REAGENTS, METHODS AND KITS FOR IDENTIFYING PREGNANT HUMAN BEINGS AT RISK FOR PLACENTAL BED DISORDER(S)
20230332234 · 2023-10-19
Assignee
Inventors
Cpc classification
G01N2800/368
PHYSICS
International classification
Abstract
This disclosure provides microRNA (miRNA)-based tests and treatment protocols for identifying and/or treating pregnant human beings at risk for a placental bed disorder during pregnancy, as well as reagents and/or kits relating to the same.
Claims
1. A method for identifying at least two characteristic groups in a patient population on the basis of microRNA (miRNA) expression, wherein one characteristic group is associated with a reproductive disorder or a risk of developing such a disorder, comprising the steps of: a) quantifying at least one microRNA from a biological sample derived from maternal immune cells; and, b) segregating the patient population into the groups on the basis of expression of the at least one miRNA, wherein: the miRNA is selected from the group consisting of at least one the miRNAs listed in Table 3, Table 4, Table 5, Table 8, Table 9 and/or SEQ ID NOS. 1-100; and/or, the at least one miRNA is selected from the group consisting of hsa-miR-4485-5p, hsa-miR-551b-3p, hsa-miR-24-1-5p, hsa-miR-6819-3p, hsa-miR-1238-3p, hsa-miR-6737-3p, hsa-miR-1237-3p, hsa-miR-6757-3p, hsa-miR-6889-3p, hsa-miR-6752-3p, hsa-miR-191-3p, hsa-miR-6795-3p, hsa-miR-149-5p, hsa-miR-2116-3p, hsa-miR-7974, hsa-miR-23c, hsa-miR-4310, hsa-miR-98-3p, hsa-miR-3190-5p, and/or hsa-miR-4312.
2. The method of claim 1 wherein the step of segregating the patient population comprises assigning patients expressing a relatively high level of the at least one miRNA to a first group and assigning patients expressing a relatively low level of the at least one miRNA to a second group.
3. The method of claim 1 or 2 wherein the patient population is pregnant human beings and the population segregated in step b) is at risk of developing a placental bed disorder.
4. A method for identifying a pregnant human being as being at risk for a placental bed disorder, the method comprising: a) quantifying at least one microRNA (miRNA) from a biological sample derived from maternal immune cells; b) identifying the pregnant human being as being at risk for a placental bed disorder on the basis of a difference in the expression of the at least one miRNA as compared to a control biological sample; and, c) optionally treating the pregnant human being identified in step b) as being at risk for a placental bed disorder to ameliorate the likelihood of the occurrence of said placental bed disorder in said pregnant human being, and/or to treat said placental bed disorder in said pregnant human being; wherein: the at least one miRNA is selected from the group consisting of at least one the miRNAs listed in Table 3, Table 4, Table 5, Table 8, Table 9, and/or SEQ ID NOS. 1-100; and/or, the at least one miRNA is selected from the group consisting of hsa-miR-4485-5p, hsa-miR-551b-3p, hsa-miR-24-1-5p, hsa-miR-6819-3p, hsa-miR-1238-3p, hsa-miR-6737-3p, hsa-miR-1237-3p, hsa-miR-6757-3p, hsa-miR-6889-3p, hsa-miR-6752-3p, hsa-miR-191-3p, hsa-miR-6795-3p, hsa-miR-149-5p, hsa-miR-2116-3p, hsa-miR-7974, hsa-miR-23c, hsa-miR-4310, hsa-miR-98-3p, hsa-miR-3190-5p, and/or hsa-miR-4312.
5. A method comprising the steps of: a) quantifying the expression of one or more microRNAs (miRNAs) in maternal immune cells of a pregnant human being, the miRNAs being: at least one miRNA is selected from the group consisting of at least one miRNAs listed in Table 3, Table 4, Table 5, Table 8, Table 9, and/or SEQ ID NOS. 1-100; and/or, the at least one miRNA is selected from the group consisting of hsa-miR-4485-5p, hsa-miR-551b-3p, hsa-miR-24-1-5p, hsa-miR-6819-3p, hsa-miR-1238-3p, hsa-miR-6737-3p, hsa-miR-1237-3p, hsa-miR-6757-3p, hsa-miR-6889-3p, hsa-miR-6752-3p, hsa-miR-191-3p, hsa-miR-6795-3p, hsa-miR-149-5p, hsa-miR-2116-3p, hsa-miR-7974, hsa-miR-23c, hsa-miR-4310, hsa-miR-98-3p, hsa-miR-3190-5p, and/or hsa-miR-4312; b) comparing the expression of the miRNAs quantified in step a) to the expression of the same miRNAs in a control biological sample to determine whether the pregnant human being is at risk of developing preeclampsia, wherein an increase in expression in the pregnant human being relative to the control biological sample indicates the pregnant human being is at risk of developing a placental bed disorder; and, c) optionally treating a pregnant human being identified in step b) as being at risk of developing a placental bed disorder.
6. The method of any preceding claim wherein the maternal immune cells and/or biological sample is obtained during the first trimester of pregnancy.
7. The method of any preceding claim wherein the placental bed disorder is selected from the group consisting of preeclampsia, preterm birth, HELLP Syndrome, gestational diabetes, miscarriage, implantation failure, fetal growth restriction, and premature rupture of the membranes (P.R.O.M.).
8. The method of any preceding claim, wherein the placental bed disorder is preeclampsia.
9. The method of any preceding claim wherein the control biological sample is representative of a pregnant human being without a placental bed disorder.
10. The method of any preceding claim wherein the maternal immune cells and/or biological sample comprises mononuclear cells.
11. The method of any preceding claim wherein the maternal immune cells and/or biological sample is peripheral blood.
12. The method of any preceding claim, further comprising the additional step of isolating mononuclear cells from the maternal immune cells and/or biological sample.
13. The method of any preceding claim wherein the maternal immune cells and/or biological sample is derived from peripheral blood.
14. The method of any preceding claim, further comprising the step of extracting miRNA-comprising RNA from the maternal immune cells and/or biological sample.
15. A method of any preceding claim further comprising the steps of quantifying at least one microRNA from a biological sample derived from immune cells from an additional pregnant human being and identifying the additional pregnant human being as being at risk for a placental bed disorder on the basis of expression of the at least one of the microRNAs.
16. A method of any preceding claim comprising calculating a ratio (HC ratio) of expression of said at least one miRNA, wherein said ratio comprises: a numerator equal to the difference between the mean value of expression of the at least one miRNA in the first population and the mean value of the second population and the denominator comprises the average of the two standard deviations of the values for the first and second populations.
17. The method of claim 16 wherein the first population are compromised pregnancy outcome individuals and the second population is healthy pregnancy outcome individuals.
18. The method of claim 16 or 17 wherein said miRNA exhibits a signal consistency of at least about 85%; a mean signal strength of at least 5.0; and a p value of less than 0.05 (p<0.05).
19. The method of any one of claims 16-18 wherein the at least one miRNA exhibits a HC ratio of greater than or equal to about any of 1.0. 1.1, 1.2, 1.3, 1.4, or 1.5; or greater than or equal to about 1.3.
20. A component of a diagnostic assay, the component comprising at least one miRNA listed in Table 3, Table 4, Table 5, and/or SEQ ID NOS. 1-100; and/or, at least one of hsa-miR-4485-5p, hsa-miR-551b-3p, hsa-miR-24-1-5p, hsa-miR-6819-3p, hsa-miR-1238-3p, hsa-miR-6737-3p, hsa-miR-1237-3p, hsa-miR-6757-3p, hsa-miR-6889-3p, hsa-miR-6752-3p, hsa-miR-191-3p, hsa-miR-6795-3p, hsa-miR-149-5p, hsa-miR-2116-3p, hsa-miR-7974, hsa-miR-23c, hsa-miR-4310, hsa-miR-98-3p, hsa-miR-3190-5p, and/or hsa-miR-4312.
21. The component of claim 20 wherein said component is selected from the group consisting of a nucleic acid amplification primer, a pair of nucleic acid amplification primers, and an oligonucleotide probe corresponding to at least one of said miRNAs.
22. A microarray, solid support, or collection of solid supports, comprising at least one miRNA listed in Table 3, Table 4, Table 5, Table 8, Table 9, and/or SEQ ID NOS. 1-100; and/or, at least one of hsa-miR-4485-5p, hsa-miR-551b-3p, hsa-miR-24-1-5p, hsa-miR-6819-3p, hsa-miR-1238-3p, hsa-miR-6737-3p, hsa-miR-1237-3p, hsa-miR-6757-3p, hsa-miR-6889-3p, hsa-miR-6752-3p, hsa-miR-191-3p, hsa-miR-6795-3p, hsa-miR-149-5p, hsa-miR-2116-3p, hsa-miR-7974, hsa-miR-23c, hsa-miR-4310, hsa-miR-98-3p, hsa-miR-3190-5p, and/or hsa-miR-4312; and/or a binding partner for at least one of said miRNAs.
23. The microarray, solid support, or collection of solid supports of claim 22 comprising a nucleic acid amplification primer, a pair of nucleic acid amplification primers, and/or an oligonucleotide probe corresponding to at least one of said miRNAs.
24. The microarray, solid support, or collection of solid supports of claim 22 or 23 comprising SEQ ID NOS. 1-100; and/or, hsa-miR-4485-5p, hsa-miR-551b-3p, hsa-miR-24-1-5p, hsa-miR-6819-3p, hsa-miR-1238-3p, hsa-miR-6737-3p, hsa-miR-1237-3p, hsa-miR-6757-3p, hsa-miR-6889-3p, hsa-miR-6752-3p, hsa-miR-191-3p, hsa-miR-6795-3p, hsa-miR-149-5p, hsa-miR-2116-3p, hsa-miR-7974, hsa-miR-23c, hsa-miR-4310, hsa-miR-98-3p, hsa-miR-3190-5p, and hsa-miR-4312; and/or a binding partner for at least one of said miRNAs.
25. The solid support or collection of solid supports of any one of claims 22-24 wherein said solid support is a bead or collection of beads, respectively.
26. A kit comprising a component, microarray, solid support, or collection of solid supports or any one of claims 22-25, optionally further including instructions for use.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
SUMMARY OF THE DISCLOSURE
[0107] This disclosure provides microRNA (miRNA)-based tests and treatment protocols for identifying and/or treating pregnant human beings at risk for a placental bed disorder during pregnancy, as well as reagents and/or kits relating to the same. In some embodiments, this disclosure provides reagents and methods for identifying at least two characteristic groups in a patient population on the basis of microRNA (miRNA) expression in maternal immune cells, wherein one characteristic group is associated with a reproductive disorder or a risk of developing such a disorder, comprising the steps of: a) quantifying at least one microRNA from a biological sample derived from maternal immune cells; and, b) segregating the patient population into the groups on the basis of expression of the at least one miRNA, wherein: the miRNA is selected from the group consisting of at least one the miRNAs listed in Table 3, Table 4, Table 5, SEQ ID NOS. 1-100, and/or any of
[0108] In some embodiments, this disclosure provides methods for identifying a pregnant human being as being at risk for a placental bed disorder, the methods comprising: a) quantifying at least one microRNA (miRNA) from a biological sample derived from immune cells of the pregnant human being (preferably maternal immune cells); b) identifying the pregnant human being as being at risk for a placental bed disorder on the basis of a difference in the expression of the at least one miRNA as compared to a control biological sample; and, c) optionally treating the pregnant human being identified in step b) as being at risk for a placental bed disorder to ameliorate the likelihood of the occurrence of said placental bed disorder in said pregnant human being, and/or to treat said placental bed disorder in said pregnant human being; wherein: the at least one miRNA is selected from the group consisting of at least one of the miRNAs listed in Table 3, Table 4 or Table 5; and/or at least one of SEQ ID NOS. 1-100; at least any one or more of the miRNAs of
[0109] In some embodiments, the methods disclosed here in comprise the steps of: a) quantifying the expression of one or more microRNAs (miRNAs) in a biological sample (preferably maternal immune cells) of a pregnant human being, the miRNAs being: at least one miRNA is selected from the group consisting of at least one of the miRNAs listed in Table 3, Table 4 or Table 5; and/or at least one of SEQ ID NOS. 1-100; and/or, at least one of hsa-miR-4485-5p (
[0110] Reagents and kits for carrying out such methods are also provided. Other embodiments are also disclosed as will be understood by those of ordinary skill in the art.
DETAILED DESCRIPTION
[0111] This disclosure provides microRNA (miRNA)-based tests and treatment protocols for identifying women at risk for a placental bed disorder (or having a placental bed disorder), also referred to herein as a “compromised pregnancy outcome” (or “compromised” or “compromised outcome”; i.e., as compared to a “healthy pregnancy outcome” (or “healthy” or “healthy outcome”) that does not involve a placental bed disorder). As shown herein, in some embodiments, a ratio (“HC Ratio”) for an individual miRNA can be calculated and used to identify miRNAs of interest. The HC ratio is calculated by using as the numerator the mean miRNA signal (i.e., expression) for a “compromised pregnancy outcome” population minus the mean miRNA signal level (i.e., expression) for a “healthy pregnancy outcome” population (in other words, subtracting the mean miRNA signal level for a “healthy pregnancy outcome” population from the mean miRNA signal for a “compromised pregnancy outcome” population), and using as the denominator the average of the standard deviations (SD) of the “healthy pregnancy outcome” mean signal level and the “compromised pregnancy outcome” mean signal level. Thus, the HC ratio can be calculated as shown below:
mean miRNA signal(compromised)−mean miRNA signal(healthy)/(SD(healthy)+SD(comprised))/2
The individual miRNAs identified with high HC ratios are shown herein to distinguish the two populations, for example, those with a placental bed disorder (e.g., preeclampsia) from those women destined to have healthy pregnancy outcome. In a preferred embodiment the HC ratio shall be equal or greater than about any of 1.0, 1.1, 1.2, 1.3, 1.4, or 1.5, and is most preferably equal to or greater than 1.3 (see, e.g., the results presented in Table 3). As shown herein, for microRNAs that demonstrate a high ratio, the “associated criterion value” at the Youden index J point of the ROC calculation can be used to determine the cut-off value used to determine patient risk of developing a placental bed disorder. In some embodiments, when a patient's measured miRNA signal is greater than this predetermined cut-off value, the patient is deemed to be at “higher risk” of experiencing a placental bed disorder. The women in whom a higher miRNA signal is observed can then be further supervised and/or treated, as appropriate, in order to prevent and/or treat placental bed disorders. In some embodiments, such miRNAs can be one or more (i.e., at least one) of the miRNAs listed in Table 3, Table 4 or Table 5; and/or at least one of SEQ ID NOS. 1-100; and/or, at least one of hsa-miR-4485-5p (
[0112] Within this disclosure, the term “placental bed disorder” refers to conditions that can arise during pregnancy, typically have deleterious effects on and/or during pregnancy, and includes but is not limited to preeclampsia, preterm birth, HELLP Syndrome (a complication of pregnancy characterized by hemolysis, elevated liver enzymes, and a low platelet count), gestational diabetes, miscarriage, implantation failure, intrauterine growth retardation (IUGR) or fetal growth restriction, and premature rupture of the membranes (P.R.O.M.). Within this disclosure, the term “placental site” shall refer to the discrete area of the maternal endometrium in direct contact with the implanting feto-placental unit, which is coextensive with the placenta.
