 (m, 6H, aromatic H), 7.21 (d, 1H, J=10.8 Hz, aromatic H), 6.97 (t, 1H, J=8.4 Hz, aromatic H), 6.73 (d, 1H, J=8.4 Hz, aromatic H), 4.40 (d, 1H, J=13.5 Hz, CH.sub.2OH), 3.90-3.86 (m, 1H, CH.sub.2NCH), 3.71-3.65 (m, 2H, NHCHCH and CH.sub.2NCH), 3.51-3.47 (m, 2H, CH.sub.2NCH and CH.sub.2OH), 2.95-2.92 (m, 1H, NCH.sub.2CH.sub.2), 2.83-2.79 (m, 1H, NCH.sub.2CH.sub.2), 2.39-2.35 (m, 1H, NCH.sub.2CH.sub.2), 2.02-1.94 (m, 2H, NHCHCH and NCH.sub.2CH.sub.2).
(211) .sup.13C NMR (100 MHz, CDCl.sub.3): δ 164.5 and 162.1 (d, .sup.1J.sub.C,F=244 Hz, aromatic C), 149.5 (2) (pyridinyl C), 148.2 (aromatic C), 145.8 (pyridinyl C), 143.5 and 143.4 (d, .sup.3J.sub.C,F=7.9 Hz, aromatic C), 130.1 and 130.0 (d, .sup.3J.sub.C,F=8.2 Hz, aromatic C), 129.4 (aromatic C), 128.8 (aromatic C), 127.5 (aromatic C), 123.9 (2) (pyridinyl C), 121.7 and 121.7 (d, .sup.4J.sub.C,F=2.3 Hz, aromatic C), 119.4 (aromatic C), 115.2 (aromatic C), 113.0 and 112.8 (d, .sup.2J.sub.C,F=21.8 Hz, aromatic C), 112.9 and 112.7 (d, .sup.2J.sub.C,F=21.0 Hz, aromatic C), 64.3 (CH.sub.2NCH), 63.3 (CH.sub.2NCH), 58.1 (CH.sub.2OH), 54.4 (NHCHCH), 51.6 (NCH.sub.2CH), 38.1 (NHCHCH), 23.6 (NCH.sub.2CH.sub.2).
(212) .sup.19F NMR (376 MHz, CDCl.sub.3): δ −113.4.
(213) [α].sub.D.sup.22=−29.8° (c=0.4, CHCl.sub.3).
(214) Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et.sub.3N in CO.sub.2, λ=210 nm): t.sub.R(minor)=6.2 min, t.sub.R(major)=6.9 min.
(215) IR (thin film, cm.sup.1): ν.sub.max 3364, 2917, 1608, 1516, 1480, 1314, 1262, 1193, 1164, 1076, 869, 822, 788, 752, 691.
(216) LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >95% by UV, rt=0.82 min, m/z 390 (M+H).sup.+, m/z 434 (M+FA-H).sup.−.
(217) HRMS (ESI, m/z): calcd for C.sub.24H.sub.24FN.sub.3O (M+H).sup.+: 390.1982, found: 390.1972.
((3aR,4R,9bR)-8-(4-Methoxyphenyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-4-yl)methanol (4/BRD1490)
(218) ##STR00044##
(219) Prepared from benzyl (3aR,4R,9bR)-4-(hydroxymethyl)-8-(4-methoxy-phenyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13d (142 mg, 0.32 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 70% ethyl acetate in hexane gave the desired product 4 as an off-white solid (52 mg, yield 41%).
(220) R.sub.f=0.40 (silica gel, 5% methanol in dichloromethane, UV).
(221) .sup.1H NMR (400 MHz, CDCl.sub.3): δ 8.54 (d, 2H, J=4.9 Hz, aromatic H), 7.44 (d, 2H, J=8.4 Hz, aromatic H), 7.32-7.25 (m, 4H, aromatic H), 6.96 (d, 2H, J=8.4 Hz, aromatic H), 6.73 (d, 1H, J=8.0 Hz, aromatic H), 4.43 (d, 1H, J=13.2 Hz, CH.sub.2OH), 3.90-3.89 (m, 1H, CH.sub.2NCH), 3.85 (s, 3H, OCH.sub.3), 3.71-3.65 (m, 2H, CH.sub.2NCH and NHCHCH), 3.49-3.45 (m, 2H, CH.sub.2NCH and CH.sub.2OH), 2.94-2.80 (m, 2H, NCH.sub.2CH.sub.2 and NHCHCH), 2.36-2.34 (m, 1H, NCH.sub.2CH), 2.00-1.97 (m, 2H, NCH.sub.2CH.sub.2).
(222) .sup.13C NMR (100 MHz, CDCl.sub.3): δ 158.4 (aromatic C), 150.3 (aromatic C), 149.9 (2) (aromatic C), 144.9 (aromatic C), 134.0 (aromatic C), 130.1 (aromatic C), 129.1 (aromatic C), 127.3 (2) (aromatic C), 127.2 (aromatic C), 123.8 (2) (aromatic C), 119.4 (aromatic C), 115.2 (aromatic C), 114.2 (2) (aromatic C), 64.4 (CH.sub.2NCH), 63.3 (CH.sub.2NCH), 58.1 (CH.sub.2OH), 55.4 (OCH.sub.3), 54.5 (NHCHCH), 51.6 (NCH.sub.2CH.sub.2), 38.2 (NHCHCH), 23.6 (NCH.sub.2CH.sub.2).