[0113] With this disclosure, specific microRNAs may be identified by their prefix mir- and their identifier, such as mir-155. Sequences within an RNA transcript targeted by miRNAs may lie anywhere within the transcript. However, sequences within the 3′ untranslated region are most common. MicroRNA nomenclature comprises a three-letter prefix “mir” followed by a number assigned generally in order of the description of the microRNA. In one convention, when the “R” is lower case, the sequence refers to the pre-microRNA while when upper case is employed (miR), the mature form is indicated. Variants where the sequences vary by one or two bases may be designated by the letters “a” and “b”. Occasionally, pre-microRNAs located within separate regions of the genome result in an identical mature microRNA. These microRNAs are distinguished by a numeric suffix (e.g., “miR-123-1” and “miR-123-2”). When two microRNAs originate from opposite arms of the same pre-microRNA they are designated with the suffix-3p or -5p according to whether the 3′ or 5′ strand is used. As used herein, the numeric code, e.g., “mir-123” shall include its variants such as mir-123-1, mir123-2, and the -3p and -5p variants. As used herein the term “pri-miRNA” shall mean the RNA targeted by the Drosha-Pasha complex; the term “pre-miRNA” shall mean the product of the cleavage by the Drosha-Pasha complex; and, no distinction shall be made between sequences between the parent nomenclature for example mir-123 and any more selective sequence for example mir-123-5p and other than by description within the text. Specific microRNA abbreviations may also include an additional prefix identifying the species of origin, such as “has” for Homo sapiens. miRNAs typically comprise approximately 18-25 nucleotides, in some embodiments, about 22 nucleotides. Nomenclature for miRNAs as used herein may be found in miRBase (www.mirbase.org), the entries of which represent the predicted hairpin portion of the miRNA transcript. It is also noted, as would be understood by those of ordinary skill in the art, that while specific miRNAs are listed in the Tables, Figures and Examples, a number of microRNA equivalents are recognized including, e.g., isomirs (i.e., nongenomic changes made by imprecise cleaving of the microRNA from precursors, 3′ and 5′ additions and deletions), alleles, and the like, and that, in certain embodiments, the methods, reagents and kits of this disclosure comprising such miRNA equivalents are intended to be included therein. Although the primary embodiments described herein are directed to humans, one of skill in the art will appreciate that, in some embodiments, the methods provided in this disclosure can be applied to other species.
[0114] As will be discussed below, examples of suitable microRNAs that may be used according to this disclosure include, without limitation, at least one of the miRNAs listed in Table 3, Table 4 or Table 5; at least one of SEQ ID NOS. 1-100; and/or the miRNAs listed in any
[0115] Within this disclosure, the term “non-placental biological sample” shall mean maternal cells (preferably maternal immune cells) and derivatives thereof not collected from the placental site but instead collected from, e.g., the peripheral blood, of a subject (e.g., a pregnant human being). A non-placental biological sample (preferably maternal immune cells) may be derived from an individual being investigated for the propensity or likelihood of developing a placental bed disorder, or having a placental bed disorder, during the first trimester of a pregnancy, and/or from a control subject. As used herein, the term “subject” refers to any mammal, including both human and other mammals. A “control subject” is an individual(s) of comparable characteristics such as age, sex, and/or condition (e.g., pregnant) who does not have a placental bed disorder, and/or related condition(s) and/or pathology leading to said a placental bed disorder, and are not at known to be at risk of developing a placental bed disorder. The term “control sample” mean a non-placental biological sample of a control subject, taken from the same source, such a peripheral blood, and collected under the same or comparable conditions as a patient sample comprising cells of the non-placental biological sample collected from a control individual that is processed and analyzed in the same manner as a patient sample (e.g., test sample). In some embodiments, the term “control sample” as used herein may represent the mathematical mean of multiple samples from control individuals wherein a number of samples considered sufficient by an individual of ordinary skill in the art are collected. Additional statistical parameters may be derived from said samples such as standard deviation of the mean. Said additional statistical parameters may be used for purposes of comparison of a patient test result with control samples to estimate the probability that the patient's test result represents an abnormal finding and, thereby suggests that the patient is suffering from preeclampsia and related conditions or risk of said condition. For purposes of simplicity the term may also be used in another way wherein a plurality of comparable, temporally separate, samples are collected and assayed from a single individual and compared with one another such that a first sample or a particular subsequent sample are compared as though the first is a control for the second, permitting assessment of a change in condition potentially as a function of the clinical state, or stage of pregnancy or as a result of therapeutic intervention. Preferably, the subjects to whom the methods described herein are applied are human beings, most preferably pregnant human beings.
[0116] Suitable techniques for isolating cells from non-placental biological sample (preferably maternal immune cells) can include isopycnic density-gradient centrifugation or monoclonal antibody paramagnetic bead conjugates, for example, as are well-known known in the art as well as any other suitable techniques that are available to those of ordinary skill in the art. In some embodiments, this disclosure provides methods comprising providing a non-placental biological sample (preferably maternal immune cells). Such a non-placental biological sample can be being derived from cells of the biologic sample (preferably maternal immune cells) such as, for example, peripheral blood (e.g., whole blood), the buffy coat thereof (i.e., the fraction of an anticoagulated peripheral blood sample that contains most of the white blood cells and platelets following density gradient centrifugation of the blood), bone marrow, or other source and then isolating mononuclear cells (e.g., as taught by Boyum (Scand J Immunol 17: 429-436 (1983)). In a preferred embodiment, for example, a sample derived from a peripheral blood and/or bone marrow can include any leukocyte population(s), for example, monocytes, lymphocytes, granulocyte, platelets, and/or stem cells may be segregated by means well known in the art permits selective quantification of miRNAs within that cell population. Further, for example, cell subpopulations (e.g., T cells, B cells) can be individually interrogated following their selective isolation by techniques such as, for example, flow cytometric sorting following interaction with fluorescently labeled monoclonal antibody combinations that are capable of discreetly characterizing the individual subclasses. It is understood by those of ordinary skill in the art that the miRNA content of a sample enriched for mononuclear cells (e.g., the buffy coat) is representative of the miRNA content of the mononuclear cells in that sample because the miRNA content of mononuclear cells is vastly greater than that of plasma. Thus, in preferred embodiments, a buffy coat specimen or even a whole blood specimen is essentially equivalent to a mononuclear cell specimen.
[0117] Exemplary methods for isolating RNA include phenol-based extraction and silica matrix or glass fiber filter (GFF)-based binding. Phenol-based reagents comprise various components that denaturants sample constituents, possess the capacity to inhibit RNase's that permit cell and tissue disruption that is followed by steps that permit separation of the RNA from other constituents of the sample. Commercial reagents and kits may be configured to recover short RNA polynucleotides of microRNA length. Extraction procedures such as those using Trizol or TriReagent are useful wherein both long and short RNA polynucleotides are desired. Advantage may be taken of the relative quantity of cell-comprised microRNA versus the quantity of microRNA comprised in the blood liquid phase as in plasma or serum-comprised vesicular structures. The relative quantity of microRNA in the former is very substantially greater than the later permitting assessment of cellular microRNA as a measured by total blood microRNA. The PAXgene blood RNA Tube™ is designed for the collection, storage, stabilization and transport of intracellular RNA, and may be utilized, optionally in conjunction with a nucleic acid purification kit (e.g., the PAXgene Blood RNA Kit) for isolation of cellular miRNA. Isolated cells can be interrogated in batch assays assessing the total quantity of a specific miRNA that may be related to the average quantity expressed by cells of the individual cell type, or may be quantified by in situ hybridization. It is understood herein that detection of miRNA may include detection of the presence or absence of a specific microRNA within a non-placental biological sample, and more preferably its quantification. The methods may produce quantitative or semi-quantitative results. It is understood that relative quantification wherein comparative levels between the sample of the patient is related to the level in a control or other sample particularly wherein sequential samples are assayed. Any detection method well known to those skilled in the art falls within the scope of the invention. Hybridization, preferably where a polynucleotide complimentary to the target polynucleotide is labeled, may be used to detect the target strand. Polymerase chain reaction (PCR) using labeled probes, electrophoresis, and/or sequencing of target strands, or other detection strategy may be employed.
[0118] In some embodiments, RNA can be extracted from cells of the non-placental biological sample (preferably maternal immune cells) according to well-known techniques. Blood collected can be drawn into heparinized tubes and maintained at room temperature preferably for approximately 24 hours prior to isolation of cells. RNA sampling and extraction: cells or sorted cell populations (<1×10{circumflex over ( )}7 viable cells) were collected in 1 ml TRIzol (Invitrogen) and stored at −80° C. until use). Total RNA can be isolated according to standard techniques, such as using the TRIzol reagent/protocol (Invitrogen) and/or RNeasy Mini Kit (Qiagen) (e.g., at room temperature with the QIAcube automated robot (Qiagen)). Total RNA yield can be assessed using the Thermo Scientific NanoDrop 1000 micro-volume spectrophotometer (absorbance at 260 nm and the ratio of 260/280 and 260/230), and RNA integrity assessed using, e.g., the Agilent's Bioanalyzer NANO Lab-on-Chip instrument (Agilent). miRNAs may be quantitated by any suitable technique including but not limited to quantitative real time PCR (qPCR using, e.g., SYBR® Green, a TaqMan® probe, locked nucleic acid probe (Vester, et al. Nature Methods, 7: 687-692 (2004)), miRNA arrays, next generation sequencing (NGS) techniques (e.g., TruSeq kits (Illumina); Baker et al. Biochemistry, 43: 13233-13241 (2010)), multiplex miRNA profiling assays (e.g., FirePlex® miRNA assays), and the like, and/or other available techniques.
[0119] In some embodiments, the expression of various miRNAs (e.g., those of Tables 2 and/or Table 3) in a non-placental biological sample (preferably maternal immune cells) of an individual can be collected and assembled to provide a miRNA signature for that individual. Analysis and/or comparison of a microRNA signature of a non-placental biological sample may be compared with a corresponding microRNA signature derived from a control sample and/or a database representative of a control sample. Mathematical approaches to analysis of data and methods for comparison are well known to those skilled in the art and can include, for example, Signal to Noise ratios, Fold Quotients, correlation and statistical methods as hypothesis tests such as t-test, the Wilcoxon-Mann-Whitney test, the Area under the Receiver operator Characteristics Curve Information. Theory approaches, for example, the Mutual Information, Cross-entropy, Probability theory, for example, joint and conditional probabilities can also be appropriate. Combinations and modifications of the previously mentioned examples are understood to be within the scope of the present invention. Heuristic methods may be applied as the database expands.
[0120] The methods for quantifying or semi-quantifying microRNA(s) are well-known in the art. These include but are not limited to nucleic acid hybridization techniques well-known in the art for example performed using a solid phase support comprising specific, bound polynucleotides complementary to the target microRNA sequence. RNA isolated from a biologic sample may be reversed transcribed into DNA and conjugated with a detectable label and thence contacted with the anchored probes under hybridizing conditions and scanned by a detection system permitting discrete quantification of signals. It is understood that probe sequences may also be complementary to target sequences comprising SNPs. Moreover, it is understood that probe sequences may be complementary to pre-microRNA and pri-microRNA regions of specific microRNAs. Techniques comprising the polymerase chain reaction (PCR), preferably those incorporating real-time techniques, wherein amplification products are detected through labeled probes or utilizing non-specific dye amplicon-binding dyes such as Cyber Green™. For instance, RNA may be extracted from cells isolated cells by extraction according to instructions from the manufacturer (Qiagen catalogue 763134). microRNA such as for mir-155 may be detected and quantified by polymerase chain reaction (PCR) by the method described by Chen et al. (http://www3.appliedbiosystems.com/cms/groups/mcb_marketing/documents/generaldocuments/cms_040548.pdf downloaded May 11, 2010). Primers and reagents may be selected for individual microRNAs from those described in product overview (http://www3.appliedbiosystems.com/cms/groups/mcb_marketing/documents/generaldocuments/cms_068884.pdf downloaded May 11, 2010).
[0121] In some embodiments, an individual identified as being at risk for a placental bed disorder (or as having a placental bed disorder) may be treated by a therapeutic intervention that can prevent, slow, or eliminate the placental bed disorder. Exemplary therapeutic intervention(s) can include any one or more of immunotherapy (e.g., administration of a immunosuppresent and/or anti-inflammatory drug such as intravenous immunoglobulin (IVIG), corticosteroids, Neupogen®), anticoagulant(s) (e.g., heparin(s) such as low molecular weight versions such as Lovenox®), statin(s), progesterone, antibiotic(s), metformin, Cerclage, intralipids, “natural” therapies (e.g., omega-3 and/or fish or krill oil preparations, and the like), dietary changes and/or restrictions, bedrest regimens, and the like. In some embodiments, the appropriate therapeutic intervention can be selected using various in vitro cell markers of maternal immune cells (any maternal (non-fetal) immune cells or subset thereof, e.g., of peripheral blood mononuclear cells (PBMCs)). In some embodiments, quantification of various miRNAs and patterns of miRNA change (e.g., at least one of the miRNAs listed in Table 3, Table 4 or Table 5; at least one of SEQ ID NOS. 1-100; and/or any one or more of the miRNAs of
[0122] The methods described herein can then comprise quantification of a plurality of individual miRNAs from the non-placental biological sample and quantifying the individual miRNAs and comparing the amount of miRNA(s) in the test sample to the expression of the corresponding microRNA in control sample(s). A significant difference in the amount of miRNA expressed in a test and control samples (i.e., between the test and the control subjects) can indicate the test subject is at risk of developing and/or has a placental bed disorder. In contrast, where there is not a difference (e.g., a significant difference) in the expression of such miRNA(s) between the test and control samples indicates the test subject is not at risk of developing, or does not have, a placental bed disorder. In some embodiments, the method further comprises selecting a treatment or modifying a treatment based on the amount of the one or more RNAs determined. This determination may be based upon assessment of specific individual or combinations of the individual microRNAs. Thus, in some embodiments, this disclosure provides methods for diagnosing a disease or condition, comprising the steps (1) quantifying miRNAs within a predetermined miRNA profile in a non-placental biological sample from an individual (e.g., patient or subject); and (2) comparing said miRNA profile to a reference, wherein the reference is the set of quantifications of said miRNA profile of one or the average of many individuals that are without disease or have a second condition to which the first condition is to be distinguished or compared (e.g., a control sample). This comparison permits diagnosis. Wherein the comparison is between two temporally separate non-placental biological samples of the same individual, it may be used to determine clinical progress. Wherein the two non-placental biological samples of the same individual span a therapeutic intervention, the relative efficacy of therapy may be assessed. Thus, the methods described herein can include the separation of patients into groups distinguishable by characteristic changes in single or multiple microRNAs (e.g., those with or without a risk of development a placental bed disorder), optionally following the selected therapeutic intervention. Identification of patients belonging to microRNA response groups is associated with improved efficacy, prognosis and utility of particular therapeutic intervention(s). Moreover, quantitative levels of certain microRNAs and patterns of change within microRNAs may predict patient response group(s) and post-therapy levels may have additional predictive value. Use of microRNA patterns responsive to therapeutic intervention or predictive thereof provides useful insights into management unavailable through identification of markers directly related to the pathologic process
[0123] In some embodiments, expression profiles may consist of the entirety of all known microRNAs incorporated into or onto a microarray chip, bead or other solid support typically used in expression analysis. Any of several methods may be used for quantification or semi-quantification. Determination of an expression profile may be performed by quantitative or semi-quantitative determination of a panel of microRNAs in patients affected by a condition to be assessed and in individuals without said condition. Alternatively, determination of an expression profile that may be used to determine progress of a condition may be determined in a similar manner wherein comparison is made by quantitative or semi-quantitative differences between the two time points. Separate expression profiles may be determined in a similar manner wherein the two time points are separated by a therapeutic intervention. In a similar manner individual expression profiles may be determined at different time points particularly during the course of pregnancy including time points within 6 months preceding or following pregnancy by a term of approximately six months. Panels of miRNAs to be assessed selected a priori or these may comprise large collections intended to include all currently known microRNAs such as in a microarray. The determination may be carried out by any means for determining the expression profiles of nucleic acids (e.g., miRNAs).
[0124] In some embodiments, e.g., as described in the Examples, the mean and standard deviation of the expression levels for each miRNA (e.g., those listed in Table 3, Table 4, and/or Table 5) from patient samples with “healthy” outcomes and also “compromised” outcomes (e.g., identified as “0” and “1”, respectively, in
[0125] Thus, in some embodiments, this disclosure provides reagents and methods for identifying at least two characteristic groups in a patient population on the basis of microRNA (miRNA) expression, wherein one characteristic group is associated with a reproductive disorder or a risk of developing such a disorder, comprising the steps of: a) quantifying at least one microRNA from a biological sample derived from immune cells; and, b) segregating the patient population into the groups on the basis of expression of the at least one miRNA, wherein: the miRNA is selected from the group consisting of at least one the miRNAs listed in Table 3, Table 4, Table 5, Table 8, Table 9, SEQ ID NOS. 1-100, and/or the miRNAs referred to in
7. In some embodiments, this disclosure provides reagents and methods for identifying a pregnant human being as being at risk for a placental bed disorder, the method comprising: a) quantifying at least one microRNA (miRNA) from a biological sample derived from immune cells of the pregnant human being; b) identifying the pregnant human being as being at risk for a placental bed disorder on the basis of a difference in the expression of the at least one miRNA as compared to a control biological sample; and, c) optionally treating the pregnant human being identified in step b) as being at risk for a placental bed disorder to ameliorate the likelihood of the occurrence of said placental bed disorder in said pregnant human being, and/or to treat said placental bed disorder in said pregnant human being; wherein the at least one miRNA is selected from the group consisting of at least one of the miRNAs listed in Table 3, Table 4, Table 5, Table 8, or Table 9; at least one of SEQ ID NOS. 1-100; and/or at least one of the miRNAs referred to in
[0126] In some embodiments, this disclosure provides one or more component(s) of a diagnostic assay comprising at least one of the miRNAs listed in Table 3, Table 4, Table 5, Table 8, or Table 9; at least one of SEQ ID NOS. 1-100; at least one of the miRNAs referred to in
[0127] In some preferred embodiments, this disclosure provides the following aspects: [0128] 1. A method for identifying at least two characteristic groups in a patient population on the basis of microRNA (miRNA) expression, wherein one characteristic group is associated with a reproductive disorder or a risk of developing such a disorder, comprising the steps of: a) quantifying at least one microRNA from a biological sample derived from maternal immune cells; and, b) segregating the patient population into the groups on the basis of expression of the at least one miRNA, wherein: [0129] the miRNA is selected from the group consisting of at least one the miRNAs listed in Table 3, Table 4, Table 5, Table 8, Table 9 and/or SEQ ID NOS. 1-100; and/or, [0130] the at least one miRNA is selected from the group consisting of hsa-miR-4485-5p, hsa-miR-551b-3p, hsa-miR-24-1-5p, hsa-miR-6819-3p, hsa-miR-1238-3p, hsa-miR-6737-3p, hsa-miR-1237-3p, hsa-miR-6757-3p, hsa-miR-6889-3p, hsa-miR-6752-3p, hsa-miR-191-3p, hsa-miR-6795-3p, hsa-miR-149-5p, hsa-miR-2116-3p, hsa-miR-7974, hsa-miR-23c, hsa-miR-4310, hsa-miR-98-3p, hsa-miR-3190-5p, and/or hsa-miR-4312. [0131] 2. The method of aspect 1 wherein the step of segregating the patient population comprises assigning patients expressing a relatively high level of the at least one miRNA to a first group and assigning patients expressing a relatively low level of the at least one miRNA to a second group, in preferred embodiments the “relatively high” or “relatively low” being relative to the other respective group. [0132] 3. The method of aspect 1 or 2 wherein the patient population is pregnant human beings and the population segregated in step b) is at risk of developing a placental bed disorder. [0133] 4. A method for identifying a pregnant human being as being at risk for a placental bed disorder, the method comprising: [0134] a) quantifying at least one microRNA (miRNA) from a biological sample derived from maternal immune cells; [0135] b) identifying the pregnant human being as being at risk for a placental bed disorder on the basis of a difference in the expression of the at least one miRNA as compared to a control biological sample; and, [0136] c) optionally treating the pregnant human being identified in step b) as being at risk for a placental bed disorder to ameliorate the likelihood of the occurrence of said placental bed disorder in said pregnant human being, and/or to treat said placental bed disorder in said pregnant human being; [0137] wherein: [0138] the at least one miRNA is selected from the group consisting of at least one the miRNAs listed in Table 3, Table 4, Table 5, Table 8, Table 9, and/or SEQ ID NOS. 1-100; and/or, [0139] the at least one miRNA is selected from the group consisting of hsa-miR-4485-5p, hsa-miR-551b-3p, hsa-miR-24-1-5p, hsa-miR-6819-3p, hsa-miR-1238-3p, hsa-miR-6737-3p, hsa-miR-1237-3p, hsa-miR-6757-3p, hsa-miR-6889-3p, hsa-miR-6752-3p, hsa-miR-191-3p, hsa-miR-6795-3p, hsa-miR-149-5p, hsa-miR-2116-3p, hsa-miR-7974, hsa-miR-23c, hsa-miR-4310, hsa-miR-98-3p, hsa-miR-3190-5p, and/or hsa-miR-4312. [0140] 5. A method comprising the steps of: [0141] a) quantifying the expression of one or more microRNAs (miRNAs) in maternal immune cells of a pregnant human being, the miRNAs being: [0142] at least one miRNA is selected from the group consisting of at least one miRNAs listed in Table 3, Table 4, Table 5, Table 8, Table 9, and/or SEQ ID NOS. 1-100; and/or, [0143] the at least one miRNA is selected from the group consisting of hsa-miR-4485-5p, hsa-miR-551b-3p, hsa-miR-24-1-5p, hsa-miR-6819-3p, hsa-miR-1238-3p, hsa-miR-6737-3p, hsa-miR-1237-3p, hsa-miR-6757-3p, hsa-miR-6889-3p, hsa-miR-6752-3p, hsa-miR-191-3p, hsa-miR-6795-3p, hsa-miR-149-5p, hsa-miR-2116-3p, hsa-miR-7974, hsa-miR-23c, hsa-miR-4310, hsa-miR-98-3p, hsa-miR-3190-5p, and/or hsa-miR-4312; [0144] b) comparing the expression of the miRNAs quantified in step a) to the expression of the same miRNAs in a control biological sample to determine whether the pregnant human being is at risk of developing preeclampsia, wherein an increase in expression in the pregnant human being relative to the control biological sample indicates the pregnant human being is at risk of developing a placental bed disorder; and, [0145] c) optionally treating a pregnant human being identified in step b) as being at risk of developing a placental bed disorder. [0146] 6. The method of any preceding aspect wherein the maternal immune cells and/or biological sample is obtained during the first trimester of pregnancy. [0147] 7. The method of any preceding aspect wherein the placental bed disorder is selected from the group consisting of preeclampsia, preterm birth, HELLP Syndrome, gestational diabetes, miscarriage, implantation failure, fetal growth restriction, and premature rupture of the membranes (P.R.O.M.). [0148] 8. The method of any preceding aspect, wherein the placental bed disorder is preeclampsia. [0149] 9. The method of any preceding aspect wherein the control biological sample is representative of a pregnant human being without a placental bed disorder. [0150] 10. The method of any preceding aspect wherein the maternal immune cells and/or biological sample comprises mononuclear cells. [0151] 11. The method of any preceding aspect wherein the maternal immune cells and/or biological sample is peripheral blood. [0152] 12. The method of any preceding aspect, further comprising the additional step of isolating mononuclear cells from the maternal immune cells and/or biological sample. [0153] 13. The method of any preceding aspect wherein the maternal immune cells and/or biological sample is derived from peripheral blood. [0154] 14. The method of any preceding aspect, further comprising the step of extracting miRNA-comprising RNA from the maternal immune cells and/or biological sample. [0155] 15. A method of any preceding aspect further comprising the steps of quantifying at least one microRNA from a biological sample derived from immune cells from an additional pregnant human being and identifying the additional pregnant human being as being at risk for a placental bed disorder on the basis of expression of the at least one of the microRNAs. [0156] 16. A method of any preceding aspect comprising calculating a ratio (HC ratio) of expression of said at least one miRNA, wherein said ratio comprises: a numerator equal to the difference between the mean value of expression of the at least one miRNA in the first population and the mean value of the second population and the denominator comprises the average of the two standard deviations of the values for the first and second populations. [0157] 17. The method of aspect 16 wherein the first population are compromised pregnancy outcome individuals and the second population is healthy pregnancy outcome individuals. [0158] 18. The method of aspect 16 or 17 wherein said miRNA exhibits a signal consistency of at least about 85%; a mean signal strength of at least 5.0; and a p value of less than 0.05 (p<0.05). [0159] 19. The method of any one of claims 16-18 wherein the at least one miRNA exhibits a HC ratio of greater than or equal to about any of 1.0. 1.1, 1.2, 1.3, 1.4, or 1.5; or greater than or equal to about 1.3. 20. A component of a diagnostic assay, the component comprising at least one miRNA listed in Table 3, Table 4, Table 5, and/or SEQ ID NOS. 1-100; and/or, at least one of hsa-miR-4485-5p, hsa-miR-551b-3p, hsa-miR-24-1-5p, hsa-miR-6819-3p, hsa-miR-1238-3p, hsa-miR-6737-3p, hsa-miR-1237-3p, hsa-miR-6757-3p, hsa-miR-6889-3p, hsa-miR-6752-3p, hsa-miR-191-3p, hsa-miR-6795-3p, hsa-miR-149-5p, hsa-miR-2116-3p, hsa-miR-7974, hsa-miR-23c, hsa-miR-4310, hsa-miR-98-3p, hsa-miR-3190-5p, and/or hsa-miR-4312. [0160] 21. The component of aspect 20 wherein said component is selected from the group consisting of a nucleic acid amplification primer, a pair of nucleic acid amplification primers, and an oligonucleotide probe corresponding to at least one of said miRNAs. [0161] 22. A microarray, solid support, or collection of solid supports, comprising at least one miRNA listed in Table 3, Table 4, Table 5, Table 8, Table 9, and/or SEQ ID NOS. 1-100; and/or, at least one of hsa-miR-4485-5p, hsa-miR-551b-3p, hsa-miR-24-1-5p, hsa-miR-6819-3p, hsa-miR-1238-3p, hsa-miR-6737-3p, hsa-miR-1237-3p, hsa-miR-6757-3p, hsa-miR-6889-3p, hsa-miR-6752-3p, hsa-miR-191-3p, hsa-miR-6795-3p, hsa-miR-149-5p, hsa-miR-2116-3p, hsa-miR-7974, hsa-miR-23c, hsa-miR-4310, hsa-miR-98-3p, hsa-miR-3190-5p, and/or hsa-miR-4312; and/or a binding partner for at least one of said miRNAs. [0162] 23. The microarray, solid support, or collection of solid supports of aspect 22 comprising a nucleic acid amplification primer, a pair of nucleic acid amplification primers, and/or an oligonucleotide probe corresponding to at least one of said miRNAs. [0163] 24. The microarray, solid support, or collection of solid supports of aspect 22 or 23 comprising SEQ ID NOS. 1-100; and/or, hsa-miR-4485-5p, hsa-miR-551b-3p, hsa-miR-24-1-5p, hsa-miR-6819-3p, hsa-miR-1238-3p, hsa-miR-6737-3p, hsa-miR-1237-3p, hsa-miR-6757-3p, hsa-miR-6889-3p, hsa-miR-6752-3p, hsa-miR-191-3p, hsa-miR-6795-3p, hsa-miR-149-5p, hsa-miR-2116-3p, hsa-miR-7974, hsa-miR-23c, hsa-miR-4310, hsa-miR-98-3p, hsa-miR-3190-5p, and hsa-miR-4312; and/or a binding partner for at least one of said miRNAs. [0164] 25. The solid support or collection of solid supports of any one of aspects 22-24 wherein said solid support is a bead or collection of beads, respectively. [0165] 26. A kit comprising a component, microarray, solid support, or collection of solid supports or any one of aspects 20-25, optionally further including instructions for use.