(223) [α].sub.D.sup.22=−34.1° (c=0.4, CHCl.sub.3).
(224) IR (thin film, cm.sup.1): ν.sub.max 3364, 2911, 1609, 1495, 1246, 1180, 1045, 1027, 819, 754.
(225) Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et.sub.3N in CO.sub.2, λ=210 nm): t.sub.R(minor)=6.8 min, t.sub.R(major)=7.1 min.
(226) LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >95% by UV, rt=0.79 min, m/z 402.5 (M+H).sup.+, m/z 446.6 (M+FA-H).
(227) HRMS (ESI, m/z): calcd for C.sub.25H.sub.27N.sub.3O.sub.2 (M+H).sup.+: 402.2182, found: 402.2171.
((3aS,4S,9bS)-8-(3-Fluorophenyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-4-yl)methanol (5/BRD0750)
(228) ##STR00045##
(229) Prepared from benzyl (3aS,4S,9bS)-8-(3-fluorophenyl)-4-(hydroxymethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13e (168 mg, 0.39 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 80% ethyl acetate in hexane gave the desired product 5 as an off-white solid (71 mg, yield 47%).
(230) R.sub.f=0.25 (silica gel, 5% methanol in dichloromethane, UV)
(231) .sup.1H NMR (400 MHz, CDCl.sub.3): δ 8.53 (d, 2H, J=5.0 Hz, aromatic H), 7.34-7.33 (m, 3H, aromatic H), 7.28-7.26 (m, 3H, aromatic H), 7.21 (d, 1H, J=10.6 Hz, aromatic H), 6.96 (t, 1H, J=8.4 Hz, aromatic H), 6.73 (d, 1H, J=8.4 Hz, aromatic H), 4.39 (d, 1H, J=13.2 Hz, CH.sub.2OH), 3.87 (dd, 1H, J=11.6 Hz and 5.0 Hz, CH.sub.2NCH), 3.71-3.67 (m, 2H, NHCHCH and CH.sub.2NCH), 3.51 (d, 1H, J=13.2 Hz, CH.sub.2OH), 3.47-3.45 (m, 1H, CH.sub.2NCH), 2.96-2.90 (m, 1H, NCH.sub.2CH.sub.2), 2.82-2.79 (m, 1H, NCH.sub.2CH.sub.2), 2.39 (dd, 1H, J=17.8 Hz and 8.8 Hz, NCH.sub.2CH.sub.2), 1.99-1.96 (m, 2H, NHCHCH and NCH.sub.2CH.sub.2).
(232) .sup.13C NMR (100 MHz, CDCl.sub.3): δ 164.5 and 162.1 (d, .sup.1J.sub.C,F=243 Hz, aromatic C), 149.7 (2) (pyridinyl C), 148.0 (aromatic C),145.9 (pyridinyl C), 143.5 and 143.4 (d, .sup.3J.sub.C,F=7.5 Hz, aromatic C), 130.1 and 130.0 (d, .sup.3J.sub.C,F=8.6 Hz, aromatic C), 129.4 (aromatic C), 128.8 (aromatic C), 127.5 (aromatic C), 123.9 (2) (pyridinyl C), 121.8 and 121.7 (d, .sup.4J.sub.C,F=2.8 Hz, aromatic C), 119.5 (aromatic C), 115.2 (aromatic C), 113.0 and 112.8 (d, .sup.2J.sub.C,F=21.4 Hz, aromatic C), 112.9 and 112.7 (d, 2J.sub.C,F=20.9 Hz, aromatic C), 64.2 (CH.sub.2NCH), 63.3 (CH.sub.2NCH), 58.1 (CH.sub.2OH), 54.4 (NHCHCH), 51.6 (NCH.sub.2CH.sub.2), 38.1 (NHCHCH), 23.6 (NCH.sub.2CH.sub.2).
(233) .sup.19F NMR (376 MHz, CDCl.sub.3): δ −113.4.
(234) [α].sub.D.sup.22=+23.6° (c=0.4, CHCl.sub.3).
(235) Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et.sub.3N in CO.sub.2, λ=210 nm): t.sub.R(major)=6.2 min, t.sub.R(minor)=6.9 min.
(236) IR (thin film, cm.sup.1): ν.sub.max 3332, 2916, 1608, 1517, 1480, 1300, 1262, 1193, 1167, 1077, 867, 821, 784, 753, 692.
(237) LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >95% by UV, rt=0.86 min, m/z 390.5 (M+H).sup.+, m/z 434.5 (M+FA-H).sup.−.
(238) HRMS (ESI, m/z): calcd for C.sub.24H.sub.24FN.sub.3O (M+H).sup.+: 390.1982, found: 390.1973.
((3aS,4S,9bS)-8-(4-Methoxyphenyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-4-yl)methanol (6/BRD6201)
(239) ##STR00046##
(240) Prepared from benzyl (3aS,4S,9bS)-4-(hydroxymethyl)-8-(4-methoxy-phenyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13f (178 mg, 0.45 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 65% ethyl acetate in hexane gave the desired product 6 as an off-white solid (65 mg, yield 41%).
(241) R.sub.f=0.43 (silica gel, 5% methanol in dicholoromethane, UV).