Other embodiments and aspects are also contemplated, as would be understood by those of ordinary skill in the art.
[0166] Within this disclosure, the terms “about”, “approximately”, and the like, when preceding a list of numerical values or range, refer to each individual value in the list or range independently as if each individual value in the list or range was immediately preceded by that term. The terms mean that the values to which the same refer are exactly, close to, or similar thereto. Optional or optionally means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where the event or circumstance occurs and instances where it does not. Ranges may be expressed herein as from about one particular value, and/or to about another particular value. When such a range is expressed, another aspect includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent about or approximately, it will be understood that the particular value forms another aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. Ranges (e.g., 90-100%) are meant to include the range per se as well as each independent value within the range as if each value was individually listed.
[0167] All references cited within this disclosure are hereby incorporated by reference in their entirety. Certain embodiments are further described in the following examples. These embodiments are provided as examples only and are not intended to limit the scope of the claims in any way.
EXAMPLES
Example 1
Materials and Methods
[0168] This study was performed to identify individual microRNAs (miRNAs) isolated from maternal peripheral blood cells that can be used to distinguishing women destined to healthy pregnancies from women more likely to develop a placental bed disorder (e.g., preeclampsia). To enhance the number of patient samples derived from women who ultimately develop a placental bed disorder, a higher risk group (overweight (BMI≥25), black women) was selected from the sample collection for these studies. “Normal delivery” was defined as the delivery of a singleton, normal karyotype baby with the following pregnancy criteria: delivery at 38-42 weeks gestation, baby weight within the normal range for gestational age. Preeclampsia was defined according to the guidelines of the International Society for the Study of Hypertension in Pregnancy (Brown, et al. The classification and diagnosis of the hypertensive disorders of pregnancy: statement from the international society for the study of hypertension in pregnancy (ISSHP). Hypertens Pregnancy 2001). The study was a retrospective analysis using clinical data from patient charts and specimens frozen and stored as buffy coat.
[0169] Blood samples taken from nine pregnant women in their first trimester of pregnancy was retrospectively evaluated (three healthy women who developed healthy, full term deliveries and six women who developed one or more placental bed disorders, designated “compromised” (Table 2). MicroRNA was isolated according to the procedure given in said paper (Winger, et al. Peripheral blood cell microRNA quantification during the first trimester predicts preeclampsia: Proof of concept. PLoS One. 2018 Jan. 2; 13(1):e0190654), and then subsequently quantified by microarray quantification according to the manufacturer's direction (Human miRNA Microarray, Release 21.0, 8×60K, G4872A-07015 (Agilent Technologies) following labeling performed using miRNA Complete Labeling and Hyb Kit 5190-0456 (Agilent Technologies)). A total of 2,550 microRNAs were interrogated.
[0170] Means and standard deviations were calculated for each microRNA from patient samples with “healthy” outcomes and also “compromised” outcomes. To identify individual miRNAs useful for distinguishing the two populations, a “ratio” (“HC Ratio”) was calculated for each miRNA where the numerator comprises the difference between the mean value of the “compromised” population minus the mean value of the “healthy” population and the denominator comprises the average of the two standard deviations of the values for healthy and compromised individuals. The individual miRNAs identified with high ratios (≥1.3) are shown herein to discriminate between the two populations. The individual microRNAs identified with high ratios can be employed to discriminate between the two populations. To determine individual patient risk, the ROC curve's associated criterion value (cut-off point”) taken at the Youden J point can be used (as seen in Table 4). When the patient's microRNA signal level is above the cut-off point set at the Youden J point, the patient is deemed to be at “increased risk” of a developing a pregnancy disorder. The Youden J point is determined from ROC curve analysis using Medcalc® software (MedCalc Statistical Software version 18.10.2 (MedCalc Software bvba, Ostend, Belgium; http://www.medcalc.org; 2018) upon analysis of quantification of individual microRNA in patients developing healthy and compromised pregnancies. It is also understood that a plurality of microRNAs could be simultaneously analyzed to enhance predictive power. Of the 2,550 microRNAs that were interrogated in the patient population, the 100 microRNAs with the highest ratios (see the column labeled “HC Ratio”), i.e., those most useful for differentiating patients likely to experience a healthy outcome from those likely to experience a compromised outcome, are presented in Table 4. By this method of analysis, the miRNAs listed in Table 4 could be useful in differentiating between a woman predisposed to a healthy pregnancy outcome from one likely to experience a placental bed disorder.
[0171] The 100 miRNAs exhibiting the highest ratios (i.e., those listed in Table 4) were then subjected to a ROC curve analysis generating area under the curve (AUC) with their respective p values. From this, the clinical cut-offs were derived from the ROC statistics (Table 4). Individual ROC curve calculations on the nine patient samples described in Table 2 are shown in
[0172] As shown in Table 5, 20 microRNAs can be even further selected for clinical utility based on having a mean signal strength greater than 5.0 Ct signal units (more practical in a clinical setting), a microRNA demonstrating signal consistency (85% of patient samples demonstrate a measurable signal) as well as it is calculated ROC p value being less than or equal to 0.05. By using these additional selection criteria, 20 microRNAs from the original 100 were selected as being most clinically useful (Table 5), and therefore preferred. These miRNAs include hsa-miR-4485-5p (
Example 2
[0173] Significant differences in risk of compromised birth between Black women and non-Black women are well recognized. Other racial groups such as American Indian and Hispanic are recognized. There has been considerable speculation attributing cause to both environmental and genetic factors. However, most studies suggest environmental factors as more important. The identification of the association of select peripheral blood microRNAs with pregnancy compromise offers a new insight. MicroRNA are genetically determined but are also regulated in real time by physiologic requirements causing their expression to be related to both genetics and environment.
[0174] It is well recognized that studies that are undertaken to define risk categories for disease within diverse populations must account for differences in risk stratification between more homogenous subgroups within the overall population. Such stratification must take into consideration the selection of one or more biomarkers that best distinguish outcomes within the various subgroups. Further analysis of said biomarkers may also be affected by segregation of said subgroups. Moreover, distinction of additional or modifying features of the prediction may be linked to one or more subgroup and be less relevant or inapplicable in another subgroup. It is also understood that other relevant historical, clinical features, for example BMI, may be of particular relevance to the analysis of risk in one particular subgroup. Effectiveness of prediction of outcome, as well, may vary between subgroups and may, therefore, be clinically relevant to optimum outcome reporting. This study was performed to identify the differences in the expression of individual microRNAs between black and non-black pregnant women, although it is understood that such differences are exemplary of differences between subgroups for example, such as Asian or American Indian.
[0175] Microarray studies for microRNA were performed on blacks and on white patients comparing two groups of patients, those that suffered pregnancy compromise and those that had healthy pregnancies. The microarray study identifying differentially expressed microRNA was performed: MicroRNA was isolated according to the procedure given in paper (Winger E E, Reed J L, Ji X. First trimester pbmc microrna predicts adverse pregnancy outcome. Am J Reprod Immunol 2014, doi:10.1111/aji.12287), and then subsequently quantified by microarray according to the manufacturer's direction (Agilent's GeneSpring GX v11.5.1 URL: http://www.chem.agilent.com/en-US/Products-Services/Software Informatics/GeneSpring-GX/pages/default.aspx Last accessed 10/7/2012). A corresponding study was performed using Human miRNA Microarray, Release 21.0, 8×60K, G4872A-07015 (Agilent Technologies) following labeling performed using miRNA Complete Labeling and Hyb Kit 5190-0456 (Agilent Technologies)) on black patients. MicroRNA identified amongst black pregnant women that are differentially expressed between women who develop compromised pregnancies are compared with corresponding microRNA amongst non-black women. To identify individual miRNAs useful for distinguishing the two populations, a “ratio” (“HC Ratio”) was calculated for each miRNA where the numerator comprises the difference between the mean value of the “compromised” population minus the mean value of the “healthy” population and the denominator comprises the average of the two standard deviations of the values for healthy and compromised individuals. Means and standard deviations were calculated for each microRNA from patient samples with “healthy” outcomes and also “compromised” outcomes. The individual miRNAs identified with high ratios (≥1.5) are shown herein to discriminate between the two populations. The individual microRNAs identified with high ratios can be employed to discriminate between the two populations. The microarray used for the non-black population comprised approximately 850 microRNAs while the microarray used for the black population comprised 2550 microRNAs and the approximately 850 microRNAs in common were compared.
[0176] This study compares microRNAs that are differentially expressed in Black and non-Black women and ordering them by their relative degree of differential expression. Amongst microRNA that are differentially expressed in black women are microRNAs that are identified that are not differentially expressed amongst non-black women. Specimens from both black and non-black patients were analyzed by microarray. MicroRNAs (miRNAs) examined were isolated from maternal peripheral blood cells of pregnant women pregnant up to 13 weeks pregnant. “Healthy delivery” was defined as the delivery of a normal karyotype baby with none of the Great Obstetrical Syndromes present (preterm delivery, PROM, preeclampsia, fetal growth restriction, etc). The study was a retrospective analysis using frozen maternal blood samples and clinical data from patient charts.
[0177] Tables 6 and 7 display microRNAs that were interrogated on both microarrays; Table 8 displays the top 42 microRNAs (HC ratio >1.5) differentially expressed in non-Black patients; and, Table 9 displays the top 29 microRNAs (HC ratio >1.5) differentially expressed in Black patients. Amongst microRNA listed, a single microRNA (hsa-miR-590-5p) is amongst the most differentially expressed in both groups. These findings indicate the importance of selecting panels that incorporate microRNA that have been identified in patients of the same racial group as the patient.
TABLE-US-00001 TABLE 1 Figure No. and SEQ ID miRbase NO. microRNA Accession No. Sequence 1. hsa-miR-4667-3p MIMAT0019744 UCCCUCCUUCUGUCCCCACAG 2. hsa-miR-1267 MIMAT0005921 CCUGUUGAAGUGUAAUCCCCA 3. hsa-miR-7974 MIMAT0031177 AGGCUGUGAUGCUCUCCUGAGCCC 4. hsa-miR-563 MIMAT0003227 AGGUUGACAUACGUUUCCC 5. hsa-miR-3190-5p MIMAT0015073 UCUGGCCAGCUACGUCCCCA 6. hsa-miR-6792-3p MIMAT0027485 CUCCUCCACAGCCCCUGCUCAU 7. hsa-miR-98-3p MIMAT0022842 CUAUACAACUUACUACUUUCCC 8. hsa-miR-2116-3p MIMAT0011161 CCUCCCAUGCCAAGAACUCCC 9 hsa-miR-4310 MIMAT0016862 GCAGCAUUCAUGUCCC 10. hsa-miR-6737-3p MIMAT0027376 UCUGUGCUUCACCCCUACCCAG 11. hsa-miR-452-5p MIMAT0001635 AACUGUUUGCAGAGGAAACUGA 12. hsa-miR-5708 MIMAT0022502 AUGAGCGACUGUGCCUGACC 13. hsa-miR-580-3p MIMAT0003245 UUGAGAAUGAUGAAUCAUUAGG 14. hsa-miR-1238-3p MIMAT0005593 CUUCCUCGUCUGUCUGCCCC 15. hsa-miR-6782-3p MIMAT0027465 CACCUUUGUGUCCCCAUCCUGCA 16. hsa-miR-6889-3p MIMAT0027679 UCUGUGCCCCUACUUCCCAG 17. hsa-miR-4666b MIMAT0022485 UUGCAUGUCAGAUUGUAAUUCCC 18. hsa-miR-455-5p MIMAT0003150 UAUGUGCCUUUGGACUACAUCG 19. hsa-miR-4485-5p MIMAT0032116 ACCGCCUGCCCAGUGA 20. hsa-miR-149-5p MIMAT0000450 UCUGGCUCCGUGUCUUCACUCCC 21. hsa-miR-18b-3p MIMAT0004751 UGCCCUAAAUGCCCCUUCUGGC 22. hsa-miR-1537-5p MIMAT0026765 AGCUGUAAUUAGUCAGUUUUCU 23. hsa-miR-1539 MIMAT0007401 UCCUGCGCGUCCCAGAUGCCC 24. hsa-miR-23c MIMAT0018000 AUCACAUUGCCAGUGAUUACCC 25. hsa-miR-3611 MIMAT0017988 UUGUGAAGAAAGAAAUUCUUA 26. hsa-miR-19a-5p MIMAT0004490 AGUUUUGCAUAGUUGCACUACA 27. hsa-miR-6819-3p MIMAT0027539 AAGCCUCUGUCCCCACCCCAG 28. hsa-miR-1237-3p MIMAT0005592 UCCUUCUGCUCCGUCCCCCAG 29. hsa-miR-153-3p MIMAT0000439 UUGCAUAGUCACAAAAGUGAUC 30. hsa-miR-6730-3p MIMAT0027362 CCUGACACCCCAUCUGCCCUCA 31. hsa-miR-6799-3p MIMAT0027499 UGCCCUGCAUGGUGUCCCCACAG 32. hsa-miR-190a-5p MIMAT0000458 UGAUAUGUUUGAUAUAUUAGGU 33. hsa-miR-144-3p MIMAT0000436 UACAGUAUAGAUGAUGUACU 34. hsa-miR-548a-5p MIMAT0004803 AAAAGUAAUUGCGAGUUUUACC 35. hsa-miR-548ai MIMAT0018989 AAAGGUAAUUGCAGUUUUUCCC 36. hsa-miR-1973 MIMAT0009448 ACCGUGCAAAGGUAGCAUA 37. hsa-miR-6890-3p MIMAT002768 CCACUGCCUAUGCCCCACAG 38. hsa-miR-6757-3p MIMAT0027415 AACACUGGCCUUGCUAUCCCCA 39. hsa-miR-4312 MIMAT0016864 GGCCUUGUUCCUGUCCCCA 40. hsa-miR-6752-3p MIMAT0027405 UCCCUGCCCCCAUACUCCCAG 41. hsa-miR-32-5p MIMAT0000090 UAUUGCACAUUACUAAGUUGCA 42. hsa-miR-186-3p MIMAT0004612 GCCCAAAGGUGAAUUUUUUGGG 43. hsa-miR-1236-3p MIMAT0005591 CCUCUUCCCCUUGUCUCUCCAG 44. hsa-miR-4731-3p MIMAT0019854 CACACAAGUGGCCCCCAACACU 45. hsa-miR-33b-5p MIMAT0003301 GUGCAUUGCUGUUGCAUUGC 46. hsa-miR-6812-3p MIMAT0027525 CCGCUCUUCCCCUGACCCCAG 47. hsa-miR-4536-5p MIMAT0019078 UGUGGUAGAUAUAUGCACGAU 48. hsa-miR-301a-3p MIMAT0000688 CAGUGCAAUAGUAUUGUCAAAGC 49. hsa-miR-6763-3p MIMAT0027427 CUCCCCGGCCUCUGCCCCCAG 50. hsa-miR-624-3p MIMAT0004807 CACAAGGUAUUGGUAUUACCU 51. hsa-miR-590-5p MIMAT0003258 GAGCUUAUUCAUAAAAGUGCAG 52. hsa-miR-191-3p MIMAT0001618 GCUGCGCUUGGAUUUCGUCCCC 53. hsa-miR-24-1-5p MIMAT0000079 UGCCUACUGAGCUGAUAUCAGU 54. hsa-miR-144-5p MIMAT0004600 GGAUAUCAUCAUAUACUGUAAG 55. hsa-miR-6870-3p MIMAT0027641 GCUCAUCCCCAUCUCCUUUCAG 56. hsa-miR-33a-5p MIMAT0004506 CAAUGUUUCCACAGUGCAUCAC 57. hsa-miR-545-3p MIMAT0003165 UCAGCAAACAUUUAUUGUGUGC 58. hsa-miR-19a-3p MIMAT0000073 UGUGCAAAUCUAUGCAAAACUGA 59. hsa-miR-6515-3p MIMAT0025487 UCUCUUCAUCUACCCCCCAG 60. hsa-miR-551b-3p MIMAT0003233 GCGACCCAUACUUGGUUUCAG 61. hsa-miR-3679-3p MIMAT0018105 CUUCCCCCCAGUAAUCUUCAUC 62. hsa-miR-141-3p MIMAT0000432 UAACACUGUCUGGUAAAGAUGG 63. hsa-miR-557 MIMAT0003221 GUUUGCACGGGUGGGCCUUGUCU 64. hsa-miR-6766-3p MIMAT0027433 UGAUUGUCUUCCCCCACCCUCA 65. hsa-miR-101-3p MIMAT0000099 UACAGUACUGUGAUAACUGAA 66. hsa-miR-1307-5p MIMAT0022727 UCGACCGGACCUCGACCGGCU 67. hsa-miR-219a-5p MIMAT0000276 UGAUUGUCCAAACGCAAUUCU 68. hsa-miR-340-5p MIMAT0004692 UUAUAAAGCAAUGAGACUGAUU 69. hsa-miR-628-5p MIMAT0004809 AUGCUGACAUAUUUACUAGAGG 70. hsa-miR-511-3p MIMAT0026606 AAUGUGUAGCAAAAGACAGA 71. hsa-miR-192-5p MIMAT0000222 CUGACCUAUGAAUUGACAGCC 72. hsa-miR-362-3p MIMAT0004683 AACACACCUAUUCAAGGAUUCA 73. hsa-miR-4433a-5p MIMAT0020956 CGUCCCACCCCCCACUCCUGU 74. hsa-miR-4500 MIMAT0019036 UGAGGUAGUAGUUUCUU 75. hsa-miR-6820-3p MIMAT0027541 UGUGACUUCUCCCCUGCCACAG 76. hsa-miR-493-3p MIMAT0003161 UGAAGGUCUACUGUGUGCCAGG 77. hsa-miR-1537-3p MIMAT0007399 AAAACCGUCUAGUUACAGUUGU 78. hsa-miR-193a-3p MIMAT0000459 AACUGGCCUACAAAGUCCCAGU 79. hsa-miR-6795-3p MIMAT0027491 ACCCCUCGUUUCUUCCCCCAG 80. hsa-miR-18b-5p MIMAT0001412 UAAGGUGCAUCUAGUGCAGUUAG 81. hsa-miR-224-5p MIMAT0000281 UCAAGUCACUAGUGGUUCCGUUUAG 82. hsa-miR-132-3p MIMAT0000426 UAACAGUCUACAGCCAUGGUCG 83. hsa-miR-570-3p MIMAT0003235 CGAAAACAGCAAUUACCUUUGC 84. hsa-miR-6511b-3p MIMAT0025848 CCUCACCACCCCUUCUGCCUGCA 85. hsa-miR-6818-5p MIMAT0027536 UUGUGUGAGUACAGAGAGCAUC 86. hsa-miR-7-5p MIMAT0000252 UGGAAGACUAGUGAUUUUGUUGUU 87. hsa-miR-4536-3p MIMAT0020959 UCGUGCAUAUAUCUACCACAU 88. hsa-miR-129-1-3p MIMAT0004548 AAGCCCUUACCCCAAAAAGUAU 89. hsa-miR-215-5p MIMAT0000272 AUGACCUAUGAAUUGACAGAC 90. hsa-miR-3938 MIMAT0000272 AUGACCUAUGAAUUGACAGAC 91. hsa-miR-6855-3p MIMAT0027611 AGACUGACCUUCAACCCCACAG 92. hsa-miR-224-3p MIMAT0009198 AAAAUGGUGCCCUAGUGACUACA 93. hsa-miR-4737 MIMAT0019863 AUGCGAGGAUGCUGACAGUG 94. hsa-miR-582-3p MIMAT0004797 UAACUGGUUGAACAACUGAACC 95. hsa-miR-30d-3p MIMAT0004551 CUUUCAGUCAGAUGUUUGCUGC 96. hsa-miR-6796-3p MIMAT0027493 GAAGCUCUCCCCUCCCCGCAG 97. hsa-miR-429 MIMAT0001536 UAAUACUGUCUGGUAAAACCGU 98. hsa-miR-542-3p MIMAT0003389 UGUGACAGAUUGAUAACUGAAA 99. hsa-miR-185-5p MIMAT0000455 UGGAGAGAAAGGCAGUUCCUGA 100. hsa-miR-296-5p MIMAT0000690 AGGGCCCCCCCUCAAUCCUGU
TABLE-US-00002 TABLE 2 Study Population Details Gest age GA at Patient Outcome Maternal sample delivery Birthweight Delivery No. Group Race BMI age (weeks) (weeks) (g) method Pregnancy outcome description 1 Healthy Black 26.7 41.3 12.6 39.5 2900 Vaginal Full term healthy 2 Healthy Black 29.7 28.8 12.1 39.1 3030 Vaginal Full term healthy 3 Healthy Black 44.4 32.5 13.0 39.3 2835 CS Full term healthy 4 Compromised Black 28.4 35.6 12.6 26.4 540 Vaginal Early Preterm/IUGR/hypertension 5 Compromised Black 31.1 36.0 12.3 31.8 1410 CS Preterm/Preeclampsia 6 Compromised Black 36.3 34.3 12.9 26.7 560 CS Early Preterm/Preeclampsia 7 Compromised Black 32.0 31.9 13.0 30.0 1510 CS Preterm/IUGR/Preeclampsia 8 Compromised Black 32.9 33.0 13.3 34.5 1900 CS Late preterm/Preeclampsia 9 Compromised Black 47.8 42.6 12.7 38.0 3175 Vaginal Preeclampsia
TABLE-US-00003 TABLE 3 Highest 100 of 2550 total microRNAs for pregnancy outcome prediction when ordered by “HC Ratio” HC Ratio Mean SD Mean SD “HC Ratio” rank microRNAS “Healthy” “Healthy” “Compromised” “Compromised” As defined in text 1 hsa-miR-4667-3p 1.69967E−17 2.921418333 0.70222368 8.03566844 2 hsa-miR-1267 1.008133333 1.572933073 3.68654 0.45782467 2.637839673 3 hsa-miR-7974 4.938236667 0.126869462 6.159503333 0.82861759 2.556322799 4 hsa-miR-563 3.49112 0.463551785 4.97324 0.76571625 2.41138623 5 hsa-miR-3190-5p 4.28965 0.396091948 5.57967 0.6945583 2.365597951 6 hsa-miR-6792-3p 0.1 1.69967E−17 3.28381 2.72106547 2.340120098 7 hsa-miR-98-3p 4.338323333 0.352742492 5.512695 0.69139905 2.249449175 8 hsa-miR-2116-3p 5.2862 0.169996 6.511626667 0.92839498 2.231311245 9 hsa-miR-4310 4.52717 0.147006307 5.63758 0.86477875 2.194952365 10 hsa-miR-6737-3p 8.83046 0.159880835 11.147815 1.95595037 2.19049137 11 hsa-miR-452-5p 0.1 1.69967E−17 3.464421667 3.210483 2.09589751 12 hsa-miR-5708 0.1 1.69967E−17 1.959751667 1.77873403 2.091095838 13 hsa-miR-580-3p 0.1 1.69967E−17 2.18256 2.01747067 2.064525679 14 hsa-miR-1238-3p 9.021943333 0.429051319 12.01917333 2.47908222 2.061273985 15 hsa-miR-6782-3p 0.1 1.69967E−17 1.801978333 1.65522107 2.0564967 16 hsa-miR-6889-3p 6.058526667 0.46501968 9.896811667 3.32100891 2.027604871 17 hsa-miR-4666b 3.71349 0.405760837 4.885313333 0.76662344 1.999043072 18 hsa-miR-455-5p 0.1 1.69967E−17 3.704496667 3.79049687 1.901859724 19 hsa-miR-4485-5p 132.6049 71.08679799 310.85 117.384379 1.891483913 20 hsa-miR-149-5p 5.636273333 0.432960931 6.99795 1.00819351 1.889702632 21 hsa-miR-18b-3p 1.635136667 0.247680244 6.011409833 4.46898353 1.855664672 22 hsa-miR-1537-5p 0.1 1.69967E−17 2.5651 2.689866 1.832879404 23 hsa-miR-1539 5.78433 0.309926023 7.177101667 1.21314495 1.82889923 24 hsa-miR-23c) 4.53688 0.667686008 5.913703333 0.84939152 1.815099507 25 hsa-miR-3611 0.1 1.69967E−17 1.912273 2.01617178 1.797736701 26 hsa-miR-19a-5p 0.3 1.69967E−17 1.842585 1.94062663 1.795899293 27 hsa-miR-6819-3p 12.3876 2.114597808 16.49063333 2.5153603 1.772384645 28 hsa-miR-1237-3p 7.054016667 0.952082468 11.07480167 3.58767444 1.771365774 29 hsa-miR-153-3p 4.334793333 2.731902007 39.44348333 37.1079574 1.762490655 30 hsa-miR-6730-3p 0.662566667 0.974394049 1.916648333 0.45421843 1.755663877 31 hsa-miR-6799-3p 0.46066 0.624681444 2.231805 1.39411326 1.754655881 32 hsa-miR-190a-5p 0.608143333 0.880130071 14.27126 14.7878403 1.744082523 33 hsa-miR-144-3p 1298.11 330.7328376 11483.13827 11487.3513 1.723634416 34 hsa-miR-548a-5p 1.354784667 1.53352604 9.410058333 7.95233929 1.698374031 35 hsa-miR-548ai 2.884053333 1.032339303 4.389983333 0.77413207 1.667261408 36 hsa-miR-1973 50.4969 14.60525503 142.2370167 95.8935892 1.660471968 37 hsa-miR-6890-3p 2.734863333 0.924183018 4.35106 1.02410112 1.659097499 38 hsa-miR-6757-3p 