(242) .sup.1H NMR (400 MHz, CDCl.sub.3): δ 8.54 (d, 2H, J=5.0 Hz, aromatic H), 7.44 (d, 2H, J=8.2 Hz, aromatic H), 7.33-7.25 (m, 4H, aromatic H), 6.96 (d, 2H, J=8.2 Hz, aromatic H), 6.73 (d, 1H, J=8.2 Hz, aromatic H), 4.44 (d, 1H, J=13.2 Hz, CH.sub.2OH), 3.92-3.86 (m, 1H, CH.sub.2NCH), 3.85 (s, 3H, OCH.sub.3), 3.71 (dd, 1H, J=11.3 Hz and 3.6 Hz, CH.sub.2NCH), 3.65-3.64 (m, 1H, NHCHCH), 3.48-3.44 (m, 2H, CH.sub.2NCH and CH.sub.2OH), 2.95-2.91 (m, 1H, NCH.sub.2CH.sub.2), 2.84-2.81 (m, 1H, NCH.sub.2CH.sub.2), 2.36-2.34 (m, 1H, NCH.sub.2CH.sub.2), 2.03-1.95 (m, 2H, NCH.sub.2CH.sub.2).
(243) .sup.13C NMR (100 MHz, CDCl.sub.3): δ 158.4 (aromatic C), 149.8 (2) (aromatic C), 148.0 (aromatic C), 144.9 (aromatic C), 134.0 (aromatic C), 130.1 (aromatic C), 129.1 (aromatic C), 127.3 (2) (aromatic C), 127.3 (aromatic C), 123.8 (2) (aromatic C), 119.3 (aromatic C), 115.2 (aromatic C), 114.2 (2) (aromatic C), 64.4 (CH.sub.2NCH), 63.3 (CH.sub.2NCH), 58.1 (CH.sub.2OH), 55.4 (OCH.sub.3), 54.4 (NHCHCH), 51.6 (NCH.sub.2CH.sub.2), 38.1 (NHCHCH), 23.7 (NCH.sub.2CH.sub.2).
(244) [α].sub.D.sup.22=−24.6° (c=0.4, CHCl.sub.3).
(245) Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et.sub.3N in CO.sub.2, λ=210 nm): t.sub.R(major)=6.9 min, t.sub.R(minor)=7.2 min.
(246) IR (thin film, cm.sup.1): ν.sub.max 3365, 2925, 1610, 1496, 1246, 1180, 1045, 1027, 818, 756.
(247) LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >95% by UV, rt=0.80 min, m/z 402.1 (M+H).sup.+, m/z 446.6 (M+FA-H).sup.−.
(248) HRMS (ESI, m/z): calcd for C.sub.25H.sub.27N.sub.3O.sub.2 (M+H).sup.+: 402.2182, found: 402.2180.
((3aS,4R,9bS)-8-(3-Fluorophenyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-4-yl)methanol (7/BRD5039)
(249) ##STR00047##
(250) Prepared from benzyl (3aS,4R,9bS)-8-(3-fluorophenyl)-4-(hydroxymethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13g (168 mg, 0.39 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 80% ethyl acetate in hexane gave the desired product 7 as an off-white solid (83 mg, yield 55%).
(251) R.sub.f=0.39 (silica gel, 10% methanol in dichloromethane, UV)
(252) .sup.1H NMR (400 MHz, CDCl.sub.3): δ 8.46 (d, 2H, J=5.0 Hz, aromatic H), 7.35-7.33 (m, 2H, aromatic H), 7.28-7.25 (m, 4H, aromatic H), 7.21-7.19 (m, 1H, aromatic H), 6.97 (t, 1H, J=8.6 Hz, aromatic H), 6.73 (d, 1H, J=8.4 Hz, aromatic H), 4.37 (d, 1H, J=13.6 Hz, CH.sub.2OH), 4.01 (d, 1H, J=9.4 Hz, CH.sub.2NCH), 3.57-3.53 (m, 2H, NHCHCH and CH.sub.2NCH), 3.37 (s, 1H, CH.sub.2NCH), 3.30 (d, 1H, J=13.8 Hz, CH.sub.2OH), 2.97-2.93 (m, 1H, NCH.sub.2CH.sub.2), 2.24-2.21 (m, 1H, NCH.sub.2CH.sub.2), 2.10-2.04 (m, 2H, NCH.sub.2CH.sub.2 and NHCHCH), 1.67-1.64 (m, 1H, NCH.sub.2CH.sub.2).
(253) .sup.13C NMR (100 MHz, CDCl.sub.3): δ 164.5 and 162.1 (d, .sup.1J.sub.C,F=243.4 Hz, aromatic C), 149.8 (aromatic C), 149.0 (2) (pyridinyl C), 144.6 (pyridinyl C), 143.6 and 143.5 (d, .sup.3J.sub.C,F=8.4 Hz, aromatic C), 130.3 (aromatic C), 130.1 and 130.0 (d, .sup.3J.sub.C,F=8.9 Hz, aromatic C), 127.9 (aromatic C), 127.6 (aromatic C), 123.6 (2) (pyridinyl C), 121.7 and 121.7 (d, .sup.4J.sub.C,F=1.7 Hz, aromatic C), 118.2 (aromatic C), 114.7 (aromatic C), 113.0 and 112.8 (d, .sup.2J.sub.C,F=21.5 Hz, aromatic C), 112.8 and 112.6 (d, .sup.2J.sub.C,F=21.0 Hz, aromatic C), 64.7 (CH.sub.2NCH), 64.2 (CH.sub.2NCH), 56.0 (CH.sub.2OH), 54.5 (NHCHCH), 51.4 (NCH.sub.2CH), 35.8 (NHCHCH), 25.7 (NCH.sub.2CH.sub.2).