4.530083333 0.538716917 5.401475 0.51310608 1.656916925 39 hsa-miR-4312 4.70808 0.435499719 5.433713333 0.44064162 1.656429848 40 hsa-miR-6752-3p 6.560426667 0.733869516 10.52659333 4.07578 1.649253924 41 hsa-miR-32-5p 54.08236667 23.1695305 401.5129867 400.636334 1.639574387 42 hsa-miR-186-3p 2.292743333 1.932088862 8.987733333 6.36105382 1.614584544 43 hsa-miR-1236-3p 0.33838 0.412886272 1.239636167 0.70910822 1.606525124 44 hsa-miR-4731-3p 6.37425 0.795853779 11.59989167 5.73023616 1.601461738 45 hsa-miR-33b-5p 1.265056667 0.270845728 8.21405 8.41768885 1.599577759 46 hsa-miR-6812-3p 6.012563333 0.229255299 6.987688333 1.0002955 1.586148374 47 hsa-miR-4536-5p 1.2025 1.909586015 7.073131667 5.55740518 1.572422283 48 hsa-miR-301a-3p 372.5503333 200.0696713 1408.8466 1121.46497 1.568322515 49 hsa-miR-6763-3p 6.88932 0.443185623 9.205628333 2.52398127 1.561292922 50 hsa-miR-624-3p 0.50149 0.695401079 3.68011 3.38081587 1.559593144 51 hsa-miR-590-5p 580.1496667 173.8663976 2564.739083 2375.11247 1.557164275 52 hsa-miR-191-3p 6.86531 0.503358084 8.409831667 1.50266792 1.539882003 53 hsa-miR-24-1-5p 8.011073333 4.359646972 23.77916667 16.2098569 1.533152517 54 hsa-miR-144-5p 313.3803333 34.05615675 1573.889435 1614.13761 1.529564213 55 hsa-miR-6870-3p 2.65772 0.304536442 3.78178 1.18921362 1.505017508 56 hsa-miR-33a-5p 34.4442 5.488232636 229.42731 254.902566 1.497619047 57 hsa-miR-545-3p 9.49608 2.191042657 76.41257667 87.5185556 1.491846981 58 hsa-miR-19a-3p 3543.693333 2022.001224 12238.33 9679.30762 1.486096433 59 hsa-miR-6515-3p 14.69083333 2.019418957 27.81725 15.6821394 1.483080349 60 hsa-miR-551b-3p 44.84363333 17.70072778 117.1408817 80.3348909 1.47491798 61 hsa-miR-3679-3p 3.26927 0.569178204 6.161103333 3.36859158 1.468767091 62 hsa-miR-141-3p 82.59723333 29.12215089 313.6674983 286.737779 1.463118572 63 hsa-miR-57 18.01196667 2.037168764 27.32418333 10.775192 1.453630105 64 hsa-miR-6766-3p 15.16513333 2.161954635 30.97665 19.6255027 1.451432945 65 hsa-miR-101-3p 2065.382 1232.120833 7598.8324 6393.9367 1.451195556 66 hsa-miR-1307-5p 20.78453333 6.296871135 101.0276083 105.044696 1.441385763 67 hsa-miR-219a-5p 23.20546667 5.711069074 136.329095 151.637616 1.437871928 68 hsa-miR-340-5p 448.0383333 415.4182768 2036.804233 1794.69523 1.43772335 69 hsa-miR-628-5p 45.10693333 18.46749203 106.8210867 68.0953505 1.425880932 70 hsa-miR-511-3p 1.104676667 1.740151032 5.931936667 5.07084829 1.417489497 71 hsa-miR-192-5p 606.7603333 183.9095684 1559.788383 1162.92526 1.415211475 72 hsa-miR-362-3p 167.9153 137.3451969 700.0321633 616.253632 1.412201938 73 hsa-miR-4433a-5p 10.3186 2.218691659 18.46181 9.32513846 1.410833305 74 hsa-miR-4500 26.9959 9.476285203 67.66748333 48.4265557 1.404821688 75 hsa-miR-6820-3p 1.636303333 1.545653337 3.763788333 1.49772002 1.398109763 76 hsa-miR-493-3p 1.751764333 1.205591668 4.331805 2.48549385 1.397984767 77 hsa-miR-1537-3p 11.27185667 7.40202723 63.11434667 67.0489448 1.392661199 78 hsa-miR-193a-3p 37.70363333 32.35906733 210.8888167 216.635214 1.391077597 79 hsa-miR-6795-3p 5.229593333 0.829126258 6.916591667 1.60125006 1.388261006 80 hsa-miR-18b-5p 260.0956667 143.133025 689.5827017 478.764787 1.38121417 81 hsa-miR-224-5p 19.39166667 15.47241798 64.07994 49.3073497 1.379698475 82 hsa-miR-132-3p 206.0874667 117.5854325 963.7525167 995.815374 1.360992458 83 hsa-miR-570-3p 1.296396667 1.157593328 5.655508333 5.25449814 1.359653613 84 hsa-miR-6511b-3p 1.502336667 0.15370865 2.84531 1.83046516 1.353685171 85 hsa-miR-6818-5p 0.595313333 0.857907859 2.907853333 2.57244576 1.348280822 86 hsa-miR-7-5p 450.8163333 230.8243714 1296.67215 1030.42698 1.341296195 87 hsa-miR-4536-3p 0.62789 0.914332301 3.240696667 2.98703416 1.339431553 88 hsa-miR-129-1-3p 1.873213333 0.429905162 3.094061667 1.39484975 1.338095678 89 hsa-miR-215-5p 256.0586667 105.6448574 671.596775 519.302315 1.32983435 90 hsa-miR-3938 2.403593333 2.007857111 5.358258333 2.44447862 1.327242677 91 hsa-miR-6855-3p 4.57854 0.247212002 5.563731667 1.23788348 1.326772155 92 hsa-miR-224-3p 0.777633333 1.173695362 4.504228333 4.45302874 1.324605554 93 hsa-miR-4737 3.253623333 2.756743341 11.17801667 9.26072979 1.318811908 94 hsa-miR-582-3p 5.582066667 3.783831914 20.018295 18.1995889 1.313374152 95 hsa-miR-30d-3p 12.78553333 8.46129791 39.27953333 32.0726978 1.307248374 96 hsa-miR-6796-3p 2.568876667 0.358399446 3.865031667 1.62796286 1.305053965 97 hsa-miR-429 2.866653333 4.79198414 15.9349 15.2582056 1.303553417 98 hsa-miR-542-3p 34.54686667 24.16941101 117.97395 104.441288 1.297358366 99 hsa-miR-185-5p 1269.566333 585.6775049 3061.071667 2177.344 1.296772629 100 hsa-miR-296-5p 15.18166667 3.465018397 29.16081667 18.2934398 1.284939388
TABLE-US-00004 TABLE 4 Top 100 microRNAs for pregnancy outcome prediction when ordered by Ratio, with ROC statistics and p values added Area under the HC ROC 95% Associated Ratio Sample Positive Negative curve Confidence p Youden criterion* Sensi- Speci- Rank microRNA Ratio size group group (AUC) interval value index J (“cut-off”) tivity ficity #1 hsa_miR.467_3p 8.03 9 6 3 1 0.664 to <0.0001 1 >0.1 100 100 (66.67 (33.33%) 1.000 #2 hsa_miR_1267 2.64 9 6 3 1 0.664 to <0.0001 1 >2.8244 100 100 (66.67 (33.33%) 1.000 #3 hsa_miR_7974 2.56 9 6 3 0.833 0.456 to 0.0455 0.8333 >5.06652 83.33 100 (66.67 (33.33%) 0.988 #4 hsa_miR_563 2.41 9 6 3 0.889 0.518 to 0.0017 0.8333 >3.85474 83.33 100 (66.67 (33.33%) 0.997 #5 hsa_miR_3190_5p 2.37 9 6 3 1 0.664 to <0.0001 1 >4.72164 100 100 (66.67 (33.33%) 1.000 #6 hsa_miR_6792_3p 2.34 9 6 3 0.833 0.456 to 0.0016 0.6667 >0.1 66.67 100 (66.67 (33.33%) 0.988 #7 hsa_miR_98_3p 2.25 9 6 3 0.944 0.586 to <0.0001 0.8333 >4.54887 83.33 100 (66.67 (33.33%) 1.000 #8 hsa_miR_2116_3p 2.23 9 6 3 0.833 0.456 to 0.0455 0.8333 >5.46474 83.33 100 (66.67 (33.33%) 0.988 #9 hsa_miR_4310 2.19 9 6 3 0.833 0.456 to 0.0455 0.8333 >4.66386 83.33 100 (66.67 (33.33%) 0.988 #10 hsa_miR_6737_3p 2.19 9 6 3 0.833 0.456 to 0.0455 0.8333 >8.93997 83.33 100 (66.67 (33.33%) 0.988 #11 hsa_miR_452_5p 2.09 9 6 3 0.833 0.456 to 0.0016 0.6667 >0.1 66.67 100 (66.67 (33.33%) 0.988 #12 hsa_miR_5708 2.09 9 6 3 0.833 0.456 to 0.0016 0.6667 >0.1 66.67 100 (66.67 (33.33%) 0.988 #13 hsa_miR_580_3p 2.06 9 6 3 0.833 0.456 to 0.0016 0.6667 >0.1 66.67 100 (66.67 (33.33%) 0.988 #14 hsa_miR_1238_3p 2.06 9 6 3 0.944 0.586 to <0.0001 0.8333 >9.48021 83.33 100 (66.67 (33.33%) 1.000 #15 hsa_miR_6782_3p 2.06 9 6 3 0.833 0.456 to 0.0016 0.6667 >0.1 66.67 100 (66.67 (33.33%) 0.988 #16 hsa_miR_6889_3p 2.03 9 6 3 0.889 0.518 to 0.0017 0.8333 >6.49722 83.33 100 (66.67 (33.33%) 0.997 #17 hsa_miR_4666b 2 9 6 3 0.889 0.518 to 0.0017 0.8333 >4.03738 83.33 100 (66.67 (33.33%) 0.997 #18 hsa_miR_455_5p 1.9 9 6 3 0.833 0.456 to 0.0016 0.6667 >0.1 66.67 100 (66.67 (33.33%) 0.988 #19 hsa_miR_4485_5p 1.89 9 6 3 0.944 0.586 to <0.0001 0.8333 >210.413 83.33 100 (66.67 (33.33%) 1.000 #20 hsa_miR_149_5p 1.89 9 6 3 0.944 0.586 to <0.0001 0.8333 >6.112 83.33 100 (66.67 (33.33%) 1.000 #21 hsa_miR_18b_3p 1.855 9 6 3 0.667 0.299 to 0.4292 0.6667 >1.83012 66.67 100 (66.67 (33.33%) 0.925 #22 hsa_miR_1537_3p 1.833 9 6 3 0.667 0.299 to 0.4292 0.6667 >19.807 66.67 100 (66.67 (33.33%) 0.925 #23 hsa_miR_1539 1.829 9 6 3 0.833 0.456 to 0.0455 0.8333 >5.98969 83.33 100 (66.67 (33.33%) 0.988 #24 hsa_miR_23c 1.815 9 6 3 0.889 0.518 to 0.0017 0.8333 >4.97451 83.33 100 (66.67 (33.33%) 0.997 #25 hsa_miR_3611 1.798 9 6 3 0.833 0.456 to 0.0016 0.6667 >0.1 66.67 100 (66.67 (33.33%) 0.988 #26 hsa_miR.19a_5p 1.795 9 6 3 0.833 0.456 to 0.0016 0.6667 >0.1 66.67 100 (66.67 (33.33%) 0.988 #27 hsa_miR_6819_3p 1.772 9 6 3 0.889 0.518 to 0.0031 0.6667 >11.4673 100 66.67 (66.67 (33.33%) 0.997 #28 hsa_miR_1237_3p 1.771 9 6 3 0.889 0.518 to 0.0031 0.6667 >6.70602 100 66.67 (66.67 (33.33%) 0.997 #29 hsa_miR_153_3p 1.762 9 6 3 0.667 0.299 to 0.4292 0.6667 >7.23145 66.67 100 (66.67 (33.33%) 0.925 #30 hsa_miR_6730_3p 1.756 9 6 3 0.889 0.518 to 0.0031 0.6667 >0.1 100 66.67 (66.67 (33.33%) 0.997 #31 hsa_miR_6799_3p 1.755 9 6 3 0.889 0.518 to 0.0007 0.8333 >1.18198 83.33 100 (66.67 (33.33%) 0.997 #32 hsa_miR_190a_5p 1.744 9 6 3 0.778 0.400 to 0.0661 0.6667 >1.62443 66.67 100 (66.67 (33.33%) 0.972 #33 hsa_miR_144_3p 1.724 9 6 3 0.667 0.299 to 0.4292 0.6667 >1670.41 66.67 100 (66.67 (33.33%) 0.925 #34 hsa_miR_548a_5p 1.698 9 6 3 0.722 0.348 to 0.2278 0.6667 >3.06423 66.67 100 (66.67 (33.33%) 0.951 #35 hsa_miR_548ai 1.667 9 6 3 0.889 0.518 to 0.0017 0.8333 >3.48845 83.33 100 (66.67 (33.33%) 0.997 #36 hsa_miR_1973 1.66 9 6 3 0.722 0.348 to 0.2402 0.6667 >63.8822 66.67 100 (66.67 (33.33%) 0.951 #37 hsa_miR_6890_3p 1.659 9 6 3 0.889 0.518 to 0.0017 0.8333 >3.35134 83.33 100 (66.67 (33.33%) 0.997 #38 hsa_miR_6752_3p 1.657 9 6 3 0.833 0.456 to 0.0455 0.8333 >7.34944 83.33 100 (66.67 (33.33%) 0.988 #39 hsa_miR_4312 1.656 9 6 3 0.889 0.518 to 0.0031 0.6667 >4.50549 100 66.67 (66.67 (33.33%) 0.997 #40 hsa_miR_6757_3p 1.649 9 6 3 0.889 0.518 to 0.0031 0.6667 >4.66345 100 66.67 (66.67 (33.33%) 0.997 #41 hsa_miR_32_5p 1.64 9 6 3 0.667 0.299 to 0.4292 0.6667 >75.5787 66.67 100 (66.67 (33.33%) 0.925 #42 hsa_miR_186_3p 1.61 9 6 3 0.861 0.486 to 0.0108 0.8333 >3.74531 83.33 100 (66.67 (33.33%) 0.993 #43 hsa_miR_1236_3p 1.61 9 6 3 0.889 0.518 to 0.0007 0.8333 >0.81514 83.33 100 (66.67 (33.33%) 0.997 #44 hsa_miR_4731_3p 1.6 9 6 3 0.667 0.299 to 0.4292 0.6667 >7.22224 66.67 100 (66.67 (33.33%) 0.925 #45 hsa_miR33b_5p 1.6 9 6 3 0.667 0.299 to 0.4292 0.6667 >1.57673 66.67 100 (66.67 (33.33%) 0.925 #46 hsa_miR_6812_3p 1.59 9 6 3 0.778 0.400 to 0.1102 0.6667 >6.24426 66.67 100 (66.67 (33.33%) 0.972 #47 hsa_miR_4536_3p 1.57 9 6 3 0.778 0.400 to 0.0661 0.6667 >1.68367 66.67 100 (66.67 (33.33%) 0.972 #48 hsa_miR_301a_3p 1.57 9 6 3 0.778 0.400 to 0.1102 0.6667 >601.907 66.67 100 (66.67 (33.33%) 0.972 #49 hsa_miR_6763_3p 1.56 9 6 3 0.778 0.400 to 0.1102 0.6667 >7.35826 66.67 100 (66.67 (33.33%) 0.972 #50 hsa_miR_624_3p 1.56 9 6 3 0.778 0.400 to 0.0661 0.6667 >1.30447 66.67 100 (66.67 (33.33%) 0.972 #51 hsa_miR_590_5p 1.557164 9 6 3 0.667 0.299 to 0.4292 0.6667 >770.79 66.67 100 (66.67 (33.33%) 0.925 #52 hsa_miR_191_3p 1.539882 9 6 3 0.833 0.456 to 0.0455 0.8333 >7.44412 83.33 100 (66.67 (33.33%) 0.988 #53 hsa_miR_24_1_5p 1.533153 9 6 3 0.833 0.456 to 0.0455 0.8333 >12.6289 83.33 100 (66.67 (33.33%) 0.988 #54 hsa_miR_144_5p 1.529564 9 6 3 0.667 0.299 to 0.4292 0.6667 >352.682 66.67 100 (66.67 (33.33%) 0.925 #55 hsa_miR_6870_3p 1.505018 9 6 3 0.833 0.456 to 0.0253 0.6667 >3.0069 66.67 100 (66.67 (33.33%) 0.988 #56 hsa_miR_33a_5p 1.497619 9 6 3 0.667 0.299 to 0.4292 0.6667 >40.7681 66.67 100 (66.67 (33.33%) 0.925 #57 hsa_miR_545_3p 1.491847 9 6 3 0.667 0.299 to 0.4292 0.6667 >12.0259 66.67 100 (66.67 (33.33%) 0.925 #58 hsa_miR_19a_3p 1.486096 9 6 3 0.667 0.299 to 0.4292 0.6667 >5526.07 66.67 100 (66.67 (33.33%) 0.925 #59 hsa_miR_6515_3p 1.48308 9 6 3 0.722 0.348 to 0.2402 0.6667 >16.127 66.67 100 (66.67 (33.33%) 0.951 #60 hsa_miR_551b_3p 1.474918 9 6 3 0.833 0.456 to 0.0455 0.8333 >62.7273 83.33 100 (66.67 (33.33%) 0.988 #61 hsa_miR_3679_3p 1.468767 9 6 3 0.667 0.299 to 0.4292 0.6667 >3.88047 66.67 100 (66.67 (33.33%) 0.925 #62 hsa_miR_141_3p 1.463119 9 6 3 0.722 0.348 to 0.2402 0.6667 >114.69 66.67 100 (66.67 (33.33%) 0.951 #63 hsa_miR_557 1.45363 9 6 3 0.778 0.400 to 0.1102 0.6667 >20.1291 66.67 100 (66.67 (33.33%) 0.972 #64 hsa_miR_6766_3p 1.451433 9 6 3 0.667 0.299 to 0.4292 0.6667 >16.6197 66.67 100 (66.67 (33.33%) 0.925 #65 hsa_miR_101_3p 1.451196 9 6 3 0.667 0.299 to 0.4292 0.6667 >3175.93 66.67 100 (66.67 (33.33%) 0.925 #66 hsa_miR_1307_5p 1.441386 9 6 3 0.778 0.400 to 0.1102 0.6667 >27.6972 66.67 100 (66.67 (33.33%) 0.972 #67 hsa_miR_219a_5p 1.437872 9 6 3 0.667 0.299 to 0.4292 0.6667 >27.81 66.67 100 (66.67 (33.33%) 0.925 #68 hsa_miR_340_5p 1.437723 9 6 3 0.667 0.299 to 0.4292 0.6667 >922.362 66.67 100 (66.67 (33.33%) 0.925 #69 hsa_miR_628_5p 1.425881 9 6 3 0.778 0.400 to 0.1102 0.6667 >66.4284 66.67 100 (66.67 (33.33%) 0.972 #70 hsa_miR_511_3p 1.417489 9 6 3 0.778 0.400 to 0.0661 0.6667 >3.11403 66.67 100 (66.67 (33.33%) 0.972 #71 hsa_miR_192_5p 1.415211 9 6 3 0.667 0.299 to 0.4292 0.6667 >768.06 66.67 100 (66.67 (33.33%) 0.925 #72 hsa_miR_362_3p 1.412202 9 6 3 0.667 0.299 to 0.4292 0.6667 >326.167 66.67 100 (66.67 (33.33%) 0.925 #73 hsa_miR_4433a_5p 1.410833 9 6 3 0.778 0.400 to 0.1102 0.6667 >12.7101 66.67 100 (66.67 (33.33%) 0.972 #74 hsa_miR_4500 1.404822 9 6 3 0.722 0.348 to 0.2402 0.6667 >35.1259 66.67 100 (66.67 (33.33%) 0.951 #75 hsa_miR_6820_5p 0.48145 9 6 3 0.611 0.254 to 0.6726 0.3333 >16.9729 100 33.33 (66.67 (33.33%) 0.896 #76 hsa_miR_493_3p 1.397985 9 6 3 0.833 0.456 to 0.0253 0.6667 >3.14076 66.67 100 (66.67 (33.33%) 0.988 #77 hsa_miR_1537_3p 1.392661 9 6 3 0.667 0.299 to 0.4292 0.6667 >19.807 66.67 100 (66.67 (33.33%) 0.925 #78 hsa_miR_193a_3p 1.391078 9 6 3 0.722 0.348 to 0.2402 0.6667 >74.3609 66.67 100 (66.67 (33.33%) 0.951 #79 hsa_miR_6795_3p 1.388261 9 6 3 0.833 0.456 to 0.0253 0.6667 >6.14139 66.67 100 (66.67 (33.33%) 0.988 #80 hsa_miR_18b_5p 1.381214 9 6 3 0.778 0.400 to 0.1102 0.6667 >425.259 66.67 100 (66.67 (33.33%) 0.972 #81 hsa_miR_224_5p 1.379698 9 6 3 0.778 0.400 to 0.1102 0.6667 >37.2526 66.67 100 (66.67 (33.33%) 0.972 #82 hsa_miR_132_3p 1.360992 9 6 3 0.722 0.348 to 0.2402 0.6667 >301.68 66.67 100 (66.67 (33.33%) 0.951 #83 hsa_miR_570_3p 1.359654 9 6 3 0.722 0.348 to 0.2278 0.6667 >2.41083 66.67 100 (66.67 (33.33%) 0.95 #84 hsa_miR_651b_3p 1.353685 9 6 3 0.833 0.456 to 0.0455 0.8333 >1.65773 83.33 100 (66.67 (33.33%) 0.988 #85 hsa_miR_6818_5p 1.348281 9 6 3 0.778 0.400 to 0.0661 0.6667 >1.58594 66.67 100 (66.67 (33.33%) 0.972 #86 hsa_miR_7_5p 1.341296 9 6 3 0.667 0.299 to 0.4292 0.6667 >703.504 66.67 100 (66.67 (33.33%) 0.925 #87 hsa_miR_4536_3p 1.339432 9 6 3 0.778 0.400 to 0.0661 0.6667 >1.68367 66.67 100 (66.67 (33.33%) 0.972 #88 hsa_miR_129_1_3p 1.338096 9 6 3 0.778 0.400 to 0.121 0.6667 >2.34617 66.67 100 (66.67 (33.33%) 0.972 #89 hsa_miR_215_5p 1.329834 9 6 3 0.667 0.299 to 0.4292 0.6667 >342.911 66.67 100 (66.67 (33.33%) 0.925 #90 hsa_miR_3938 1.327243 9 6 3 0.889 0.518 to 0.0017 0.8333 >3.78251 83.33 100 (66.67 (33.33%) 0.997 #91 hsa_miR_6855_3p 1.326772 9 6 3 0.667 0.299 to 0.4292 0.6667 >4.85022 66.67 100 (66.67 (33.33%) 0.925 #92 hsa_miR_224_3p 1.324606 9 6 3 0.833 0.456 to 0.0182 0.6667 >2.1329 66.67 100 (66.67 (33.33%) 0.988 #93 hsa_miR_4737 1.318812 9 6 3 0.75 0.373 to 0.1649 0.6667 >5.20544 66.67 100 (66.67 (33.33%) 0.962 #94 hsa_miR_582_3p 1.313374 9 6 3 0.722 0.348 to 0.2402 0.6667 >9.62108 66.67 100 (66.67 (33.33%) 0.951 #95 hsa_miR_30d_3p 1.307248 9 6 3 0.778 0.400 to 0.1102 0.6667 >22.4999 66.67 100 (66.67 (33.33%) 0.972 #96 hsa_miR_6796_3p 1.305054 9 6 3 0.778 0.400 to 0.1102 0.6667 >2.97689 66.67 100 (66.67 (33.33%) 0.972 #97 hsa_miR_429 1.303553 9 6 3 0.778 0.400 to 0.0661 0.6667 >8.39996 66.67 100 (66.67 (33.33%) 0.972 #98 hsa_miR_542_3p 1.297358 9 6 3 0.667 0.299 to 0.4292 0.6667 >62.3748 66.67 100 (66.67 (33.33%) 0.925 #99 hsa_miR_185_5p 1.296773 9 6 3 0.667 0.299 to 0.4292 0.6667 >1905.99 66.67 100 (66.67 (33.33%) 0.925 #100 hsa_miR_296_5p 1.284939 9 6 3 0.667 0.299 to 0.4292 0.6667 >18.5114 66.67 100 (66.67 (33.33%) 0.925 *The criterion value corresponding with the Youden index J is the optimal “cut-off” point for disease prediction.
TABLE-US-00005 TABLE 5 MicroRNA Clinical Value Ranking: Top 100 microRNAs selected by Ratio, further selected for clinical utility based on additional selection criteria: adequate signal strength >5.0 Ct, signal consistency (>85% of patients demonstrate signal) and ROC curve p value <0.05 Mean Clinical Signal Mean ** = Top 20 value Signal strength P value Signal miRNAs MicroRNA Ranking consistency >5.0 Ct <0.05 Ratio ROC p value Strength ** hsa-miR-4485-5p 1 x x x 1.89 0.94 <0.0001 301.95 ** hsa-miR-551b-3p 2 x x x 1.47 0.83 0.0455 131.01 ** hsa-miR-24-1-5p 3 x x x 1.53 0.83 0.0455 25.23 ** hsa-miR-6819-3p 4 x x x 1.77 0.89 0.0031 15.58 ** hsa-miR-1238-3p 5 x x x 2.06 0.94 <0.0001 11.69 ** hsa-miR-6737-3p 6 x x x 2.19 0.83 0.0455 10.76 ** hsa-miR-1237-3p 7 x x x 1.77 0.89 0.0031 10.36 ** hsa-miR-6757-3p 8 x x x 1.66 0.83 0.0455 10.26 ** hsa-miR-6889-3p 9 x x x 2.03 0.89 0.0017 9.43 ** hsa-miR-6752-3p 10 x x x 1.65 0.89 0.0031 5.23 ** hsa-miR-191-3p 11 x x x 1.54 0.83 0.0455 8.26 ** hsa-miR-6795-3p 12 x x x 1.39 0.83 0.0253 6.69 ** hsa-miR-149-5p 13 x x x 1.89 0.94 <0.0001 6.68 ** hsa-miR-2116-3p 14 x x x 2.23 0.83 0.0455 6.27 ** hsa-miR-7974 15 x x x 2.56 0.83 0.0455 5.94 ** hsa-miR-23c 16 x x x 1.82 0.89 0.0017 5.61 ** hsa-miR-4310 17 x x x 2.19 0.83 0.0455 5.5 ** hsa-miR-98-3p 18 x x x 2.25 0.94 <0.0001 5.34 ** hsa-miR-3190-5p 19 x x x 2.37 1.00 <0.0001 5.28 ** hsa-miR-4312 20 x x x 1.66 0.89 0.0031 5.15 hsa-miR-563 21 x x 2.41 0.89 0.0017 4.75 hsa-miR-4666b 22 x x 2.00 0.89 0.0017 4.64 hsa-miR-548ai 23 x x 1.67 0.89 0.0017 4.22 hsa-miR-6890-3p 24 x x 1.66 0.89 0.0017 4.09 hsa-miR-6870-3p 25 x x 1.51 0.83 0.0253 3.74 hsa-miR-1539 26 x x 1.83 0.83 0.0455 3.4 hsa-miR-6511b-3p 27 x x 1.35 0.83 0.0455 2.74 hsa-miR-19a-3p 28 x x 1.49 0.67 0.4292 11759.43 hsa-miR-144-3p 29 x x 1.72 0.67 0.4292 10506.22 hsa-miR-101-3p 30 x x 1.45 0.67 0.4292 7120.65 hsa-miR-185-5p 31 x x 1.30 0.67 0.4292 2942.79 hsa-miR-590-5p 32 x x 1.56 0.67 0.4292 2394.84 hsa-miR-340-5p 33 x x 1.44 0.67 0.4292 1904.9 hsa-miR-192-5p 34 x x 1.42 0.67 0.4292 1487.56 hsa-miR-144-5p 35 x x 1.53 0.67 0.4292 1423.65 hsa-miR-301a-3p 36 x x 1.57 0.78 0.1102 1397.07 hsa-miR-7-5p x x 1.34 0.67 0.4292 1197.83 hsa-miR-132-3p 38 x x 1.36 0.72 0.2402 827.44 hsa-miR-18b-5p 39 x x 1.38 0.78 0.1102 696 hsa-miR-362-3p 40 x x 1.41 0.67 0.4292 660.34 hsa-miR-215-5p 41 x x 1.33 0.67 0.4292 630.74 hsa-miR-32-5p 42 x x 1.64 0.67 0.4292 362.01 hsa-miR-141-3p 43 x x 1.46 0.72 0.2402 288.35 hsa-miR-33a-5p 44 x x 1.50 0.67 0.4292 209.95 hsa-miR-193a-3p 45 x x 1.39 0.72 0.2402 192.7 hsa-miR-1973 46 x x 1.66 0.72 0.2402 134.03 hsa-miR-219a-5p 47 x x 1.44 0.67 0.4292 119.19 hsa-miR-542-3p 48 x x 1.30 0.67 0.4292 116.12 hsa-miR-628-5p 49 x x 1.43 0.78 0.1102 108.53 hsa-miR-1307-5p 50 x x 1.44 0.78 0.1102 92.37 hsa-miR-224-5p 51 x x 1.38 0.78 0.1102 68.45 hsa-miR-545-3p 52 x x 1.49 0.67 0.4292 66.57 hsa-miR-1537-3p 53 x x 1.39 0.67 0.4292 59.91 hsa-miR-4500 54 x x 1.40 0.72 0.2402 57.25 hsa-miR-30d-3p 55 x x 1.31 0.78 0.1102 37.27 hsa-miR-6766-3p 56 x x 1.45 0.67 0.4292 29.38 hsa-miR-296-5p 57 x x 1.28 0.67 0.4292 28.8 hsa-miR-6515-3p 58 x x 1.48 0.72 0.2402 26.74 hsa-miR-557 59 x x 1.45 0.78 0.1102 25.84 hsa-miR-582-3p 