(254) .sup.19F NMR (376 MHz, CDCl.sub.3): δ −113.4.
(255) [α].sub.D.sup.22=−30.4° (c=0.4, CHCl.sub.3).
(256) Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et.sub.3N in CO.sub.2, λ=210 nm): t.sub.R(major)=6.4 min, t.sub.R(minor)=7.0 min.
(257) IR (thin film, cm.sup.−1): ν.sub.max 3334, 2927, 1608, 1522, 1484, 1326, 1261, 1198, 1160, 1076, 868, 819, 782, 752. 694.
(258) LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >95% by UV, rt=0.87 min, m/z 390.2 (M+H).sup.+, m/z 434.6 (M+FA-H).sup.−.
(259) HRMS (ESI, m/z): calcd for C.sub.24H.sub.24FN.sub.3O (M+H).sup.+: 390.1982, found: 390.1976.
((3aS,4R,9bS)-8-(4-Methoxyphenyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-4-yl)methanol (8/BRD0739)
(260) ##STR00048##
(261) Prepared from benzyl (3aS,4R,9bS)-4-(hydroxymethyl)-8-(4-methoxy-phenyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13h (143 mg, 0.32 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 70% ethyl acetate in hexane gave the desired product 8 as an off-white solid (62 mg, yield 48%).
(262) R.sub.f=0.67 (silica gel, 10% methanol in dichloromethane, UV)
(263) .sup.1H NMR (400 MHz, CDCl.sub.3): δ 8.46 (d, 2H, J=4.8 Hz, aromatic H), 7.44-7.43 (d, 2H, J=8.2 Hz, aromatic H), 7.32-7.27 (m, 4H, aromatic H), 6.96 (d, 2H, J=8.2 Hz, aromatic H), 6.73 (d, 1H, J=8.2 Hz, aromatic H), 4.39 (d, 1H, J=13.8 Hz, CH.sub.2OH), 3.99 (d, 1H, J=10.0 Hz, CH.sub.2NCH), 3.85 (s, 3H, OCH.sub.3), 3.58-3.52 (m, 2H, CH.sub.2NCH and NHCHCH), 3.37 (s, 1H, CH.sub.2NCH), 3.29 (d, 1H, J=13.8 Hz, CH.sub.2OH), 2.96 (t, 1H, J=9.0 Hz, NCH.sub.2CH.sub.2), 2.24-2.18 (m, 1H, NCH.sub.2CH.sub.2), 2.10-2.07 (m, 2H, NCH.sub.2CH.sub.2 and NHCHCH), 1.68-1.64 (m, 1H, NCH.sub.2CH.sub.2).
(264) .sup.13C NMR (100 MHz, CDCl.sub.3): δ 158.3 (aromatic C), 149.8 (aromatic C), 149.1 (2) (aromatic C), 143.7 (aromatic C), 134.0 (aromatic C), 129.9 (aromatic C), 129.3 (aromatic C), 127.4 (aromatic C), 127.3 (2) (aromatic C), 123.7 (2) (aromatic C), 118.2 (aromatic C), 114.8 (aromatic C), 114.2 (2) (aromatic C), 64.6 (CH.sub.2NCH), 64.2 (CH.sub.2NCH), 56.1 (CH.sub.2OH), 55.4 (OCH.sub.3), 54.6 (NHCHCH), 51.4 (NCH.sub.2CH), 35.9 (NHCHCH), 25.7 (NCH.sub.2CH.sub.2).
(265) [α].sub.D.sup.22=−23.4° (c=0.4, CHCl.sub.3).
(266) Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et.sub.3N in CO.sub.2, λ=210 nm): t.sub.R(major)=6.1 min, t.sub.R(minor)=7.3 min.
(267) IR (thin film, cm.sup.1): ν.sub.max 3402, 2929, 1614, 1499, 1246, 1180, 1029, 817, 753.
(268) LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >95% by UV, rt=0.80 min, m/z 402.2 (M+H).sup.+, m/z 446.6 (M+FA-H).sup.−.
(269) HRMS (ESI, m/z): calcd for C.sub.25H.sub.27N.sub.3O.sub.2 (M+H).sup.+: 402.2182, found: 402.2172.
tert-Butyl (3-((3aR,4S,9bR)-4-(hydroxymethyl)-1-(pyridin-4-ylmethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinolin-8-yl)phenyl)carbamate (14)
(270) ##STR00049##
(271) Prepared from benzyl (3aR,4S,9bR)-8-(3-((tert-butoxycarbonyl)amino)-phenyl)-4-(hydroxymethyl)-2,3,3a,4,5,9b-hexahydro-1H-pyrrolo[3,2-c]quinoline-1-carboxylate 13i (210 mg, 0.53 mmol) according to General Procedure B. Purification by flash column chromatography eluting with 60% to 90% ethyl acetate in hexane gave the desired product 14 as a white solid (205 mg, yield 79%).
(272) R.sub.f=0.28 (silica gel, 10% methanol in dichloromethane, UV).
(273) .sup.1H NMR (400 MHz, CDCl.sub.3): δ 8.45 (d, 2H, J=5.0 Hz, aromatic H), 7.50 (s, 1H, aromatic H), 7.35-7.29 (m, 5H, aromatic H), 7.18 (d, 1H, J=7.3 Hz, aromatic H), 6.71 (d, 1H, J=8.2 Hz, aromatic H), 4.34 (d, 1H, J=13.8 Hz, CH.sub.2OH), 3.98 (d, 1H, J=10.2 Hz, CH.sub.2NCH), 3.58 (d, 1H, J=10.2 Hz, CH.sub.2NCH), 3.53-3.51 (m, 1H, NHCHCH), 3.36-3.32 (m, 2H, CH.sub.2NCH and CH.sub.2OH), 2.99-2.97 (m, 1H, NCH.sub.2CH.sub.2), 2.27-2.25 (m, 1H, NCH.sub.2CH.sub.2), 2.10-2.03 (m, 2H, NCH.sub.2CH.sub.2 and NHCHCH), 1.69-1.67 (m, 1H, NCH.sub.2CH.sub.2), 1.54 (s, 9H, tert-butyl CH.sub.3).
(274) .sup.13C NMR (100 MHz, CDCl.sub.3): δ 171.2 (CONH), 152.9 (aromatic C), 148.8 (aromatic C), 144.3 (aromatic C), 142.0 (aromatic C), 138.8 (aromatic C), 130.3 (aromatic C), 129.3 (aromatic C), 127.9 (aromatic C), 123.8 (aromatic C), 121.0 (aromatic C), 116.5 (aromatic C), 116.4 (aromatic C), 114.8 (aromatic C), 80.5 (tert-butyl C), 64.6 (CH.sub.2NCH), 64.3 (CH.sub.2NCH), 56.0 (CH.sub.2OH), 54.4 (NHCHCH), 51.4 (NCH.sub.2CH.sub.2), 35.8 (NHCHCH), 28.4 (tert-butyl CH.sub.3), 25.8 (NCH.sub.2CH.sub.2).
(275) [α].sub.D.sup.22=+57.6° (c=0.5, CHCl.sub.3).
(276) Chiral SFC (AS-H, 1.5 mL/min, MeOH with 0.05% Et.sub.3N in CO.sub.2, λ=210 nm): t.sub.R(minor)=6.5 min, t.sub.R(major)=6.9 min.
(277) IR (thin film, cm.sup.−1): ν.sub.max 3425, 2930, 1706, 1606, 1514, 1366, 1241, 1162, 1065, 788, 754, 699.
(278) LCMS (UV Chromatogram, 210 nm, 2.5 min run): Purity >85% by UV, rt=0.99 min, m/z 487.6 (M+H).sup.+, m/z 531.7 (M+FA-H).sup.−.
(279) HRMS (ESI, m/z): calcd for C.sub.29H.sub.35N.sub.4O.sub.3 (M+H).sup.+: 487.2709, found: 487.2720.
Example 2. Assays for Detection of RNA Guided Endonuclease Activities
(280) Fluorescence Polarization-Based Assay
(281) Binding to PAM-site (NGG for SpCas9) is an important first step in target recognition by SpCas9. Since disruption of PAM-site binding (e.g., by mutating SpCas9 residues involved in PAM-site recognition or mutating PAM-sequence) disrupts SpCas9 activity, it was hypothesized that inhibitors disrupting SpCas9's PAM-binding also render SpCas9 inactive. The affinity of SpCas9 for a single PAM site is weak, which portends well for identifying potential inhibitors, but the low affinity creates a challenge in developing a robust assay for SpCas9-PAM binding activity.
(282) SpCas9 affinity for DNA sequences increases monotonically with the increase in the number of PAM sites. Fluorescence polarization (FP) is a useful technique to monitor protein:DNA interaction, including for example, Cas9-gRNA (ribonucleoprotein) complex and target DNA (12PAM). It was discovered that the fluorescence polarization signal of the fluorophore appended to the DNA increased when target DNA bound to the [Cas9:guideRNA] complex (
(283) TABLE-US-00014 (SEQ ID NO: 1) 5′-GGCTGGACCACGCGGGAAAATCCACCTAGGTGGTTCCTCTTCGG ATGTTCCATCCTTT/36-FAM-3′ (SEQ ID NO: 2) 3′-CCGACCTGGTGCGCCCTTTTAGGTGGATCCACCAAGGAGAAGCC TACAAGGTAGGAAA-5′
(284) As the target DNA is much smaller than the [Cas9:guideRNA] complex, the target DNA's tumbling rate is significantly reduced upon binding to [Cas9:guideRNA] complex. Exploiting the above results, an assay was developed that monitors the change in the fluorescence polarization of the fluorophore-labelled PAM-rich target DNA (henceforth called 12PAM-DNA) upon binding to [Cas9:guideRNA] complex. In this assay, the complexation of [Cas9:guideRNA] to 12PAM-DNA showed a dose-dependent increase in fluorophore polarization (
(285) The FP-assay was validated using competition and differential scanning fluorimetry experiments. In the competition experiment, 12PAM-DNA was competed with DNA sequences containing a varying number of PAM-sites. A drop in FP-signal of 12PAM-DNA was observed that was proportional to the number of PAM-sites on the competitor DNA (
(286) Motivated by these findings, a pilot screening of ˜15,000 compounds was performed in two replicates (
(287) All the “hits” came from Broad Institute's in-house libraries and none from the commercial libraries. Interestingly, compounds from specific libraries were observed to be highly enriched in hits pointing to the strong structure-activity relationship. Most excitingly, dose curves of “hits” from spirocyclic-azetidine library demonstrated stereochemical-dependence on the activity (
(288) In a typical experimental protocol, a plasmid DNA substrate containing target gene corresponding to the guide RNA (gRNA) was incubated with Cas9/gRNA complex at 37° C. for 10 min before quenching by addition of EDTA. For compound testing, Cas9/gRNA RNP complex was incubated with compounds at the indicated concentration for 30 min before introducing cleavable plasmid DNA into it. Reaction mixtures were then analyzed by running on an agarose gel with ethidium bromide as the DNA staining agent.