60 x x 1.31 0.72 0.2402 20.73 hsa-miR-4433a-5p 61 x x 1.41 0.78 0.1102 17.37 hsa-miR-4731-3p 62 x x 1.60 0.67 0.4292 10.98 hsa-miR-6763-3p 63 x x 1.56 0.78 0.1102 8.9 hsa-miR-6812-3p 64 x x 1.59 0.78 0.1102 6.78 hsa-miR-3679-3p 65 x x 1.47 0.67 0.4292 6.13 hsa-miR-18b-3p 66 x x 1.86 0.67 0.4292 5.99 hsa-miR-6855-3p 67 x x 1.33 0.67 0.4292 5.51 hsa-miR-6796-3p 68 x 1.31 0.78 0.1102 3.67 hsa-miR-129-1-3p 69 x 1.34 0.78 0.121 2.97 hsa-miR-186-3p 70 x x 1.61 0.86 0.0108 7.96 hsa-miR-224-3p 71 x 1.32 0.83 0.0182 4.53 hsa-miR-3938 72 x 1.33 0.89 0.0017 4.5 hsa-miR-493-3p 73 x 1.40 0.83 0.0253 4.03 hsa-miR-452-5p 74 x 2.10 0.83 0.0016 3.51 hsa-miR-455-5p 75 x 1.90 0.83 0.0016 3.47 hsa-miR-1267 76 x 2.64 1.00 0.0001 3.47 hsa-miR-6792-3p 77 x 2.34 0.83 0.0016 3.26 hsa-miR-4667-3p 78 x 8.04 1.00 <0.0001 2.35 hsa-miR-6799-3p 79 x 1.75 0.89 0.0007 2.02 hsa-miR-580-3p 80 x 2.06 0.83 0.0016 1.95 hsa-miR-6730-3p 81 x 1.76 0.89 0.0031 1.82 hsa-miR-19a-5p 82 x 1.80 0.83 0.0016 1.67 hsa-miR-6782-3p 83 x 2.06 0.83 0.0016 1.58 hsa-miR-3611 84 x 1.80 0.83 0.0016 1.55 hsa-miR-5708 85 x 2.09 0.83 0.0016 1.34 hsa-miR-1236-3p 86 x 1.61 0.89 0.0007 1.16 hsa-miR-153-3p 87 x 1.76 0.67 0.4292 35.65 hsa-miR-429 88 x 1.30 0.78 0.0661 14.79 hsa-miR-190a-5p 89 x 1.74 0.78 0.0661 12.64 hsa-miR-4737 90 x 1.32 0.75 0.1649 10.24 hsa-miR-548a-5p 91 x 1.70 0.72 0.2278 10.03 hsa-miR-33b-5p 92 x 1.60 0.67 0.4292 7.58 hsa-miR-4536-5p 93 x 1.57 0.78 0.0661 6.72 hsa-miR-511-3p 94 x 1.42 0.78 0.0661 5.78 hsa-miR-570-3p 95 x 1.36 0.72 0.2278 5.13 hsa-miR-6820-3p 96 1.40 0.61 0.6726 3.33 hsa-miR-624-3p 97 1.56 0.78 0.0661 3.31 hsa-miR-6818-5p 98 1.35 0.78 0.0661 3.13 hsa-miR-4536-3p 99 1.34 0.78 0.0661 2.93 hsa-miR-1537-5p 100 1.83 0.67 0.4292 2.45 (x designates microRNA that fulfils selection criteria designated at top of the column)
TABLE-US-00006 TABLE 6 Non-black population details Pregnancy Patient Outcome Maternal Gest age GA at Birthweight Delivery outcome No. Group Race BMI age (weeks) (weeks) (g) method description 1 Healthy Asian 24 32 9.9 41 4253 CS Full term Healthy 2 Heathy White 31.5 45 4.9 39 3175 CS Full term Healthy 3 Healthy White 26.3 34 8.3 40 3317 Vaginal Full term Healthy 4 Healthy Asian NA 40 NA 40 3771 Vaginal Full term Healthy 5 Healthy White 25.1 40 6 35 1814 × 3 CS Triplets healthy 6 Unhealthy White 24.1 46 9.4 37 2411 CS Preeclampsia IUGR 7 Unhealthy White 36.6 51 6 36 3288 Vaginal Preterm PROM 8 Unhealthy White NA 40 5.6 40 2693 Vaginal IUGR
TABLE-US-00007 TABLE 7 Black population details Patient Outcome Maternal Gest age GA at Birthweight Delivery Pregnancy outcome No. Group Race BMI age (weeks) (weeks) (g) method description 1 Healthy Black 26.7 41.3 12.6 39.5 2900 Vaginal Full term healthy 2 Healthy Black 29.7 28.8 12.1 39.1 3030 Vaginal Full term healthy 3 Healthy Black 44.4 32.5 13 39.3 2835 CS Full term healthy 4 Unhealthy Black 28.4 35.6 12.6 26.4 540 Vaginal Early Preterm/IUGR/hypertension 5 Unhealthy Black 31.1 36 12.3 31.8 1410 CS Preterm/Preeclampsia 6 Unhealthy Black 36.3 34.3 12.9 26.7 560 CS Early Preterm/Preeclampsia 7 Unhealthy Black 32 31.9 13 30 1510 CS Preterm/IUGR/Preeclampsia 8 Unhealthy Black 32.9 33 13.3 34.5 1900 CS Late preterm/Preeclampsia 9 Unhealthy Black 47.8 42.6 12.7 38 3175 Vaginal Preeclampsia
TABLE-US-00008 TABLE 8 Non-Black race population: Highest of 852 total microRNAs for pregnancy outcome prediction when ordered by “HC Ratio” (>1.5) HC Ratio = Mean Mean Unhealthy- >1.5 Shared Ratio Healthy SD Unhealthy SD Healthy/ HC microRNA order microRNA non Black Healthy nonBlack Unhealthy (MeanSD) Ratio w/black 1 hsa-miR-374b-5p −1.607146555 0.322687 −0.099845253 0.021748 8.752301372 x 2 hsa-miR-18a-5p −3.26450914 1.261435 −0.006070455 0.090208 4.821450552 x 3 hsa-miR-652-3p −1.41289091 0.12101 0.12471612 0.551146 4.575151393 x 4 hsa-miR-374a-5p −1.907748945 0.60976 0.12176959 0.326151 4.33699033 x 5 hsa-miR-505-3p −1.952102427 0.442561 −0.106297973 0.412806 4.3158182 x 6 hsa-miR-185-5p −2.164586563 0.653478 −0.018602683 0.382906 4.141289112 x 7 hsa-miR-128 −2.923292141 1.339394 −0.132012047 0.056616 3.998941112 x 8 hsa-miR-454-3p −1.545131683 0.571763 0.03124857 0.223257 3.965632768 x 9 hsa-miR-320a −1.224274468 0.214056 0.142960707 0.48603 3.905906418 x 10 hsa-miR-502-3p −1.683463051 0.499359 0.153467337 0.685722 3.10009131 x 11 hsa-miR-500a-3p −1.688102685 0.56856 0.263761987 0.727274 3.012521989 x 12 hsa-miR-665 −0.569733407 0.301323 2.471473367 1.736099 2.985347191 x 13 hsa-miR-23b-3p −1.98162678 0.796097 −0.282214955 0.360738 2.938037087 x 14 hsa-miR-18b-5p −1.770823883 1.062443 −0.02517573 0.135332 2.914819459 x 15 hsa-miR-27a-3p −0.459644003 0.241587 0.0767018 0.132851 2.864800842 x 16 hsa-miR-378_ −2.012221544 1.011758 0.30876605 0.707733 2.69962237 x v17.0 17 hsa-miR-199a-5p −2.700553587 0.744756 −0.302387553 1.107134 2.589966348 x 18 hsa-miR-361-5p −1.999709686 1.108255 −0.248628145 0.293447 2.498507373 x 19 hsa-miR-324-5p −1.328012336 0.708594 0.47069137 0.792009 2.39730666 x 20 hsa-miR-31-5p −1.624088603 1.169749 0.074897607 0.265859 2.366922794 x 21 hsa-miR-195-5p −1.58981945 1.045509 −0.046031477 0.27603 2.336348856 x 22 hsa-miR-151a-3p −1.281248497 0.50867 0.028563188 0.615574 2.330120847 x 23 hsa-miR-625-5p −3.221208847 1.421968 −0.515666151 0.923 2.307530206 x 24 hsa-miR-29c-5p −1.298467283 0.720562 0.062286697 0.475367 2.275643867 x 25 hsa-miR-551b-3p −1.971138023 0.724857 −0.03583662 0.980063 2.270255556 x 26 hsa-miR-363-3p −2.242929965 1.570397 0.176148263 0.61072 2.218201272 x 27 hsa-miR-148a-3p −3.79779434 2.329934 −0.146206697 0.972439 2.211493158 x 28 hsa-miR-20b-5p −0.518502163 0.369618 0.089043617 0.19079 2.168229148 x 29 hsa-miR-425-5p −2.414560777 1.273586 −0.446014087 0.551627 2.157059118 x 30 hsa-miR-151a-5p −0.664588672 0.185858 −0.246714113 0.203855 2.144526892 x 31 hsa-miR-141-3p −0.968595067 0.812812 0.715403213 0.883999 1.984897476 x 32 hsa-miR-136-5p −1.689871117 1.900498 1.560480667 1.608627 1.852514021 x 33 hsa-miR-28-5p −0.279255794 0.11338 0.1187795 0.338506 1.761664078 x 34 hsa-miR-8863p_ −1.886180625 1.714513 0.495315397 1.018042 1.743054671 x v15.0 35 hsa-miR-765 −1.48204985 0.301323 0.934661267 2.55059 1.694800001 x 36 hsa-miR-93-5p −0.72143601 0.498703 −0.083294868 0.271401 1.65728579 x 37 hsa-miR-660-5p −2.064092207 1.62302 −0.11524041 0.7365 1.65190524 x 38 hsa-miR-152 −2.617742348 3.399434 0.4126501 0.37101 1.607446077 x 39 hsa-miR-548am- −2.188462537 2.973847 0.414261338 0.378366 1.552839392 x 5p 40 hsa-miR-95 −2.671787723 3.533743 0.696188613 0.845591 1.538122692 x 41 hsa-miR-200c-3p −0.590390362 0.440325 0.606822253 1.121883 1.532718116 x 42 hsa-miR-590-5p −2.099997207 1.680134 0.297731867 1.478738 1.518091872 x x
TABLE-US-00009 TABLE 9 Black race population: Highest of 852 total microRNAs for pregnancy outcome prediction when ordered by “HC Ratio” (>1.5) HC Ratio = Mean Mean Unhealthy- Shared Ratio Healthy SD Unhealthy SD Healthy/ >1.5 microRNA order microRNAS Black Healthy Black Unhealthy (mean SD) ratio w/white 1 hsa-miR-1267 1.008133 1.572933073 3.68654 0.457825 2.63784 x 2 hsa-miR-563 3.49112 0.463551785 4.97324 0.765716 2.411386 x 3 hsa-miR-98-3p 4.338323 0.352742492 5.512695 0.691399 2.249449 x 4 hsa-miR-452-5p 0.1 1.69967E−17 3.464422 3.210483 2.095898 x 5 hsa-miR-580-3p 0.1 1.69967E−17 2.18256 2.017471 2.064526 x 6 hsa-miR-1238-3p 9.021943 0.429051319 12.01917 2.479082 2.061274 x 7 hsa-miR-149-5p 5.636273 0.432960931 6.99795 1.008194 1.889703 x 8 hsa-miR-18b-3p 1.635137 0.247680244 6.01141 4.468984 1.855665 x 9 hsa-miR-1537-5p 0.1 1.69967E−17 2.5651 2.689866 1.832879 x 10 hsa-miR-1539 5.78433 0.309926023 7.177102 1.213145 1.828899 x 11 hsa-miR-23c 4.53688 0.667686008 5.913703 0.849392 1.8151 x 12 hsa-miR-19a-5p 0.1 1.69967E−17 1.842585 1.940627 1.795899 x 13 hsa-miR-1237-3p 7.054017 0.952082468 11.0748 3.587674 1.771366 x 14 hsa-miR-153-3p 4.334793 2.731902007 39.44348 37.10796 1.762491 x 15 hsa-miR-190a-5p 0.608143 0.880130071 14.27126 14.78784 1.744083 x 16 hsa-miR-144-3p 1298.11 330.7328376 11483.14 11487.35 1.723634 x 17 hsa-miR-548a-5p 1.354785 1.53352604 9.410058 7.952339 1.698374 x 18 hsa-miR-548ai 2.884053 1.032339303 4.389983 0.774132 1.667261 x 19 hsa-miR-1973 50.4969 14.60525503 142.237 95.89359 1.660472 x 20 hsa-miR-32-5p 54.08237 23.1695305 401.513 400.6363 1.639574 x 21 hsa-miR-186-3p 2.292743 1.932088862 8.987733 6.361054 1.614585 x 22 hsa-miR-1236-3p 0.33838 0.412886272 1.239636 0.709108 1.606525 x 23 hsa-miR-33b-5p 1.265057 0.270845728 8.21405 8.417689 1.599578 x 24 hsa-miR-301a-3p 372.5503 200.0696713 1408.847 1121.465 1.568323 x 25 hsa-miR-624-3p 0.50149 0.695401079 3.68011 3.380816 1.559593 x 26 hsa-miR-590-5p 580.1497 173.8663976 2564.739 2375.112 1.557164 x x 27 hsa-miR-191-3p 6.86531 0.503358084 8.409832 1.502668 1.539882 x 28 hsa-miR-24-1-5p 8.011073 4.359646972 23.77917 16.20986 1.533153 x 29 hsa-miR-144-5p 313.3803 34.05615675 1573.889 1614.138 1.529564 x
[0178] While certain embodiments have been described in terms of the preferred embodiments, it is understood that variations and modifications will occur to those skilled in the art. Therefore, it is intended that the appended claims cover all such equivalent variations that come within the scope of the following claims.