(289) Briefly, SpCas9 activity was followed by quantifying the amount of cleaved product of a target gene using agarose DNA gel (
(290) Spinach Transcription Assay
(291) A mechanism-independent assay was developed to assess any Cas9 nuclease activity in vitro. Thus, an in vitro transcription based assay was developed wherein the transcribed mRNA is the “spinach aptamer” that fluoresces in the presence of a small molecule (Paige et al., Science 2011, 333, 642-6) (
(292) TABLE-US-00015 TABLE 1 Spinach Transcription Assay sequences Spinach GGGAGACGCAACUGAAUGAAAUGGUGAAGGACG aptamer GGUCCAGGUGUGGCUGCUUCGGCAGUGCAGCUU GUUGAGUAGAGUGUGAGCUCCGCGUAACUAGUC GCGUCAC (SEQ ID NO: 20) Guide RNA GCUAUAGGACGCGACCGAAAGUUUUAGAGCUAG AAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAU CAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU U (SEQ ID NO: 11) Spinach DNA TAATACGACTCACTATAGGACGCGACCGAAATG NonTemplate GTGAAGGACGGGT (SEQ ID NO: 3) Strand Spinach DNA ACCCGTCCTTCACCATTTCGGTCGCGTCCTATA Template GTGAGTCGTATTA (SEQ ID NO: 21) Strand Spinach DNA GCGCGCTTTCTAATACGACTCACTATAGGGTGA Template CGCGACCGAAATGGTGAAGGACGGGTCCAGTGC TTCGGCACTGTTGAGTAGAGTGTGAGCTCCGTA ACTGGTCGCGTC (SEQ ID NO: 14) Spinach RNA GGUGACGCGACCGAAAUGGUGAAGGACGGGUCC aptamer AGUGCUUCGGCACUGUUGAGUAGAGUGUGAGCU CCGUAACUGGUCGCGUC (SEQ ID NO: 12) Spinach DNA GCGCGCNNNNTAATACGACTCACTATAGGGNNN Template NGACGCGACCGAAATGGTGAAGGACGGGTCCAG (general) TGCTTCGGCACTGTTGAGTAGAGTGTGAGCTCC GTAACTGGTCGCGTC (SEQ ID NO: 15) Spinach RNA GGNNNNGACGCGACCGAAAUGGUGAAGGACGGG aptamer UCCAGUGCUUCGGCACUGUUGAGUAGAGUGUGA (general) GCUCCGUAACUGGUCGCGUC (SEQ ID NO: 13) T7 Promoter = TAATACGACTCACTA (SEQ ID NO: 22) Cpf1 PAM = TTTN SpCas9 PAM = NGG SaCas9 PAM = NNGGGT NNNN represents any nucleotide A, G, T, or C. The length of the string of NNNN is arbitrary, and can be expanded to accommodate the PAM consensus motif of any RNA-programmable DNA nuclease. The first “NNNN” site accommodates distal-PAM binding nucleases such as those of the Cpf1 family, while the second “NNNN” site accommodates both distal and proximal PAM binding nucleases (such as those of the Cpf1 family and Cas9 family, respectively).
(293) Using a T7 polymerase for transcription, as low as 1 nM of the spinach gene was able to be detected (
(294) Without being bound by theory, as long as the correct PAM sequence is present in the DNA template, it is possible to use any Cas nuclease with the appropriate gRNA (Table 1). Analysis of the Spinach sequence revealed a number of NGG sites evenly distributed throughout the sequence, allowing for preliminary optimization of the assay with SpCas9. Indeed, titering the amount of DNA template used (0.1 nM) was able to detect nanomolar levels of SpCas9 activity using a guide RNA that targeted site Sp-g1 (
(295) While this indicated that no modifications would be needed to assess this assay in the context of SpCas9, it hindered the generalizability of the assay to include Cas9 nucleases with more complex PAM recognitions. Indeed, the spinach gene only contained only one NNGGGT and TTTN site each, which are the PAM recognition sequences for SaCas9 and AsCpf1/LbCpf1, respectively. To overcome this limitation, additional nucleotides were inserted that could accommodate arbitrary PAM sites—one between the T7 promoter and the spinach gene (proximal site, intended for 3′-PAM binding Cas enzymes), and one upstream of the T7 promoter (distal site, intended for 5′-PAM binding Cas enzymes like Cpf1. The proximal site contained a TAGGGT SaCas9 PAM, and the distal site contained a TTTC Cpf1 PAM (
(296) To assess the generalizability of our assay, it was assessed whether the activities 3 different Cpf1 orthologs—Acidaminococcus sp. Cpf1 (AsCpf1), Lachnospiraceae bacterium ND2006 Cpf1 (LbCpf1), or Francisella tularensis subsp. novicida Cpf1 (FnCpf1) could be sensitively detected. In general, the Cpf1 orthologs had lower cleavage efficiency compared to the Cas9 nucleases, as was previously reported (Kim, 2016), although nanomolar detection was observed (
(297) EGFP Disruption Assay
(298) Joung and co-workers (Fu et al., Nat Biotechnol 2013, 31, 822-6; Kleinstiver et al., Nature 2015, 523, 481-5) have reported a U2OS.EGFP cell line wherein knockdown of EGFP gene by leads to loss of EGFP fluorescence (
(299) Strand Invasion Assay
(300) To measure the Cas9 nuclease activity, a technique was designed based on DNA strand invasion. It was hypothesized that, after a DSB by Cas9 on the substrate DNA, the fluorophore labeled (FAM) 5′-end of the non-target strand can be replaced by a corresponding single-stranded cold DNA (
(301) Initially, performed a fluorescence polarization assay was performed with increasing concentration of Cas9:gRNA keeping the substrate DNA concentration constant and a dose curve was generated (
(302) Strand Displacement Assay.
(303) In another approach, the previously described strand invasion assay was modified to make it more sensitive and effective with an orthogonal readout of fluorescence instead of fluorescence polarization. In this assay, the substrate DNA remained the same as the strand invasion assay, though the sequence of the invading cold DNA was changed in such a way that it can hybridize with the 5′-end free DNA available only after the Cas9 mediated cleavage. Moreover, the DNA strand was conjugated with a fluorescence quencher at the 3′-end which can readily quench FAM fluorescence only when it hybridizes with the labile non-target strand (
(304) Although SpCas9 binds to its DNA substrate with nanomolar affinity, even following double stranded cleavage, it was discovered that of the 4 resulting DNA fragments, the distal non-target strand is weakly held, and can be displaced upon addition of excess complementary single stranded DNA (Richardson, 2016) (
(305) An oligo complementary to the 5′-end of the non-target strand was generated, containing an Iowa-Black FQ quencher on the 3′ terminus (Q-oligo) (Table 2). Excess Q-oligo (5 nM) could not disrupt the fluorescence of duplex DS-oligo (1 nM), but was capable of quenching the FAM-labeled strand outside of a duplex (SS-oligo, 1 nM). When SpCas9:gRNA complex (5 nM) was added, a significant loss of fluorescence was observed. This activity was dependent on gRNA-mediated cleavage of DNA and not local DNA melting caused by Cas9 binding to the PAM motif, as addition of ApoCas9 to DS-oligo and Q-oligo did not result in fluorescence loss (
(306) TABLE-US-00016 TABLE 2 Strand Displacement Assay sequences SpCas9 DNA 5′-6-FAM/TAATACGACTCACTATAGGAC Substrate GCGACCGAAATGGTGAAGGACGGGT-3′ (SEQ ID NO: 3) SaCas9 DNA 5′-6-FAM/ACTCACTATAGGGACGCGACC Substrate GAAATGGTGAAGGACGGGTCCAGTGCTTCG G-3′ (SEQ ID NO: 4) Cpf1 (all 5′-CGTCCTTCACCATTTCGGTCGCGTCCC species) DNA TATAGTGAGTCGTATTAGTTCCAT/6- Substrate FAM-3′ (SEQ ID NO: 5) DNA 5′-6-FAM/ATGGAACTAATACGACTCACT Substrate ATAGGGACGCGACCGAAATGGTGAAGGAC G-3′ (SEQ ID NO: 6) SpCas9 5′-ATAGTGAGTCGTATTA/3IABkFQ-3′ Quencher (SEQ ID NO: 7) Strand SaCas9 5′-CGTCCCTATAGTGAGT/3IABkFQ-3′ Quencher (SEQ ID NO: 8) Strand Cpf1 (all 5′-5IABkFQ/ATGGAACTAATACGAC-3′ species) (SEQ ID NO: 9) Quencher Strand Quencher 5′-GTCGTATTAGTTCCAT/3IABkFQ-3′ Strand (SEQ ID NO: 10) DNA substrates for the strand displacement assay shown are double stranded, and only include a fluorophore (6-FAM) on the strand shown. Quencher strand sequences for the strand displacement assay shown are single stranded, and include a quencher (Iowa Black ® FQ).
(307) The ratio of Q-oligo and Cas9:gRNA to the DS-oligo substrate was characterized by testing relative ratios of 1:1, 1:2, 1:5, 1:10, and 1:20, and found that a 5-fold excess of each reagent relative to DS-oligo is sufficient to yield maximum quenching (
(308) Encouraged by the success at assessing SpCas9 activity, the assay scheme was applied to other CRISPR nucleases. It was possible that such generalizability might be hindered by lack of detailed studies on the catalytic mechanisms of Cas9-nucleases from other classes and bacterial species. However, given the similarities between Staphylococcus aureus Cas9 (SaCas9) and SpCas9 protein fold and modes of DNA substrate binding, SaCas9 strand displacement was tested to see if it would proceed in the same manner. Using FAM-labeled oligos containing an SaCas9-recognizable ACGGGT PAM and a ACGGTT non-target PAM (ref Friedland 2015) with the appropriate Q-oligo, PAM- and Cas9:gRNA-dependent loss of fluorescence was observed (
Example 3. Identification of Small Molecule Inhibitors Using Assays for Detection of RNA Guided Endonuclease Activities
(309) Using the primary screening assay (FP-assay) (
(310) Structure-activity optimizations involve synthesis and potency evaluation of the structural analogs of the “hits” in an iterative fashion. However, this iterative approach is tedious, labor intensive, expensive, and time-consuming. Conveniently, multiple analogs of the “hits” (
(311) Following counter-screening, the “surviving hits” are tested using EGFP disruption assay and Spinach assay (
Example 4. Structure-Guided Enhancement of DNA Recognition by Cas9:gRNA Complex
(312) Cas9:gRNA complex is considerably more tolerant to base pair mismatches between the gRNA and the target DNA at PAM-distal sites compared to PAM-proximal sites. To investigate the molecular basis for such a gradient in sequence specificity, the interactions of Cas9 with gRNA and with target DNA were analyzed in three different crystal structures of the ternary complex (
(313) The results described herein were obtained using the following materials and methods.
(314) Materials and Instruments
(315) All oligos were purchased from IDT, and were either purified by HPLC for use in strand displacement assays or by desalting for use in in vitro transcription experiments. Single time point fluorescence measurements were taken using an Envision plate reader with a FITC top mirror (403), FITC 485 excitation filter (102), and BODIPY TMP FP 531 emission filter (105). Gel images were acquired with an Azure Biosystems C400 or C600.
(316) Oligonucleotide and Plasmid Cleavage Assays
(317) Oligonucleotides were annealed by heating to 95° C. for 5 minutes, followed by slow cooling to 25° C. at a rate of 0.1° C./sec to produce a double stranded oligo (DS-oligo). Oligo-annealing solutions were prepared by mixing 10 μM of each complementary strand together in the presence of 1× Cas9 assay buffer (20 mM Tris-HCl, pH=7.5, 150 mM KCl, 1 mM EDTA, 50 mM MgCl.sub.2). A T7-promoter spinach (ref) sequence cloned into pUC57-Kan and linearized with AsiS1 was used as the plasmid substrate for Cas9 cleavage.
(318) A Cas9:gRNA complex was first preformed by mixing each component at a ratio of 1:1.2 (Cas9:gRNA) and incubating at room temperature for 15 minutes. Cas9:gRNA complexes (500 nM) were mixed with either 100 nM of oligonucleotide or 5 nM (100 ng) of linearized plasmid in 1× assay buffer, and incubated at 37° C. for 1 hour. For oligonucleotide cleavage assays, Proteinase K (Qiagen) and RNAse (Qiagen) were added to final concentrations of 200 μg/L and 100 μg/μL, respectively, and incubated at 37° C. for at least 30 minutes. Samples were boiled in loading buffer and 50 mM EDTA for 10 min, and run on a 15% TBE-Urea gel (ThermoFisher EC68855) for 70 minutes at 200 V. FAM fluorescence was measured prior to staining with SYBR gold (ThermoFisher) to visualize total nucleotide content. For plasmid cleavage assays, loading buffer was directly added to reactions and run on 1.6-2% agarose gels with 0.01% ethidium bromide.
(319) Fluorescence Strand Displacement Assays (SDA)
(320) Assay components and solutions were prepared at 10× working stocks prior to mixing. Concentrations are given as the final concentrations. In a typical assay, a Cas9:gRNA complex was first formed as described above. Cas9 without gRNA (ApoCas9) was treated similarly. DS-oligo (1 nM) was mixed with quencher oligo (Q-oligo, 5 nM) in 1× Cas9 assay buffer. Reactions were initiated by addition of Cas9:gRNA (5 nM), distributed among a 384-well plate (Corning 3575) (3 technical replicates per experiment), and incubated at 37° C. for 2-3 hours. Fluorescence was read on an Envision plate reader, using 485 nm emission and 535 nm excitation wavelengths. Typical controls included replacing Cas9:gRNA with ApoCas9 (maximum possible fluorescence), replacing DS-oligo with the single stranded FAM-labeled oligo (SS-oligo, maximum possible quenching), and omitting FAM labeled oligos altogether (background fluorescence from ApoCas9 and Q-oligo). Fraction cleaved was calculated by subtracting SS-oligo controls from matched Apo-Cas9+DS-oligo and Cas9/gRNA+DS-oligo samples and normalizing to ApoCas9+DS-oligo samples.
(321) Cas Nuclease Binding In Vitro Transcription Spinach Assay
(322) HiScribe T7 High Yield RNA in vitro transcription kits were purchased from NEB (E2040S). The Spinach aptamer template and non-template oligonucleotides were annealed as described above. In a typical assay, a Cas9/Cpf1:gRNA complex was first formed as described above. Cas9/Cpf1 without gRNA (ApoCas9/ApCpf1) was treated similarly. A typical assay was performed by mixing the following components together from the 10× stocks to get the indicated final concentrations: NTPs (6.7 mM), 10× T7 reaction buffer (0.67×), murine RNase inhibitor (M0314L) (1.3 U), DFHBI (1 mM), DNA template (0.1 nM), and water to a final volume of 25 mL. ApoCas9 or Cas9:gRNA complexes (10×) were added to initiate cleavage and incubated at 37° C. for 30 minutes. Transcription was initiated by adding 2 mL of T7 RNA polymerase, or was omitted to assess background fluorescence. Reactions (27 μL) were transferred to a 384-well plate and the fluorescence was monitored at 37° C.
(323) Other Embodiments
(324) From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.
(325) The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
(326) All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference. In the case of conflict, the present specification, including definitions, will control.